CN104087600A - Wheat methionine sulfoxide reductase gene TaMsrA4.1 and application thereof - Google Patents

Abstract

The invention discloses a wheat methionine sulfoxide reductase gene TaMsrA4.1 and application of the gene TaMsrA4.1 for improving salt resistance of arabidopsis thaliana and wheat plant. An experimental result shows that salt resistance of a transgenic plant is greatly improved in comparison with that of a non-transgenic plant, and theoretical basis and practice basis are provided for improving salt resistance of crops through gene engineering means.

Description

Wheat methionine sulfoxide reductase gene TaMsrA4.1 and application thereof

Technical field

The invention belongs to technical field of biological genetic engineering, relate in particular to grow wheat methionine sulfoxide reductase gene TaMsrA4.1 and an application thereof.

Background technology

High salt is the important factor of limiting plant growth growth and the output of being correlated with.Therefore, excavate and identify that anti-salt-related gene is one of key issue of breeding scientist consideration for farm crop improvement.Methionine sulfoxide reductase (Methionine Sulfoxide reductase, Msr) family gene can be by multiple abiotic stress abduction delivering.In plant materials, Msr not only can remove excessive active oxygen (Reactive oxygen radical species in body, ROS), and can external catalysis because the R of ROS oxidation and the MetSO of S type are reduced to Met, these evidences show that Msr may play a significant role in plant stress is replied.

Wheat is one of of paramount importance sweet native food crop, not Salt And Alkali Tolerance in the world.But worldwide soil salinization aggravation in recent years, has seriously limited crop growth and output.Therefore the ability of strengthening wheat reply salt tolerant is to expand wheat planting scope and improve the most effectively one of approach of wheat yield.The genome that wheat Jinan 177 is in earlier stage gradually infiltrated by the chromatin of long fringe couchgrass extremely strong resistance of reverse near wheat edge dogstail in this laboratory, has formulated a collection of degeneration-resistant new germ plasm resource and has therefrom selected high yield/Salt-tolerant Wheat new variety mountain and melted (SR3) No. 3.The cDNA chip that the salt drought treatment S R3 seedling in early stage builds shows that TaMsrA4.1 wherein has remarkable response.Although MsrA family gene is the existing PRELIMINARY RESULTS of the effect aspect anti-coercing in Arabidopis thaliana, paddy rice and some other plants, in staple food crop wheat, particularly clone, the functional verification of TaMsrA4.1 gene there is not yet report to this family gene.

Summary of the invention

The object of this invention is to provide an anti-salt-related gene--wheat methionine sulfoxide reductase gene TaMsrA4.1, and utilize this gene in the application improving in plant salt resistance.

Technical scheme of the present invention is: melt from wheat mountain No. 3 (SR3) and separate and obtain wheat methionine sulfoxide reductase gene TaMsrA4.1, first in Arabidopis thaliana, verify its function, confirm that subsequently it improves salt resistance in wheat.

Wheat methionine sulfoxide reductase gene TaMsrA4.1 of the present invention, is characterized in that: described gene cDNA sequence is as shown in SEQ ID No.1.Wherein, described wheat is that wheat is melted on mountain No. 3.

Compared with similar gene in methionine sulfoxide reductase gene TaMsrA4.1 and other species that the present invention clones in wheat, homology is between 60～79%.Its conserved regions analysis is found, the conserved sequence that the aminoacid sequence that in wheat, methionine sulfoxide reductase gene TaMsrA4.1 derives contains similar " GCFWG " and " KGCNDPIRCYG " conserved sequence that is positioned at C end, the thermostability that these three Cys are wherein enzymes and catalytic activity institute are necessary.Comparing with other isoformgene, also have the higher variability of N-and C-end, there is the differentiation in function in this hint this gene in wheat.

Wheat methionine sulfoxide reductase gene TaMsrA4.1 of the present invention is in the application improving in plant salt resistance.

Experiment confirms: under salt is processed, the plant that proceeds to gene TaMsrA4.1 of the present invention crosses and expresses is that upgrowth situation and root length are better than wild-type growth, illustrates that the conversion of this gene has strengthened the ability of the anti-salt of plant (Arabidopis thaliana and wheat) really.

Beneficial effect of the present invention: utilize existing plant gene engineering technology, the present invention clones first and obtained wheat SR3 methionine sulfoxide reductase gene TaMsrA4.1 and carried out functional verification.Experiment this gene of discovery and salt resistance are closely related.Therefore the research for this gene TaMsrA4.1 has most important theories meaning and application prospect.

Brief description of the drawings

Fig. 1: the cDNA electrophorogram of TaMsrA4.1 gene, wherein: M is DNA Marker, and the cDNA that swimming lane 1-2 is TaMsrA4.1, the negative contrast of swimming lane NC, water is masterplate.

Fig. 2: turn the Arabidopis thaliana transfer-gen plant screening of TaMsrA4.1 gene, green seedling is transfer-gen plant.

Fig. 3: methionine sulfoxide reductase gene TaMsrA4.1 RealTime-PCR expression analysis in transgenic arabidopsis, Clo-0 is wild-type Arabidopis thaliana, and OE1 and OE2 are different transgenosis pure lines, and Actin is interior mark contrast.

Fig. 4: NaCl Treatment Analysis in genetically modified Arabidopis thaliana, WT is wild-type, OE1 and OE2 express system.

Fig. 5: transgenic wheat PCR screens electrophoresis result, the negative contrast of NC, M is DNA Marker, all the other transgenic wheats for detecting.

Embodiment

The clone of embodiment 1, TaMsrA4.1cDNA

The extraction of the total RNA of 1.1SR3 wheat

(1) will grow into 2 leaf one heart stage wheats and shred and put into mortar, be ground into powder after adding liquid nitrogen covering material;

(2) once after liquid nitrogen volatilization, get immediately about 200mg powder and proceed in 1.5ml centrifuge tube, add 1ml TrizolRNA extracting solution, vortex concussion fully mixes in room temperature and leaves standstill 5min;

(3) 4 DEG C, centrifugal 10min under 12000rpm condition, gets 0.9ml supernatant liquor and moves in another 1.5ml centrifuge tube, add 0.2ml chloroform thermal agitation 15sec to mix after in room temperature leave standstill 5min;

(4) at 4 DEG C, centrifugal 10min under 12000rpm condition, gets 0.4ml supernatant liquor and moves in new 1.5ml centrifuge tube, gets after 0.4ml Virahol adds and mixes in room temperature and leave standstill 15mim;

(5) 4 DEG C, centrifugal 10min under 12000rpm condition, abandons after supernatant with twice, 4 DEG C of the ethanol continuous washing of 1ml75%, centrifugal 5min under 8000rpm condition;

(6) abandon supernatant, in Bechtop, dry RNA5min, adds 40 μ l RNase-Free water, in 60 DEG C, dissolves RNA10min;

(7) survey concentration and the quality of RNA sample with ultraviolet spectrophotometer, A ₂₆₀/ A ₂₈₀reach 1.7-2.0 for well; The quality of the sepharose standard electrophoresis Detection and Extraction RNA of recycling 1.2%.

1.2 synthetic TaMsrA4.1cDNA the first chains

(1) to adding successively following material (40 μ l system) in centrifuge tube:

(2) after light mixed at 65 DEG C sex change 5min, immediately ice bath 1min;

(3) afterwards immediately to adding successively following reagent in centrifuge tube:

(4) after light mixed, in 42 DEG C of water bath with thermostatic control 1h, sex change 10min at 65 DEG C stores for future use at-20 DEG C afterwards.

The cDNA of the synthetic TaMsrA4.1 of 1.3PCR reaction

TaMsrA4.1-F：5'GGACTGACTGAGCCGACGAAGCATC 3'

TaMsrA4.1-R：5'GGTCAGGTCACCAGGCTCGTTCATC 3'

(1) PCR reaction system (20 μ l):

PCR reaction conditions is as follows:

After reaction finishes, PCR product detects in 0.8% agarose gel electrophoresis, has obtained and has expected big or small electrophoretic band, and result as shown in Figure 1.

(2) purifying of clone gene fragment reclaims (using DP209 test kit and standard program)

Put into 1.5ml centrifuge tube and weigh cutting with the gel of object fragment, adding the sol solutions of 3 times of volumes in 60 DEG C of incubation 10min, during this time continuous jog; After gel melts completely, be all drawn to and reclaim in post, place a moment; Room temperature, 12000rpm, centrifugal 30sec, abandons solution; In post, add 700 μ l rinsing liquids, under 12000rpm, centrifugal 1min, abandons rinsing liquid; In post, add the rinsing liquid of 500 μ l, in the centrifugal 1min of 12000rpm, abandon rinsing liquid; Void column, 12000rpm, centrifugal 2min; Recovery post is uncapped and is dried 1-2min, puts into new clean 1.5ml centrifuge tube, adds 40 μ l aqua sterilisas or the EB damping fluid of 60 DEG C of preheatings, places 2min; The centrifugal 1min of 12000rpm, contains the object fragment of recovery in gained solution.

The connection of 1.4 object fragments and Transformed E .coli DH10B

(1) connect: the object fragment of above-mentioned recovery is connected with pEasy-T1simple carrier.Linked system needs 1 μ lpEasy-T1simple carrier, and 4 μ l PCR reclaim the ratio of products (containing object fragment 100～200ng), mixes rear of short duration centrifugally, connects 20min in 25-30 DEG C.Obtain recombinant plasmid for reaction below.

(2) transform: recombinant chou transforms and uses thermal shock method Transformed E .coli DH10B (reagent is purchased from Ding Guo Bioisystech Co., Ltd, Beijing).Under aseptic condition, draw in the 1.5ml Eppendorf pipe that 100 μ l competent cells add pre-cold sterilization, add 10 μ l to connect products (recombinant plasmids in 1.4), mix gently, be placed in immediately 30min on ice; Heat shock 90sec in 42 DEG C of waters bath with thermostatic control; Ice bath 5min; Add 800 μ l not containing antibiotic LB liquid nutrient medium, mix, 60min is cultivated in 37 DEG C of vibration recoveries; Of short duration centrifugal collection thalline, with the resuspended thalline of 150 μ l LB liquid nutrient medium, goes on the LB solid plate containing microbiotic Amp, X-gal, IPTG, with aseptic spreading rod coating; Flat board is placed to 30min in 37 DEG C of forwards and be absorbed to liquid, inversion is dull and stereotyped, and in 37 DEG C of cultivation 16h, observation flat board has blue bacterial plaque in vain and occurs.Hickie is for the qualification work of positive recombinant below.

The qualification of 1.5 positive recombinants

(1) white colony that first contains recon by alkaline lysis method of extracting

The single bacterium colony of picking white, access is containing in the 3ml LB liquid nutrient medium of microbiotic Amp (50mg/L), and 12-16h is cultivated in 37 DEG C of concussions; Centrifugal 30sec under 12000rpm, abandons supernatant afterwards; The solution I that adds 100 μ l ice precoolings makes thalline fully resuspended on vortice; Add 200 μ l solution II, immediately centrifuge tube is slowly put upside down for several times to ice bath 10min; Add the solution III of 150 μ l ice precoolings, slowly put upside down centrifuge tube for several times until white precipitate fully forms, ice bath 10min; The centrifugal 3min of 12000rpm, gets supernatant and proceeds in new centrifuge tube, adds 2 times of volume 95% ethanol, and after mixing, room temperature leaves standstill 3min; The centrifugal 3min of 12000rpm, makes plasmid DNA precipitation; Abandon supernatant, get 200 μ l TE solution dissolution precipitations; The 5mol/L LiCl solution that adds the precooling of equal-volume ice, ice bath 5min, precipitates a large amount of RNA; 12000rpm, centrifugal 3min; Shift supernatant in another centrifuge tube, add 95% ethanol of 2 times of volumes, after mixing, leave standstill 3min in room temperature, the centrifugal 3min of 12000rpm makes plasmid precipitation; After abandoning supernatant, use 1ml70% washing with alcohol precipitation, abandon most liquid; After drying at room temperature, get the TE solution dissolution precipitation of 20 μ l containing RNaseA (20 μ g/ml), 37 DEG C of water-bath 60min digest remaining RNA; Cumulative volume is supplemented to 200 μ l by TE solution, adds isopyknic phenol-chloroform-primary isoamyl alcohol, the 10min that fully vibrates, the centrifugal 5min of 12000rpm; Get supernatant, add isopyknic chloroform-primary isoamyl alcohol, repeat above operation; Get supernatant, add the 3mol/L sodium-acetate (pH5.3) of 1/10 volume and the dehydrated alcohol of 2 times of volumes, after mixing, place after 15min for-20 DEG C, the centrifugal 3min of 12000rpm makes plasmid precipitation; Abandon supernatant 1ml70% washing with alcohol precipitation, abandon liquid, with 40 μ l sterilized water dissolution precipitations.The plasmid that extracts for endonuclease reaction below.

(2) enzyme is cut checking recombinant plasmid

Endonuclease reaction system is as follows:

Recombinant plasmid 16 μ l

EcoRI 2μl

10×Buffer 2μl

Above-mentioned reaction system is mixed and the centrifugal 1min of 5000rpm, and 37 DEG C of water-baths spend the night, and then carry out 1% TAE agarose gel electrophoresis detection, found that extracted plasmid size meets the expection length of institute's clone gene.

1.6cDNA order-checking and unnamed gene

Enzyme is cut to the positive list bacterium colony that checking is correct and shake and spend the night with the liquid LB that contains Amp (50mg/L), then serve the order-checking of Hai Boya Bioisystech Co., Ltd, obtain full-length gene cDNA sequence as shown in sequence table SEQ ID No.1.

Analyze through NCBI blast, have the similarity of conserved sequence with the methionine sulfoxide reductase gene M srA4 in Arabidopis thaliana and paddy rice source, preliminary designation is wheat methionine sulfoxide reductase gene TaMsrA4.1.

Embodiment 2, in Arabidopis thaliana, TaMsrA4.1 is carried out to functional verification

The structure of 2.1 plant over-express vectors

(1) design primer: pSTART carrier is common binary vector, and the T-DNA sequence that it contains, through Agrobacterium-mediated Transformation, can be incorporated in the genome of Arabidopis thaliana, and great expression.According to its physical map and restriction endonuclease sites, forward primer increases Xba I, and reverse primer increases BamH I, and design primer increases:

TaMsrA4.1-F-PSTART：5'TCTAGAATGCCTCCCCTCCTCACCTCAC 3'

TaMsrA4.1-R-PSTART：5'GGATCCTCCATAGCAGCGGATGGGG 3'

(2) PCR reacts and is connected and transforms: except reaction masterplate is the recombinant plasmid that contains TaMsrA4.1, reaction system and condition are with 1.3 (1); Electrophoresis reclaims the method for object fragment with 1.3 (2); Reclaim after fragment is connected with pEasy-T1 and transform intestinal bacteria, plasmid is identified and extracted to positive recombinant.Connection and method for transformation are with 1.4, and positive recombinant qualification and plasmid extraction method are with 1.5;

(3) cloned plasmids and pSTART empty carrier plasmid carry out enzyme with corresponding suitable restriction endonuclease and cut (on primer, introducing), reclaim carrier linear fragment and object fragment after electrophoresis; Enzyme blanking method is with 1.5, and the recovery of fragment is with 1.3 (2).

(4) use T4DNA ligase goal gene to be connected into the pSTART empty carrier cutting; Method of attachment is with 1.4.

(5) connect product heat shock method Transformed E .Coli DH10B competent cell; Method for transformation is with 1.4.

(6) enzyme of positive recombinant is cut verification method with 1.5.

The dicotyledons expression vector called after pSTART-TaMsrA4.1 building.

2.2 plant expression vectors transform Agrobacterium

(1) Agrobacterium competence is prepared in aseptic technique: the Agrobacterium GV3101 depositing that goes bail for is inoculated in 10ml YEP liquid nutrient medium, and 28 DEG C of shaking tables spend the night; Be inoculated in 50ml YEP liquid nutrient medium by 1 ︰ 50 afterwards, 28 DEG C of shaking culture 3-4 hour, to OD ₆₀₀value is 0.4-0.6; 4 DEG C, 4200rpm, centrifugal 10min, collects thalline; Abandon supernatant, add the NaCl suspension thalline of the 0.15M of 10ml precooling; 4 DEG C, 4200rpm, centrifugal 10min, collects thalline; Abandon supernatant, add the CaCl of the 20mM of 2ml precooling ₂suspension thalline, is sub-packed in 1.5ml centrifuge tube, existing with or add final volume 7%DMSO after liquid nitrogen flash freezer-80 DEG C save backup.

(2) under aseptic technique, carry out Agrobacterium-mediated Transformation: 10 μ l plant expression carrier plasmid DNA are added in the competent cell of 50 μ l, flick centrifuge tube and mix, ice bath 30min; Liquid nitrogen flash freezer 1min; Then 37 DEG C of water-bath 5min, immediately ice bath 2-3min; Add 1ml YEP substratum, cultivate 2-4h for 28 DEG C; Room temperature, 4000rpm, centrifugal 3min, collects thalline; Bacterium is coated and contained on corresponding antibiotic YEP culture plate, be inverted for 28 DEG C and cultivate 48h.

(3) PCR of positive bacterium colony checking: use bacterium colony round pcr, reaction system as follows (20 μ l):

Amplification condition:

After reaction finishes, PCR product detects at 0.8%TAE agarose gel electrophoresis, and result shows that PCR product length is consistent with inserted gene TaMsrA4.1 length.

2.3 flower-dipping method arabidopsis thaliana transformations

First Col-0 Arabidopis thaliana seed subject to sterilization is put into 1.5ml centrifuge tube, add the ethanol concussion sterilizing 1min of 1ml75%, then twice each 1min of ethanol sterilizing of 70%, is drawn onto seed on aseptic filter paper and dries with suction nozzle afterwards, is clicked and entered in 1/2MS substratum afterwards with sterilizing toothpick; During to bolting 1cm, top is cut to induce the generation of adnation inflorescence; Transforming the day before yesterday, getting the Agrobacterium that contains expression vector plasmid that 1ml activate and be added in the 40ml YEP substratum that contains corresponding microbiotic and 50 μ g/ml Rifampins, 28 DEG C of concussions are cultured to OD ₆₀₀be about 1.0-1.2; Room temperature, 4200rpm, centrifugal 10min, collects thalline, with the resuspended thalline of dip-dyeing solution (5% sucrose, 0.05%Silwet L-77), makes OD ₆₀₀be about 0.8; The Agrobacterium that contains recombinant plasmid is dripped on inflorescence with pipettor, after infecting, immediately Arabidopis thaliana is put into vacuum drier and vacuumize 1min; Cover inflorescence with freshness protection package, cultivate and within one day, cut off top and expose inflorescence in 20-22 DEG C of lucifuge, then cultivate after one day and throw off freshness protection package, be cultured to seed maturity.

The acquisition of 2.4 transgenosis pure lines

To the T of results ₀carry out surface sterilization for seed, then evenly coat (containing corresponding microbiotic kantlex) on 1/2MS flat board.Vernalization treatment moves into phytotron growth after 3 days.Sprout approximately 10 days, cotyledon is still that green plant is transfer-gen plant, not genetically modified withered and yellow even dead (Fig. 2).Transfer-gen plant is proceeded in soil to cultivating and growing to gathering in the crops individual plant T ₁for seed, seed that every strain is collected continues screening, and offspring is separated after transplanting than the positive plant that is 3: 1 (positive: feminine gender) and grows to results T ₂for seed, after individual plant sowing, the seed that every strain is collected can be sheerly through screening.The RT-PCR of 2.5 transfer-gen plants detects

The synthetic method of the extraction of the total RNA of plant and cDNA the first chain is with reference to 1.1 and 1.2.The RT-PCR primer sequence of TaMsrA4.1 gene is as follows:

TaMsrA4.1-RT-F：5'CCACCCCCTCCTCCTCGTC 3'

TaMsrA4.1-RT-R：5'TGGCGATTGGGCGTGGTC 3'

CDNA the first chain that reverse transcription is obtained suitably dilutes and carries out normal pcr amplification as template, as internal reference, adds following material with the gene TaActin of single copy constitutive expression in 200 μ l centrifuge tubes:

Mix system centrifugal, put into PCR instrument and carry out PCR reaction.

PCR response procedures:

Utilize afterwards 1% agarose electrophoretic analysis PCR result, detected result, as shown in figure (3), shows successfully to have obtained transgenic line.

2.6 different salt concn were processed expression Arabidopis thaliana

By the Arabidopis thaliana wild-type (WT) after sterilizing and turn TaMsrA4.1 and cross the seed of expressing system (OE) and put respectively on 1/2MS solid medium, unglazed cultivations 3-4d at 4 DEG C, after be transferred to vertically cultivation 3d of 22 DEG C of illumination boxs; Preparation is added with the 1/2MS solid medium of the NaCl (0,80mM, 130mM) of different concns; Long root 0.8～1cm and the consistent seedling that grows are moved into vertically cultivation in different salt concn 1/2MS solid mediums, require each culture dish to comprise that contrast wild-type and two independently cross that to express be seedling, cultivate and take pictures after 10d and to add up root long, experiment repetition 3 times.

Result shows, crosses expression system and compares with wild-type, has significantly strengthened the resistance (Fig. 4) to salt stress under 80mM and 130mM concentration NaCl.

Embodiment 3, in wheat Jinan 17, cross expression methionine sulfoxide reductase TaMsrA4.1

3.1 seed sterilizings: get Jinan 17 seeds, with 75% alcohol immersion 1min, aseptic washing 3～4 times, then soaks 10min, aseptic washing 3～4 times with 0.1% mercuric chloride on Bechtop.

3.2 vernalization treatment: the seed after sterilizing is placed in the aseptic triangular flask of the 100mL that contains appropriate sterilized water, spend the night at 28 DEG C of 100rpm shaking tables, and the seed showing money or valuables one carries unintentionally is placed at the bottom of culture dish with on ultrapure water saturated filter paper; Put into afterwards 4 DEG C of refrigerators and secretly cultivate surrounding, treat that coleoptile length to 1～3cm can cut seedling and infect.

The structure of 3.3 expression vectors and conversion Agrobacterium: utilize pSTART carrier construction, method, with 2.1, has just been replaced 35S promoter by ubiquitin promotor.Transform the qualification of Agrobacterium and positive bacteria with 2.2.

3.4 transformed wheats: the Agrobacterium activation that contains plant expression vector: cut first 3～4 days activated spawn (substratum: 10mLYEP+5 μ L Kan+50 μ L Rifampin) of seedling: 20mL substratum+50～100 μ L bacterium liquid → guarantor bacterium (dense white) is used in activation for the first time; Activate for the second time and cutting seedling evening before that day, will activate for the first time rear bacterium liquid 450 μ L+40～60mL substratum with 100mL triangular flask and spend the night to shake to OD and be slightly larger than 1.0.Get 1ml and be activated to OD _6ooreach 1.0 Agrobacterium bacterium liquid, the centrifugal 30s of 10000rpm, adds Syringylethanone to make its final concentration reach 200 μ M after abandoning supernatant, adds sterilized water 10ml, is placed in for subsequent use on ice.Cut seedling and Agrobacterium-mediated Transformation: first by the seedling of coleoptile length to 1～3cm cutter from root starts, cut sth. askew and expose seedling stem end vegetative point; Then draw 4 μ L bacterium liquid with microsyringe, drip in the vegetative point exposing; Seedling after treatment is placed in to the culture dish of own sterilizing, incubated at room temperature is transplanted in soil to wheat stalwartness, before plant blossom, every strain wheat head is carried out to bagging isolation.

Determining of the positive strain of 3.5 transgenic wheats: the extraction (CTAB method) of (1) plant genomic dna to be measured: T ₁～T ₂while growing to 3～4 leaf for transformed wheat, clip 3-5cm blade, uses liquid nitrogen grinding powdered after shredding blade, is transferred to immediately in 1.5ml centrifuge tube, then adds the CTAB Extraction buffer of 700 μ l65 DEG C, is placed in 65 DEG C of water bath heat preservation 2h, frequently puts upside down and mixes.Add afterwards isopyknic phenol: atmosphere is imitative: primary isoamyl alcohol (25: 24: 1), the centrifugal 10min of 10000g at 4 DEG C.Liquid phase is transferred in a clean centrifuge tube, adds isopyknic chloroform: primary isoamyl alcohol (24:1), the centrifugal 10min of 10000g at 4 DEG C.Supernatant is transferred in a clean centrifuge tube, adds two volumes dehydrated alcohol, gentleness mixes, and places 30min precipitation DNA for-20 DEG C.At 4 DEG C, the centrifugal 10min of 10000g, discards liquid, and by 70% washing with alcohol twice, after drying at room temperature DNA, adds 100 μ l RNA enzyme liquid, 37 DEG C of water-bath 30min.Add 200 μ l dehydrated alcohols, gentleness mixes, and places 30min precipitation DNA for-20 DEG C.4 DEG C of centrifugal 10min of 10000rpm, discard liquid, and by 70% washing with alcohol twice, after drying at room temperature DNA, add 40 μ l sterilized water dissolving DNAs, and 4 DEG C of preservations are stand-by.(2) PCR method detects positive transfer-gen plant, and Bian screens with GUS primer:

GUSr:GACAGCAGCAGTTTCATCAATC

GUSf:ATCCCACTATCCTTCGCAAG

PCR reaction system (20 μ l):

Pcr amplification condition:

After reaction finishes, reaction solution detects (Fig. 5) in 1%TAE agarose gel electrophoresis, has carried out correlated inheritance analysis according to electrophoresis result, has obtained positive wheat pure lines.

3.6 cross the analysis of expression salt tolerance of wheat: with 1/2Hoagland liquid nutrient medium (formula is in table 1) cultivation JN17 (contrast), the transgenosis different with two crossed and expressed is OE1 and OE2, under 22 DEG C of long day (the dark 18h of illumination 16h/) condition, cultivate, until material grow to two leaves select wholeheartedly time growth consistent carry out different concns NaCl (0,100mM, 150mM) process see after 2 weeks upgrowth situation and statistics root long, root is long tests in triplicate.Result, as table 2, can find out under the condition that there is no salt stress, and it is that all well-grown and root length do not have significant difference that contrast and two cross expression; Under the condition of different concns salt processing, cross the growth of expressing system and be significantly better than contrast, cross the root length of expressing system than wild-type obvious difference, experimental result illustrates that the cross table of this gene in wheat strengthened the ability of the anti-salt of wheat.

Table 1:1/2Hogland liquid culture based formulas is as follows:

Table 2: cross the long analysis of root under salt is processed of expression wheat

Claims (4)

1. a grow wheat methionine sulfoxide reductase gene TaMsrA4.1, is characterized in that: the nucleotide sequence of described gene cDNA is as shown in SEQ ID No.1.

2. wheat methionine sulfoxide reductase gene TaMsrA4.1 as claimed in claim 1, is characterized in that: described wheat is that wheat is melted on mountain No. 3.

3. the application of wheat methionine sulfoxide reductase gene TaMsrA4.1 in raising plant salt resistance described in claim 1.

4. application as claimed in claim 3, is characterized in that: described plant is wheat or Arabidopis thaliana.