CN104293933B - Direct fluorescence PCR detection reagent kit and application for rs8099917 single nucleotide polymorphism - Google Patents
Direct fluorescence PCR detection reagent kit and application for rs8099917 single nucleotide polymorphism Download PDFInfo
- Publication number
- CN104293933B CN104293933B CN201410504522.5A CN201410504522A CN104293933B CN 104293933 B CN104293933 B CN 104293933B CN 201410504522 A CN201410504522 A CN 201410504522A CN 104293933 B CN104293933 B CN 104293933B
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- reagent
- detection
- taqman probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 239000003153 chemical reaction reagent Substances 0.000 title claims abstract description 71
- 238000001514 detection method Methods 0.000 title claims abstract description 64
- 239000002773 nucleotide Substances 0.000 title claims abstract description 11
- 125000003729 nucleotide group Chemical group 0.000 title claims abstract description 11
- 239000000523 sample Substances 0.000 claims abstract description 91
- 239000012153 distilled water Substances 0.000 claims description 25
- 239000000203 mixture Substances 0.000 claims description 20
- UIIMBOGNXHQVGW-UHFFFAOYSA-M buffer Substances [Na+].OC([O-])=O UIIMBOGNXHQVGW-UHFFFAOYSA-M 0.000 claims description 19
- 238000003908 quality control method Methods 0.000 claims description 19
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L MgCl2 Chemical compound [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 claims description 8
- 101700011961 DPOM Proteins 0.000 claims description 7
- 101710029649 MDV043 Proteins 0.000 claims description 7
- 101700061424 POLB Proteins 0.000 claims description 7
- 101700054624 RF1 Proteins 0.000 claims description 7
- 230000000295 complement Effects 0.000 claims description 6
- 229910001629 magnesium chloride Inorganic materials 0.000 claims description 5
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims 2
- 101710031899 moon Proteins 0.000 claims 1
- 238000006243 chemical reaction Methods 0.000 abstract description 25
- 238000000034 method Methods 0.000 abstract description 12
- 230000002093 peripheral Effects 0.000 abstract description 5
- 238000011109 contamination Methods 0.000 abstract description 2
- 230000003321 amplification Effects 0.000 description 15
- 238000003199 nucleic acid amplification method Methods 0.000 description 15
- 238000000137 annealing Methods 0.000 description 9
- 241000711549 Hepacivirus C Species 0.000 description 7
- 230000004087 circulation Effects 0.000 description 7
- 201000010099 disease Diseases 0.000 description 7
- 102100005076 IFNL3 Human genes 0.000 description 6
- 101700043924 IFNL3 Proteins 0.000 description 6
- 238000005457 optimization Methods 0.000 description 6
- 102000004190 Enzymes Human genes 0.000 description 5
- 108090000790 Enzymes Proteins 0.000 description 5
- 208000005176 Hepatitis C Diseases 0.000 description 5
- 238000004458 analytical method Methods 0.000 description 5
- 201000009910 diseases by infectious agent Diseases 0.000 description 5
- 238000003753 real-time PCR Methods 0.000 description 5
- 230000035945 sensitivity Effects 0.000 description 5
- 239000000243 solution Substances 0.000 description 5
- 238000002944 PCR assay Methods 0.000 description 4
- 239000002253 acid Substances 0.000 description 4
- 230000002068 genetic Effects 0.000 description 4
- 230000035772 mutation Effects 0.000 description 4
- 238000011017 operating method Methods 0.000 description 4
- 229920001850 Nucleic acid sequence Polymers 0.000 description 3
- 230000036425 denaturation Effects 0.000 description 3
- 229920003013 deoxyribonucleic acid Polymers 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 239000007788 liquid Substances 0.000 description 3
- 150000007523 nucleic acids Chemical class 0.000 description 3
- 239000011886 peripheral blood Substances 0.000 description 3
- 238000007792 addition Methods 0.000 description 2
- 230000000840 anti-viral Effects 0.000 description 2
- 230000003416 augmentation Effects 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000003814 drug Substances 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 230000000869 mutational Effects 0.000 description 2
- 108020004707 nucleic acids Proteins 0.000 description 2
- 239000000137 peptide hydrolase inhibitor Substances 0.000 description 2
- 230000002000 scavenging Effects 0.000 description 2
- 238000002560 therapeutic procedure Methods 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 1
- 206010019799 Hepatitis viral Diseases 0.000 description 1
- 102000000588 Interleukin-2 Human genes 0.000 description 1
- 108010002350 Interleukin-2 Proteins 0.000 description 1
- 231100000614 Poison Toxicity 0.000 description 1
- 241000218636 Thuja Species 0.000 description 1
- 238000007259 addition reaction Methods 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 230000024881 catalytic activity Effects 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 238000002512 chemotherapy Methods 0.000 description 1
- 230000001684 chronic Effects 0.000 description 1
- 238000003776 cleavage reaction Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000005336 cracking Methods 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 238000002651 drug therapy Methods 0.000 description 1
- 229940079593 drugs Drugs 0.000 description 1
- 238000004043 dyeing Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 230000035876 healing Effects 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 239000003112 inhibitor Substances 0.000 description 1
- 230000002401 inhibitory effect Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 230000001717 pathogenic Effects 0.000 description 1
- 244000052769 pathogens Species 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- 238000006116 polymerization reaction Methods 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000004445 quantitative analysis Methods 0.000 description 1
- 238000010791 quenching Methods 0.000 description 1
- 230000000171 quenching Effects 0.000 description 1
- 239000000376 reactant Substances 0.000 description 1
- 229920002477 rna polymer Polymers 0.000 description 1
- 230000002269 spontaneous Effects 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 239000000758 substrate Substances 0.000 description 1
- 230000001225 therapeutic Effects 0.000 description 1
- 210000001519 tissues Anatomy 0.000 description 1
- 201000001862 viral hepatitis Diseases 0.000 description 1
- 230000003612 virological Effects 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
Abstract
The invention discloses a kind of direct fluorescence PCR detection reagent kit for rs8099917 single nucleotide polymorphism and application, described test kit includes detecting PCR reagent, positive control PCR reagent and negative control PCR reagent, and described detection PCR reagent includes specific primer 1 and primer 2, the probe 1 and PCR Mixture1 in single nucleotide polymorphism rs8099917 site；Human mouth swab sample or human peripheral sample directly as template, are added in the PCR reaction system optimized and detect by the present invention, and process one step completes, without uncapping, laboratory operating procedures can be reduced, time-consuming, also avoid the sample contamination that operation of uncapping may bring simultaneously.
Description
(1) technical field
The present invention relates to the test kit of a kind of single nucleotide polymorphism detection, be specifically related to a kind of for
The test kit of rs8099917 SNP direct fluorescent PCR detection and detection side thereof
Method.
(2) background technology
Rs8099917 site is interleukin-2 8B (interleukin-28B, IL-28B) mononucleotide polymorphic
Property (single nucleotide polymorphism, SNP) site, research find this site C or
T polymorphic allele infects restrovirus Scavenging activity with hepatitis C virus (HCV) and disease is entered
Exhibition height correlation.
Hepatitis C is a kind of viral hepatitis caused by HCV infection, according to world health
Tissue statistics, the infection rate of whole world HCV is about 3%, in global prevalence.IL-28B genotype
It is that gene 1 type chronic HCV infection uses PEG-IFN associating RBV or protease inhibitor three
Prediction index important before Regimen Chemotherapy.Associating PEG-IFN and RBV treatment after obtain SVR and
The probability of the spontaneous removing of HCV infection depends on nucleotide sequence and No. 19 dyeing near IL-28B
The genetic fragment of the IFN γ on body.Wherein IL-28B gene rs8099917 site mononucleotide polymorphic
Property with HCV infection restrovirus Scavenging activity and progression of disease height correlation, research find
Rs8099917GG type patient is invalid to viral therapy.
The generation of most diseases is relevant with the comprehensive function of environmental factors and inherited genetic factors, generally recognizes
For being on the basis of individuality has genetic predisposition, bad environmental factor effect and cause disease.No
With colony with individual susceptibility, repellence and other biological character to disease (as to medicine
Reactive etc.) there is difference, its genetic base is the variability of human genome DNA's sequence, its
In be most commonly that SNP.SNP is primarily referred to as in genomic level by the variation of single core thuja acid
Caused DNA sequence polymorphism.It is modal one in the heritable variation of the mankind, accounts for
More than the 90% of all known polymorphisms.SNP is widely present in human genome, some SNP
Directly affect structure representation and the hereditary stability etc. of albumen.Along with the progress of the Human Genome Project,
People more and more believe that the SNP in genome contributes to explaining the phenotypic difference of individuality, different groups
With individuality to disease, the particularly susceptibility to complex disease and the toleration to various medicines and right
The reaction of envirment factor.Therefore, find and study SNP and become the content of the Human Genome Project
With one of target.
By the detection to IL-28B rs8099917 SNP, can filter out and control
The crowd that therapeutic effect is good, resolutely carries out antiviral therapy, to treatment expection refractory patient, it is proposed that change
Or wait better healing scheme, thus realize hepatitis C antiviral individualized treatment is instructed；Detection
Key SNP site rs8099917 that the treatment of internationally recognized hepatitis C is relevant, not only can instruct tradition
IFN+RBV hepatitis C treatment, it may also be used for up-to-date protease inhibitor class Drug therapy hepatitis C
Guidance.
The clinical detection method conventional for SNP site has DNA direct Sequencing, fluorescent PCR etc.,
DNA direct Sequencing complex operation is time-consuming and sensitivity is low, and Fluorescence PCR assay because it is highly sensitive,
High specificity, the feature such as easy and simple to handle are used widely at plurality of medical detection field.The most
The fluorescence PCR detection reagent applied clinically and the most thousands of kinds of method, conventionally by fluorescence
The method of PCR detection nucleic acid is it is generally required to two independent processes: one is nucleic acid-templated preparation, and two
It is nucleic acid-templated addition reaction system will to carry out PCR augmentation detection.Prepared by general kernel acid template
Journey is basically identical, is required for through steps such as digestion cracking, adsorption and purification, washing collections.Single sample
This process often time-consuming several tens minutes, when processing great amount of samples, the most even than PCR
Detection reaction is longer.Due to various operating procedure, in large sample processing procedure, between sample
Mutually pollute the most inevitable.
Directly Fluorescence PCR assay uses the PCR buffer solution system optimized and special DNA polymerization
Enzyme, reduces the interference that PCR is reacted by various inhibitors present in sample, has strong vigor, height
The feature such as stability, strong toleration.The nucleic acid extraction process that this technology is the most time-consuming without carrying out costliness,
Make employment specimen or pathogen preserve liquid and i.e. can be directly used for PCR amplification qualification, shorten greatly
Detection time and simplification operating procedure.
The present invention is directed to IL-28B gene rs8099917 loci polymorphism sequential design specific primer
Probe, employing ARMS primer enhanced sensitivity combines the PCR reaction system of Taqman probe and optimization
Directly Fluorescence PCR assay, it is provided that a kind of directly fluorescence polymerase chain reaction (fluorescent PCR) is qualitative
The test kit of detection rs8099917 SNP, shortens PCR detection time and letter
Changing operating procedure, low cost quickly detects rs8099917 loci polymorphism, it is possible to clear and definite sample center
Acid fragment rs8099917 single nucleotide polymorphisms.
(3) summary of the invention
It is an object of the present invention to provide a kind of for rs8099917 SNP detection straight
Connect fluorescence PCR detection reagent kit, specify sample amplifying nucleic acid fragment rs8099917 locus gene polymorphic
Property, the present invention uses direct Fluorescence PCR assay as detection method, directly does template with sample and enters
Row detection, shortens the PCR detection time and simplifies operating procedure.
The technical solution used in the present invention is:
The present invention provides the test kit that a kind of rs8099917 SNP detects, described
Test kit includes detecting PCR reagent, positive control PCR reagent and negative control PCR reagent,
Described detection PCR reagent includes the specific primer 1 in single nucleotide polymorphism rs8099917 site
With primer 2, probe 1 and PCR Mixture1；Described positive control PCR reagent includes positive matter
Control product, primer 3, primer 4, TaqMan probe 2 and PCR Mixture2, described positive quality control
Product are rs8099917 site wild type and mutant plasmids mixed liquor；Described negative control PCR tries
Agent includes negative quality-control product, primer 5, primer 6, TaqMan probe 3 and PCR Mixture3,
Described negative quality-control product is rs8099917 site wild plasmid solution；Described PCR Mixture1
Including PCR buffer, dNTPs, BSA, MgCl2, Taq 22B archaeal dna polymerase and distilled water,
The composition of described PCR Mixture2 and PCR Mixture3 is with PCR Mixture1；
Primer 1, primer 3 and primer 5 are: 5 '-ACATACAACATGGAGAGTTAAAG
-3'(seq1)；
Primer 2 and primer 6 are: 5 '-TGGTTCCAATTTGGGTGgC-3'(seq3)；
Primer 4 is: 5 '-TGGTTCCAATTTGGGTGgA-3'(seq2)；
TaqMan probe 1, TaqMan probe 2 and TaqMan probe 3 are:
5’-FAM-AAGTCTTGTATTTCACCTCCTGGAGG-BHQl-3’(seq4)；
The sequence of wild plasmid is (seq5):
GTTCCTTGTAAAAGATTCCATCCATACAAAAACATACAACATGGAGAGTTAAAGTAAGTCT
TGTATTTCACCTCCTGGAGGTAAATATTTTTTAACAATT
TGTCACTGTTCCTCCTTTTGTTTTCCTTTCTGTGAGCAATTTCACCCAAATTGGAACCATGCT
GTATACAGTTTGGTAGCTGGCTTTTTATGTCTTACCATTATCTCTCATTTGCATTCTCCCACA
TCTTTAATTATAGCGTATCAGTTAGGGCCCAGCAGGAAACAGATGGCCCGTCAATTTAGGA
TAAT TTGAGGTGGGGTTGATACCAGAAGCCTTTA；
The sequence of mutant plasmids is (seq6):
GTTCCTTGTAAAAGATTCCATCCATACAAAAACATACAACATGGAGAGTTAAAGTAAGTCT
TGTATTTCACCTCCTGGAGGTAAATATTTTTTAACAATT TGTCACTGTT
CCTCCTTTTGTTTTCCTTTCTGTGAGCAATG
TCACCCAAATTGGAACCATGCTGTATACAGTTTGGTAGCTGGCTTTTTATGTCTTACCATTATC
TCTCATTTGCATTCTCCCACATCTTTAATTATAGCGTATCAGTTAGGGCCCAGCAGGAAACAG
ATGGCCCGTCAATTTAGGATAATTTGAGGTGGGGTTGATACCAGAAGCCTTTA。
Further, described PCR Mixture 1 consists of: Taq22B 1.5 μ L, dNTPs 2 μ L,
Mg2+2 μ L, BSA 1 μ L, PCR buffer 2.5 μ L, distilled water 12.6 μ L～4.6 μ L.
Further, the consisting of of described detection PCR reagent:
PCR Mixture 1 is 21.6 μ L～13.6 μ L, primer 1 is 0.5 μ L, primer 2 is 0.5 μ L,
TaqMan probe 1 is 0.4 μ L, distilled water surplus；Described PCR Mixture 1 consists of: Taq22B
1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L, PCR buffer 2.5 μ L, distilled water
12.6 μ L～4.6 μ L.
Further, the consisting of of described positive control PCR reagent: PCR Mixture2 is
21.6 μ L～13.6 μ L, primer 3 is 0.5 μ L, primer 4 is 0.5 μ L, TaqMan probe 2 is
0.4 μ L, positive quality control product 2 μ L～10 μ L, distilled water complements to 25 μ L；Described PCR Mixture
2 consist of: Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L, PCR buffer
Liquid 2.5 μ L, distilled water 12.6 μ L～4.6 μ L.
Further, the consisting of of described negative control PCR reagent: PCR Mixture3 is
21.6 μ L～13.6 μ L, primer 5 is 0.5 μ L, primer 6 is 0.5 μ L, TaqMan probe 3 is
0.4 μ L, negative quality-control product 2 μ L～10 μ L, distilled water complements to 25 μ L；Described PCR Mixture3
Consist of: Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L, PCR buffer
2.5 μ L, distilled water 12.6 μ L～4.6 μ L.
The most preferred group of test kit of the present invention becomes:
Detection the consisting of of PCR reagent: PCR Mixture 1 is 21.6 μ L, primer 1 be 0.5 μ L,
Primer 2 is 0.5 μ L, TaqMan probe 1 is 0.4 μ L, distilled water surplus；Described PCR Mixture
1 consists of: Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L, PCR buffer
Liquid 2.5 μ L, distilled water 12.6 μ L；
Consisting of of positive control PCR reagent: PCR Mixture2 is 21.6 μ L, primer 3 is
0.5 μ L, primer 4 are 0.5 μ L, TaqMan probe 2 is 0.4 μ L, positive quality control product 2 μ L；Institute
State PCR Mixture 2 to consist of: Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L,
PCR buffer 2.5 μ L, distilled water 12.6 μ L；
Consisting of of negative control PCR reagent: PCR Mixture3 is 21.6 μ L, primer 5 is
0.5 μ L, primer 6 are 0.5 μ L, TaqMan probe 3 is 0.4 μ L, negative quality-control product 2 μ L；Institute
State PCR Mixture3 to consist of: Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L,
PCR buffer 2.5 μ L, distilled water 12.6 μ L；
Described PCR Mixture1 component and final concentration of:
PCR buffer Final concentration is 1 ×；
The final concentration of 0.2mM of dNTPs；
MgCl2Final concentration of 4mM；
The final concentration of 1 μ g/ml of BSA；
Taq 22B archaeal dna polymerase final concentration of 0.3U/ μ L.
The present invention also provides for a kind of described rs8099917 SNP detection kit
Application, concrete described application is:
(1) being added by testing sample in the detection PCR reagent of test kit, distilled water complements to 25 μ L
Reaction system, build lid, carry out fluorescent PCR detection；Simultaneously by positive control PCR reagent
With the reaction system that negative control PCR reagent is made into 25 μ L, build lid, carry out fluorescence respectively
PCR detects；The buccal swab sample of described testing sample behaviour or peripheral blood sample；Described to be measured
The addition of sample is 2 μ L～10 μ L, adds the detection PCR reagent of formula ratio, and distilled water is mended
Sufficient to 25 μ L；
(2) condition of fluorescent PCR amplified reaction is: 92～97 DEG C of denaturations 10min；92～97
DEG C degeneration 5s；57～62 DEG C of annealing 35s；3～5 circulations；92～97 DEG C of degeneration 10～15s；55～
60 DEG C of annealing 40s；40～45 circulations；
(3) availability deciding:
Negative control PCR reagent Ct value≤35, detection PCR reagent Ct value are Undet or 40,
And positive control PCR reagent with detection PCR reagent Ct value≤35, otherwise test be considered as invalid；
(4) result interpretation:
Negative control PCR reagent, positive control PCR reagent are equal with the Ct value of detection PCR reagent
For Undet or 40, this detection is failed or does not adds sample, again detects；
Negative control PCR reagent, positive control PCR reagent Ct value≤38, detect PCR reagent
Ct value is Undet or 40, and this sample results is judged as feminine gender；
Negative control PCR reagent, positive control PCR reagent and detection PCR reagent Ct value≤38,
This sample results is judged as the positive.
Probe used in the present invention is the TaqMan probe of 5 ' end FAM labellings, and probe two ends are divided
The acid of few core former times of other mark fluorescent reporter group (R) and fluorescent quenching group (Q).When probe is complete,
I.e. random manner and during without PCR primer hybridized state, the fluorescence that reporter group sends is quenched group
Absorb.In fluorescent PCR amplification procedure, when special PCR primer occurs with TaqMan probe
During hybridization, 5 ' end 5 prime excision enzyme activities of Taq enzyme are simultaneously also probe cleavage, and reporter group is released
The exometer that the fluorescence released just can be built in instrument detects.PCR often warp
Crossing a circulation, fluorescence signal is also the same with purpose fragment, has the process that a sync index increases,
The power of fluorescence signal just represents the number of the copy number of template ribonucleic acid.Therefore the present invention not only may be used
For simple qualitative detection, also can be used as the detection by quantitative of the concrete content of sample.
The advantage of comprehensive directly detection, and the feature of Real-Time Fluorescent Quantitative PCR Technique, with gene
The detection techniques such as order-checking compare, and the present invention is used for detecting rs8099917 site SNP and has following excellent
Gesture:
(1) high specificity: the primed probe of the present invention is many for rs8099917 site mononucleotide
State property regional sequence designs, and the 3 ' ends at mutation specific downstream primer introduce one or many respectively
The sudden change of individual base makes its specific amplification mutant allele.Outside mutational site, number base sets
The meter non-specific downstream primer of sudden change, in order to expand wild type and mutant allele simultaneously.It is only capable of
Rs8099917 site wild type and saltant type are detected, high specificity.
(2) sensitivity is high: the present invention can detect the rs8099917 of 1000copies/mL concentration
Site SNP fragment.
(3) detection process behaviour buccal swab sample or human peripheral sample directly carry out fluorescence
PCR augmentation detection, reduces experimental procedure, and greatly reduces pollution and the probability of result error.
(4) simple to operate quickly, can complete within 3 hours to obtaining a result from specimen transfer.
(5) result interpretation is clear and definite, objective, the most also result can be carried out quantitative analysis.
Safety: do not comprise poisonous and harmful substance in whole system, it is not necessary to the post processing of PCR primer,
To operator and environment all non-hazardous.
Relative to prior art, the beneficial effects of the present invention is:
The test kit of the present invention can detection people rs8099917 site quick, accurate, high sensitive list
Nucleotide polymorphisms, particularly without carrying out DNA extraction, directly detects with sample.
Human mouth swab sample or human peripheral sample are optimized by the present invention directly as template, addition
Detecting in PCR reaction system, process one step completes, it is not necessary to uncap, and can reduce experiment behaviour
Make step, time-consuming, also avoid the sample contamination that operation of uncapping may bring simultaneously.
(4) accompanying drawing explanation
Fig. 1 is to survey normal with the test kit of rs8099917 SNP of the present invention detection
The amplification curve diagram of the rs8099917 site SNP wild-type situation of human peripheral sample；
Fig. 2 is just to detect with the test kit of rs8099917 SNP of the present invention detection
The amplification curve diagram of the rs8099917 site SNP mutation type situation of ordinary person's peripheral blood sample；
Fig. 3 is to detect not with the test kit of rs8099917 SNP of the present invention detection
Amplification curve diagram with concentration rs8099917 site SNP wild-type mutant type plasmid solution.
(5) detailed description of the invention
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention
It is not limited to that:
Experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, all can be from business
Approach obtains.
Embodiment 1 test kit
(1) primed probe designs and screens the primer of energy specific detection: according to rs8099917 position
Point (GeneBank accession number AC011445.6 and AY336714.1) SNP situation, respectively prominent
The sudden change of 3 ' end one or more bases of introducing becoming specific Down Stream primer makes its specific amplification
Mutant allele.Outside mutational site, the number base design non-specific downstream primer of sudden change, uses
To expand wild type and mutant allele simultaneously.Design and screen multipair primer and probe, primer
Length is generally about 20 bases.
Rs8099917 site SNP detection general forward primer sequence as shown in seq1 (primer 1,
Primer 3, primer 5): 5 '-ACATACAACATGGAGAGTTAAAG-3'
The downstream wild type specific primer sequence of rs8099917 site SNP detection is as shown in seq2
(primer 4): 5 '-TGGTTCCAATTTGGGTGgA-3'
The downstream saltant type specific primer sequence of rs8099917 site SNP detection is as shown in seq3
(primer 2, primer 6): 5 '-TGGTTCCAATTTGGGTGgC-3'
Sequence (TaqMan as shown in seq4 of the TaqMan probe of rs8099917 site SNP detection
Probe 1, TaqMan probe 2, TaqMan probe 3):
5’-FAM-AAGTCTTGTATTTCACCTCCTGGAGG–BHQl-3’
(2) optimization of reaction system: collect the fresh sample of peripheral blood of 20 example normal persons, directly use
Real-time fluorescence quantitative PCR detection rs8099917 site SNP situation.
Real-time fluorescence quantitative PCR reaction system: positive control PCR reaction reagent includes positive quality control
Product, primer 3 and primer 4, TaqMan probe 2 and PCR Mixture2；Described negative control PCR
Reagent includes negative quality-control product, primer 5, primer 6, TaqMan probe 3 and PCR Mixture3；
Detection PCR reaction reagent includes primer 1 and primer 2, TaqMan probe 1 and PCR Mixture1；
Described PCR Mixture1 includes PCR buffer, dNTPs, BSA, MgCl2、Taq 22B DNA
Polymerase and distilled water, the same PCR of composition of described PCR Mixture2 and PCR Mixture3
Mixture1.It is optimized for main component primer, probe, enzyme in this system.
The condition of fluorescent quantitative PCR reaction is: 92～97 DEG C of denaturations 10min；92～97
DEG C degeneration 5s；57～62 DEG C of annealing 35s；3～5 circulations；92～97 DEG C of degeneration 10～15s；55～
60 DEG C of annealing 40s；40～45 circulations.
A, the optimization of primer concentration: in the case of in reaction system, other condition is identical, primer is dense
Degree makees multiple proportions serial dilution from 0.1 μM to 1.6 μM respectively: 0.1 μM, 0.2 μM, 0.4 μM, 0.8 μM,
1.6 μMs, carry out fluorescent PCR amplification, by the com-parison and analysis to amplification curve, determine and most preferably draw
Substrate concentration is 0.2 μM.
B, the optimization of concentration and probe concentration: in the case of in reaction system, other conditions are identical, by probe
Concentration makees serial dilution from 0.05 μM to 0.25 μM respectively: 0.05 μM, 0.1 μM, 0.15 μM,
0.2 μM, 0.25 μM, 0.15 μM, 0.16 μM, 0.17 μM, 0.18 μM, 0.19 μM, 0.2 μM,
Carry out fluorescent PCR amplification, by the com-parison and analysis to amplification curve, determine that optimal concentration and probe concentration is
0.16μM。
C, the optimization of annealing temperature: in the case of in reaction system, other condition is identical, carry out ladder
Degree PCR (54 DEG C～62 DEG C of annealing temperatures), by the com-parison and analysis to result of the test, determines optimal
Annealing temperature is 56 DEG C.
D, the optimization of enzyme: in the case of in reaction system, other condition is identical, in reaction system
Add different company's archaeal dna polymerase, by the com-parison and analysis to experimental result, determine that optimal enzyme is
Efficient DNA polymerase Taq22B (non-high-fidelity).
Utilize above-mentioned primer and probe to carry out the foundation of reaction system, determine the rs8099917 position of employing
It is 25 μ L that some SNP detects direct Fluorescence PCR system, carries out by quantitative fluorescent PCR reagent
The configuration of reactant liquor, wherein:
Consisting of of detection PCR reagent:
PCR Mixture 1 is 21.6 μ L, and primer 1 is 0.5 μ L, primer 2 is 0.5 μ L, TaqMan
Probe 1 is 0.4 μ L, distilled water surplus；Described PCR Mixture 1 consists of: Taq22B 1.5 μ L,
DNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L, PCR buffer 2.5 μ L, distilled water 12.6 μ L.
Consisting of of positive control PCR reagent: PCR Mixture2 is 21.6 μ L, primer 3 is
0.5 μ L, primer 4 are 0.5 μ L, TaqMan probe 2 is 0.4 μ L, positive quality control product 2 μ L；Institute
State PCR Mixture 2 to consist of: Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L,
PCR buffer 2.5 μ L, distilled water 12.6 μ L.
Consisting of of negative control PCR reagent: PCR Mixture2 is 21.6 μ L, primer 5 is
0.5 μ L, primer 6 are 0.5 μ L, TaqMan probe 3 is 0.4 μ L, negative quality-control product 2 μ L；Institute
State PCR Mixture3 to consist of: Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L,
PCR buffer 2.5 μ L, distilled water 12.6 μ L.
Described PCR Mixture1 component and final concentration of:
PCR buffer Final concentration is 1 ×；
The final concentration of 0.2mM of dNTPs；
MgCl2Final concentration of 4mM；
The final concentration of 1 μ g/ml of BSA；
Taq 22B archaeal dna polymerase final concentration of 0.3U/ μ L.
Described PCR Mixture2 and the component of PCR Mixture3 and the same PCR of final concentration thereof
Mixture1。
Embodiment 2 detects
(1) rs8099917 site wild type (seq5) plasmid solution (10 is taken6Copies/mL) and sudden change
Type (seq6) plasmid solution (106Copies/mL) 10 times of gradient dilutions are made respectively: 106copies/mL、
105copies/mL、104copies/mL、103copies/mL、102Copies/mL, 10copies/mL,
Detect as contrast template；Take human peripheral sample to detect as sample template simultaneously.
(2) use test kit reaction system of the present invention that above-mentioned template carries out fluorescent PCR detection:
According to the composition (optimum composition) of test kit in embodiment 1, by 106Copies/mL's is wild
Type (seq5) plasmid and 106Copies/mL saltant type (seq6) plasmid mixes as positive quality control product template
In positive control PCR reagent, constitute 25 μ L reaction systems carry out quantitative fluorescent PCR reaction, with
Time by 106Wild type (seq5) plasmid of copies/mL as negative quality-control product template in negative control
PCR reagent carries out quantitative fluorescent PCR reaction.
Take volunteer buccal swab sample 2 μ L and add detection PCR reagent (PCR as testing sample
Mixture 1 is 21.6, and primer 1 is 0.5 μ L, primer 2 is 0.5 μ L, TaqMan probe 1 is
0.4 μ L) in carry out quantitative fluorescent PCR reaction.
(3) condition of fluorescent quantitative PCR reaction is: 92～97 DEG C of denaturations 10min；92～
97 DEG C of degeneration 5s；57～62 DEG C of annealing 35s；3～5 circulations；92～97 DEG C of degeneration 10～15s；
55～60 DEG C of annealing 40s；40～45 circulations；
(4) experimental result is as shown in accompanying drawing 1～accompanying drawing 3.
Analysis of test results: if containing rs8099917 site mutation in sample to be checked, using specificity
Then showing positive amplification curve when primer 1 and primer 2 amplification, its detection sensitivity can reach
1000copies/mL；If sample to be checked does not has rs8099917 site mutation, with above-mentioned primer 1
Then show negative amplification curve, i.e. Ct value >=38 when expanding with primer 2, point out above-mentioned primer to sample
Product and probe have good specificity and sensitivity.Sample is detected with primer 3 and primer 4 amplification curve
This total template amount, total template amount≤104The sample of copy/mL is considered as defective sample and (abandons or dense
Analyze again after contracting), total template amount >=106The sample of copy/mL reanalyses after suitably diluting.
(5) availability deciding:
Negative control PCR reagent Ct value≤35, detection PCR reagent Ct value are Undet or 40,
And positive control PCR reagent with detection PCR reagent Ct value≤35, otherwise test be considered as invalid；
(6) result interpretation:
Negative control PCR reagent, positive control PCR reagent are equal with the Ct value of detection PCR reagent
For Undet or 40, this detection is failed or does not adds sample, again detects；
Negative control PCR reagent, positive control PCR reagent Ct value≤38, detect PCR reagent
Ct value is Undet or 40, and this sample results is judged as feminine gender；
Negative control PCR reagent, positive control PCR reagent and detection PCR reagent Ct value≤38,
This sample results is judged as the positive.
Claims (5)
1. for a direct fluorescence PCR detection reagent kit for rs8099917 single nucleotide polymorphism, its
It is characterised by that described test kit includes detecting PCR reagent, positive control PCR reagent and negative control PCR
Reagent, described detection PCR reagent includes the specific primer in single nucleotide polymorphism rs8099917 site
1 and primer 2, probe 1 and PCR Mixture1；Described positive control PCR reagent includes positive quality control
Product, primer 3, primer 4, TaqMan probe 2 and PCR Mixture2, described positive quality control product is
Rs8099917 site wild type and mutant plasmids mixed liquor；Described negative control PCR reagent includes the moon
Property quality-control product, primer 5, primer 6, TaqMan probe 3 and PCR Mixture3, described negative Quality Control
Product are rs8099917 site wild plasmid solution；Described PCR Mixture1 include PCR buffer,
dNTPs、BSA、MgCl2, Taq 22B archaeal dna polymerase and distilled water, described PCR Mixture2
With the composition of PCR Mixture3 with PCR Mixture1；
Primer 1, primer 3 and primer 5 are: 5 '-ACATACAACATGGAGAGTTAAAG-3'；
Primer 2 and primer 6 are: 5 '-TGGTTCCAATTTGGGTGgC-3'；
Primer 4 is: 5 '-TGGTTCCAATTTGGGTGgA-3'；
TaqMan probe 1, TaqMan probe 2 and TaqMan probe 3 are:
5’-FAM-AAGTCTTGTATTTCACCTCCTGGAGG-BHQl-3’；
The sequence of wild plasmid is:
GTTCCTTGTAAAAGATTCCATCCATACAAAAACATACAACATGGAGAGTTAAAGTAAGTCTTGT
ATTTCACCTCCTGGAGGTAAATATTTTTTAACAATT
TGTCACTGTTCCTCCTTTTGTTTTCCTTTCTGTGAGCAATTTCACCCAAATTGGAACCATGCTGTA
TACAGTTTGGTAGCTGGCTTTTTATGTCTTACCATTATCTCTCATTTGCATTCTCCCACATCTTTAA
TTATAGCGTATCAGTTAGGGCCCAGCAGGAAACAGATGGCCCGTCAATTTAGGATAAT
TTGAGGTGGGGTTGATACCAGAAGCCTTTA；
The sequence of mutant plasmids is:
GTTCCTTGTAAAAGATTCCATCCATACAAAAACATACAACATGGAGAGTTAAAGTAAGTCTTGT
ATTTCACCTCCTGGAGGTAAATATTTTTTAACAATT TGTCACTGTT
CCTCCTTTTGTTTTCCTTTCTGTGAGCAATG
TCACCCAAATTGGAACCATGCTGTATACAGTTTGGTAGCTGGCTTTTTATGTCTTACCATTATCTCTC
ATTTGCATTCTCCCACATCTTTAATTATAGCGTATCAGTTAGGGCCCAGCAGGAAACAGATGGCCC
GTCAATTTAGGATAATTTGAGGTGGGGTTGATACCAGAAGCCTTTA。
2. test kit as claimed in claim 1, it is characterised in that described PCR Mixture 1 consists of:
Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L, PCR buffer 2.5 μ L, double steamings
Water 12.6 μ L～4.6 μ L.
3. test kit as claimed in claim 1, it is characterised in that consisting of of described detection PCR reagent:
PCR Mixture 1 is 21.6 μ L～13.6 μ L, primer 1 is 0.5 μ L, primer 2 is 0.5 μ L,
TaqMan probe 1 is 0.4 μ L, and distilled water complements to 25 μ L；Described PCR Mixture 1 consists of:
Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L, PCR buffer 2.5 μ L, double steamings
Water 12.6 μ L～4.6 μ L.
4. test kit as claimed in claim 1, it is characterised in that the group of described positive control PCR reagent
Become: PCR Mixture2 is 21.6 μ L～13.6 μ L, primer 3 is 0.5 μ L, primer 4 is 0.5 μ L,
TaqMan probe 2 is 0.4 μ L, positive quality control product 2 μ L～10 μ L, and distilled water complements to 25 μ L；Institute
State PCR Mixture 2 to consist of: Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L,
PCR buffer 2.5 μ L, distilled water 12.6 μ L～4.6 μ L.
5. test kit as claimed in claim 1, it is characterised in that the group of described negative control PCR reagent
Become: PCR Mixture3 is 21.6 μ L～13.6 μ L, primer 5 is 0.5 μ L, primer 6 is 0.5 μ L,
TaqMan probe 3 is 0.4 μ L, and negative quality-control product 2 μ L～10 μ L, distilled water complements to 25 μ L；Institute
State PCR Mixture3 to consist of: Taq22B 1.5 μ L, dNTPs 2 μ L, Mg2+2 μ L, BSA 1 μ L,
PCR buffer 2.5 μ L, distilled water 12.6 μ L～4.6 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410504522.5A CN104293933B (en) | 2014-09-27 | Direct fluorescence PCR detection reagent kit and application for rs8099917 single nucleotide polymorphism |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410504522.5A CN104293933B (en) | 2014-09-27 | Direct fluorescence PCR detection reagent kit and application for rs8099917 single nucleotide polymorphism |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104293933A CN104293933A (en) | 2015-01-21 |
| CN104293933B true CN104293933B (en) | 2017-01-04 |
Family
ID=
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103993076A (en) * | 2014-04-30 | 2014-08-20 | 厦门安普利生物工程有限公司 | Human chromosome gene IL28B site polymorphism detection kit, and detection method and application thereof |
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103993076A (en) * | 2014-04-30 | 2014-08-20 | 厦门安普利生物工程有限公司 | Human chromosome gene IL28B site polymorphism detection kit, and detection method and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| Predicting sustained viral response to hepatitis C using a rapid and simple IL28B rs8099917 genotyping assay;WEI LI;《Antiviral Research》;20120222;第94卷(第1期);54-56 * |
| Simultaneous Genotyping of rs12979860 and rs8099917 Variants Near the IL28B Locus Associated with HCV Clearance and Treatment Response;Roberta Melis;《The Journal of Molecular Diagnostics》;20110731;第13卷(第4期);446-451 * |
| The rs8099917 Polymorphism, When Determined by a Suitable Genotyping Method, Is a Better Predictor for Response to Pegylated Alpha Interferon_Ribavirin Therapy in Japanese Patients than Other Single;Kiyoaki Ito;《JOURNAL OF CLINICAL MICROBIOLOGY》;20110531;第49卷(第5期);1853-1860 * |
| 多重荧光错配引物PCR进行单核苷酸多态性检测分析;孙岳枫;《国际检验医学杂志》;20120531;第33卷(第9期);1030-1032 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| USRE46293E1 (en) | System and method for detection of HIV tropism variants | |
| CN103757091B (en) | Sudden cardiac death rapid gene detection kit and detection method | |
| CN105177115B (en) | A kind of UGT1A1 Polymorphisms site fluorescence detection reagent kit for being used to instruct Irinotecan based chemotherapy drug individualized treatment | |
| CN102227507A (en) | System and method for detection of HIV integrase variants | |
| CN103773897B (en) | Multiplex fluorescence PCR detection kit for hepatitis C virus nucleic acid detection and genotyping and application thereof | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN107338287B (en) | Kit and method for detecting sheep BMPR-IB gene A746G mutation by Taqman-MGB probe | |
| CN105238861A (en) | Kit for Chinese pediatric asthma susceptibility gene SNP (single nucleotide polymorphism) genotyping and application method of kit for Chinese pediatric asthma susceptibility gene SNP genotyping | |
| CN101812537B (en) | Method and reagent kit for simultaneously detecting resistance site of three nucleotide analogues of hepatitis B virus | |
| CN109182493A (en) | The primer and kit and its detection method of people's 16p11.2 microdeletion syndrome detection | |
| CN103429760A (en) | System and method for detection of hiv integrase variants | |
| CN110241264B (en) | Quantitative detection kit for Hepatitis B Virus (HBV) DNA | |
| CN108060213A (en) | Isothermal duplication method detection SNP site probe and kit based on the recombinase-mediated that probe is oriented to | |
| CN104357584A (en) | Preparation and application of guiding gene chip for HCV infection individual treatment | |
| CN114085926B (en) | Primer, probe, kit and detection method for SNP locus polymorphism of ABCB1 gene C3435T | |
| CN111235252A (en) | Method for distinguishing individual medication of nitrendipine by mass spectrometry through detecting product | |
| CN111235251A (en) | Kit for detecting gene of nitrendipine individualized medication guidance of antihypertensive drug | |
| CN104293933B (en) | Direct fluorescence PCR detection reagent kit and application for rs8099917 single nucleotide polymorphism | |
| CN102534030B (en) | Kit for jointly detecting four deafness predisposing genes and application thereof | |
| CN108660252A (en) | A kind of human immunodeficiency virus drug resistance analysis method based on pyrosequencing | |
| CN105274197A (en) | Quality control method and kit used for biological sample nucleic acid detection | |
| CN108546753A (en) | Baclofen pharmaceutical relevant gene GABBR1 genetic polymorphism detection kits | |
| CN102912038A (en) | RT-HDA kit and primer for detecting avian influenza virus | |
| CN111235253A (en) | Detection product for distinguishing nitrendipine individualized medication type | |
| CN111235255A (en) | Method for distinguishing individual medication of nitrendipine by using primer composition through mass spectrometry |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170104 Termination date: 20190927 |