CN104450702A - Serum miRNA biomarker composition and application thereof - Google Patents
Serum miRNA biomarker composition and application thereof Download PDFInfo
- Publication number
- CN104450702A CN104450702A CN201410819430.6A CN201410819430A CN104450702A CN 104450702 A CN104450702 A CN 104450702A CN 201410819430 A CN201410819430 A CN 201410819430A CN 104450702 A CN104450702 A CN 104450702A
- Authority
- CN
- China
- Prior art keywords
- mir
- mirna
- serum
- azoospermia
- aspermia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a biomarker, and particularly relates to a serum miRNA biomarker composition and an application thereof. The serum miRNA biomarker composition comprises at least one miRNA and sequences of reverse transcription primers, forward primers and reverse primers of all miRNAs. The serum miRNA biomarker composition can be used for preparing oligozoospermia and azoospermia detection reagents. An oligozoospermia and azoospermia detection kit comprises the serum miRNA biomarker composition, Taq enzyme, dNTP, MgCl2 and a PCR buffer solution. The serum miRNA biomarker composition provided by the invention has the advantages of high sensitivity, low sample consumption, wide detection range and wide linear quantitative range.
Description
Technical field
The present invention relates to biomarker, especially relate to a kind of Serum miRNA biomarker composition and application.
Background technology
MiRNA, also known as microRNA, is the strand non-coding RNA that a class is made up of about 22 Nucleotide, mainly utilizes the direct shearing of messenger RNA(mRNA) or indirectly suppresses translation in the expression of post-transcriptional level regulation and control target gene.MiRNA has different expression patterns in ontogenetic different times is as cytodifferentiation, propagation, apoptosis etc. and different tissues, shows that it plays important regulating and controlling effect in growth and differentiation.By to organizing the research of miRNA express spectra to have been found that, miRNA has very strong cell, tissue or disease specific, the miNRA of these specifically expressings is the basis of its functional study, is again good disease markers.In recent years research display, miRNA is not only with the generation of disease with develop relevant, can also be free on outside cell, stable existence is in blood plasma or serum, possesses some feature of disease molecules biomarker, at present in the diagnosis and prognosis of kinds of tumors and non-tumor disease, show unique value (Chen X, Ba Y, Ma L, et al.Characterization ofmicroRNAs in serum:a novel class of biomarkers for diagnosis of cancer and otherdiseases [J] .Cell research, 2008, 18 (10): 997-1006.).
Traditional miRNA detection technique such as northern is hybridized, and microarray is hybridized, poor to the amplification susceptibility of low-abundance miRNA.Quantitative fluorescent PCR (qRT-PCR) is the sensitiveest, the reliable method of gene expression detection amount, but the qRT-PCR technology of routine is difficult to detect the miRNAs of about 22bp, for overcoming this problem, Life Sciences company etc. develops Taqman detection method, but the method cost is higher, also the specificity of answering cannot be sent out by solvent tracing analysis PCR.
Summary of the invention
The object of the present invention is to provide a kind of Serum miRNA biomarker composition.
The second object of the present invention is to provide Serum miRNA biomarker composition preparing in aspermia or oligospermia and azoospermia detection reagent and applies.
The third object of the present invention is to provide a kind of test kit detected for aspermia or oligospermia and azoospermia.
Described Serum miRNA biomarker composition comprises the sequence of the reverse transcription primer of at least one in miRNA and each miRNA, forward primer and reverse primer;
Described miRNA comprises:
miR-34c：aggcaguguaguuagcugauugc；
miR-1275：gugggggagaggcuguc；
miR-375：uuuguucguucggcucgcguga；
miR-410：agguugucugugaugaguucg；
miR-758：gaugguugaccagagagcacac；
The sequence of the reverse transcription primer of each miRNA, forward primer and reverse primer is as shown in the table:
Described Serum miRNA biomarker composition can be applied preparing in aspermia or oligospermia and azoospermia detection reagent.
The described test kit for aspermia or oligospermia and azoospermia detection comprises described Serum miRNA biomarker composition and Taq enzyme, dNTP, MgCl2 and PCR damping fluid.
The using method of described aspermia or oligospermia and azoospermia detection reagent is as follows:
1) set up sample storehouse and the database of unified standard: from hospital's blood sample collection sample, simultaneity factor collects pathologic data and the clinical data of patient;
2) serum miRNA differential expression spectrum analysis: the serum selecting healthy individuals and aspermia or oligospermia, patients with azoospermia, extract total serum IgE, and adopt Agilient miRNA cDNA microarray technology, the detection Sanger microRNA database (miRBase special to the total serum IgE of sample, 19.0 versions) 1888 mankind to be correlated with miRNA, and ripe miRNA can be detected specifically and the miRNA molecule of very high homology can be distinguished well;
3) the serum miRNA that can be used as detection molecules mark is filtered out with real time fluorescence quantifying PCR method (stem is around-France): in large sample crowd, quantitative analysis checking is carried out to the miRNAs of the serum differential expression screened, determine the miRNA:miR-34c (SEQ ID NO.1) that can be used in distinguishing normal people and aspermia or oligospermia or azoospermia, miR-1275 (SEQ ID NO.2), miR-375 (SEQ ID NO.3), miR-410 (SEQ ID NO.4) and miR-758 (SEQ ID NO.5).
The detection method that the present invention uses can be selected from: at least one in RT-PCR method, chip technology, sequencing technologies, fluorescence quantifying PCR method etc.
Serum miRNA biomarker composition of the present invention, detection method provide Data support for the pathological study of aspermia or oligospermia and azoospermia, have following beneficial effect:
First, relative other of serum is organized and is more easily obtained, and compared with testis biopsy or testicular biopsy, belongs to woundless testing, is very easy to the use of healthcare givers, alleviate the misery of patient.
Secondly, miRNAs is a kind of desirable biomarker, such as by be easy to without wound means acquisition, Sensitivity and Specificity highly, have disease commitment detected ability, longer transformation period and detectivity fast and accurately in sample.
Finally, by the method extending stem ring primer, further increase the base of RNA-DNA chain complementary pairing, improve its thermostability, be more conducive to improving Reverse Transcription Efficiency; Use SYBR Green detection of fluorescent dyes simultaneously, reduce experimentation cost.
MiRNA in Late Cambrian serum of the present invention can become recruit's mark of Noninvasive diagnosis aspermia or oligospermia and the azoospermia epigenetic cause of disease and mechanism.In serum, miRNAs is highly stable, has good susceptibility and specificity to the diagnosis of disease, adds the relative noninvasive of drawing materials, and shows its advantage as biomarker, and can bring future clinical change medically.
The present invention is based on stem ring primer reverse transcription and SYBR Green qPCR detection method, the stem ring primer qRT-PCR Real_time quantitative detection method of foundation, directly can judge by melt curve analysis the specificity that PCR reacts.The around-France length by extending miRNA artificially of stem is beneficial to the amplification of fragment, specific reverse transcription primer is by the consensus sequence of a section longer and the one section Sequence composition with miRNA mature sequence complementary specificity, after annealed reverse transcription, it is longer cDNA that miRNA is artificially extended reverse transcription.The qPCR of design increases forward primer 3' end and miRNA reverse complemental, the binding site reverse complemental of universal primer in downstream primer and reverse transcription primer consensus sequence.The method has highly sensitive, the advantage such as sample consumption is few, sensing range is wide, quantitative linearity wide ranges.
Accompanying drawing explanation
Fig. 1 is the main flow of miRNA of the present invention screening and detection reagent and preparation.
Fig. 2 carries out cluster analysis result as molecular marker to normal healthy controls group and aspermia or oligospermia patient group with miR-34c, miR-1275, miR-375, miR-410 and miR-758 for showing.
Fig. 3 carries out cluster analysis result as molecular marker to normal healthy controls group and patients with azoospermia group with miR-34c, miR-1275, miR-375, miR-410 and miR-758 for showing.
Fig. 4 carries out cluster analysis result as molecular marker to normal healthy controls group, aspermia or oligospermia patient group and patients with azoospermia group with miR-34c, miR-1275, miR-375, miR-410 and miR-758 for showing.
Fig. 5 is the ROC curve between display normal healthy controls group and aspermia or oligospermia patient group.
Fig. 6 is the ROC curve between display normal healthy controls group and patients with azoospermia group.
Fig. 7 is the ROC curve between display aspermia or oligospermia patient's group and patients with azoospermia group.
Embodiment
The present invention is further elaborated by the following examples.
The collection of embodiment 1, sample and the arrangement of sample data
Collected a large amount of serum samples from the attached First Hospital of Xiamen University, by the arrangement to sample data, therefrom have selected 9 routine azoospermias, 23 ~ 29 years old age, 26 ± 3 years old mean age, more than secondary conventional semen efamination does not all find sperm.Aspermia or oligospermia group 9 example, at 22 ~ 30 years old age of aspermia or oligospermia patient, 26 ± 4 years old mean age, more than secondary conventional semen efamination sperm count is all less than 20 × 10
6/ mL.Control group 9 example, have the healthy male volunteer of childbearing history, 24 ~ 29 years old age, 26 ± 3 years old mean age, Semen routione is normal.
Embodiment 2, aspermia or oligospermia and azoospermia serological specificity miRNA expression chip primary dcreening operation
(1) screening of chip sample
From the clinical serum sample collected, have chosen 9 routine azoospermias, 23 ~ 29 years old age, 26 ± 3 years old mean age, more than secondary conventional semen efamination does not all find sperm.Aspermia or oligospermia group 9 example, at 22 ~ 30 years old age of aspermia or oligospermia patient, 26 ± 4 years old mean age, more than secondary conventional semen efamination sperm count is all less than 20 × 10
6/ mL.Control group 9 example, have the healthy male volunteer of childbearing history, 24 ~ 29 years old age, 26 ± 3 years old mean age, Semen routione is normal.
(2) collection of serum sample
Collect three groups of person 2ml peripheral bloods to be checked, proceed to rapidly in heparin tube, at room temperature leave standstill 15 ~ 30min, 4 DEG C of centrifugal 10min of 1900 × g, careful Aspirate supernatant in centrifuge tube, 4 DEG C, the centrifugal 10min of 16 000 × g, leaves and takes supernatant, is placed in-80 DEG C of refrigerators and preserves stand-by.
(3) extract the total serum IgE of each group of serum sample with reference to Qiagen company commercial total RNA extraction reagent box miRNeasy Serum/Plasma kit specification sheets, then each group of total serum IgE is uniformly mixed into 3 parts.
(4) the miRNA express spectra detection of aspermia or oligospermia, azoospermia and control group is carried out with reference to Agilent company miRNA chip specification sheets.
(5) according to the detected result of miRNA chip, find the miR-34c of aspermia or oligospermia serum and azoospermia serum, the expression of miR-1275, miR-375, miR-410 and miR-758, all higher than normal people, has differential expression.
The real time fluorescence quantifying PCR method checking of embodiment 3, aspermia or oligospermia and azoospermia serological specificity miRNA
(1) screening of sample is verified
From the clinical serum sample collected, have chosen 20 routine azoospermias, 23 ~ 35 years old age, 29 ± 6 years old mean age, more than secondary conventional semen efamination does not all find sperm.Aspermia or oligospermia group 20 example, at 22 ~ 34 years old age of aspermia or oligospermia patient, 28 ± 6 years old mean age, more than secondary conventional semen efamination sperm count is all less than 20 × 10
6/ mL.Control group 20 example, have the healthy male volunteer of childbearing history, 24 ~ 36 years old age, 30 ± 6 years old mean age, Semen routione is normal.
(2) collection of serum sample
Collect three groups of person 2ml peripheral bloods to be checked, proceed to rapidly in heparin tube, at room temperature leave standstill 15 ~ 30min, 4 DEG C of centrifugal 10min of 1900 × g, careful Aspirate supernatant in centrifuge tube, 4 DEG C, the centrifugal 10min of 16 000 × g, leaves and takes supernatant, is placed in-80 DEG C of refrigerators and preserves stand-by.
(3) extraction of total serum IgE in serum
Get above-mentioned serum sample, every part of 400 μ L, by the total serum IgE in Qiagen miRNeasy Serum/Plasma kit test kit specification sheets extracting serum, by the concentration of spectrophotometer measurement serum RNA, the RNA of extraction is placed in-80 DEG C of refrigerators and preserves stand-by.
(4) reverse transcription synthesis cDNA
In without the 0.2ml PCR pipe of RNase, 6.387 μ L H are added successively according to ABI company commercial MicroRNA Reverse Transcription test kit specification sheets
2o, 0.063 μ L RNAase inhibitor (20U/ μ L), 0.05 μ L dNTPs (100mM), 0.03 μ L Multiscribe ThermoScript II (50U/ μ L), 1uL specificity loop-stem structure reverse transcription primer (2 μMs), the RNA (10ng/ μ L) in 1.67 μ L serum.Reaction conditions: 16 DEG C of 30min, 42 DEG C of 30min, 85 DEG C of 5min.The present invention we often kind of miRNA is devised to the specificity loop-stem structure reverse transcription primer of respective miRNA, miR-34c (SEQ IDNO.6), miR-1275 (SEQ ID NO.7), miR-375 (SEQ ID NO.8), miR-410 (SEQ ID NO.9) and miR-758 (SEQ ID NO.10).As above operate separately, single tube synthesis cDNA.
(5) real-time quantitative PCR
The present invention devises forward primer and the reverse primer of each miRNA, miR-34c (SEQ ID NO.11 and SEQ ID NO.12), miR-1275 (SEQ ID NO.13 and SEQ ID NO.14), miR-375 (SEQ ID NO.15 and SEQ ID NO.16), miR-410 (SEQ ID NO.17 and SEQ ID NO.18) and miR-758 (SEQ ID NO.19 and SEQ ID NO.20).Obtained by synthetic (entrusting biotech firm), with the genomic dna of said extracted for template, carry out pcr amplification; Wherein PCR reaction system is 25 μ l:cDNA template (50ng) 1 μ l, upstream primer (10 μMs) 1 μ l, downstream primer (10 μMs) 1 μ l, 10 × PCR damping fluid 2.5 μ l, dNTP (2.5mM) 2 μ l, MgCl2 (25mM) 1.5 μ l, Taq enzyme (5U/ μ l) 0.125 μ l, 20 × SYBR Green11.25 μ l, aseptic double-distilled water 14.625 μ l; PCR reaction conditions: denaturation 94 DEG C, 10min; Sex change 94 DEG C, 30sec; Anneal 55 DEG C, 30sec; Extend 72 DEG C, 1min, totally 30 circulations; Extend 72 DEG C, 10min.
(6) statistical procedures
Application SPSS 20.0 software is analyzed real-time fluorescence quantitative PCR detected result, and continuous data represents with mean ± standard deviation, and compare between group and adopt t inspection, P<0.05 is that difference has statistical significance, represents with *.
Select 20 routine aspermia or oligospermia patients, the serum sample of 20 routine azoospermia patients and 20 routine normal peoples carries out fluorescent quantitative PCR experiment, tries to achieve the CT value of each sample, utilize miR-34c respectively, the CT value of miR-1275, miR-375, miR-410 and miR-758 is figure than the CT value of miR-16.Case group is RQ=2 relative to the change formula of the expression multiple of Normal group sample blood plasma miRNA
-Δ Δ Ct, RQ represents relative expression's variable, wherein Δ Ct=Ct (sample)-Ct (internal reference), and Δ Δ Ct=Δ Ct case-Δ Ct contrasts.In control group, Δ Δ Ct is 0, so the RQ of control group is defaulted as 1.Test design negative control group and revision test, negative control group is do not add cDNA template in reaction system, and replace with ddH2O, all quantitative fluorescent PCRs all do three times.According to real-time quantitative PCR result, obvious relative to normal people's differential expression at 5 miRNA of aspermia or oligospermia group and azoospermia group candidate, be high expression level, and coincide with chip primary dcreening operation result.The aggregation of experiment proof 5 miRNA is good, identical with the expression trend of azoospermia group in aspermia or oligospermia group, although there is no statistical significance therebetween, but the serum miRNA of the normal people relative to spermatogenesis, miR-34c, miR-1275, miR-375, miR-410 and miR-758 has notable difference, and has statistical significance.
(7) cluster analysis
As molecular marker, cluster analysis is carried out to data results Cluster 3.0 using these 5 miRNAs, the results are shown in Figure 2 ~ 4.Fig. 2 is 20 routine normal healthy controls persons and 20 routine aspermia or oligospermia patient cluster analysis results, Fig. 3 is 20 routine normal healthy controls persons and 20 routine patients with azoospermia cluster analysis results, and Fig. 4 is 20 routine normal healthy controls persons, 20 routine aspermia or oligospermia patients and 20 routine patients with azoospermia cluster analysis results.As can be seen from Fig. 2 ~ 4, can obviously by normal people and aspermia or oligospermia as blood serum designated object with miRNA, miR-34c, miR-1275, miR-375, miR-410 and miR-758, normal people and azoospermia distinguish, but distinguish azoospermia and aspermia or oligospermia not obvious.
(8) ROC analysis and diagnosis value assessment
In order to assess miRNA, miR-34c, miR-1275, miR-375, miR-410 and miR-758 be ability in aspermia or oligospermia and azoospermia detect, the present invention is to aspermia or oligospermia, and the fluorescent quantitative PCR result of azoospermia and spermatogenesis Normal group has carried out risk assessment, by ROC evaluate miRNA marker at aspermia or oligospermia and azoospermia the value in diagnosis.Be that ordinate zou represents True Positive Rate with susceptibility, 1-specificity is that X-coordinate represents false positive rate, does ROC tracing analysis.Area under curve (AUC) is larger, and diagnostic accuracy is higher.On ROC curve, be the threshold value that Sensitivity and Specificity is all higher near the upper left point of coordinate diagram.Present significant miR-34c, miR-1275, miR-375, miR-410 and miR-758 in this test, its ROC area under a curve between 0.7 ~ 0.9, as shown in Tables 1 and 2.Illustrate that these 5 serum miRNA marker have certain accuracy, the truncation points near the upper left point of coordinate diagram can be used as diagnosis reference value.
Table 1.miR-34c, miR-1275, miR-375, miR-410 and miR-758 diagnose the ROC of aspermia or oligospermia to analyze
Table 2.miR-34c, miR-1275, miR-375, miR-410 and miR-758 diagnose the ROC of azoospermia to analyze
Utilize miR-34c when combining, when miR-1275, miR-375, miR-410 and miR-758 distinguish control group and aspermia or oligospermia as molecular marker, AUC is 0.985, and sensitivity is 0.992, and specificity is 0.996 (Fig. 5); Utilize miR-34c when combining, when miR-1275, miR-375, miR-410 and miR-758 distinguish control group and aspermia or oligospermia as molecular marker, AUC is 0.988, and sensitivity is 0.997, and specificity is 0.998 (Fig. 6); Utilize miR-34c when combining, miR-1275, miR-375, miR-410 and miR-758 distinguish aspermia or oligospermia as molecular marker and azoospermia is, and 0.612, sensitivity is 0.653, specially behavior 0.60.In sum, 5 blood serum designated objects can by aspermia or oligospermia and normal people, and azoospermia and normal people well make a distinction, but the effect distinguishing aspermia or oligospermia and azoospermia is poor.
The invention provides a kind of serum miRNA composition for detecting aspermia or oligospermia and azoospermia and and preparation method thereof with application.Serum miRNA composition of the present invention be selected from following at least one miRNA:miR-34c, miR-1275, miR-375, miR-410 and miR-758.The present invention also provides a kind of Primer composition detected for aspermia or oligospermia and azoospermia, comprises the reverse transcription primer of miRNA of the present invention, forward primer and reverse primer.MiRNA combination thing of the present invention can be applied in the reagent preparing detection aspermia or oligospermia and azoospermia or instrument.By the development and application of Serum miRNA biomarker of the present invention and detection kit, make the easy to detect easy of aspermia or oligospermia and azoospermia, for clinician finds aspermia or oligospermia and azoospermia fast, takes effectively preventing scheme to provide support in time.
Finally, it is also to be noted that what enumerate above is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be had.All distortion that those of ordinary skill in the art can directly derive from content disclosed by the invention or associate, all should think protection scope of the present invention.
Claims (4)
1. a Serum miRNA biomarker composition, is characterized in that the sequence of it reverse transcription primer comprising at least one in miRNA and each miRNA, forward primer and reverse primer;
Described miRNA comprises:
miR-34c：aggcaguguaguuagcugauugc；
miR-1275：gugggggagaggcuguc；
miR-375：uuuguucguucggcucgcguga；
miR-410：agguugucugugaugaguucg；
miR-758：gaugguugaccagagagcacac；
The sequence of the reverse transcription primer of each miRNA, forward primer and reverse primer is as shown in the table:
2. Serum miRNA biomarker composition is applied preparing in aspermia or oligospermia and azoospermia detection reagent as claimed in claim 1.
3., for the test kit that aspermia or oligospermia and azoospermia detect, it is characterized in that comprising Serum miRNA biomarker composition as claimed in claim 1, and Taq enzyme, dNTP, MgCl
2with PCR damping fluid.
4. apply as claimed in claim 2, it is characterized in that the using method of described aspermia or oligospermia and azoospermia detection reagent is as follows:
1) set up sample storehouse and the database of unified standard: from hospital's blood sample collection sample, simultaneity factor collects pathologic data and the clinical data of patient;
2) serum miRNA differential expression spectrum analysis: the serum selecting healthy individuals and aspermia or oligospermia, patients with azoospermia, extract total serum IgE, and adopt Agilient miRNA cDNA microarray technology, the detection Sanger microRNA database (miRBase special to the total serum IgE of sample, 19.0 versions) 1888 mankind to be correlated with miRNA, and ripe miRNA can be detected specifically and the miRNA molecule of very high homology can be distinguished well;
3) with real time fluorescence quantifying PCR method, namely stem is around-France, filter out the serum miRNA that can be used as detection molecules mark: in large sample crowd, quantitative analysis checking is carried out to the miRNAs of the serum differential expression screened, determine the miRNA:miR-34c (SEQ ID NO.1) that can be used in distinguishing normal people and aspermia or oligospermia or azoospermia, miR-1275 (SEQ ID NO.2), miR-375 (SEQ ID NO.3), miR-410 (SEQ ID NO.4) and miR-758 (SEQ ID NO.5).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410819430.6A CN104450702B (en) | 2014-12-25 | 2014-12-25 | A kind of Serum miRNA biomarker composition and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410819430.6A CN104450702B (en) | 2014-12-25 | 2014-12-25 | A kind of Serum miRNA biomarker composition and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450702A true CN104450702A (en) | 2015-03-25 |
| CN104450702B CN104450702B (en) | 2017-08-29 |
Family
ID=52897453
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410819430.6A Active CN104450702B (en) | 2014-12-25 | 2014-12-25 | A kind of Serum miRNA biomarker composition and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450702B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450707A (en) * | 2014-12-25 | 2015-03-25 | 厦门大学 | Application of serum miRNA biomarker |
| CN109295215A (en) * | 2018-11-05 | 2019-02-01 | 苏州立豪生物科技有限公司 | It is a kind of for detecting the kit of oligospermatism |
| CN109385472A (en) * | 2018-12-07 | 2019-02-26 | 中国科学院近代物理研究所 | A kind of serum miRNA marker and its method for detecting ionization radiation injury |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
| CN102286625A (en) * | 2011-08-30 | 2011-12-21 | 中国人民解放军南京军区南京总医院 | Seminal plasma micro RNA combination relevant to male reproductive function disorder and application thereof |
| CN102296112A (en) * | 2011-08-09 | 2011-12-28 | 南京医科大学 | Seminal plasma miRNA marker associated with human non-obstructive azoospermia and application thereof |
| CN103555848A (en) * | 2013-11-08 | 2014-02-05 | 复旦大学 | 3'-5'-qPCR (quantitative polymerase chain reaction) quantitative detection technology for small RNA (ribonucleic acid) |
-
2014
- 2014-12-25 CN CN201410819430.6A patent/CN104450702B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
| CN102296112A (en) * | 2011-08-09 | 2011-12-28 | 南京医科大学 | Seminal plasma miRNA marker associated with human non-obstructive azoospermia and application thereof |
| CN102286625A (en) * | 2011-08-30 | 2011-12-21 | 中国人民解放军南京军区南京总医院 | Seminal plasma micro RNA combination relevant to male reproductive function disorder and application thereof |
| CN103555848A (en) * | 2013-11-08 | 2014-02-05 | 复旦大学 | 3'-5'-qPCR (quantitative polymerase chain reaction) quantitative detection technology for small RNA (ribonucleic acid) |
Non-Patent Citations (1)
| Title |
|---|
| SAEID GHORBIAN: "Micro-RNAs, next-generation molecular markers in male infertility Field", 《TRANSL ANDROL UROL》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450707A (en) * | 2014-12-25 | 2015-03-25 | 厦门大学 | Application of serum miRNA biomarker |
| CN109295215A (en) * | 2018-11-05 | 2019-02-01 | 苏州立豪生物科技有限公司 | It is a kind of for detecting the kit of oligospermatism |
| CN109385472A (en) * | 2018-12-07 | 2019-02-26 | 中国科学院近代物理研究所 | A kind of serum miRNA marker and its method for detecting ionization radiation injury |
| CN109385472B (en) * | 2018-12-07 | 2021-10-08 | 中国科学院近代物理研究所 | Serum miRNA marker and method for detecting ionizing radiation damage by using same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450702B (en) | 2017-08-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103436606B (en) | Kit for auxiliary diagnosis and/or prognosis judgment of esophageal carcinoma | |
| Jia et al. | Identification of four serum microRNAs from a genome‑wide serum microRNA expression profile as potential non‑invasive biomarkers for endometrioid endometrial cancer | |
| CN101956014B (en) | Kit for detecting 7 genetic markers of peripheral blood in early diagnosis of nasopharyngeal darcinoma | |
| CN103540679B (en) | Primers, probes and detection kit for detecting human HCC (Hepatocellular Carcinoma) marker | |
| CN101845520B (en) | HPA allelic gene typing detection reagent kit | |
| CN106148529B (en) | LncRNA marker related to gastric cancer, special detection primer, detection method, kit and application thereof | |
| CN102776185A (en) | Liver cancer diagnostic marker composed of blood plasma microRNA (micro ribonucleic acid) and new method for diagnosing liver cancer | |
| US20130012412A1 (en) | Marker for diagnosis of breast cancer, test method, and test kit | |
| CN104450707B (en) | A kind of application of Serum miRNA biomarker | |
| CN102220413A (en) | Method for detecting exon 19 deletion mutation and exon 21 point mutation of epidermal growth factor receptor gene | |
| CN103074430B (en) | Special primer, kit and method for testing miRNA-155 in bladder cancer urine | |
| CN109593847B (en) | Primer pair, kit and method for detecting stability of NR24 locus of microsatellite | |
| CN104450702B (en) | A kind of Serum miRNA biomarker composition and application | |
| CN103074431B (en) | Special primer, kit and method for testing minRNA-128 in colorectal cancer serum | |
| CN101880715B (en) | Recurrence predicting reagent kit for liver cancer liver transplantation postoperation | |
| CN102925444B (en) | Serum micro ribonucleic acid (miRNA) biomarker of bladder cancer and detection method of expression quantity thereof | |
| CN104694641A (en) | Method for predicating gene age and disease susceptibility and kit | |
| CN111518908A (en) | Urine prostate cancer marker combination and application thereof in preparation of accurate diagnostic reagent | |
| CN106282387A (en) | Gastric cancer detection primer probe and test kit thereof | |
| WO2020134950A1 (en) | Gene mutation/fusion combination and kit for identification of benign and malignant pulmonary nodules | |
| CN103940998B (en) | The application of the early diagnosis marker that serum microRNA shifts as hepatocellular carcinoma | |
| CN108424962A (en) | The miRNA detection markers and its diagnostic kit of mesangial proliferative glomerulonephritis | |
| CN104131102B (en) | A kind of judge that NSCLC patient is to the test kit of Gefitinib therapeutic response | |
| CN102021228B (en) | Specific primers for tissue or whole blood EGFR gene mutation detection | |
| CN105154560B (en) | PCR kit for fluorescence quantitative and detection method and purposes for oophoroma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |