CN103937888B - Differentiate screening and the application of the blood plasma microRNA mark of gastric cancer - Google Patents
Differentiate screening and the application of the blood plasma microRNA mark of gastric cancer Download PDFInfo
- Publication number
- CN103937888B CN103937888B CN201410148251.4A CN201410148251A CN103937888B CN 103937888 B CN103937888 B CN 103937888B CN 201410148251 A CN201410148251 A CN 201410148251A CN 103937888 B CN103937888 B CN 103937888B
- Authority
- CN
- China
- Prior art keywords
- mir
- gastric cancer
- microrna
- mirna
- hsa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses screening and the application of a kind of blood plasma microRNA mark differentiating gastric cancer；MicroRNA data to be measured, for being used in combination cel miR 39 as outer ginseng and miR 16 as internal reference, are normalized, and then improve qRT PCR data reliability by described screening.And based on the method, screening obtains blood plasma microRNA biomarker miR 19b, miR 671 5p and miR 101.Wherein, miR 19b with miR 671 5p, can be as the mark of gastric cancer screening for distinguishing normal and having the most by stages and the patients with gastric cancer of difference differentiation degree.Especially miR 671 5p distinguishes early gastric cancer patient and normal person for specificity, therefore can be as the markers characteristic of early gastric cancer diagnosis.And miR 101 is used for distinguishing preoperative and postoperative patients with gastric cancer, can be as gastric cancer Prognosis mark.
Description
Technical field
The present invention relates to medical science and molecular diagnosis field, particularly relate to a kind of blood plasma microRNA mark differentiating gastric cancer
The screening of thing and application.
Background technology
Gastric cancer is one of modal malignant tumor of digestive tract of China, occupies the first place of China's mortality of malignant tumors.At present,
Diagnosing gastric cancer is still with iconography, scope, histopathology for Main Diagnosis method.But clinical diagnosis is many when finding gastric cancer is
In late period, the therapeutic effect such as routine operation, chemotherapy, radiotherapy is not good enough, poor prognosis, and it is low early to examine recall rate, and detection process need to be to patient
It is aided with contrast agent, or patient is caused wound.And by means of the diagnostic method of tumor markers, to some extent solve
State problem.It is now recognized that relatively there is the diagnosing gastric cancer tumor markers of clinical value mainly to have carcinoembryonic antigen (CEA) and saccharide to resist
Former (CA19-9, CA72-4) etc., diagnosis and clinical treatment to gastric cancer have definite meaning, but its sensitivity and specificity are the most relatively
Low.So, the most still lack the Noninvasive stomach cancer marker of clinical value, examine realizing gastric cancer highly sensitive, specific
Disconnected, and detect for prognosis.And recently circulate the appearance of miRNA marker, for gastric cancer examination, early examine, prognosis and prediction are opened
Ward off new approach.
MicroRNA is the endogenous non-coding small RNA molecular that a class length is about 21nt, and it can be by volume non-with mRNA3 '
Exact complementarity pairing between code district UTR (Untranslated region), after cutting mRNA molecule so that it is degraded；Or
By the non-precision complementary pairing between mRNA molecule, participate in the expression of regulation and control mRNA.Multiple microRNA can work in coordination with
Regulate and control a mRNA, or a miRNA also can affect multiple target gene simultaneously, thus form the regulation and control net of a high complexity
Network, and then affect from molecule to cell again to a series of biological functions of tissue level.Particular, it is important that miRNA is with swollen
The generation development of tumor is closely related.MiRNAs is commonly located in the genome area that tumor is relevant, as occur loss of heterozygosity or
On the tiny area of amplification, or the broken site that generally exists and fragile site, and as carcinogenic miRNA or press down cancer miRNA, logical
Cross the unconventionality expression of miRNA self, work in tumor occurs.Additionally, miRNA is not only present in the middle of cell or tissue,
It also can be stable in the presence of in the middle of peripheral blood and body fluid.And it is reported that miRNA expression map relatively mrna expression collection of illustrative plates can be more
Accurately cancer is classified.(Meyer S.U., Pfaffl M.W.and Ulbrich S.E.Normalization
Strategies for microRNA profiling experiments:a ' normal ' way to a hidden layer
ofcomplexity?Biotechno1.Lett., 2010.32 (12): 1777-1788.) thus, miRNA is expected to become new cancer
Disease biomarker, for diagnosis and the prognosis of cancer.
In recent years, the screening study of cancer miRNA marker is in the ascendant.Researcher generally utilizes chip or high-flux sequence
High flux characteristic, in conjunction with high sensitivity and the specificity of qRT-PCR, from tissue samples or blood (include whole blood, serum or
Blood plasma) in sample, screening has obtained substantial amounts of miRNA marker, for diagnosis or the prognosis of cancer.Even if for cancer of the same race
Disease, different research groups, the miRNA marker difference that screening obtains is the biggest.On the one hand, can be subject to due to miRNA express spectra
Many factors affects, and one of influence factor is type and the quantity choosing sample during screening.For one, sample type is same
Property is the highest, and sample size is the biggest, and miRNA expression is the most stable, and correspondingly, difference miRNA the selection result is the most reliable.Group
Knit the more difficult acquisition of sample, the especially tissue samples of clinical cancer patient to be more difficult to obtain, so its sample size is extremely difficult to hundred
More than example；And blood sample, either whole blood, or serum or blood plasma, all it is easier to obtain, therefore is easier to reach large sample amount.This
Outward, tissue samples individual variation is relatively big, the tumor of different tissue sources, the different differentiation shapes of the most same tissue-derived tumor
State, its miRNA expression map is all not quite similar.In addition, sample of tissue is the biggest with psychological wound at physiology to patient, therefore
Limit its application in miRNA marker screening.And peripheral blood is owing to its sampling is simple, noinvasive, in addition, in peripheral blood
MiRNA molecule may transport other positions of health by blood circulation, and affects the cell system at this, and then finally
Cause cancer development (Cortez M.A.and Calin G.A.MicroRNA identification in plasma and
Serum:a new tool to diagnose and monitor diseases.Expert Opinion on
Biological Therapy, 2009.9 (6): 703-711.), i.e. it is likely in peripheral blood, comprise cellular and tissue-pathology and becomes
The omen miRNA molecule changed.So peripheral blood is more suitable as the samples sources of miRNA marker screening.Especially serum or
Plasma sample does not contains hemocyte than whole blood sample, thus its miRNA expressing information will not be by cell line and cell differentiation
Impact (the Buchsbaum D.J.and Croce C.M.Will detection of microrna biomarkers of difference
in blood improve the diagnosis and survival of patients with pancreatic
cancer?JAMA:the j ournal of the American MedicalAssociation, 2014.311 (4): 363-
365.), thus simplify the explanation to miRNA marker screening difference source, and beneficially screening obtains more structurally sound
MiRNA marker.
On the other hand, utilize qRT-PCR measure miRNA expression time, the most not yet find generally acknowledged reference miRNA and
Corresponding data normalization method.Therefore, the method for some researcher absolute quantitation, walk around and choose bottleneck with reference to miRNA, and
By drawing standard curve, directly the absolute concentration of miRNA to be measured is measured.The method of this absolute quantitation, has spirit
The advantages such as sensitivity is high, highly reliable, but owing to being limited by the standard curve range of linearity, it is easy to cannot give in once experiment
Go out the concentration of a certain miRNA to be measured in actual biological specimen, and experiment need to be repeated, after the standard substance of change respective concentration gradient,
Redeterminate.Additionally, often measure batch one miRNA, it is necessary for same batch and measures the miRNA of the same race of one group of gradient concentration,
Thus considerably increase mensuration sample aperture quantity and reagent consumption, take time and effort and consume money.As fully visible, absolute quantitation is uncomfortable
Screening in large sample amount multiple miRNA candidate markers.Relative quantification is owing to avoiding drafting standard curve, and thus
The problems brought, therefore, in large sample amount mark screens, many these methods of employing.Reference is selected during relative quantification
The condition of miRNAs is: first, and each reference miRNA belongs to different functional categories, has few common regulation the most to each other
Function, such as small nuclear rna U6, and little kernel RNAU24 and U26 (Mestdagh P., VanVlierberghe P, De WeerA.,
Muth D., Westermann F., Speleman F.A novel and universal method for microRNA
RT-qPCR data normalization.Genome Biology,2009.10(6).).Second, different cells, tissue or
Between individuality, expression is consistent.As the reference microRNA of current more use has miR-16 (Reid G, Kirschner
M.B.and van Zandwijk N.Circulating microRNAs:Association with disease and
potential use as biomarkers.Critical Reviews in Oncology Hematology,2011.80
(2): 193-208.).But the research report also having, miR-16 express in circulating exist individual variation (Konishi H.,
Ichikawa D., Komatsu S., Shiozaki A., Tsujiura M., Takeshita H.Detection of
gastric cancer-associated microRNAs on microRNA microarray comparing pre-and
Post-operative plasma.British Journal of Cancer, 2012.106 (4): 740-747.).Also grind
Study carefully to be reported in serum and cannot detect that U6,5S etc. are with reference to miRNA (Liu R., Zhang C.N., Hu Z.B., Li G, Wang
C., Yang C.H.A five-microRNA signature identified from genome-wide serum
microRNA expression profiling serves as a fingerprint for gastric cancer
Diagnosis.Eur.J.Cance r, 2011.47 (5): 784-791.).Mitchell etc. utilize nonmammalian first
MiRNA, the most beautiful new hidden rhabditida (Caenorhabditis elegans) miRNAs:cel-miR-39, celmiR-54, and
Cel-miR-238, adds it in the middle of the plasma sample after degeneration liquid processes, and then as with reference to miRNA, subsequently
Data processing, takes three kinds and inserts with reference to the meansigma methodss of miRNA as normalization factor, enter miRNAqRT-PCR data to be measured
Row normalization (Mitchell.Circulating microRNAs stable blood-based markers for
Cancer detection.Proc.Natl.Acad.Sci.U.S.A., 2008.105 (30): 10513.).But outside Cha Ruing
Source reference miRNA is only capable of reflecting from the deviation in RNA extractive process and qRT-PCR operating process, but cannot reflect from sample
This endogenous biological difference own, thus the relative quantification of miRNA can not be carried out well.To this end, the suggestion such as Zampetaki will
The interior miRNAs that sample itself is expressed is used in combination with the outer miRNAs of the synthesis being inserted in sample, as reference miRNA,
QRT-PCR data are normalized (Zampetaki A.and Mayr M.Analytical challenges and
technical limitations in assessing circulating MiRNAs.Thrombosis and
Haemostasis, 2012.108 (4): 592-598.).The method can reflect in plasma sample strictly according to the facts with interior miRNAs
The expression of miRNA, can monitor whole experimentation by the outer miRNAs inserted again, thus obtain more structurally sound treating
Survey the expression of miRNA.But existing large sample cancer difference miRNA screening study, the most still uses single type reference
MiRNA carries out relative quantification, thus leverages the reliability of its selection result.
Summary of the invention
It is an object of the invention to overcome above-mentioned the deficiencies in the prior art, it is provided that a kind of blood plasma microRNA differentiating gastric cancer
The screening of mark and application.Particularly as follows: data normalization method when a kind of qRT-PCR detection microRNA is provided, and
And having obtained new gastric cancer blood plasma microRNA biomarker based on the method screening, it can be used for differentiation and has difference by stages
Patients with gastric cancer with different differentiation degrees.The qRT-PCR data normalization method that the present invention provides is microRNA biological marker
Thing screening provides reliable approach, and the new microRNA biomarker that the present invention obtains based on the screening of this method is gastric cancer
Early screening and pre-front Prognosis are laid a good foundation.
It is an object of the invention to be achieved through the following technical solutions:
First aspect, the present invention relates to the data normalization method of a kind of qRT-PCR detection microRNA, with cel-
MiR-39, as outer ginseng, simultaneously using miR-16 as internal reference, takes the meansigma methods of the two, microRNA data to be measured is carried out normalizing
Change processes；Wherein, the sequence of cel-miR-39 as shown in SEQ ID NO:1, the sequence of hsa-miR-16 such as SEQ ID NO:2 institute
Show.
Second aspect, the present invention relates to the microRNA biology of a kind of detection gastric cancer obtained according to above-mentioned method screening
Mark, described biomarker is sequence hsa-miR-101 as shown in SEQ ID NO:3, sequence such as SEQ ID NO:4 institute
Any one in the hsa-miR-19b, the sequence hsa-miR-671-5p as shown in SEQ ID NO:5 that show.
The third aspect, the present invention relates to the microRNA biomarker of a kind of above-mentioned detection gastric cancer in preparation gastric cancer
Purposes in diagnostic reagent, described biomarker be sequence hsa-miR-19b as shown in SEQ ID NO:4 or sequence such as
Hsa-miR-671-5p shown in SEQ ID NO:5.
Preferably, described has-miR-19b is for diagnosis and examination late period or low differentiation gastric cancer；Described hsa-miR-671-
5p is for diagnosis and examination relatively early stage or differentiated gastric cancer.
Fourth aspect, the present invention relates to the microRNA biomarker of a kind of above-mentioned detection gastric cancer in preparation gastric cancer
Purposes in Prognosis reagent, described biomarker is sequence hsa-miR-101 as shown in SEQ ID NO:3, preferably
Ground, described hsa-miR-101 is used for distinguishing preoperative and postoperative gastric cancer patient.
5th aspect, the present invention relates to a kind of diagnostic kit for detecting gastric cancer, and described test kit includes specificity
Detect the reagent of microRNA biomarker as claimed in claim 2.
Preferably, described test kit also includes the reverse transcription premixed liquid TaqMan of Applied Biosystems company
MicroRNA Reverse Transcription Kit (SKU:4366596) and neck ring reverse transcriptase primer, TaqMan probe and
QPCR primer TaqMan microRNA assay (SKU:4427975, the analysis number of each microRNA is shown in Table 1),
The qPCR premixed liquid GoTaq Probe qPCR Master Mix of Promega company (2 ×, P/N:A6101).
Table 1 microRNA measures the article No. of TaqMan microRNA assay used
| MIMAT | No. ID | |
| cel-miR-39 | 0000010 | 200 |
| hsa-miR-16 | 0000069 | 391 |
| hsa-miR-101-3p | 0000099 | 2253 |
| hsa-miR-19b | 0000074 | 396 |
| hsa-miR-671-5p | 0003880 | 197646_mat |
| hsa-miR-21-5p | 0000076 | 397 |
In the present invention, first, miRNA to be measured is carried out relative by the method using external source comparison to combine with endogenous control
Quantitatively.Wherein, external source comparison is the nonmammalian miRNAcel-miR-39 of synthesis, adds it to through the process of degeneration liquid
In the middle of sample to be tested (such as blood plasma or cell suspension), then carry out Total RNAs extraction and qRT-PCR reaction；Endogenous control is document
In common mir-16 (Reid G., Kirschner M.B.and van Zandwiik N.Circulating
MicroRNAs:Association with disease and potential use as biomarkers.Critical
Reviews in Oncology Hematology, 2011.80 (2): 193-208.).Obtain Ct value through qRT-PCR, take the two
Meansigma methods, miRNA data to be measured are normalized.
Second, said method is respectively used to cell miRNA detection and large sample amount blood plasma miRNA detects, test further
Demonstrate,prove its feasibility.Wherein, cell miRNA detects the stomach cancer cell of the process LAN mir-101 having selected this laboratory to build
MGC803；And large sample amount blood plasma miRNA is detected, on the one hand, select the gastric cancer blood plasma miRNA mark of oneself report in document
Thing miR-21 as detection target, verify data normalization method provided by the present invention can detect miR-21 in gastric cancer and
Difference between normal plasma sample, on the other hand, reference miRNA (cel-used in the large sample amount statistical analysis present invention
MiR-39 and mir-16) differential expression between group in group, the stability of checking reference used miRNA itself.
3rd, the present invention devises the multistage, case-comparative study is screened for gastric cancer blood plasma microRNA mark.
Mainly chip and qRT-PCR are combined, first with the high flux characteristic of cDNA microarray, from full microRNA group, right
Patients with gastric cancer and normal inter-sample difference carry out primary dcreening operation.On this basis, strengthen sample size, utilize qRT-PCR high specific high
The characteristic of sensitivity, from difference microRNA that primary dcreening operation obtains, carries out dusting cover to patients with gastric cancer and normal inter-sample difference.?
After, still with qRT-PCR, in difference microRNA that two benches screening obtains, to poor between gastric cancer preoperative and postoperative sample in the past
Different screen.
Compared with prior art, beneficial effects of the present invention is as follows:
First, the present invention establishes the data normalization side that a kind of reliable large sample amount microRNA qRT-PCR measures
Method.The method relatively only carrying out data normalization with single internal reference, in the present invention, method had both avoided single reference miRNA not
The impact screened difference miRNA with differential expression between individuality, in turn ensure that RNA extracting, qRT-PCR experiment and blood plasma RNA
The integral monitoring of endogenous difference, thus improve the reliability of experimental result on the whole.
Second, the present invention according to above-mentioned data normalization method, has obtained new blood plasma through the screening of large sample amount first
MicroRNA mark miR-19b and miR-671-5p, it can be used for diagnosing gastric cancer, wherein, miR-19b be suitable to examination late period or
Low differentiation patients with gastric cancer, and miR-671-5p is suitable to examination relatively early stage or differentiated patients with gastric cancer, and miR-671-5p can conduct
The Specific marker of early gastric caacer diagnosis.
3rd, the present invention has obtained a new blood plasma microRNA according to above-mentioned data normalization method through screening first
Mark miR-101, it is expected to be used for gastric cancer Prognosis.
4th, the circulation miRNA marker that screening obtains, relatively conventional gastric cancer detection method, in gastric cancer screening and detection
In little to person under inspection's wound and checked operation is easy；Additionally, compare protein marker, it is highly sensitive, and high specificity can be used for
Early stage or the diagnosis of different differentiation degree gastric cancer.
Accompanying drawing explanation
By the detailed description non-limiting example made with reference to the following drawings of reading, the further feature of the present invention,
Purpose and advantage will become more apparent upon:
Fig. 1 is to insert the qRT-PCR amplification curve (A) of gradient concentration external source cel-miR-39 and corresponding Ct value in blood plasma
(B)；
Fig. 2 be cell miR-101 process LAN miR-101 Gastric cancer line 101, Gastric cancer line and
Expression in normal gastric mucosa cell strain GES；
Fig. 3 is blood plasma miR-21 expression in difference Patients with Gastric Cancer by stages and normal person and difference thereof；
Fig. 4 is blood plasma cel-miR-39 and miR-16 expression in Patients with Gastric Cancer and normal person and difference thereof；
Fig. 5 is hierarchical clustering figure and the Vean diagram of twice array experiment data of array experiment data screening difference miRNA
Solve；
Fig. 6 is that by stages and different differentiation degree patients with gastric cancer is with normal at different TNM for blood plasma miR-19b and miR-671-5p
Expression in people and difference thereof；
Fig. 7 is blood plasma miR-19b and the miR-671-5p ROC curve for diagnosis of gastric cancer；
Fig. 8 be blood plasma miR-101 in the preoperative with the expression in postoperative gastric cancer patient and difference thereof.
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is described in detail.Following example will assist in the technology of this area
Personnel are further appreciated by the present invention, but limit the present invention the most in any form.It should be pointed out that, the ordinary skill to this area
For personnel, without departing from the inventive concept of the premise, it is also possible to make some deformation and improvement.These broadly fall into the present invention
Protection domain.
Embodiment 1, blood plasma insert the determination of external source cel-miR-39 concentration
(1) blood plasma RNA extracting
Take same plasma sample, to without the 1.5mL centrifuge tube of RNase is separately added into 200 μ L blood plasma.Subsequently, according to behaviour
Explaining, carry out RNA extracting with mirVana Paris Kit (SKU:AM1556, Ambion), step is slightly modified as follows: to
After blood plasma adds 2 × degeneration liquid, sequentially add 2.5 μ L concentration and be respectively 0.005, the cel-miR-39 of 0.05,0.5,5 μM
Solution, is subsequently added phenol chloroform mixed liquor and is centrifuged, and again adds phenol chloroform mixed liquor and enter in the aqueous phase of gained upper strata
Row mixing is centrifugal, finally, processes water with the DEPC of 100 μ L95 DEG C preheating and carries out eluting.
(2) qRT-PCR measures cel-miR-39
Reverse transcription:
With TaqMan MicroRNA Reverse Transcription Kit (SKU:4366596, Applied
Biosystems) reverse transcription is carried out.It is pre-configured with the reverse transcription premixed liquid system of 77.0 μ L, wherein containing 1.7 μ L100mM
DNTPs, 11 μ LMultiscribe Reverse-Transcriptase (50U μ L-), 16.5 μ L10 × Reverse-
Transcription Buffer, 2.1 μ LRNase-Inhibitor (20U μ L-, 45.7 μ L nuclease-free water).
Pipette 4.66 μ L reverse transcription premixed liquids, 3.34 μ LRNA extracting solution and 2 μ L RT gene-specific primer the most successively
(SKU:4427975, TaqMan microRNA assay, Applied Biosystems), obtaining final volume after mixing is 10 μ L
Reaction system.Reactant mixture is placed in PCR instrument (Long Gene) and reacts as follows: 16 DEG C of 30min, 42 DEG C
30min, 85 DEG C of 5min.Gained cDNA the first chain is placed in 4 DEG C of preservations.
QPCR:
Add after 57.8 μ L dilute without enzyme water standby in above-mentioned gained 10 μ LcDNA solution.Successively by 16.5 μ LGoTaq
Probe qPCR Master Mix (2 ×, P/N:A6101, Promega), 1.65 μ L gene-specific primer/
Probe (SKU:4427975, TaqMan microRNA assay, Applied Biosystems), 14.85 μ LcDNA diluents
Mixing, obtains the reactant liquor that final volume is 33 μ L.Subsequently by every hole 10 μ L, 3 multiple holes, 96 orifice plates are loaded.Model will be added
It is placed in BioRad-iQ5 and reacts as follows: 95 DEG C of 10min (denaturation), subsequently 95 DEG C of 15s, 60 DEG C of 1min, carry out 40 and follow
Ring.
(3) result
After inserting the outer ginseng cel-miR-39 of variable concentrations in blood plasma, its amplification curve and corresponding Ct value are as shown in Figure 1.
As shown in Figure 1, along with the concentration of cel-miR-39 is from 0.005 μM, with 1 order of magnitude for interval, when being stepped up 5 μMs, its
Amplification curve the most progressively moves, and correspondingly, Ct value is gradually lowered from big to small.When the concentration of cel-miR-39 is
When 0.5 μM, corresponding Ct value is 20.97, suitable as with reference to Ct value, so adding 2.5 μ in the every 200 μ L blood plasma of final choice
The cel-miR-39 of L0.5 μM.
Embodiment 2, cell microRNA detect
(1) cell RNA extracting
First, build and cultivate the Gastric cancer line 101 of process LAN miR-101, cultivate stomach cancer cell line simultaneously
MGC803 and normal gastric mucosa epithelial cell strain GES-1.Wherein, the stomach cancer cell line of process LAN miR-101 is by this laboratory certainly
Building, process is as follows: first, builds hsa-miR-101 Lentiviral.Expand from the DNA of HEK293T cell extraction
Increase the 490bp fragment expressing miR-101, be cloned on pCDH1-CMV-MCS-EF1a-GFP-T2A-Puro expression vector, simultaneously
Negative control Negative control is set；The primer taked is as follows:
PCR primers:
MiR-101-1F:CCTGAATTCATTCTAATTTAATTCAACTGG (SEQ ID NO:7)
MiR-101-1R:TATGGATCCTCAGCACAACATGGCTGCAC (SEQ ID NO:8)
(restriction enzyme site: EcoRI/BamHI)
Second, pack lentiviral particle.Use Ji Man company test kit (GM easyTM slow virus package kit) packaging
Having the lentiviral particle of has-miR-101 sequence, the cell line of packaging slow virus uses HEK293T (Invitrogen), receives
Collection virus ,-80 DEG C of storages；3rd, utilize slow virus expression system construction stably to express the cell line of hsa-miR-101
MGC803.MGC803 cell line (Chinese Academy of Sciences's Shanghai cell bank) is infected, by slow virus carrier certainly by the lentiviral particle packed
The puromycin selection markers of band carries out screening the cell of the hsa-miR-101 obtaining stable expression.Gastric cancer line
And normal gastric mucosa epithelial cell strain GES-1 is purchased from the Chinese Academy of Sciences Shanghai cell bank (Zheng, B.Q., et
al.MicroRNA-148a Suppresses Tumor Cell Invasion and Metastasis by
Downregulating ROCK1in Gastric Cancer.Clinical Cancer Research, 2011.17 (24):
7574-7583.)。
Subsequently, peek mesh is about 105Above-mentioned three kinds of cells, according to operating instruction, with mirVana Paris Kit
(SKU:AM1556, Ambion) carries out RNA extracting, and step is slightly modified as follows: the cell after PBS of learning from else's experience, and adds 200 μ L
Cytopathy liquid is resuspended and vortex, is subsequently added into 200 μ L2 × degeneration liquid, adds the cel-miR-39 solution of 2.5 μ L0.5 μM,
It is subsequently added phenol chloroform mixed liquor to be centrifuged, gained upper strata aqueous phase adds phenol chloroform mixed liquor again and mixes
Centrifugal, finally, process water with the DEPC of 100 μ L95 DEG C preheating and carry out eluting.
(2) qRT-PCR measures miR-101
Reverse transcription and qPCR step are shown in that qRT-PCR described in embodiment 1 measures cel-miR-39, simply only do when qPCR
2 multiple holes.
(3) qRT-PCR reaction obtains the Ct value of external source comparison cel-miR-39, is designated as Ctex, endogenous control miR-16 obtains
Ctin, microRNA to be measured obtains Cttar, according to 2-ΔΔCtMethod calculates microRNA to be measured relative comparison in test sample test
The expression ratio of sample control, formula is as follows:
△ Ct (test)=Cttar-Ave Ct(Ctex, Ctin)
△ Ct (control)=Cttar-Ave Ct(Ctex, Ctin)
△△Ct=△Ct(test)-△Ct(control)
Expression ratio FC (test/conctrol)=2-ΔΔCt
(4) result
According to data normalization method provided by the present invention, obtain expression such as Fig. 2 of miR-101 in three kinds of cells
Shown in.From Figure 2 it can be seen that the Gastric cancer line 101 of process LAN miR-101, Gastric cancer line and normal gastric are viscous
The normalization Ct value of theca cell strain GES-1 be respectively-4.26,7.59 and 2.36, first two cell relative to GES cell, its miR-
101 expressions are 98.19 and 0.0266, i.e. measurement result has high-caliber really in showing the MGC803101 cell built
MiR-101 expresses, and MGC803 cell is relative to GES cell, and its miR-101 expression is lowered, and exists with document report miR-101
In stomach cancer cell down-regulated expression consistent (Varambally S., Cao Q., Mani R.S., Shankar S., Wang X.,
Ateeq B.Genomic loss ofmicroRNA-101leads to overexpression ofhistone
Methyltransferase EZH2in cancer.Science, 2008.322 (5908): 1695-9.).Visible, the present invention carries
The normalized of qRT-PCR data when cell miRNA measures is may be used for for method.
Embodiment 3, large sample amount blood plasma microRNA detect
(1) blood plasma RNA extracting
Take plasma sample, to without the 1.5mL centrifuge tube of RNase adds 200 μ L blood plasma.Subsequently, according to operating instruction, use
MirVana Paris Kit (SKU:AM1556, Ambion) carries out RNA extracting, and step is slightly modified as follows: add in blood plasma
After 2 × degeneration liquid, add the cel-miR-39 solution that 2.5 μ L concentration are 0.5 μM, be subsequently added phenol chloroform mixed liquor and enter
Row is centrifugal, and again adding phenol chloroform mixed liquor in the aqueous phase of gained upper strata, to carry out mixing centrifugal, finally, with 100 μ L95 DEG C preheating
DEPC process water carry out eluting.
(2) qRT-PCR measures miR-21
MiR-21 sequence is as shown in SEQ ID NO:6.Its reverse transcription step is shown in that qRT-PCR described in embodiment 1 measures
cel-miR-39。
QPCR:
Take above-mentioned gained 10 μ L cDNA solution, draw 3 μ L, retain standby.2.5 μ L are added to remaining in 7 μ LcDNA solution
Use for follow-up qPCR after the dilution of water without enzyme.Successively by 10.5 μ L GoTaq Probe qPCR Master Mix (2 ×, P/
N:A6101, Promega), 1.05 μ L gene-specific primer/probe (SKU:4427975, TaqMan
MicroRNA assay, Applied Biosystems), 9.45 μ LcDNA diluent mixing, obtaining final volume is the anti-of 21 μ L
Answer liquid.Subsequently by every hole 10 μ L, 2 multiple holes, 96 orifice plates are loaded.To add model be placed in BioRad-iQ5 carry out following anti-
Should: 95 DEG C of 10min (denaturation), subsequently 95 DEG C of 15s, 60 DEG C of 1min, carry out 40 circulations.
(3) data process and statistical analysis
For qRT-PCR data, the data normalization method using the present invention to provide, use independent sample Mann-Whitney
The difference of normalization Ct value between gastric cancer and normal sample is compared in U inspection, it is believed that P < 0.05 i.e. has significant difference.
(4) result
Randomly select 19 example gastric cancer (GC) and normal (N) plasma sample of 22 examples, according to data normalizing provided by the present invention
Change method, obtains its miR-21 expression as shown in Figure 3.Wherein, TNM is the gastric cancer plasma sample of II phase and III phase by stages
T2 and T3 has 7 examples and 12 examples respectively, its relatively 22 example normal plasma samples, and normalization Ct value shows as lower mediation respectively and raises, and
Statistical analysis obtains P value respectively P=0.032 and P=0.012 of two groups of gastric cancer samples and normal inter-sample difference, has statistics
Learn meaning, i.e. TNM II phase Patients with Gastric Cancer calibration ordinary person's miR-21 up-regulated (FC=1.62), and TNMIII phase Patients with Gastric Cancer
MiR-21 down-regulated expression (FC=0.28).
MiR-21 acts not only as the mark of multiple entity tumor, it is also possible to as the tumor markers in circulating
(Mo M.-H., Chen L, Fu Y., Wang W.and Fu S.W.Cell-free Circulating miRNA
Biomarkers in Cancer.Journal ofCancer, 2012.3:432-448.).And have document to be reported in patients with gastric cancer
In blood plasma, miR-21 expression higher than normal person (Tsujiura M., Ichikawa D., Komatsu S., Shiozaki A.,
Takeshita H., Kosuga T.Circulating microRNAs in plasma of patients with
Gastric cancers.British Journal of Cancer, 2010.102 (7): 1174-1179.).According to the present invention
The data normalization method provided, obtaining TNMII phase Patients with Gastric Cancer has the miR-21 of high expressed, consistent with having been reported, table
Large sample amount blood plasma miRNA qRT-PCR data can be normalized by bright the method effectively.But TNMIII phase stomach
Carninomatosis people's miR-21 down-regulated expression, is not inconsistent with existing document, checking further of still needing.
Embodiment 4, large sample amount compare with reference to miRNA differential expression
Randomly select 61 example gastric cancer (GC) and normal (N) plasma sample of 40 examples, according to blood plasma described in embodiment 3
MicroRNA detection method, measures two groups of sample China and foreign countries ginseng cel-miR-39 and the expression of internal reference miR-16, such as Fig. 4 institute
Show.Wherein, cel-miR-39 Average Ct values in gastric cancer and normal sample is respectively 15.04 and 15.19, and miR-16 is respectively
23.14 and 22.13, and two kinds of Average Ct values ave (c39, h16) with reference to miRNA are respectively 18.92 and 18.66, two kinds of references
MiRNA belongs to the miRNA of middle high expression level, is applicable to data normalization.Gastric cancer is compared with normal through one factor analysis of variance
Between sample, the Ct value difference with reference to miRNA is different, and the P value obtaining cel-miR-39, miR-16 and ave (c39, h16) is respectively
0.760,0.021 and 0.548.Think that P < 0.05 i.e. has significant difference, it is seen that the reference miRNA that other document is conventional
MiR-16 differential expression between gastric cancer and normal sample group has significance, show only with miR-16 as being to pay no attention to reference to miRNA
Think, because one of condition of desired reference miRNA is exactly stable expression (Zampetaki A.and Mayr between Different Individual
M.Analytical challenges and technical limitations in assessing circulating
MiRNAs.Thrombosis and Haemostasis.2012.108 (4): 592-598.).And insert external source cel-miR-39
And with average ave (c39, h16) of miR-16, its P value is all higher than 0.05, i.e. expresses stable between two groups.The visible present invention
The data normalization method provided, i.e. takes two kinds of expression averages with reference to miRNA for reference to Ct value, both having avoided single ginseng
Examine the miRNA impact that difference miRNA is screened by differential expression between Different Individual, in turn ensure that to RNA extracting, qRT-PCR in fact
Test the integral monitoring of difference endogenous with blood plasma RNA, thus improve the reliability of qRT-PCR experimental data, be more beneficial for full-page proof
This amount screening difference miRNA.
Embodiment 5, cDNA microarray gastric cancer and normal inter-sample difference miRNA
By Shanghai Biotechnology Corporation with two Agilent micro-array chip Human miRNA18.0 and
19.0 have successively carried out high flux miRNA respectively to two batch samples expresses mensuration, expression map drafting, cluster analysis and difference
Express miRNA screening.First batch sample is 7 example gastric cancer and 8 example normal plasma samples, and the second batch is 9 example gastric cancer and 10 examples
Normal plasma sample.Collected sample is mainly provided by Xi'an Tang Dou hospital, all through the informed consent of participant.Numbering is respectively
For the two batch array experiment of BH13053 and BH13333, according to p < 0.05, difference miRNA that screening obtains is divided through hierarchical clustering
Analysis, obtains thermal map, as shown in Figure 5.The two screens respectively and obtains 50 and 51 differences miRNA, wherein, 5 difference miRNA phases
With, as shown in Venn Diagram.These 5 miRNA are respectively hsa-miR-19b-3p, hsa-miR-3162-5p, hsa-miR-
4466, hsa-miR-4532, hsa-miR-671-5p.In twice array experiment, it is poor that it is expressed between gastric cancer and normal group
Different P value and fold differences are aggregated into table 2 below.Wherein, only hsa-miR-19b-3p expression in gastric cancer is less than normal
People, other 4 kinds of miRNA expressions are above normal person.In conjunction with document, select hsa-miR-19b-3p and hsa-miR-671-
Two kinds of miRNA of 5p are used for follow-up qRT-PCR confirmatory experiment.
Twice array experiment of table 2 screens same difference miRNA obtained and expresses between patients with gastric cancer and normal person
The P value of difference and fold differences
Note: expression refers to the gastric cancer group ratio relative to normal group miRNA signal value.
Embodiment 6, qRT-PCR large sample amount screening gastric cancer and normal inter-sample difference miRNA
Randomly select 58 example gastric cancer and 37 example normal plasma samples, detect according to blood plasma microRNA described in embodiment 3
Hsa-miR-19b and corresponding reference microRNA cel-miR-39 and hsa-miR-16 is detected by method.Select the most at random
Take 55 example gastric cancer and 36 example normal plasma samples, according to blood plasma MicroRNA detection method described in embodiment 3 to hsa-miR-
671 and corresponding reference microRNA cel-miR-39 and hsa-miR-16 detect, and wherein, only qPCR step is amended as follows:
Add in above-mentioned gained 10 μ L cDNA solution after 4.0 μ L dilute without enzyme water and use for follow-up qPCR.Successively by 15.65 μ L
GoTaq Probe qPCR Master Mix (2 ×, P/N:A6101, Promega), 1.56 μ L gene-specific
Primer/probe (TaqMan microRNA assay, SKU:4427975, Applied Biosystems), 14.0 μ LcDNA
Diluent mixes, and obtains the reactant liquor that final volume is 31. μ L.Subsequently by every hole 10 μ L, 3 multiple holes, 96 orifice plates are loaded.Will
Add model to be placed in BioRad-iQ5 and react as follows: 95 DEG C of 10min (denaturation), subsequently 95 DEG C of 15s, 60 DEG C of 1min, enter
Row 40 circulates.
The data of miR-19b and miR-671-5p qRT-PCR are entered by the data normalization method provided according to the present invention
Row normalization, obtains the two expression in gastric cancer and normal sample as shown in Fig. 6 and Biao 3.From Fig. 6 and table 3,
MiR-19b Ct value overall compared with normal sample in gastric cancer sample is higher, and the average normalized Ct value of two groups of samples is respectively 8.909
With 8.027, correspondingly, its expression ratio of relatively normal sample in gastric cancer sample is 0.543, down-regulated expression.And
MiR-671 Ct value compared with normal sample in gastric cancer sample is on the low side, and the average normalized Ct value of the two is respectively 14.120 Hes
14.849, its expression ratio of relatively normal sample in gastric cancer sample is 1.66, up-regulated.Use independent sample
The difference of two kinds of miRNA normalization Ct values between gastric cancer and normal sample is compared in Mann-Whitney U inspection.Obtain P value to be respectively
0.000 and 0.020, it is believed that P < 0.05 i.e. has significance, it is seen then that miR-19b and miR-671-5p expresses between two groups of samples
Variant.Wherein, miR-19b is down-regulated expression in gastric cancer, and miR-671-5p is up-regulated in gastric cancer, can be used for distinguishing gastric cancer
With normal plasma sample.
Analyze two kinds of miRNA further by stages poor with different differentiation degree patients with gastric cancer and the expression of the normal human world in difference
Different, obtain miR-19b and be IV phase and gastric cancer differentiation degree is that in PD gastric cancer sample, compared with normal sample is lowered at TNM by stages
Degree is maximum, respectively 0.427 and 0.399；And miR-671-5p is differentiated for II phase and gastric cancer differentiation degree at TNM by stages
Gastric cancer sample in compared with normal sample to raise degree maximum, respectively 3.32 and 2.23, and it is III at TNM by stages, IV phase and
Gastric cancer differentiation degree be low differentiation and in PD gastric cancer sample the expression difference in compared with normal sample not there is system
Meaning learned by meter, and therefore, the miR-671-5p that present invention screening obtains is on TNM differentiates for I, II phase and middle differentiated gastric cancer by stages
There is certain specificity.
Table 3 miR-19b and miR-671 is at different TNM table by stages and in different differentiation degree patients with gastric cancer and normal person
Reach level and difference thereof
Note: GC refers to that patients with gastric cancer, N are made a comment or criticism ordinary person；Ave ACt refers to the gastric cancer sample of corresponding kind and quantity or normal sample
The meansigma methods of normalization Ct value, 2-aveΔΔCtRefer to that in corresponding kind normal sample relative with the gastric cancer sample of quantity, miRNA expresses water
The meansigma methods of flat ratio, wherein, data normalization method and expression ratio calculation method see embodiment 2.T1-4 refers to stomach
Cancer TNM is respectively I, II, III and IV phase by stages；D1-4 refer to gastric cancer differentiation degree be respectively low differentiation, in low differentiation, middle differentiation
And differentiated." * " refers to, according to Mann-Whitney U check analysis result, be merged together by the patients with gastric cancer of D3 with D4 and carry out
Statistical analysis；"-" refer to as into normal control its without P value；P value the most only retains to arithmetic point three, and NS refers to Mann-Whitney
U check analysis shows do not have significant difference.
For passing judgment on miR-19b and the miR-671-5p feasibility as diagnosing gastric cancer mark further, the present invention draws
Recipient's operating characteristic curve (ROC curve), by area under curve (AUC) and the index evaluation such as sensitivity, specificity two
Plant the diagnostic of miRNA.Wherein, choosing point corresponding when sensitivity is maximum with specificity sum is optimal threshold point,
Result is as shown in Fig. 7 and Biao 4.
From Fig. 7 and table 4, miR-19b with miR-671-5p can be used for distinguishing different by stages with difference differentiation degrees
Gastric cancer sample and normal inter-sample difference.Wherein, miR-19b is when diagnosis of gastric cancer patient and normal human world difference, and its ROC is bent
Under line, area AUC is 0.75, and when taking threshold value and being 7.818, the detection sensitivity of this index is 0.879, and specificity is 0.514.
Meanwhile, its can be additionally used in diagnosis TNM by stages for I, II, III, IV phase and gastric cancer differentiation degree be low differentiation, in low differentiation, in point
Changing the gastric cancer sample with differentiated and normal inter-sample difference, wherein, IV phase and PD gastric cancer sample have the AUC of maximum
Value, respectively 0.865 and 0.848, and the diagnostic sensitivity of the two the most all reach more than 0.8.Visible, miR-19b is well suited to sieve
Look into late period or low differentiation patients with gastric cancer.
And miR-671 is when diagnosis of gastric cancer patient and normal human world difference, under its ROC curve, area AUC is 0.644,
When taking threshold value and being 14.2, the detection sensitivity of this index is 0.806, and specificity is 0.473.Meanwhile, it can be additionally used in diagnosis
TNM is I, II phase and gastric cancer sample that gastric cancer differentiation degree is middle differentiation and differentiated and normal inter-sample difference by stages, for
Late period or in PD gastric cancer sample, the diagnostic of miR-671-5p is not satisfactory, with Mann-Whitney U inspection knot
Fruit is consistent, does not provides corresponding sensitivity and specificity in table.And for II phase or differentiated gastric cancer sample, miR-671-5p has
There is a bigger AUC, respectively 0.861 and 0.854, and the two diagnostic sensitivity and specificity the most all reach more than 0.8.Can
Seeing, miR-671-5p is suitable to examination relatively early stage or differentiated patients with gastric cancer.
When table 4 is respectively with miR-19b and miR-671-5p for diagnosis index, the two diagnosis difference breaks up journey with difference by stages
Degree patients with gastric cancer and the usefulness of normal human world difference
Note: GC refers to patients with gastric cancer；T1-4 refers to that classifying gastric cancer TNM is respectively I, II, III and IV phase；D1-4 refers to that gastric cancer is broken up
Degree be respectively low differentiation, in low differentiation, middle differentiation and differentiated." * " refers to according to Mann-Whitney U check analysis result,
The patients with gastric cancer of D3 Yu D4 is merged together the ROC curve drawing miR-19b as diagnosis index."-" refers to according to Mann-
Whitney U check analysis result, due to during with miR-671-5p for diagnosis index, the patients with gastric cancer of T3, T4, D1 and D2 with just
Between ordinary person, difference is not notable, therefore does not provides corresponding sensitivity and specificity.
Embodiment 7, qRT-PCR screen gastric cancer preoperative and postoperative inter-sample difference miRNA
Randomly select 21 pairs of gastric cancer preoperative and postoperative pairing plasma samples, according to blood plasma described in embodiment 3 and embodiment 6
MicroRNA detection method is to hsa-miR-101, hsa-miR-19b, hsa-miR-671-5p and corresponding reference microRNA
Cel-miR-39 and hsa-miR-16 detects.The data normalization method Ct to two kinds of miRNA provided according to the present invention
Value is normalized, and obtains its expression, and compares the difference between preoperative and postoperative pairing plasma sample with Wilcoxon inspection,
Thinking that p < 0.05 i.e. has significant difference, the P value only obtaining miR-101 is less than 0.05, is 0.039, and difference has significance,
Other two kinds of miRNA, i.e. miR-19b and the miR-671-5p P value between two groups of samples is more than 0.05, and difference does not have statistics
Meaning.The expression of miR-101 as shown in Figure 8, the average normalized Ct value of miR-101 in preoperative and postoperative gastric cancer plasma sample
It is divided into two bunches, respectively in the range of 2～4 and 12～13.The postoperative difference △ △ Ct with preoperative normalization Ct value of miR-101
(pos-pre) mostly be on the occasion of, it is seen then that in down regulation trend in miR-101 patients with gastric cancer after surgery.
Above the specific embodiment of the present invention is described.It is to be appreciated that the invention is not limited in above-mentioned
Particular implementation, those skilled in the art can make various deformation or amendment within the scope of the claims, this not shadow
Ring the flesh and blood of the present invention.
Claims (4)
1. the data normalization method microRNA biology mark in selective mechanisms gastric cancer detecting microRNA with qRT-PCR
Purposes in will thing, it is characterised in that using cel-miR-39 as outer ginseng, simultaneously using miR-16 as internal reference, takes the flat of the two
Large sample amount blood plasma microRNA data to be measured are normalized by average；Wherein, the sequence of cel-miR-39 such as SEQ
Shown in ID NO:1, the sequence of hsa-miR-16 is as shown in SEQ ID NO:2；Described data normalization method is used for screening gastric cancer
MicroRNA biomarker, and for the purpose of not being the diagnosis to obtain disease and therapeutic outcome.
Purposes the most according to claim 1, it is characterised in that described data normalization method is used for stomach cancer cell miRNA
The normalized of qRT-PCR data during mensuration；Detection sequence is the hsa-miR-101 shown in SEQ ID NO:3, detects cell
For the Gastric cancer line of process LAN miR-101, Gastric cancer line and normal gastric mucosa epithelial cell strain GES-
1。
Purposes the most according to claim 1, it is characterised in that described data normalization method is used for large sample amount gastric cancer blood
The normalized of slurry microRNA qRT-PCR data；Detection sequence is the hsa-miR-21 shown in SEQ ID NO:6.
Purposes the most according to claim 1, it is characterised in that the biomarker filtered out is sequence such as SEQ ID NO:
Hsa-miR-19b as shown in SEQ ID NO:4 of hsa-miR-101 shown in 3, sequence, sequence are as shown in SEQ ID NO:5
Any one in hsa-miR-671-5p.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410148251.4A CN103937888B (en) | 2014-04-14 | 2014-04-14 | Differentiate screening and the application of the blood plasma microRNA mark of gastric cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410148251.4A CN103937888B (en) | 2014-04-14 | 2014-04-14 | Differentiate screening and the application of the blood plasma microRNA mark of gastric cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103937888A CN103937888A (en) | 2014-07-23 |
| CN103937888B true CN103937888B (en) | 2016-08-17 |
Family
ID=51185755
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410148251.4A Active CN103937888B (en) | 2014-04-14 | 2014-04-14 | Differentiate screening and the application of the blood plasma microRNA mark of gastric cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103937888B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200157B (en) * | 2015-11-04 | 2018-11-09 | 中国人民解放军总医院 | The blood plasma miRNA biomarker combinations of gastric cancer, its application and early gastric caacer diagnostic kit |
| CN107557467B (en) * | 2017-08-10 | 2021-05-11 | 李永东 | Clinical marker related to cerebral aneurysm and application thereof |
| TWI688655B (en) * | 2017-11-06 | 2020-03-21 | 高雄醫學大學 | Application of glycine n-methyltransferase knockout mouse model of high-throughput sequencing for identifying micrornas as novel biomarker and kit of cancer and liver disease |
| CN108424962B (en) * | 2018-05-25 | 2021-08-03 | 中国人民解放军陆军军医大学 | MiRNA detection marker for mesangial proliferative glomerulonephritis and diagnostic kit thereof |
| CN115537466A (en) * | 2019-04-30 | 2022-12-30 | 觅瑞实验室私人有限公司 | miRNA marker combination and kit for detecting gastric cancer |
| CN111621573A (en) * | 2020-07-27 | 2020-09-04 | 江苏省苏北人民医院 | Gastric cancer differentiation related marker miRNA composition and chip and application thereof |
| CN112071369B (en) * | 2020-09-10 | 2021-08-03 | 暨南大学附属第一医院（广州华侨医院） | Module marker mining method and device, computer equipment and storage medium |
| CN114085902B (en) * | 2022-01-19 | 2022-05-31 | 中南大学湘雅二医院 | Application of reagent for detecting miR-671-5p in human serum exosome and osteoporosis detection kit |
| CN115261482B (en) * | 2022-10-08 | 2022-12-09 | 暨南大学 | Application of miR-4256 in treatment, diagnosis and prognosis evaluation of gastric cancer |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101755208A (en) * | 2007-07-25 | 2010-06-23 | 路易斯维尔大学研究基金会公司 | Allochthon associated microRNA as diagnostic marker |
| CN101988059A (en) * | 2009-07-30 | 2011-03-23 | 江苏命码生物科技有限公司 | Gastric cancer detection marker and detecting method thereof, kit and biochip |
| WO2012040500A2 (en) * | 2010-09-22 | 2012-03-29 | Hoon Dave S B | Direct blood assay for detection of circulating microrna in cancer patients |
| CA2833389A1 (en) * | 2011-04-18 | 2012-10-26 | Diamir, Llc | Mirna-based universal screening test (ust) |
| EP2623598A1 (en) * | 2007-10-04 | 2013-08-07 | Santaris Pharma A/S | Micromirs |
| US8512951B2 (en) * | 2006-01-05 | 2013-08-20 | The Ohio State University | Methods for diagnosing stomach cancer using MicroRNAs |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009143379A2 (en) * | 2008-05-21 | 2009-11-26 | Fred Hutchinson Cancer Research Center | Use of extracellular rna to measure disease |
-
2014
- 2014-04-14 CN CN201410148251.4A patent/CN103937888B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8512951B2 (en) * | 2006-01-05 | 2013-08-20 | The Ohio State University | Methods for diagnosing stomach cancer using MicroRNAs |
| CN101755208A (en) * | 2007-07-25 | 2010-06-23 | 路易斯维尔大学研究基金会公司 | Allochthon associated microRNA as diagnostic marker |
| EP2623598A1 (en) * | 2007-10-04 | 2013-08-07 | Santaris Pharma A/S | Micromirs |
| CN101988059A (en) * | 2009-07-30 | 2011-03-23 | 江苏命码生物科技有限公司 | Gastric cancer detection marker and detecting method thereof, kit and biochip |
| WO2012040500A2 (en) * | 2010-09-22 | 2012-03-29 | Hoon Dave S B | Direct blood assay for detection of circulating microrna in cancer patients |
| CA2833389A1 (en) * | 2011-04-18 | 2012-10-26 | Diamir, Llc | Mirna-based universal screening test (ust) |
Non-Patent Citations (4)
| Title |
|---|
| Identification of Suitable Reference Genes for qPCR Analysis of Serum microRNA in Gastric Cancer Patients;Jianning Song et al;《Dig.Dis.Sci.》;20111225;1-7 * |
| MicroRNA-101 is down-regulated in gastric cancer and involved in cell migration and invasion;Hui-Ju Wang et al;《EUROPEAN JOURNAL OF CANCERR》;20100831;第46卷(第12期);2295-2303 * |
| Plasma miR-601 and miR-760 Are Novel Biomarkers for the Early Detection of Colorectal Cancer;Qifeng Wang et al;《PLOS ONE》;20120930;第7卷(第9期);1-2 * |
| 胃癌石蜡包埋组织的miRNA实时荧光定量PCR表达;吴晓斌等;《现代肿瘤医学》;20091025(第10期);1853-1856 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103937888A (en) | 2014-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103937888B (en) | Differentiate screening and the application of the blood plasma microRNA mark of gastric cancer | |
| Yokoi et al. | A combination of circulating miRNAs for the early detection of ovarian cancer | |
| Yang et al. | Serum microRNA signature is capable of early diagnosis for non-small cell lung cancer | |
| Liu et al. | Analysis of miR-205 and miR-155 expression in the blood of breast cancer patients | |
| Frères et al. | Circulating microRNA-based screening tool for breast cancer | |
| Zhang et al. | Prognostic and predictive value of a microRNA signature in stage II colon cancer: a microRNA expression analysis | |
| Shi et al. | Serum miR-626 and miR-5100 are promising prognosis predictors for oral squamous cell carcinoma | |
| Khare et al. | Plasma microRNA profiling: Exploring better biomarkers for lymphoma surveillance | |
| Wang et al. | Diagnostic and prognostic value of circulating miR-21 for cancer: a systematic review and meta-analysis | |
| Wang et al. | Serum microRNA-29a is a promising novel marker for early detection of colorectal liver metastasis | |
| Gao et al. | Plasma miR-324-3p and miR-1285 as diagnostic and prognostic biomarkers for early stage lung squamous cell carcinoma | |
| Liu et al. | Blood-based liquid biopsy: Insights into early detection and clinical management of lung cancer | |
| CN102876676B (en) | Blood serum/blood plasma micro ribonucleic acid (miRNA) marker relevant with pancreatic cancer and application thereof | |
| Shah et al. | Combining serum microRNA and CA-125 as prognostic indicators of preoperative surgical outcome in women with high-grade serous ovarian cancer | |
| Chen et al. | Serum exosomal miR-34a as a potential biomarker for the diagnosis and prognostic of hepatocellular carcinoma | |
| Pei et al. | Clinically relevant circulating microRNA profiling studies in pancreatic cancer using meta-analysis | |
| CN105950753A (en) | Plasma miRNA marker relevant to lung adenocarcinoma auxiliary diagnosis and application thereof | |
| Yang et al. | Validation of a serum 4-microRNA signature for the detection of lung cancer | |
| El-Daly et al. | Circulating microRNAs as reliable tumor biomarkers: Opportunities and Challenges facing Clinical Application | |
| KR20130029079A (en) | Marker consisting of plasma microrna and a new method for diagnosis of hepatocellular carcinoma | |
| CN107881239A (en) | The miRNA marker related to colorectal cancer transfer and its application in blood plasma | |
| Liu et al. | Exosome-mediated miR-25/miR-203 as a potential biomarker for esophageal squamous cell carcinoma: improving early diagnosis and revealing malignancy | |
| Khan et al. | Potential plasma microRNAs signature miR-190b-5p, miR-215-5p and miR-527 as non-invasive biomarkers for prostate cancer | |
| CN105925703A (en) | Method for screening miRNA markers in PB (peripheral blood) of kidney cancer and kidney cancer diagnosis marker miR-210 | |
| Peng et al. | The role of circulating microRNAs for the diagnosis of hepatitis B virus-associated hepatocellular carcinoma with low alpha-fetoprotein level: a systematic review and meta-analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |