CN104232570B - Set up the method and its application of monoclonal mescenchymal stem cell - Google Patents
Set up the method and its application of monoclonal mescenchymal stem cell Download PDFInfo
- Publication number
- CN104232570B CN104232570B CN201310253266.2A CN201310253266A CN104232570B CN 104232570 B CN104232570 B CN 104232570B CN 201310253266 A CN201310253266 A CN 201310253266A CN 104232570 B CN104232570 B CN 104232570B
- Authority
- CN
- China
- Prior art keywords
- cell
- stem cell
- mescenchymal stem
- reporter protein
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0662—Stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Diabetes (AREA)
- Cell Biology (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Developmental Biology & Embryology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Cardiology (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Physical Education & Sports Medicine (AREA)
- Heart & Thoracic Surgery (AREA)
- Virology (AREA)
- Obesity (AREA)
- Epidemiology (AREA)
- Rheumatology (AREA)
- Endocrinology (AREA)
- Microbiology (AREA)
- Emergency Medicine (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention proposes the method and its application for building monoclonal mescenchymal stem cell.The method of separating mesenchymal stem cell, including：A）Animal specimen is digested using clostridiopetidase A, to disperse the cell included in the animal specimen, to obtain the cell mixture for including stem cell；B）The nucleic acid molecules of encoding reporter protein are introduced at least a portion cell of the cell mixture, wherein, the nucleic acid molecules of the encoding reporter protein are operably connected with mescenchymal stem cell specificity promoter, to express the reporter protein in mescenchymal stem cell；And C）Using FACS, sorting obtains the mescenchymal stem cell of the expression reporter protein, wherein, the mescenchymal stem cell is in the form of individual cells.The mescenchymal stem cell of individual cells form can be effectively prepared using this method.
Description
Technical field
The present invention relates to biomedical sector.Specifically, the present invention relates to method of separation stem cell and application thereof.More
Body, the present invention relates to the method for separation stem cell, using stem cell obtained by this method or derivatives thereof, and this is dry thin
Purposes of the born of the same parents or derivatives thereof in medicine is prepared.
Background technology
Mescenchymal stem cell（MSC）Extensive concern is received recently, because it is conducive to the property of transplanting, i.e., it has
There are pluripotency and non-immunogenic.It has been reported that mescenchymal stem cell can be obtained from Adult Human Bone Marrow and fetal tissue's separation
（MSC）.The MSC separated from marrow（BM MSC）It has been reported as the multipotential cell in vitro with high proliferation potential.BM
MSC can be divided into fat cell (A), Gegenbaur's cell (O), cartilage cell (C) and vascular smooth muscle (V) pedigree, but can not
It is divided into Skeletal Muscle Cell, cardiac muscle cell, hematopoietic cell, liver cell or neural lineage.It can be used for which imply them
The cell therapy of numerous damaged tissues：Bone, cartilage, axoneure and cardiac muscular tissue.
First, from the extracorporeal separation method of mescenchymal stem cell, mainly there is an adherent method, density-gradient centrifugation method,
Flow cytometry and magnetic activated cell seperation.It is relatively low that the shortcoming of first two method essentially consists in cell purity；Latter two method
Common drawback is 1）Without real specific cell surface marker；2）There is considerable influence to cytoactive, easily cause MSCs
Damage, occur propagation it is slow the problems such as；3）Complex operation, it is expensive, it is typically limited to only laboratory applications.What these were present
Technical bottleneck problem greatly limit MSCs clinical practice and development.However, there is presently no can separate list
The method for cloning mescenchymal stem cell.Secondly, from the point of view of mescenchymal stem cell clinical application angle, that mainly carries out at present is autologous
Stem cell transplantation technology is found broad application in clinical various diseases.But shortcoming is：Derived from bone marrow materials inconvenience, is easily caused
From bulk damage；Derived from peripheral blood must make stem cell reach certain amount by external source sexual stimulus；Though adipose-derived avoid
State inferior position, but have that the oncogenicity and serum of amplification in vitro uses it is pathogenic.
Therefore, the method for setting up monoclonal mescenchymal stem cell awaits further improving.
The content of the invention
It is contemplated that at least solving one of above-mentioned technical problem to a certain extent or providing at a kind of useful business
Industry is selected.Therefore, it is an object of the present invention to propose a kind of method that can efficiently separate stem cell, utilizing this method energy
The stem cell of individual cells form is enough obtained, and then the stem cell monoclonal cluster formed by individual cells can be obtained.
In the first aspect of the present invention, the present invention proposes a kind of method for separating stem cell.According to the implementation of the present invention
Example, this method includes：A）Animal specimen is digested using clostridiopetidase A, it is thin included in the animal specimen to disperse
Born of the same parents, to obtain the cell mixture for including stem cell；B）The nucleic acid molecules of encoding reporter protein are introduced into the mixing with cells
In at least a portion cell of thing, wherein, nucleic acid molecules and the mescenchymal stem cell specificity of the encoding reporter protein start
Son is operably connected, to express the reporter protein in mescenchymal stem cell；And C）Using FACS, sorting obtains table
Up to the mescenchymal stem cell of the reporter protein, wherein, the mescenchymal stem cell is in the form of individual cells.According to the present invention
The method of embodiment, due to nucleic acid molecules and mescenchymal stem cell the specificity promoter operably phase of encoding reporter protein
Even, therefore, obtained in the mescenchymal stem cell that the nucleic acid molecules of the encoding reporter protein will be included in cell mixture
It is specific expressed, so as to using cell airflow classification means, can be carried out to the mesenchymal cell of specific expressed reporter protein
Effectively sorting, so as to obtain the mescenchymal stem cell of individual cells form.
Embodiments in accordance with the present invention, preceding method can also have following additional technical feature：
In one embodiment of the invention, the animal specimen is from selected from liver organization, adipose tissue, bony process
Matter, muscle, Cord blood, umbilical cord, placenta, peripheral blood, pancreas, lungs, at least one of menses and dental pulp.Optionally, it is described dynamic
Thing sample is from human fetal liver tissue and Adult Human Bone Marrow tissue.So as to effectively improve the effect of separating mesenchymal stem cell
Rate.
In one embodiment of the invention, the nucleic acid of encoding reporter protein is introduced at least the one of the cell mixture
Part cell includes：The cell mixture is cultivated using fluid nutrient medium；Construct is introduced into the culture to obtain
In the attached cell obtained, wherein, the construct includes：The nucleic acid molecules of encoding reporter protein；And mescenchymal stem cell is special
Specific Promoters, the nucleic acid molecules of the encoding reporter protein are operably connected with mescenchymal stem cell specificity promoter.
Thus, it is possible to which effectively the nucleic acid molecules of encoding reporter protein are incorporated into cell, and encoding reporter protein can make it that
Nucleic acid molecules effectively can be expressed in mescenchymal stem cell.
In one embodiment of the invention, the fluid nutrient medium is α-MEM culture mediums.Thus, it is possible to further carry
The efficiency of high later separation mescenchymal stem cell.Embodiments in accordance with the present invention, the culture medium can also add EGF or FGF2 etc.
Biotic factor, so as to maintain MSC optimal biological characteristics and differentiation potential.
Embodiments in accordance with the present invention, the type for the reporter protein that can be used is not particularly limited, if its have can
The activity of detection.According to some embodiments of the present invention, reporter protein can be selected from luminescent protein, fluorescin, enzyme
At least one.Specifically, embodiments in accordance with the present invention, reporter protein can a kind of can produce the albumen of optical signalling
Matter is such as luminescent protein either fluorescin such as green fluorescent protein or reporter protein can be that one kind can be with substrate
Interact to produce the enzyme of detectable signal.Thus, it is possible to according to the conventional method, be monitored to reporter protein and to table
Cell up to reporter protein is sorted.According to some specific examples of the present invention, it is preferable that reporter protein can be glimmering for green
Photoprotein（GFP）, enhanced green fluorescence protein（EGFP）And at least one of luciferase.According to one of present invention tool
Body example, preferably reporter protein are enhanced green fluorescence protein, thus, and the fluorescence signal that reporter protein is produced can be easier
Ground is detected, so that signal detection is sensitiveer, thus, in one embodiment of the invention, the reporter protein is
Selected from luminescent protein, fluorescin, enzyme at least one.Optionally, the reporter protein is green fluorescent protein.
In the present invention used term " operably " refer to expression of nucleic acid control sequence such as promoter with
Function connects between target nucleic acid sequence, wherein when suitable molecule such as transcriptional activating molecular is combined with expression control sequence
When, expression control sequence affects the transcription and/or translation of the nucleic acid corresponding to target nucleic acid sequence.Thus, according to the present invention
Embodiment, specific mescenchymal stem cell specificity promoter can be introduced in mesenchymal cell directly by construct and is used
In start encoding reporter albumen nucleic acid molecules transcript and expression, thus, it is possible to improve obtained receive the nucleic acid molecules
Cell in reporter protein expression.According to the specific example of the present invention, the mescenchymal stem cell specificity that can be used starts
Son is people's NANOG promoters, and its genome sequence is classified as：
5’-GATTTAAAAGTTGGAAACGTGGTGAACCTAGAAGTATTTGTTGCTGGGTTTCTC
TTCAGGTTCTGTTGCTCGGTTTTCTAGTTCCCCACCTAGTCTCCCTTACTCTGCAGCTAC
TTTTGCATTACAATGGCCTTGGTGAGACTGGTAGACGGGATTAACTGAGAATTCACAAG
GGTGGGTCAGTAGGGGGTGTGCCCGCCAGGAGGGGTGGGTCTAAGGTGATAGAGCCT
TCATTATAAATCTAGAGACTCCAGGATTTTAACGTTCTGCTGGACTGAGGCTGGTTGCCT CATGTTATTAT-3’。
Used term " construct " refers to a kind of such genetic carrier in the present invention, and it includes specific nucleic acid sequence
Row, and purpose nucleic acid sequence can be transferred in host cell with the genome generation homologous recombination of host cell to obtain weight
Group cell.Embodiments in accordance with the present invention, the form of construct is not particularly limited, and according to the specific example of the present invention, it can
Think plasmid, bacteriophage, artificial chromosome, clay（Cosmid）, virus at least one.According to the specific example of the present invention,
Construct is in the form of plasmid.Plasmid, with simple to operate, can carry the property of larger fragment, be easy to as genetic carrier
Operation and processing.The form of plasmid is also not particularly limited, and both can be circular plasmids or linear plasmid, you can with
It is single-stranded or double-strand.Those skilled in the art can be selected as needed.
In the second aspect of the present invention, the present invention proposes a kind of stem cell or derivatives thereof, and the stem cell is to pass through
Above prepared by the method described in any one.Due to being unicellular form using the stem cell obtained by foregoing method
Stem cell, or belong to the monoclonal cluster of stem cell, thus it has identical genetic background, reduces it for animal
Immunogenicity during body.In addition, stem cell obtained using embodiments in accordance with the present invention or derivatives thereof purity is high；Gene
Group unicity, is easy to gene order-checking from now on；It is difficult differentiation or the more non-monoclonal cell of differentiation degree is low, easily keeps original MSC
Characteristic and potential.
Thus, in the third aspect of the present invention, the present invention proposes foregoing stem cell or derivatives thereof in preparation
Purposes in medicine, the medicine, which is used to treat, is selected from following at least one：Disease in the blood system, angiocardiopathy, liver are hard
Change, the nervous system disease, nervous system reparation, meniscus of knee joint Partial Resection injury repair, autoimmune disease, spinal cord
Damage, brain paralysis, ALS, systemic loupus erythematosus, systemic sclerosis, clone disease, apoplexy, diabetes,
Diabetes and hepatic sclerosis.These diseases it is verified that, effectively treated using mescenchymal stem cell, so as to utilize root
According to the mescenchymal stem cell obtained by the inventive method, based on the advantage of foregoing monoclonal mescenchymal stem cell of the present invention, by energy
It is enough to obtain more effectively therapeutic effect.
Therefore, in the fourth aspect of the present invention, the present invention proposes a kind of pharmaceutical composition, it is characterised in that including：Before
Stem cell described in face or derivatives thereof；And acceptable excipient on medicine.
" treatment " include prevention in the present invention, alleviate, suppress or cure defect, dysfunction, disease or other are harmful
Process, including interference treatment and/or the process caused by treatment.
The cell of the single form produced by methods described herein or monoclonal stem cell can be used in it is clinical with handle by
Examination person." subject " is vertebrate, preferably mammal, more preferably people.Mammal includes but is not limited to people, domestic animal, competing
Skill animal and pet.Need to be included due to physical damnification or the relevant damage of disease with the subject that the method for the present invention is treated
The subject lost with function.Therefore, can be by their preparations into pharmaceutical composition.Therefore, in certain embodiments, stem cell
It is present in suitable in the administration i.e. composition of physical compatibility.Therefore, composition generally also includes one or more buffer (examples
Such as neutral buffered saline or phosphate buffered saline), carbohydrate (such as glucose, mannose, sucrose or glucan), sweet dew
Alcohol, albumen, polypeptide or amino acid such as glycine, antioxidant, bacteriostatic agent, chelating agent such as EDTA or glutathione, adjuvant
(such as aluminium hydroxide), make the preparation isotonic compared with the blood of junctor, hypotonic or somewhat hypertonic solute, suspending agent, increasing
Thick dose and/or preservative.In other embodiments, cell may reside in the composition suitable for freezing or storage.In many
In embodiment, the purity of the cell for giving subject is about 100%.In other embodiments, it is 95%-100%.At it
In his embodiment, it is 95%-100%.Preferably for the mixture with other cells, the percentage can be about 10%-
15%、15%-20%、20%-25%、25%-30%、30%-35%、35%-40%、40%-45%、45%-50%、60%-70%、70%-80%、
80%-90% or 90%-95%.Or, separation/purity can represent that wherein such as 10- has occurred for cell in the form of cell doubles
20th, 20-30,30-40,40-50 or more times of cell multiplication.The cell quantity of given volume can be by being widely known by the people and normal
The method and Instrument measuring of rule.The percentage of cell in the cell mixture of given volume can be surveyed by method about the same
It is fixed.Easily cell can be counted either manually or by using automatic cell counter.The specific cells of given volume can make
It is with specific stain and range estimation and thin by using specificity combinating reagent (generally antibody), fluorescence labeling and fluorescence-activation
The automatic mode of born of the same parents' sorter and determine.Dependence many factors select the formulation for giving the cell for given purposes.
In these factors, it is important that the species of subject, illness to be treated, the property of dysfunction or disease and its tested
The property of state and distribution in person, other therapies to be administrated and reagent, the optimal path of administration, by the remaining of the approach
Property, the factor that dosage regimen and other skilled in the art understand.For example, specifically, suitable carrier and other additives
Selection can rely on the definite approach of administration and the property of particular dosage form.For example, cell survival may be based on the therapy of cell
One important determinant of effect.This is all working as establishment for primary treatment and auxiliary treatment.Target site is unsuitable for carefully
Born of the same parents can produce another worry when being inoculated with cell growth.This may prevent therapeutic cells from reaching the site and/or transplanting
Thereunto.Multiple embodiments of the present invention include increase cell survival and/or overcome because caused by being inoculated with and/or grow barrier
The measure of problem.The final preparation of the aqueous suspension of cell/culture medium, which is generally comprised, arrives the ionic strength regulation of the suspension
Isotonic (i.e. about 0.1-0.2) and physiological pH (i.e. about pH6.8-7.5) is arrived into pH regulations.The final preparation generally also contains liquid
Body lubricant such as maltose, it is necessary for body and is resistant to.Exemplary lubricants composition includes glycerine, glycogen, maltose etc..
Material based on organic polymer, such as polyethylene glycol and hyaluronic acid and Non-fibrous collagen (preferably succinated glue
It is former), it is also possible to make lubricant.These lubricants are generally used for improving the injection energy for injecting biomaterial on injection position
Power, intrability and dispersiveness, and reduce by changing the viscosity of the composition motive force (spiking).Last matches somebody with somebody
System is that the cell is limited in pharmaceutical acceptable carrier.Then the cell is placed in syringe or other injection devices with essence
Really it is expelled on the site of tissue defect.Term " injectable " refer to the preparation be not required to promotion substantially can in normal pressure and just
To be given in the syringe with as little as No. 25 syringe needles under the conditions of often.Promotion can cause composition non-injection from syringe spilling
Into tissue.For this accurate arrangement, it is necessary to thin to No. 27 (200 μ I.D.) or even the syringe needle of No. 30 (150 μ I.D.).It can lead to
The largest particles size for crossing these syringe needles extrusion is the complicated function at least with following parameter：Particle full-size, particle are long
Width is than (long：It is wide), particle rigidity, relevant factor sticky between rough degree and influence particle, the viscoelastic of suspension
Property, and the flow velocity for passing through syringe needle.The rigid ball for being suspended in Newtonian fluid kind represents simplest situation, and in visco elastic fluids
Fibroid in body or the particle for having branch seem much more complex.The preferable isotonicity of the composition can be used sodium chloride or its
He realizes pharmaceutically acceptable dose of such as dextrose, boric acid, sodium tartrate, propane diols or other inorganic or organic solutes.Sodium chloride is special
It is preferred for the buffer solution containing sodium ion.If desired, pharmaceutically useful thickener can be used to protect the viscosity of the composition
Hold on selected level.It is preferred that methylcellulose, because it can readily and economically be obtained and easy to use.Other are suitable
Thickener includes such as xanthans, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer etc..The preferred concentration of the thickener
Depending on selected reagent.It is important that usage amount can realize selected concentration.Cementitious compositions are typically by solution
It is middle to add the thickener and prepare.Pharmaceutically useful preservative or stabilizer can be used for increase cell/culture media composition
Life-span.If adding the preservative, then selection does not influence the cell viability or the composition of effect completely in ability
Within the knowledge of field technique personnel.It will be appreciated by those skilled in the art that the composition of the composition should be lazy in chemistry
Property.This does not constitute problem in terms of chemistry and pharmacy principle to those skilled in the art.It can be used what present disclosure was provided
Information, the typically available document in herein cited and this area, make reference to the text-book or by simple experiment (not including excessively examination
Test) it can easily avoid problem.Sterile injectable solution can be prepared in the following manner：As needed, it will be used to realize this
The cell of invention is mixed in the desired amount of suitable solvent with different amounts of other compositions.
In certain embodiments, stem cell can be made into the injectable forms of unit dose, such as solution, suspension or breast
Liquid.Pharmaceutical preparation suitable for cell infusion is usually aseptic aqueous solution and dispersion.Carrier for injectable formulation can
For solvent or decentralized medium, containing such as water, salt solution, phosphate buffered saline, polyalcohol (such as glycerine, propane diols and the poly- second of liquid
Glycol etc.) and their suitable mixture.Those skilled in the art, which can be readily determined, to be given in the methods of the invention
The amount of cell and optional additive, medium (vehicle) and/or carrier in composition.Generally, any additive is (except described
Beyond cell) all it is present in 0.001wt%-50wt% amount in solution such as phosphate buffered saline.The active component with
Microgram to milligram magnitude is present, e.g., from about 0.0001wt% to about 5wt%, preferably from about 0.0001wt% to about 1wt%, most preferably from about
0.0001wt% is to about 0.05wt%, or about 0.001wt% to about 20wt%, preferably from about 0.01wt% are to about 10wt%, most preferably
0.05wt% to about 5wt%.In certain embodiments, cell encapsulation is particularly improved into treatment effect to be administered when encapsulated
When or provide processing and/or shelf-life on advantage when.In certain embodiments, exempt from when encapsulated increase is cell-mediated
During the effect that epidemic disease suppresses, the need for therefore it is also reduced to immuno-suppressive medication.In addition, in certain embodiments, capsule
It (is not immunogenicity or simply generally in allograft to the cell to change offer can further reduce subject
Faint immunogenicity) immune response the barrier for subject immune system, so as to mitigate due to giving the cell
And any graft rejection or inflammation that may occur.Cell can be packaged by film and capsule before implantation.It is contemplated that
Any one in a variety of methods available for cell encapsulation can be used.In certain embodiments, cell is separately packaged.
In some embodiments, many cells are encapsulated in same film.In the embodiment that wherein described cell is removed after the implantation,
One structure of large-size that many cells are for example encapsulated in single film can provide convenient recovery method.It is thin in microencapsulation
Multiple material can be used in the various embodiments of born of the same parents.These materials include such as polymer capsule, alginates-poly-L-Lysine-
Alginates microcapsules, poly-L-Lysine Barium alginate capsule, Barium alginate capsule, polyacrylonitrile/polyvinyl chloride (PAN/PVC) are hollow
Fiber and polyether sulfone (PES) doughnut.Some embodiments add cell in polymer, such as biopolymer or synthesis
Polymer.The example of biopolymer includes but is not limited to fibronectin, fibrin, fibrinogen, fibrin ferment, glue
Former and proteoglycan.Other factors cell factor as discussed above can be also added into the polymer.In other implementations
In example, cell can be added into the space of three dimensional gel.Big polymer or gel are generally implanted into by performing the operation.Foot can be configured to
The polymer or gel of enough small particle or fiber can be conventional by other, more easily, the approach of No operation gives.Specifically
Ground, when treating liver defect, the cell can be encapsulated in the device of an implantable subject.Cell can quilt
Be implanted in liver or liver nearby or other positions are to replace or supplement liver function.Cell can not also plant in a device
Enter, such as in existing liver organization.
Composition can be according to age, sex, body weight and the illness of such as specific patient, and by the preparation of administration (for example
Solid or liquid) etc. factor, according to dosage and pass through medicine and known to veterinary applications technical staff technology be administered.The mankind or other
The dosage of mammal can be not required to by technical staff according to present disclosure, the document cited herein and the knowledge of this area
Excessively experiment and draw.Many factors are depended on suitable for the cell dosage of multiple embodiments of the invention.It is for different feelings
Sizable variation can occur for condition.Can determine that main and auxiliary treatment optimal dosage parameter including some following or
All：The disease to be treated and its stage；The species of subject, their health, sex, age, body weight and metabolic rate；By
The immunocompetence of examination person；Other therapies given；And the history or the possibility of genetype for predicting according to subject are concurrent
Disease.The parameter may also include：The cell is isogenic, autologous, allogeneic or xenogenesis；Their efficiency
(concrete activity)；Make the cell effectively site that must be targetted and/or distribution；And these characteristics in the site are for example
The accessibility of cell and/or the implantable of cell.Other specification includes and other factors (such as growth factor and cell factor)
Common administration.Optimal dose in the case of given is also contemplated that will be thin after the mode of cell preparation, the mode for giving them, administration
Born of the same parents navigate to the degree of target site.Finally, the determination of optimal dose must provide such effective dose, i.e., described dosage was both
The threshold value for being not less than maximum beneficial effect is also not higher than the threshold value that dose-dependent illeffects exceedes the benefit of incremental dose.It is right
In some embodiments, the optimal dose of cell is in in autologous, monokaryon bone-marrow transplantation dosage range.For very pure
Cell preparation, in different embodiments, the optimal dose being administered every time can be 104~108Individual cell/kg recipient's mass.At certain
In a little embodiments, the optimal dose being administered every time is 105~107Individual cell/kg.In many examples, what is be administered every time is optimal
Dosage is 5 × 105~5 × 106Individual cell/kg.For referring to, foregoing higher dosage is with being used for autologous monokaryon bone-marrow transplantation
The dosage of karyoblast is similar.Some relatively low dosage and the CD34 for autologous monokaryon bone-marrow transplantation+Individual cell/kg quantity
It is similar.It should be understood that single doses can once, portioning or the continuous delivering within a period of time.Also whole doses can be delivered to one
Individual position is distributed to several positions.
In various embodiments, cell can be administered with a predose, then by the way that holding is administered again.Cell can be
A kind of method administration is begun through, is then administered by same procedure or one or more distinct methods.Level can by after
It is continuous to give the cell and keep.Various embodiments give the cell and/or keep them by being injected intravenously when starting
Level in subject.In various embodiments, the other factors that can be discussed according to the state of an illness and elsewhere herein of patient
Use other form of medication.It should be noted that the time that human experimenter receives treatment is typically longer than experimental animal, however, treatment
Length of the length generally to lysis and therapeutic effect is proportional.Those skilled in the art can consider to use in people and/or move
The result for the other method carried out in thing (rat, mouse, non-human primates etc.), to determine the suitable dose for people.
The guidance provided based on these considerations and according to present disclosure and prior art, this determination can be not required to technical staff
Excessively experiment and determine dosage.The initial administration and suitable scheme of administration or successive administration can be all identical or can be again
Change.Suitable scheme can be not required to by technical staff according to present disclosure, the document cited herein and the knowledge of this area
Excessively experiment and draw.Dosage, frequency and the duration for the treatment of depend on many factors, include property, the subject of disease
And other therapies that may be given.Therefore, kinds of schemes can be used for giving the cell/culture medium.In certain embodiments,
By cell subject is given with a dosage.In some other embodiment, by cell with a series of two dosage or multiple
Dosage continuously gives subject.Wherein other of cell are given with a dosage, two dosage and/or more than two dosage
In some embodiments, dosage may be the same or different, and the interval between administration may be the same or different.Cell can be in various differences
It is administered in time with multi-frequency.In certain embodiments, cell is administered within the time less than 1 day.In other embodiments,
They are 2, be administered in the time of 3,4,5 or 6 days.In certain embodiments, cell within the time of several weeks with weekly or
Multiple dosing.In other embodiments, cell is administered within the time of several weeks continues one to the several months.In various embodiments, carefully
Born of the same parents can be administered within the time of several months.In other embodiments, cell can one or the several years time in be administered.General therapeutic is long
Degree is that the length to lysis, the situation of the effect of therapy used and the subject to be treated and reaction are proportional.
Embodiments in accordance with the present invention, separated mescenchymal stem cell, which can have, to be induced to differentiate to form at least one
Ability selected from following cell：It is Gegenbaur's cell, cartilage cell, fat cell, fibroblast, bone marrow matrix, skeletal muscle, flat
Sliding flesh, cardiac muscle, endothelial cell, epithelial cell, hematopoietic cell, Deiter's cells, neuronal cell or oligodendroglia class
Type.The present invention also provides the noble cells obtained from above-mentioned mesenchymal cell, and wherein its progeny cell can be bone, cartilage, fat
Cell, fibroblast, bone marrow matrix, skeletal muscle, smooth muscle, cardiac muscle, endothelial cell, epithelial cell, endocrine cell, outer point
Secrete cell, hematopoietic cell, Deiter's cells, neuronal cell or oligodendroglia.The differentiation progeny cell can be skin
Skin epithelial cell, liver epithelial cell, pancreatic epithelial cells, pancreatic endocrine cell or island cell, Exocrine Pancreas In Rats, on intestines
Chrotoplast, renal epithelial cell or epithelium dependency structure.Cell or its differentiation offspring can be used for correcting genetic disease, degenerative disease
Disease, angiocardiopathy, metabolism thesaurismosis, sacred disease or cancer disease process.They can be used for producing the tooth for being used for treating periodontosis
Gum sample material.They can be used for forming skin epidermis tissue, and the skin epidermis tissue, which is derived from, can be used for dermatoplasty and shaping
The cell of operation.They can be used for for example toning up the muscles in penis or heart.They, which can be used for producing treating, uses external blood, or
Human hematopoietic cell and/or people are produced with before birth or postnatal animal blood.They can be used as therapeutic agent with for example in patient from cancer
Disease treatment, the chemotherapy for the treatment of autoimmune diseases or radiotherapy help out in recovering, to cause the tolerance of recipient.They
Available for treatment AIDS or animal infectious diease.Optic cell can be used for treatment by including but is not limited to caused by optic nerve disease
Blindness, the optic nerve disease is by including but is not limited to macular degeneration, BDR, glaucoma, retinal color
Element denaturation causes.The cell or cardiac muscle cell from the cell can be used for treatment heart disease, include but is not limited to cardiac muscle
Inflammation, cardiomyopathy, heart failure, by heart attack caused by damage, hypertension, atherosclerosis and the function of heart valve not
Entirely.They can also be used to treat the disease for being related to CNS defects or damage.In addition, the stem cell or its neuron differentiation offspring
Cell can be used for treating the disease for being related to neurologically handicapped or degeneration, including but not limited to apoplexy, Alzheimer's disease, Parkinson
Family name's disease, Huntington's disease, aids related dementia, spinal cord injury, influence brain or other nerve fibers metabolic disease.Carefully
Born of the same parents or their differentiation offspring such as stroma cell can be used for supporting the growth and differentiation of other cell types in vivo or in vitro,
Other described cell classes include but is not limited to hematopoietic cell, pancreatic islet cells or β cells, liver cell etc..The cell or differentiation
Cartilage offspring, available for treatment joint or cartilage disease, including but not limited to cartilage tear, cartilage be thinning, osteoarthritis.This
Outside, the cell or their differentiation Gegenbaur's cell offspring can be used for improving the process for having bone deleterious effects, including but not
It is limited to fracture, nonunion, osteoarthritis, by the tumour (such as prostate cancer, breast cancer, the multiple marrow that are diffused into bone
Knurl etc.) caused by bone " hole ".Using suitable growth factor, chemotactic factor (CF) and cell factor, cell can be induced to break up shape
Into some pedigrees, including for example a variety of cells with mesoderm phenotype, the cell (neuroglia with neuroderm phenotype
Cell, oligodendroglia and neuron) and cell with entoderm phenotype.These include Gegenbaur's cell, cartilage cell, fat
Fat cell, cartilage and bone, skeletal muscle, smooth muscle, cardiac muscle, endothelial cell, hematopoietic cell, stroma cell, neuronal cell and on
Chrotoplast.Being induced to differentiate can be in osteoporosis, osteitis deformans (Paget ' s with the cell for forming osteocyte
Disease), fracture, osteomyelitis, osteonecrosis, achondroplasia, osteogenesis imperfecta, Hereditary multiple osteochondroma, multiple
Property epiphyseal dysplasia, Marianne Cotard (Marfan ' s syndrome), mucopolysaccharidosis, neurofibromatosis or
It is used as cell therapy in scoliosis or for regeneration, local deformity, spina bifida, hemivertebra or fused vertebrae, limbs
The reconstruction operations of deformity, the reconstruction after the reconstruction and infection (such as tympanitis) of neoplastic lesion tissue.It has been induced to differentiate with shape
The regeneration that the cell of chondroblast can be used in the disease or injury relevant with the age, sports-related injury, or it is specific
Disease such as rheumatoid arthritis, psoriatic arthritis, bad special arthritis (Reiter ' s arthritis), ulcerative colitis
Inflammation, Crohn disease (Crohn ' s disease), ankylosing spondylitis, the cell therapy in osteoarthritis or regeneration；Outside
The reconstruction operations of ear；The reconstruction operations of nose；And the reconstruction operations of annular cartilage.It has been induced to differentiate to form fat cell
Cell can be used for rebuilding or cosmetic surgery remodeling, include but is not limited to, postmastectomy breasst reconstruction, to because of other hands
The art tissue that tumor resection is caused for example from face or on hand, which is lost, to carry out shaping, enlarges the bosom and go to wrinkle.It can be additionally used in type ii diabetes
Treatment.Therefore derivative fat cell may also provide effective extracorporeal model system for studying fat regulation.Into fiber finer
Born of the same parents：Fibroblast from the cell can be used for cell therapy or tissue repair to promote wound healing or provide connective group
Knit supporter, the support of such as cosmetic surgery.It has been induced to differentiate and has been sought with the cell for forming Skeletal Muscle Cell available for Du Shi fleshes
Support bad disease (Duchenne muscular dystrophy), bencher muscular dystrophy (Beckermuscular
Dystrophy), the tissue repair in steirert-Batten-Gibb syndrome, the treatment of skeletal muscle lesion, and repair skeletal muscle damage
The reconstruction operations of wound.It has been induced to differentiate and gastronintestinal system dysplasia such as esophagus can be used for the cell for forming smooth muscle cell
Cell therapy or tissue repair in the treatment of locking, intestinal atresia and entembole, and intestinal obstruction or colonic diversion it is postoperative
Tissue is replaced.Smooth muscle cell can be additionally used in bladder or uterus reconstruction, neovascularization, by such as atherosclerosis or artery
The reparation for the injury of blood vessel that knurl is caused.Smooth muscle precursor (mesangial cell) can be used as the external model of renal glomerular disease
Or for the cell therapy in diabetic neuropathy or regeneration.Smooth muscle precursor can also be used to repair distal convoluted tubule or kidney
The macula densa of tissue by bead.Cardiac muscle cell can be used for after treatment miocardial infarction, with congestive heart failure, valve to put
It is during changing, damage to cardiac tissue is thin as caused by congenital cardiac anomaly or as caused by cardiomyopathy or endocarditis
Born of the same parents' therapy or tissue repair.Microglia cell can be used for treatment spinal cord injury and nerve degeneration sexual dysfunction such as Heng Tingdunshi
Disease (Huntington ' s disease), Parkinson's disease, multiple sclerosis and Alzheimer's disease, and for influenceing
The reparation of injury tissue during the infectious disease of central nervous system.By hereditary change to produce the mesoglia of cell factor
Cell can also be used to transplanting treat passage because of the infectious disease in the confined central nervous system of blood-brain barrier.Neuroglia is thin
Born of the same parents can also produce nerve fiber regeneration and ridge after the apoplexy as caused by multiple sclerosis, ALS and the cancer of the brain
The growth factor or growth factor inhibiting factor regenerated after marrow damage.Stroma cell：Stroma cell can be used as marrow after chemotherapy and put
Change the transplanted cells with bone-marrow transplantation.Endothelial cell can be used for treatment factor VIII deficiency and for neovascularization.Endothelium is thin
Born of the same parents may also provide the external model for suppressing tumour using angiogenesis inhibitor, and vasculitis, hypersensitivity and blood coagulation barrier
The external model hindered.Hematopoietic cell：Hematopoietic cell can be used for the expanding myeloid again after high dose chemotherapy.It is thin from the aggregation
The hematopoietic cell of born of the same parents can further break up to form haemocyte, to be stored in blood bank, the problem of alleviating blood transfusion hematopenia.It is small
Deiter's cells can be used for treatment spinal cord injury and nerve degeneration sexual dysfunction such as Heng Tingdunshi diseases, Parkinson's disease, multiple
Property sclerosis and Alzheimer's disease, and infectious disease to influenceing central nervous system in injury tissue reparation.Lost
Pass to change and can be additionally used in transplanting to produce the microglia cell of cell factor, to treat passage because blood-brain barrier is confined
Infectious disease in central nervous system.Deiter's cells can also produce by multiple sclerosis, ALS and
The growth factor or growth factor inhibiting factor that regenerate after nerve fiber regeneration and spinal cord injury after apoplexy caused by the cancer of the brain.Quilt
The cell of induced synthesis oligodendroglia and astroglia, for example, can be used for being transplanted to demyelinate tissue especially ridge
In marrow, their function is for peripheral nerve tissue plus myelin there.The cell can be additionally used in cell exchange therapy and/or
Gene therapy is to treat congenital nerve degeneration obstacle or storage disorder such as mucopolysaccharidosis, leukodystrophy (ball
Shape cell leukodystrophy, card receive Wen's disease (Canavan ' s disease)), fucose mass formed by blood stasis, GM2 gangliosides
Deposit disease, Niemann-Pick disease (Niemann-Pick), the sharp ripple syndrome (Sanfilippo syndrome) in Santa Fe, Wal Man
Sick (Wolman ' s disease) and Tay Sachs disease (Tay Sachs).They can be additionally used in trauma such as apoplexy,
Central nervous system bleeding and central nervous system trauma；For peripheral nervous disease such as spinal cord injury or spinal cord empty
Disease；Regarded for retinal disease such as detachment of retina, macular degeneration and other degenerative retinal diseases, and diabetic keratopathy
Retinopathy.Ectodermal epithelium cell：Cell can be used in cell exchange therapy and/or gene therapy, to treat or alleviate skin
Skin case such as alopecia, defect of skin such as skin burn and albinic symptom.Epithelial cell can be used for cell exchange therapy and/or
In gene therapy, to treat or alleviate the symptom of some organopathies.The cell can be used for treating or alleviating congenital hepatic disease
Disease, for example, thesaurismosis such as mucopolysaccharidosis, leukodystrophy, GM2 gangliosidosis；Bilirubin increase disease
Become, such as crigler-Najjar syndrome (Crigler-Najjar syndrome)；Ammonia disease, such as urea cycle it is congenital
Sexual dysfunction such as ornithine decarboxylase deficiency disease, citrullinemia and argininosuccinate aciduria；Amino acid and organic acid it is congenital
Sexual dysfunction, such as PKU, hereditary tyrosinemia and alpha-1 antitrypsin deficiency disease；And the blood coagulation disorders such as factor
VIII and IX deficiency diseases.The cell can be additionally used in treatment acquired liver pathological changes caused by virus infection.The cell may be used also
For external, for example, artificial liver is generated, produce clotting factor and produce the albumen or enzyme generated by liver epithelial cell.Institute
State epithelial cell and can be additionally used in cell exchange therapy and/or gene therapy, to treat or alleviate the disorder of gallbladder such as biliary cirrhosis
With the symptom of Biliary atresia.The epithelial cell can be additionally used in cell exchange therapy and/or gene therapy, to treat or alleviate pancreas
The symptom of gland disease such as pancreatic atresia, pancreatitis and alpha-1 antitrypsin deficiency disease.In addition, when can obtain pancreatic epithelial cells,
During nerve cell, β cells can be generated.These cells can be used for diabetes treatment (be subcutaneously implanted or pancreas in or liver in
Implantation).In addition, the epithelial cell can be additionally used in cell exchange therapy and/or gene therapy, to treat or alleviate gut epithelium
The symptom of illness such as intestinal atresia, inflammatory bowel disease, intestinal obstruction and Bowel resection.Cell can be used for tissue repair：Cell also can use
In tissue repair.Cell can be implanted to strengthen the repair process in bone, to strengthen the bone died down or cover joint again.
Cartilage cell can be expelled in joint to cover articular cartilage again.Caplan et al. (United States Patent (USP) 5,855,619) is described
A kind of bio-matrix implant, including wherein added the contraction gel-type vehicle of a leaf liver cell.The implant is intended to repair
Overlying tissue defect, especially tendon, ligament, the damage of meniscus or muscle.For example, cartilage can be by the way that cartilage cell be added to
By such as collagen, synthesize porous, three-dimensional rack neighboring area and shape that polyglycolic acid fiber or synthesizing polylactic acid fiber be made
Into.Inventor is it has been proved that the cell differentiation of the present invention is to form cartilage cell, for example, it can be deposited on collagen, synthesize poly- second
In alkyd, synthesizing polylactic acid or other timbering materials or surrounding is to provide implant with promotion organization reparation.
The according to embodiments of the present invention method for setting up monoclonal mescenchymal stem cell has the beneficial effect that：
1. because with identical genetic background, reducing its immunogenicity when for animal body；
2. very high purity, cellular genome unicity；It is easy to the sequencing of genome from now on；
3. being difficult differentiation or the more non-monoclonal cell of differentiation degree being low, original MSCs characteristic and multi-functional differentiation are easily kept
Potential；With
4. can longterm culture in vitro, largely expand to meet clinical demand, oncogenicity is low.
The additional aspect and advantage of the present invention will be set forth in part in the description, and will partly become from the following description
Obtain substantially, or recognized by the practice of the present invention.
Brief description of the drawings
Fig. 1 is shown in the MSCs cells of utilization flow cytometry analysis according to embodiments of the present invention by transfection
Nanog promoter transfection efficiencies；
Fig. 2 shows GFP in the MSCs cells of utilization fluorescence microscope according to embodiments of the present invention by transfection
Expression；
Fig. 3 shows that the optics of the monoclonal MSCs according to embodiments of the present invention that 96 orifice plates are incubated at after sorting shows
Micro mirror observation figure；And
Fig. 4 is shown in the MSCs cells of utilization fluorescence microscope according to embodiments of the present invention by transfection
VIMENTIN genes（4A）, α-SMA genes（4B）With CNN1 genes（4C）Expression.
Embodiment
Embodiments of the invention are described below in detail, it is necessary to which explanation is the following examples, it is only for illustrate this
Invention, without limiting the present invention in any way.In addition, the reagent and material employed in embodiment are also commercially available below
It is available, if be not known illustrate, the method and condition used, also according to known methods to the related place of condition progress
Reason.
The Cell isolation and culture of embodiment 1
The different tissues of animal will be respectively derived from, be digested using clostridiopetidase A, after centrifugation, removed after supernatant, will
Cultivated after the cells rinsed with PBS 2 times of collection with complete medium, MSCs is adherent rapid, carry out changing liquid after 24 hours, go
Except the cell of remaining suspension, so as to obtain all attached cells.Wherein complete medium includes α-MEM nutrient solution cultures, 10%
Hyclone.
The cell transfecting of embodiment 2
By new isolated MSC adhere-wall cultures 24 hours, change after liquid and continue to cultivate, trained before transfection using antibiotic-free
Base culture is supported, cell fusion 70%-80% is treated, the plasmid containing Nanog promoters and control plasmid are dissolved in 50 microlitres of nothings respectively
In the nutrient solutions of Opti-MEM I of serum, it is well mixed.Appropriate liposome is dissolved in the trainings of Opti-MEM I of 50 microlitres of serum-frees
In nutrient solution, it is well mixed.It is incubated 5 minutes at room temperature.Then above two solution mixture is mixed（Cumulative volume 100 is micro-
Rise）.After being gently mixed uniform incubation at room temperature 25 minutes, add 100 microlitres of compound per hole in 24 orifice plates and fit
Measure culture medium.Culture medium is replaced by complete medium after compound 4~6 hours is added, and cell is continued at 37 degree 5%
CO2Cultivated in incubator after 48 hours, measure transfection efficiency using FACS, as a result see Fig. 1, Fig. 2.
Can be seen that the transfection efficiency that control group plasmid shows from the result in Fig. 1 is 56.8%, mescenchymal stem cell
The positive rate of expression is 34.4%.By flow cytomery, it can confirm that the method according to the invention will successfully can contain
The transfection of people NANOG promoter sequences enters cell, and transfection efficiency is good, can be used for subsequent experimental.Fig. 2's shows from reality
Apply transfection of the cell of the acquisition of example 1 through transfected with human NANOG promoter sequences and GFP under the green polariscope of fluorescence microscope
As a result.
The cell sorting of embodiment 3
After pancreatin digestion centrifugation, the attached cell after transfecting successfully is shifted from culture dish with PBS, passed through
After cleaning, detected with FACS flow cytometers under 488 nanometers under argon laser.Utilize Cell-Quest softwares (Weasel
V2.3.1) 10,000 cells in sample are analyzed.
Use above-mentioned complete medium in 96 orifice plates in 37 degrees Celsius of 5%CO the individual cells after sorting2Under the conditions of enter
Row culture, changes liquid once in every 3~5 days, understands that early stage single clone cell growth is more slow by observation, but cell is in after one week
After existing colony group, growth is rapid, is grown in typical mescenchymal stem cell sample, in fusiform, whirlpool sample, radial growth, as a result
See Fig. 3.
The immunofluorescence of embodiment 4
By the cell culture broken up in Chinese entitled culture chamber room slide (B＆D).The cellular layer of fusion is with being dissolved in phosphorus
Acid buffer（PBS）4%（Volume/volume）Paraformaldehyde solution is fixed 15 minutes at room temperature, discards paraformaldehyde molten
Add the 0.1%Triton100X that is dissolved in PBS after liquid into cell through over cleaning and be incubated at room temperature 10 minutes so as to
Protein expression is carried out in nucleus.Cytoskeletal protein fixes 5 minutes with methanol under -20 degrees celsius.Then it will be loaded with
The slide of the cell fixed respectively with the anti-human vimentin VIMENTIN antibody of mouse, the anti-human α-smooth muscle actin of mouse (α-
SMA) the anti-human calcium of the anti-human nestin antibody of antibody, mouse, the anti-human desmin antibody of mouse, mouse nurses one's health albumen (CNN1) antibody in room
Temperature is lower to be incubated 1 hour, sheep anti mouse, sheep after being cleaned after the antibody that inclines respectively to slide with corresponding Alexa-448 combinations
Anti-rabbit and the anti-goat-anti body of mouse continue to be incubated 2 minutes.After dyeing, mounting is carried out with Vecta-shield+DAPI (Vector), is used in combination
Imager A1 microscopes (Carl Zeiss) are observed.Shown by Fig. 4 results, VIMENTIN, α in mescenchymal stem cell-
The expression of SMA and CNN1 albumen is the positive, and wherein VIMENTIN protein 10s 0% are expressed, and it can also be used as MSCs protein expressions
Positive control.
In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show
The description of example " or " some examples " etc. means to combine specific features, structure, material or the spy that the embodiment or example are described
Point is contained at least one embodiment of the present invention or example.In this manual, to the schematic representation of above-mentioned term not
Necessarily refer to identical embodiment or example.Moreover, specific features, structure, material or the feature of description can be any
One or more embodiments or example in combine in an appropriate manner.
Although embodiments of the invention have been shown and described above, it is to be understood that above-described embodiment is example
Property, it is impossible to limitation of the present invention is interpreted as, one of ordinary skill in the art is not departing from the principle and objective of the present invention
In the case of above-described embodiment can be changed within the scope of the invention, change, replace and modification.
Claims (8)
1. a kind of method of separating mesenchymal stem cell, it is characterised in that including：
A) animal specimen is digested using clostridiopetidase A, to disperse the cell included in the animal specimen, to obtain
The cell mixture of stem cell must be included；
B) cell mixture is cultivated using fluid nutrient medium；Construct is introduced into the adherent thin of the culture acquisition
In born of the same parents, wherein, the construct includes the nucleic acid molecules and mescenchymal stem cell specificity promoter of encoding reporter protein, institute
The nucleic acid molecules for stating encoding reporter protein are operably connected with mescenchymal stem cell specificity promoter, so as to dry in mesenchyma
The reporter protein is expressed in cell；The mescenchymal stem cell specificity promoter behaviour NANOG promoters, its gene order
Such as SEQ ID NO:Shown in 1；And
C FACS) is utilized, sorting obtains the mescenchymal stem cell of the expression reporter protein, wherein, the mescenchymal stem cell is in
The form of individual cells.
2. according to the method described in claim 1, it is characterised in that the animal specimen is from selected from liver organization, fat
At least one of tissue, bony process matter, muscle, Cord blood, umbilical cord, placenta, peripheral blood, pancreas, lungs, menses and dental pulp.
3. according to the method described in claim 1, it is characterised in that the animal specimen is from human fetal liver tissue and adult
Marrow.
4. according to the method described in claim 1, it is characterised in that the fluid nutrient medium is α-MEM culture mediums.
5. according to the method described in claim 1, it is characterised in that the reporter protein be selected from luminescent protein, fluorescin,
At least one of enzyme.
6. method according to claim 5, it is characterised in that the reporter protein is green fluorescent protein.
7. according to the method described in claim 1, it is characterised in that the construct in plasmid, bacteriophage, artificial chromosome,
At least one form of clay, virus.
8. according to the method described in claim 1, it is characterised in that further comprise resulting individual cells form
Mesenchymal stem cells are cultivated, to obtain stem cell monoclonal cluster.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310253266.2A CN104232570B (en) | 2013-06-21 | 2013-06-21 | Set up the method and its application of monoclonal mescenchymal stem cell |
| PCT/CN2014/079970 WO2014201986A1 (en) | 2013-06-21 | 2014-06-16 | Monoclonal mesenchymal stem cell generation method and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310253266.2A CN104232570B (en) | 2013-06-21 | 2013-06-21 | Set up the method and its application of monoclonal mescenchymal stem cell |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104232570A CN104232570A (en) | 2014-12-24 |
| CN104232570B true CN104232570B (en) | 2017-08-25 |
Family
ID=52103956
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310253266.2A Active CN104232570B (en) | 2013-06-21 | 2013-06-21 | Set up the method and its application of monoclonal mescenchymal stem cell |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN104232570B (en) |
| WO (1) | WO2014201986A1 (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109432128A (en) * | 2018-12-07 | 2019-03-08 | 卡替（上海）生物技术股份有限公司 | Application of the dental pulp mescenchymal stem cell in curing psoriasis |
| CN109674819B (en) * | 2018-12-21 | 2023-05-05 | 博雅干细胞科技有限公司 | Placenta mesenchymal stem cell preparation and use thereof for treating sclerotic disease |
| CN109762820B (en) * | 2019-02-18 | 2020-07-28 | 河北佑仁生物科技有限公司 | Application of specific starting element of mesenchymal stem cells in stem cells |
| CN110075125A (en) * | 2019-05-10 | 2019-08-02 | 成都康景生物科技有限公司 | A kind of umbilical cord mesenchymal stem cells injection and preparation method thereof hardened for treatment system sclerosis with acra |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559586A (en) * | 2011-12-08 | 2012-07-11 | 遵义医学院附属医院 | Separation, purification and identification methods of human amnion mesenchymal stem cells |
| CN102864124A (en) * | 2012-09-10 | 2013-01-09 | 广东江源生物科技有限公司 | Renal-source stem/progenitor cell for expressing nestin |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0129689D0 (en) * | 2001-12-12 | 2002-01-30 | Janssen Pharmaceutica Nv | Isolation tool for viable c-kit expressing cells |
| EP1445320A1 (en) * | 2003-02-05 | 2004-08-11 | ARTEMIS Pharmaceuticals GmbH | Automated gene-targeting using non-toxic detectable markers |
| US7396680B2 (en) * | 2003-10-31 | 2008-07-08 | Cornell Research Foundation, Inc. | Stem cell-specific promoters and their use |
| CN102517251A (en) * | 2012-01-12 | 2012-06-27 | 苏州大学附属第一医院 | Mesenchymal stem cells, as well as preparation method and application thereof |
-
2013
- 2013-06-21 CN CN201310253266.2A patent/CN104232570B/en active Active
-
2014
- 2014-06-16 WO PCT/CN2014/079970 patent/WO2014201986A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559586A (en) * | 2011-12-08 | 2012-07-11 | 遵义医学院附属医院 | Separation, purification and identification methods of human amnion mesenchymal stem cells |
| CN102864124A (en) * | 2012-09-10 | 2013-01-09 | 广东江源生物科技有限公司 | Renal-source stem/progenitor cell for expressing nestin |
Non-Patent Citations (1)
| Title |
|---|
| 人脐带间充质干细胞生物学特性及其研究进展;马锡慧 等;《中国组织工程研究与临床康复》;20110806;第15卷(第32期);6064-6067 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2014201986A1 (en) | 2014-12-24 |
| CN104232570A (en) | 2014-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Charbord | Bone marrow mesenchymal stem cells: historical overview and concepts | |
| ES2373551T3 (en) | METHODS FOR USING CELLS DERIVED FROM ADIPOSE TISSUE IN THE TREATMENT OF CARDIOVASCULAR AFFECTIONS. | |
| ES2511791T3 (en) | Mesenchymal stem cells positive for ABCB5 as immunity modulators | |
| US20060247195A1 (en) | Method of altering cell properties by administering rna | |
| CA2862661C (en) | Methods and compositions for the clinical derivation of an allogenic cell and therapeutic uses | |
| Doğan et al. | Differentiation of human stem cells is promoted by amphiphilic pluronic block copolymers | |
| Geuze et al. | Luciferase labeling for multipotent stromal cell tracking in spinal fusion versus ectopic bone tissue engineering in mice and rats | |
| US9999589B2 (en) | Culture medium of adipose-derived stem cell, method for preparing the same, and composition including the same for promoting hair growth | |
| CN1860222A (en) | Stem cells for clinical and commercial uses | |
| JP6193214B2 (en) | Method for producing dental pulp-derived pluripotent stem cells | |
| CN104232570B (en) | Set up the method and its application of monoclonal mescenchymal stem cell | |
| CN113318274A (en) | Hydrogel and preparation method and application thereof | |
| CN107354127A (en) | Effects of the LncRNA TUG1 in regulation and control PDLSCs Osteoblast Differentiations and regeneration | |
| JP6993026B2 (en) | Regenerative therapeutic composition | |
| Chen et al. | Directional homing of glycosylation-modified bone marrow mesenchymal stem cells for bone defect repair | |
| Popuri | Concerns of a pediatric dentist in dental stem cells: an overview | |
| CN108495924A (en) | Method for generating mescenchymal stem cell | |
| RU2428996C2 (en) | Biotransplant for correction of soft tissue defects (versions), method of biotransplant obtaining (versions) and method of correction of soft tissue defects | |
| WO2022247848A1 (en) | Preparation method for and application of hair follicle mesenchymal stem cell | |
| CN103911342A (en) | Mice animal model of giant cell tumor of bone of human and construction method thereof | |
| CN106606512A (en) | Mixed cell preparation used for treating myocardial infarction as well as preparation method thereof and application thereof | |
| Wang et al. | Stem cell-based therapeutic strategies for rotator cuff tendinopathy | |
| US20080233090A1 (en) | Method of Treatment by Administration of Rna | |
| de Grey | Commentary on some recent theses relevant to combating aging: December 2010 | |
| CN108606981A (en) | Pulmonary fibrosis is treated with MSCs orientation chemotactic characteristic deliveries EPO |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |