CN103709239A - Soy nuclear factor protein GmNFYB and coding gene and application thereof - Google Patents
Soy nuclear factor protein GmNFYB and coding gene and application thereof Download PDFInfo
- Publication number
- CN103709239A CN103709239A CN201310731227.9A CN201310731227A CN103709239A CN 103709239 A CN103709239 A CN 103709239A CN 201310731227 A CN201310731227 A CN 201310731227A CN 103709239 A CN103709239 A CN 103709239A
- Authority
- CN
- China
- Prior art keywords
- gmnfyb1a
- arabidopis thaliana
- plant
- seq
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a soy nuclear factor protein GmNFYB and a coding gene and an application thereof. The soy nuclear factor protein GmNFYB provided by the invention comes from soy protein (Glycine max (L.) Merrill.) Dongnong 50 and is shown in 1) or 2): 1) protein composed of amino acid residues shown in a sequence table SEQ ID NO.2; 2) protein related to plant stress tolerance, derived from 1) and obtained by substituting and/or deleting and/or adding one or a plurality of amino acid residues in the amino acid sequence of the SEQ ID NO.2. A transgenic plant prepared by the protein GmNFYB1a provided by the invention or the coding gene thereof is higher in germination rate and longer in root under drought stress/salt stress.
Description
Technical field
The present invention relates to a kind of soybean nf Protein G mNFYB and encoding gene and application, belong to biological technical field.
Background technology
The abiotic stress such as arid, saline and alkaline has a strong impact on output and the quality of crop.Resistance by genetic engineering means Crop Improvement is a kind of effective approach.The molecule mechanism of illustrating resisting abiotic stress is the prerequisite of using gene engineering improvement.Transcription factor plays very important effect in the signal conduction of abiotic stress.Soybean is as important food crop, in worldwide by establishing in large scale.Yet compare as Arabidopis thaliana, paddy rice, corn and wheat with other plant, in soybean, the relevant information research of NFYB class transcription factor is very few.Therefore, utilize biotechnology to change stress resistance of plant reaction, and then the good new variety of cultivation proterties become a kind of effective breeding method.
Summary of the invention
An object of the present invention is to provide a kind of soybean nf albumen and encoding gene thereof.
Albumen provided by the invention, called after GmNFYB1a, derives from the eastern agriculture 50 of soybean (Glycine max (L.) Merrill.), is following 1) or 2) protein:
1) protein that the amino-acid residue shown in SEQ ID NO.2 forms in sequence table;
2) by the aminoacid sequence of SEQ ID NO.2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant to plant stress tolerance by 1) derivative protein.
Above-mentioned SEQ ID NO.2 is comprised of 271 amino-acid residues, the replacement of described one or several amino-acid residue and/or disappearance and/or be added to replacement and/or disappearance and/or the interpolation that is no more than 10 amino-acid residues.
The encoding gene of above-mentioned albumen is also the scope of protection of the invention.
Described encoding gene is following 1)-5) in any DNA molecular:
1) DNA molecular shown in SEQ ID NO.1 in sequence table;
2) in sequence table SEQ ID NO.1 from the DNA molecular shown in 5 ' end 1-599 position Nucleotide;
3) in sequence table SEQ ID NO.1 from the DNA molecular shown in the Nucleotide of the 62-505 position of 5 ' end;
4) under stringent condition with 1) or 2) or 3) DNA molecule hybridize that limits and with the DNA molecular of plant stress tolerance correlative protein encoding gene;
5) with 1) or 2) or 3) DNA sequence dna that limits at least have 90% homology and with the DNA molecular of plant stress tolerance correlative protein encoding gene.
Above-mentioned SEQ ID NO.1 is comprised of 814 Nucleotide, and coding region is that SEQ ID NO.1 is from 5 ' end 62-505 position Nucleotide.
Said gene is following 1), 2) or 3) gene:
1) DNA molecular shown in SEQ ID NO.1 in sequence table;
2) in sequence table SEQ ID NO.1 from the DNA molecular shown in the Nucleotide of the 1-599 position of 5 ' end;
3) in sequence table SEQ ID NO.1 from the DNA molecular shown in the Nucleotide of the 62-505 position of 5 ' end.
The recombinant vectors that contains above-mentioned encoding gene is also within protection scope of the present invention.
Above-mentioned recombinant vectors, refers to the carrier obtaining between the Bgl II of described encoding gene insertion pCAMBIA3301 carrier and BstE II recognition site.
The application in regulating plant resistance of reverse and/or plant breeding of described albumen, encoding gene and recombinant vectors is also protection scope of the present invention.
In described method, described plant is specially dicotyledons or monocotyledons, is further specially Arabidopis thaliana or soybean.
Described pCAMBIA3301 carrier is prepared as follows: carrier pCAMBIA3301 is used to Bgl II digestion with restriction enzyme, after recovery, carry out again end smoothing purifying, re-use BstE II recovery enzyme and cut rear large fragment, expression vector pCAMBIA3301 successfully constructs.
PCAMBIA3301-NFYB1-GR vector construction: carry out BstE II endonuclease reaction and be connected with GR fragment and transform Agrobacterium successfully transforming colibacillary pCAMBIA3301-NFYB1 plasmid, vector construction completes.
In described recombinant vectors, contain promotor and the encoding gene that is connected to the GmNFYB1a albumen in described promotor downstream.Above-mentioned promotor can be following arbitrary promotor: cauliflower mosaic virus 35 S promoter and Ubiquitin promotor, be preferably cauliflower mosaic virus 35 S promoter.
Above-mentioned recombinant bacterium is for importing by above-mentioned recombinant vectors the recombinant bacterium that Host Strains obtains.
The primer pair of above-mentioned encoding gene total length or the arbitrary fragment of increasing is also the scope of protection of the invention; shown in described primer pair is specific as follows: a primer sequence is as shown in SEQ ID NO.3 in sequence table, and another primer sequence is as shown in SEQ ID NO.4 in sequence table.
In above-mentioned application, described regulating plant resistance of reverse is for improving plant stress tolerance, and described resistance of reverse is specially drought tolerance; Above-mentioned raising drought resistance in plants is to carry out under drought stress, and specifically by improving, root is long, increase germination rate embodies; Described plant is specially dicotyledons or monocotyledons, and described dicotyledons is further specially Arabidopis thaliana or soybean;
Another object of the present invention is to provide a kind of method of cultivating transgenic plant.
Method provided by the invention, comprises the steps:, into above-mentioned encoding gene is imported to object plant, to obtain transgenic plant, and the resistance of reverse of described transgenic plant is higher than described object plant.
In aforesaid method, described resistance of reverse is drought tolerance; Described object plant is specially dicotyledons or monocotyledons, and described dicotyledons is further specially Arabidopis thaliana or soybean.
Beneficial effect of the present invention: the present invention has found a new gene GmNFYB1a, is proceeded in Arabidopis thaliana or soybean, obtains turning GmNFYB1a Arabidopis thaliana or turns GmNFYB1a soybean; The long increase of root, the seed germination rate that turn after the drought resisting of GmNFYB1a Arabidopis thaliana is processed obviously increase, and can find out that this gene is relevant to plant drought resistance, can be applied to cultivate and improve the new variety of drought-resistant plant.
Accompanying drawing explanation
Fig. 1 onion epidermis cell;
(a.pCAMBIA1302-GFP transforms onion epidermis cell; B.pCAMBIA1302-GmNFYB1a-GFP fusion vector transforms c, the contrast of d. white light).
Fig. 2 T0 is for Arabidopis thaliana ppt screening figure.
Fig. 3 coerces down without DEX induction N.F,USP MANNITOL that to turn the root of GmNFYB1a and GmNFYB1a-GR gene and wild-type Arabidopsis thaliana Seedlings long;
(L a.0-200mmol
-1the root of the lower four kinds of Arabidopis thalianas for the treatment of with mannitol is long, b.150mmol L
-1the root of the lower four kinds of Arabidopis thalianas for the treatment of with mannitol is long in kind).
Fig. 4 DEX induction N.F,USP MANNITOL coerces down that to turn the root of GmNFYB1a and GmNFYB1a-GR gene and wild-type Arabidopsis thaliana Seedlings long;
(L a.0-200mmol
-1the root of the lower four kinds of Arabidopis thalianas for the treatment of with mannitol is long, b.150mmol L
-1the root of the lower four kinds of Arabidopis thalianas for the treatment of with mannitol is long in kind).
Fig. 5 coerces down without DEX induction N.F,USP MANNITOL the percentage of germination that turns GmNFYB1a Arabidopis thaliana seed.
Fig. 6 DEX induction N.F,USP MANNITOL is coerced down the percentage of germination that turns GmNFYB1a Arabidopis thaliana seed.
Fig. 7 is that transgenic plant and wild-type plant are processed the germination rate variation of lower seed to impinging upon different ABA concentration.
The different ABA concentration of Fig. 8 is processed the germination rate of lower seed.
Fig. 9 coerces down without DEX induction NaCl that to turn the root of GmNFYB1a and GmNFYB1a-GR gene and wild-type Arabidopsis thaliana Seedlings long;
(L a.0-200mmol
-1it is long that NaCl processes the root of lower four kinds of Arabidopis thalianas, b.100mmol L
-1naCl processes the long material object of root of lower four kinds of Arabidopis thalianas).
Figure 10 DEX induction NaCl coerces down that to turn the root of GmNFYB1a and GmNFYB1a-GR gene and wild-type Arabidopsis thaliana Seedlings long;
(L a.0-200mmol
-1it is long that NaCl processes the root of lower four kinds of Arabidopis thalianas, b.100mmol L
-1naCl processes the long material object of root of lower four kinds of Arabidopis thalianas).
Figure 11 coerces down without DEX induction NaCl the percentage of germination that turns GmNFYB1a Arabidopis thaliana seed.
Figure 12 DEX induction NaCl coerces down the percentage of germination that turns GmNFYB1a Arabidopis thaliana seed.
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
The acquisition of embodiment 1, GmNFYB1a
Utilize Trizol reagent extract soybean (Glycine max) (eastern agriculture 50,
wu Tianlong,
yang Qingkai,
ma Zhanfeng,
wu Zongpu,
zhao Shuwen,
gao Fenglan,
li Wenbin,
zhang Guodong,
yang Qi,
meng Qingxi,
wang Jinling. No. 1 New Soybean Variety Breeding report of eastern agriculture granule beans, [J]. Northeast Agricultural University's journal, 1994, (25) 1:104; Public Ke Cong Northeast Agricultural University obtains, once referred to as wild-type soybean) RNA in blade, the synthetic cDNA article one chain of reverse transcription is as template, with sense primer: 5'GGGTATACTTGACCAAAG3'(SEQ ID NO.3), antisense primer: 5'TTAGGTAACCCAAATTCAGGAGAAAACT3', carry out PCR reaction, PCR condition is 94 ℃ of 5min; 38 circulations: 94 ℃ of 30s, 50 ℃ of 30s, 72 ℃ of 30s; 72 ℃ of 10min.By PCR product electrophoresis detection on 1.0% sepharose, result shows that PCR product is 609bp.Through order-checking, this PCR product has SEQ ID NO.1 in sequence table from 5 ' end 1-599 position nucleotide sequence.The coding region of the gene of this PCR product is that SEQ ID NO.1 in sequence table is from 5 ' end 62-505 position Nucleotide, this unnamed gene is GmNFYB1a, the albumen called after GmNFYB1a of this genes encoding, the aminoacid sequence of this albumen is SEQ ID NO.2 in sequence table.
PCAMBIA1302-GmNFYB1a Agrobacterium infestation method transforms onion epidermis: fresh onion is cut with a knife into the fritter of 1cm * 1cm, then with tweezers, epidermis is torn and is placed on MS substratum, cultivate 24h(14h illumination, 10h is dark); To turn pCAMBIA1302-GmNFYB1a Agrobacterium and be added to YEP(containing kan, str, tri-kinds of microbiotic of rif) in while shaking OD value 0.6-0.8, draw bacterium liquid to not containing in antibiotic YEP, shake OD value 0.6-0.8, centrifugal with 50mL centrifuge tube, remove supernatant liquor, with not resuspended containing antibiotic YEP, add Syringylethanone 1mL(100 μ M); Pre-incubated onion epidermis is placed in resuspended liquid and soaks 40-60min, take out onion epidermis, thieving paper blots unnecessary bacterium liquid, is then placed on the dark 36-48h of cultivation in MS substratum: in the expression of fluorescence microscopy Microscopic observation green fluorescent protein (GFP).
The GmNFYB1a-GFP expression vector building is infected after onion epidermis, use fluorescence microscope cell, and with white light (Fig. 1) in contrast.Result shows, carries the pCAMBIA1302 of GFP gene due to not containing localization signal peptide, is therefore prevalent in nucleus and tenuigenin.And the onion epidermis cell that has proceeded to GmNFYB1a-GFP plasmid can be expressed GFP ∷ GmNFYB1a fusion rotein, on plasma membrane and nucleus, there is obvious green fluorescence, tenuigenin does not have.As mentioned above, GmNFYB1a gene is transcription factor.
One, the structure of plant expression vector pCAMBIA
Use restriction enzyme Bgl II enzyme to cut in carrier pCAMBIA3301 carrier (Australian CAMBIA company sell), recovery enzyme is 11307bp fragment after cutting, use again T4 polysaccharase by the smoothing of fragment end, after repurity, use restriction enzyme BstE II enzyme to cut, recovery enzyme is the large fragment of 9265bp after cutting, and expression vector pCAMBIA3301 has built.
The PCR product that embodiment 1 is obtained is cut through sph I enzyme, reclaim enzyme and cut rear fragment, use again T4 polysaccharase by the smoothing of fragment end, after repurity, use restriction enzyme BstE II enzyme to cut, the fragment obtaining is connected with the pCAMBIA3301 carrier segments of cutting through same enzyme, to connect product and transform intestinal bacteria, obtain transformant, extract the plasmid of transformant, send to order-checking, result is for this plasmid is for inserting from 5 ' end 1-599 position Nucleotide the recombinant vectors obtaining between the recognition site of pCAMBIA3301 by sequence in sequence table, by this recombinant vectors called after pCAMBIA-GmNFYB1a, the promotor of this carrier is CaMV35S.
Two, turn the cultivation of GmNFYB1a Arabidopis thaliana
1, turn the acquisition of GmNFYB1a Arabidopis thaliana
Adopt freeze-thaw method to be transformed in agrobacterium tumefaciens the plant expression vector pCAMBIA of above-mentioned acquisition-GmNFYB1a, the transformant obtaining extracts plasmid, send to order-checking, result for this plasmid be pCAMBIA-GmNFYB1a, by the recombinant bacterium called after LBA4404/pCAMBIA-GmNFYB1a that contains this plasmid.
Adopt agrobacterium-mediated transformation by recombinant bacterium LBA4404/pCAMBIA-GmNFYB1a infect wild-type Arabidopis thaliana (Columbia is environmental) (hereinafter to be referred as wild-type Arabidopis thaliana, Hao Lin, Xu Xin, Cao Jun. a kind of Arabidopsis Mutants is to high concentration CO
2the research of reaction, [J]. Chinese Journal of Applied Ecology, 2003, l4 (12): 2359～236. public Ke Cong Northeast Agricultural University obtain), obtain 65 strain T0 for turning GmNFYB1a Arabidopis thaliana.
1), preparation transforms the Agrobacterium bacterium liquid of use
Cotransformation Agrobacterium: connect bacterium LBA4404/pCAMBIA-GmNFYB1a 10ul:10ml inoculation in the test tube that has YEP nutrient solution.28 ℃, 220rpm shakes and spends the night, and approximately 30 hours, by shaking bacterium alive, by (1:400) and 750ul bacterium liquid, goes in 300 milliliters of YEP (RifR, StrR, KanR) substratum.The concentration of Rif (Rifampin) in substratum is 25mg/L, Str(Streptomycin sulphate) concentration in substratum is 50mg/L, the concentration of Kan (kantlex) in substratum is 50mg/L.Cultivate 28 ℃, 220rpm approximately 14 hours, surveys OD value, and YEP+Rif+StrR is as blank for use, when bacterium liquid reaches OD600, is within 1.5-3.0 time, can collect thalline in 50ml centrifuge tube (sterilizing), and 4 ℃, the centrifugal 10min of 4000g.With 5% sucrose (containing 0.02%Silwet), be diluted to OD600 and be about 0.8-1.0 left and right.Choose the above-mentioned solution 2ml preparing, fully smash the thalline of pipe bottom, then the thalline mixing is dissolved in 50ml solution, after mixing, adding Silwet (100%) 120ul final concentration is 0.02% again.
2), water: transform and the day before yesterday needs to be done to the ecotypic seedling of wild-type Arabidopis thaliana Columbia transforming and water and irrigate.
3), transform: the inflorescence of wild-type Arabidopis thaliana plant is soaked to 30s in the resuspended solution of the thalline preparing, and growth under the low light level (secretly cultivating), obtains T0 for the seedling that turns GmNFYB1a Arabidopis thaliana.
4), mark is good, the seedling that is turned to GmNFYB1a Arabidopis thaliana and 100 strain GmNFYB1a-GR 96 strain T0 generations lies against in box, upper cover sealed membrane is sealed, lucifuge is cultivated 24hrs, after 1 day, plant is erected to normal cultivation, waters.
Obtain altogether 96 strain T0 and turn GmNFYB1a-GR Arabidopis thaliana plant for turning GmNFYB1a Arabidopis thaliana plant and 100.
2, turn the evaluation of GmNFYB1a Arabidopis thaliana
1) Molecular Identification
Extract the genomic dna of the blade that 64 strain T0 generations turned GmNFYB1a Arabidopis thaliana plant as template, with primer sequence, be NFYB1, primer positive-sense strand is that 5'GGGTATACTTGACCAAAG3' antisense strand is 5'TTAGGTAACCCAAATTCAGGAGAAAACT3', and primer bar (316), positive-sense strand is that 5'ATCTCGGTGACGGGCAGGACC3' antisense strand is 5'AGGCACGCAACGCCTACGAC3', result shows: the fragment that obtains 609bp and 316bp is positive, obtain altogether the positive T0 of 40 strains for turning GmNFYB1a Arabidopis thaliana plant, transformation efficiency is 41.67%.
2) PPT screening concentration
(1) by the Arabidopis thaliana seed of wild-type, be seeded in respectively on the MS substratum containing 0mg/L, 1mg/L, 3mg/L, 5mg/L, 7mg/L, 10mg/L PPT, in culturing room, (temperature is 22 ℃ ± 2 ℃, and intensity of illumination is 0.3～0.4mmolm
-2s
-1) grow light/secretly the cycle is under 16h/8h condition, to allow it sprout, and according to sprouting result, determines the Effective selection concentration of expressing positive seedling, the PPT that result is 5mg/mL is Effective selection concentration.
(2) screening transformant
By being numbered 12,24 T0 generation, turn GmNFYB1a Arabidopis thaliana seed after 4 ℃ of subzero treatment 3d, add 10% clorox, shake up, 5-8 minute, by sterile water wash 4-5 time, is then evenly seeded in the substratum that contains 5mg/mLPPT.Move into growth room and within 6 days, observe afterwards and add up the number (Fig. 2) of the green seedling of health of growth.Normal green seedling is taken out from substratum, be placed in soil: vermiculite (3:1) is cultivated.Life cycle through about 50 days, screening obtains T1 for turning GmNFYB1a Arabidopis thaliana plant.
More than experiment shows that foreign gene GmNFYB1a has been incorporated in the genome that turns GmNFYB1a Arabidopis thaliana plant that is numbered 12,24 two strains, and on transcriptional level, obtains effectively expressing.
By being numbered the positive T0 of 12,24 two strains generation, turning the plant that seed that GmNFYB1a Arabidopis thaliana plant ties and this seed grow up to and be called T1 generation, in T1 generation, is turned to the plant that seed that GmNFYB1a Arabidopis thaliana plant ties and this seed grow up to and be called T2 generation, T2 generation is turned to the plant that seed that GmNFYB1a Arabidopis thaliana plant ties and this seed grow up to and be called T3 generation.
Three, the T3 that turns GmNFYB1a Arabidopis thaliana is for functional analysis
A: arid is processed:
1, turning GmNFYB1a Arabidopis thaliana plant changes the root of N.F,USP MANNITOL (Minnitol) Stress treatment is long
After being turned to the seed sterilizing of GmNFYB1a Arabidopis thaliana the T3 generation that is numbered 12,24 strains of above-mentioned acquisition, be seeded on MS substratum, 16h light/8h is dark, under 25 ℃ of conditions, grow, after 1 week, obtain T3 generation that 50 strains are numbered 12,24 strains and turn GmNFYB1a Arabidopis thaliana.Then in the T3 generation that is numbered 12,24 strains, is turned GmNFYB1a Arabidopis thaliana seedling transfer to respectively having or not DEX(dexamethasone) contain 0mM N.F,USP MANNITOL (N.F,USP MANNITOL) in induction situation, 100mM N.F,USP MANNITOL, 150mM N.F,USP MANNITOL, in the MS substratum of 200mM N.F,USP MANNITOL, grow, after 1 week, measure root long, the wild-type Arabidopis thaliana seedling of take is contrast with turning GmNFYB1a-GR Arabidopis thaliana seedling, tests in triplicate results averaged.Adopt the long mean change of ImageJ software (http://rsbweb.nih.gov/ij/) statistics root.
Result while inducing without DEX as shown in Figure 3,
In the MS substratum that contains 0mM N.F,USP MANNITOL:
The T3 that is numbered 12,24 strains is respectively 3.26cm, 3.62cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 3.25cm, turns the long 3.42cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 100mM N.F,USP MANNITOL:
The T3 that is numbered 12,24 strains is respectively 4.43cm, 4.11cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 2.01cm, turns the long 2.03cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 150mM N.F,USP MANNITOL:
The T3 that is numbered 12,24 strains is respectively 2.75cm, 2.81cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 1.28cm, turns the long 1.15cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 200mM N.F,USP MANNITOL:
The T3 that is numbered 12,24 strains is respectively 3.09cm, 3.06cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 1.33cm, turns the long 1.36cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
There is the result in DEX when induction as shown in Figure 4,
In the MS substratum that contains 0mM N.F,USP MANNITOL:
The T3 that is numbered 12,24 strains is respectively 5.68cm, 4.77cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 5.48cm, turns the long 4.53cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 100mM N.F,USP MANNITOL:
The T3 that is numbered 12,24 strains is respectively 3.10cm, 3.16cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 1.13cm, turns the long 3.05cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 150mM N.F,USP MANNITOL:
The T3 that is numbered 12,24 strains is respectively 3.767cm, 3.76cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 2.00cm, turns the long 3.03cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 200mM N.F,USP MANNITOL:
The T3 that is numbered 12,24 strains is respectively 2.13cm, 2.74cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 1.05cm, turns the long 2.42cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
To being numbered 12, in T3 generation of 24 strains, turns long photograph of root after the processing of GmNFYB1a Arabidopis thaliana and wild-type Arabidopis thaliana, the observation of taking pictures, result as shown in Figure 3, as can be seen from the figure, when inducing without DEX, concentration rising along with N.F,USP MANNITOL in substratum, (0mM N.F,USP MANNITOL, 100mM N.F,USP MANNITOL, 150mM N.F,USP MANNITOL, 200mM N.F,USP MANNITOL) wild-type plant and the root that turns GmNFYB1a-GR Arabidopis thaliana plant aobvious shortening kept burning day and night, and be numbered 12, the T3 of 24 strains change in concentration for turning GmNFYB1a Arabidopis thaliana plant root personal attendant: during 0mM N.F,USP MANNITOL, transgenic arabidopsis plant root length is more approaching than wild-type plant root appearance.At 100mM N.F,USP MANNITOL, 150mM N.F,USP MANNITOL, during 200mM mannitol concentration, turns GmNFYB1a gene Arabidopis thaliana plant root length compared with wild-type plant and turns GmNFYB1a-GR Arabidopis thaliana plant root length length; And when DEX induces (Fig. 4), concentration rising along with N.F,USP MANNITOL in substratum, (0mM N.F,USP MANNITOL, 100mM N.F,USP MANNITOL, 150mM N.F,USP MANNITOL, 200mM N.F,USP MANNITOL) root of wild-type plant aobvious shortening kept burning day and night, change in concentration with the T3 that turns GmNFYB1a-GR Arabidopis thaliana plant for turning GmNFYB1a Arabidopis thaliana plant root personal attendant and be numbered 12,24 strains: during 0mM N.F,USP MANNITOL, transgenic arabidopsis plant root length is more approaching than wild-type plant root appearance.At 100mM N.F,USP MANNITOL, 150mM N.F,USP MANNITOL, during 200mM mannitol concentration, turns GmNFYB1a gene Arabidopis thaliana plant and turns GmNFYB1a-GR Arabidopis thaliana plant root length long compared with wild-type plant root.The above results explanation seedling stage GmNFYB1a gene be as transcription factor regulating plant drought-resistant ability.
2. turn the germination rate of GmNFYB1a Arabidopis thaliana plant under N.F,USP MANNITOL Stress treatment
In the T3 generation that is numbered 12,24 strains and turns GmNFYB1a-GR Arabidopis thaliana plant that turns GmNFYB1a gene from above-mentioned acquisition, is turned the seed sterilizing of GmNFYB1a Arabidopis thaliana and be seeded in and have or not the 0mM N.F,USP MANNITOL of DEX induction, on the MS substratum of 150mM N.F,USP MANNITOL, 16h light/8h is dark, under 25 ℃ of conditions, grow, 100 strains of the 5th day statistics be numbered 12,24 and T3 generation of turning GmNFYB1a-GR Arabidopis thaliana strain turn the germination rate of GmNFYB1a Arabidopis thaliana seedling.With the contrast of wild-type Arabidopis thaliana seedling, each strain is 100 strains, tests in triplicate results averaged.
Result while inducing without DEX as shown in Figure 5,
In the MS substratum that contains 0mM N.F,USP MANNITOL:
The germination rate that the T3 generation that is numbered 12,24 strains turns GmNFYB1a Arabidopis thaliana is respectively 96%, 95%, and to turn GmNFYB1a-GR Arabidopis thaliana strain germination rate be 95%, and the germination rate of wild-type Arabidopis thaliana (CK) is 97%;
In the MS substratum that contains 150mM N.F,USP MANNITOL:
The germination rate that the T3 generation that is numbered 12,24 strains turns GmNFYB1a Arabidopis thaliana is respectively 89%, 93%, and to turn GmNFYB1a-GR Arabidopis thaliana strain germination rate be 61%, and the germination rate of wild-type Arabidopis thaliana (CK) is 64%;
There is the result in DEX when induction as shown in Figure 6,
In the MS substratum that contains 0mM N.F,USP MANNITOL:
It is 96%, 95% that the germination rate that the T3 generation that is numbered 12,24 strains turns GmNFYB1a Arabidopis thaliana is respectively, and turning GmNFYB1a-GR Arabidopis thaliana strain germination rate is 94%, and the germination rate of wild-type Arabidopis thaliana (CK) is 96%;
In the MS substratum that contains 150mM N.F,USP MANNITOL:
It is 89%, 93% that the germination rate that the T3 generation that is numbered 12,24 strains turns GmNFYB1a Arabidopis thaliana is respectively, and turning GmNFYB1a-GR Arabidopis thaliana strain germination rate is 90%, and the germination rate of wild-type Arabidopis thaliana (CK) is 63%;
Result shows: while inducing without DEX, under drought stress, the germination rate of transgenic arabidopsis plant is higher than wild-type plant and the germination rate that turns GmNFYB1a-GR Arabidopis thaliana plant; When DEX induces, under drought stress, transgenic arabidopsis plant with turn the germination rate of GmNFYB1a-GR Arabidopis thaliana plant higher than the germination rate of wild-type plant.Further illustrating Arabidopis thaliana seed is drought-enduring or drought resisting in seedling stage.
3, turn GmNFYB1a Arabidopis thaliana seed to dormin (ABA) Stress treatment
In the T3 generation that is numbered 12 strains of above-mentioned acquisition, is turned and sow respectively that (ABA concentration is respectively: 0 μ M ABA on the MS substratum that contains different concns ABA after the seed sterilizing of GmNFYB1a Arabidopis thaliana, 0.5 μ M ABA, 1.0 μ M ABA, 3 μ M ABA, 0.7 μ M ABA+10 μ M DEX), 16h light/8h is dark, under 25 ℃ of conditions, grows 6 days, and statistics germination rate.With wild-type Arabidopis thaliana (CK) with turn GmNFYB1a-GR Arabidopis thaliana plant for contrasting, each strain 100 strain, experiment in triplicate, results averaged.
Result is as shown in Figure 7:
When ABA concentration is 0 μ M, the germination rate that the T3 generation that is numbered 12 strains turns GmNFYB1a Arabidopis thaliana, wild-type Arabidopis thaliana and turns GmNFYB1a-GR Arabidopis thaliana is respectively 100%, 100% and 100%;
When ABA concentration is 0.5 μ M, the germination rate that the T3 generation that is numbered 12 strains turns GmNFYB1a Arabidopis thaliana, wild-type Arabidopis thaliana and turns GmNFYB1a-GR Arabidopis thaliana is respectively 84%, 100% and 87%;
When ABA concentration is 1.0 μ M, is numbered 12 strain T3 and is respectively 71%, 90% and 82% for turning GmNFYB1a Arabidopis thaliana, wild-type Arabidopis thaliana and turning GmNFYB1a-GR Arabidopis thaliana;
When ABA concentration is 3.0 μ M, is numbered 12 strain T3 and is respectively 13%, 36% and 24% for turning GmNFYB1a Arabidopis thaliana, wild-type Arabidopis thaliana and turning GmNFYB1a-GR Arabidopis thaliana;
When ABA concentration is 0.7 μ M ABA+10 μ M DEX, is numbered 12 strain T3 and is respectively 88%, 100% and 90% for turning GmNFYB1a Arabidopis thaliana, wild-type Arabidopis thaliana and turning GmNFYB1a-GR Arabidopis thaliana;
From Fig. 7 and Fig. 8, can find out, germination rate after 6 days, along with ABA concentration increases, T3 is for turning GmNFYB1a Arabidopis thaliana, turning GmNFYB1a Arabidopis thaliana and the germination rate reduction in containing the substratum of ABA of wild-type Arabidopis thaliana, but it is larger to turn the repressed degree of GmNFYB1a Arabidopis thaliana.When having or not DEX to exist, turning the variation of GmNFYB1a Arabidopis thaliana germination rate is not clearly, and the seed germination that preliminary identification turns GmNFYB1a gene Arabidopis thaliana plant is relevant with ABA.
B: salt is processed:
4, turning GmNFYB1a Arabidopis thaliana plant changes the root of sodium-chlor (NaCl) Stress treatment is long
Being turned to the seed sterilizing of GmNFYB1a Arabidopis thaliana the T3 generation that is numbered 12,24 strains from above-mentioned acquisition, be seeded on MS substratum, 16h light/8h is dark, under 25 ℃ of conditions, grow, after 1 week, obtain T3 generation that 50 strains are numbered 12,24 strains and turn GmNFYB1a Arabidopis thaliana.Then being turned to GmNFYB1a Arabidopis thaliana seedling the T3 generation that is numbered 12,24 strains transfers to and contains 0mM sodium-chlor, 50mM sodium-chlor, in the MS substratum of 75mM sodium-chlor, grow, after 1 week, measure root long, the wild-type Arabidopis thaliana seedling of take is contrast with turning empty carrier Arabidopis thaliana seedling, test in triplicate results averaged.Adopt the long mean change of ImageJ software statistics root.
Result while inducing without DEX as shown in Figure 9,
In the MS substratum that contains 0mM sodium-chlor:
The T3 that is numbered 12,24 strains is respectively 3.26cm, 3.62cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 3.25cm, turns the long 3.42cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 100mM sodium-chlor:
The T3 that is numbered 12,24 strains is respectively 3.322cm, 3.21cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 1.71cm, turns the long 1.86cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 150mM sodium-chlor:
The T3 that is numbered 12,24 strains is respectively 1.16cm, 1.50cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 0.51cm, turns the long 0.87cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 200mM sodium-chlor:
The T3 that is numbered 12,24 strains is respectively 0.90cm, 0.89cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 0.69cm, turns the long 0.80cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
There is the result in DEX when induction as shown in figure 10,
In the MS substratum that contains 0mM sodium-chlor:
The T3 that is numbered 12,24 strains is respectively 5.68cm, 4.77cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 5.48cm, turns the long 4.53cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 100mM sodium-chlor:
The T3 that is numbered 12,24 strains is respectively 3.16cm, 2.94cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 1.30cm, turns the long 2.94cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 150mM sodium-chlor:
The T3 that is numbered 12,24 strains is respectively 1.16cm, 0.97cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 0.72cm, turns the long 1.20cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
In the MS substratum that contains 200mM sodium-chlor:
The T3 that is numbered 12,24 strains is respectively 0.97cm, 1.06cm for the root length that turns GmNFYB1a Arabidopis thaliana, and the root length of wild-type Arabidopis thaliana (CK) is 0.87cm, turns the long 1.20cm of being of root of GmNFYB1a-GR Arabidopis thaliana;
To being numbered T3 generation of 12,24 strains, turn long photograph of root after the processing of GmNFYB1a Arabidopis thaliana and wild-type Arabidopis thaliana, the observation of taking pictures, result as shown in Figure 9 and Figure 10, as can be seen from the figure, along with the concentration rising of sodium-chlor in substratum, (0mM NaCl, 100mM NaCl, 150mM NaCl, 200mM NaCl) transgenic arabidopsis plant root is grown and wild-type plant root length shortens gradually, during 200mM NaCl, do not make a big difference.Illustrate transgenic arabidopsis plant as transcription factor under low concentration of salt is coerced, be anti-salt seedling stage.
5, turn the germination rate of GmNFYB1a Arabidopis thaliana plant under sodium-chlor (NaCl) Stress treatment
In the T3 generation that is numbered 12,24 strains and turns GmNFYB1a-GR Arabidopis thaliana plant that turns GmNFYB1a gene from above-mentioned acquisition, is turned the seed sterilizing of GmNFYB1a Arabidopis thaliana and be seeded in and have or not the 0mM sodium-chlor of DEX induction, on the MS substratum of 100mM sodium-chlor, 16h light/8h is dark, under 25 ℃ of conditions, grow, 100 strains of the 5th day statistics be numbered 12,24 and T3 generation of turning GmNFYB1a-GR Arabidopis thaliana strain turn the germination rate of GmNFYB1a Arabidopis thaliana seedling.With the contrast of wild-type Arabidopis thaliana seedling, each strain is 100 strains, tests in triplicate results averaged.
Result while inducing without DEX as shown in figure 11,
In the MS substratum that contains 0mM sodium-chlor:
The germination rate that the T3 generation that is numbered 12,24 strains turns GmNFYB1a Arabidopis thaliana is respectively 96%, 95%, and to turn GmNFYB1a-GR Arabidopis thaliana strain germination rate be 95%, and the germination rate of wild-type Arabidopis thaliana (CK) is 97%;
In the MS substratum that contains 100mM sodium-chlor:
The T3 that is numbered 12,24 strains is respectively 90%, 88% for the germination rate that turns GmNFYB1a Arabidopis thaliana, and turning GmNFYB1a-GR Arabidopis thaliana strain germination rate is 57%, and the germination rate of wild-type Arabidopis thaliana (CK) is 59%;
There is the result in DEX when induction as shown in figure 12,
In the MS substratum that contains 0mM sodium-chlor:
It is 96%, 95% that the germination rate that the T3 generation that is numbered 12,24 strains turns GmNFYB1a Arabidopis thaliana is respectively, and turning GmNFYB1a-GR Arabidopis thaliana strain germination rate is 94%, and the germination rate of wild-type Arabidopis thaliana (CK) is 96%;
In the MS substratum that contains 100mM sodium-chlor:
It is 90%, 88% that the germination rate that the T3 generation that is numbered 12,24 strains turns GmNFYB1a Arabidopis thaliana is respectively, and turning GmNFYB1a-GR Arabidopis thaliana strain germination rate is 80%, and the germination rate of wild-type Arabidopis thaliana (CK) is 57%;
Result shows: while inducing without DEX, under salt stress, the germination rate of transgenic arabidopsis plant is higher than wild-type plant and the germination rate that turns GmNFYB1a-GR Arabidopis thaliana plant.When DEX induces, under salt stress, transgenic arabidopsis plant with turn the germination rate of GmNFYB1a-GR Arabidopis thaliana plant higher than the germination rate of wild-type plant.Further illustrating Arabidopis thaliana seed is salt tolerant or anti-salt in seedling stage.
What the article about nf-Y (AtNFYB1) of the drought resisting aspect that Donald E. etc. delivers and Wen-Xue Li. etc. delivered has all illustrated that at the article aspect drought resisting this family gene is relevant with drought resisting about AtNFYB5, is that one and drought are coerced relevant transcription factor.Soybean (GmNFYB1a) albumen and Arabidopis thaliana (AtNFYB1) albumen are carried out to homology phylogenetic analysis.Adopt MEGA4.0 software to analyze, result shows: the homology of GmNFYB1a gene and Arabidopis thaliana (AtNFYB1) is very high.In order to verify that whether this gene is relevant with salt stress, salt tolerant or the experiment of anti-salt have been done again.Under sodium-chlor (NaCl) is processed, the resistance that transgenic arabidopsis seedling is done well in salt stress.
In sum, the Arabidopis thaliana that turns GmNFYB1a than wild-type Arabidopis thaliana under low concentration of salt is coerced, aspect salt tolerant or anti-salt, demonstrating very large advantage, the performance aspect drought resistance is stronger, illustrates that this gene (GmNFYB1a) is and drought resisting, the relevant nf of anti-salt.
Claims (10)
1. an albumen, is following 1) or 2) protein:
1) protein being formed by the aminoacid sequence shown in SEQ ID NO.2;
2) by the aminoacid sequence of SEQ ID NO.2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant to plant stress tolerance by 1) derivative protein.
2. albumen according to claim 1, is characterized in that: the protein being comprised of the aminoacid sequence shown in SEQ ID NO.2.
3. the encoding gene of albumen described in claim 1.
4. encoding gene according to claim 3, is characterized in that: described encoding gene is following 1), 2), 3), 4) or 5) gene:
1) DNA molecular shown in SEQ ID NO.1 in sequence table;
2) in sequence table SEQ ID NO.1 from the DNA molecular shown in the Nucleotide of the 1-599 position of 5 ' end;
3) in sequence table SEQ ID NO.1 from the DNA molecular shown in the Nucleotide of the 62-505 position of 5 ' end;
4) under stringent condition with 1) or 2) or 3) DNA molecule hybridize that limits and with the DNA molecular of plant stress tolerance correlative protein encoding gene;
5) with 1) or 2) or 3) DNA sequence dna that limits at least have 90% homology and with the DNA molecular of plant stress tolerance correlative protein encoding gene.
5. encoding gene according to claim 3, is characterized in that: described encoding gene is following 1), 2) or 3) gene:
1) DNA molecular shown in SEQ ID NO.1 in sequence table;
2) in sequence table SEQ ID NO.1 from the DNA molecular shown in the Nucleotide of the 1-599 position of 5 ' end;
3) in sequence table SEQ ID NO.1 from the DNA molecular shown in the Nucleotide of the 62-505 position of 5 ' end.
6. the recombinant vectors that contains encoding gene described in claim 3.
7. recombinant vectors according to claim 6, is characterized in that: encoding gene described in claim 3 is inserted to the carrier obtaining between the Bgl II of pCAMBIA3301 carrier and BstE II recognition site.
8. the application of recombinant vectors in regulating plant resistance of reverse and/or plant breeding described in encoding gene, claim 6 described in albumen, claim 3 described in claim 1.
9. method according to claim 8, is characterized in that: described plant is dicotyledons or monocotyledons.
10. method according to claim 8, is characterized in that: described plant is Arabidopis thaliana or soybean.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310731227.9A CN103709239A (en) | 2013-12-26 | 2013-12-26 | Soy nuclear factor protein GmNFYB and coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310731227.9A CN103709239A (en) | 2013-12-26 | 2013-12-26 | Soy nuclear factor protein GmNFYB and coding gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103709239A true CN103709239A (en) | 2014-04-09 |
Family
ID=50402626
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310731227.9A Pending CN103709239A (en) | 2013-12-26 | 2013-12-26 | Soy nuclear factor protein GmNFYB and coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103709239A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110922458A (en) * | 2018-09-20 | 2020-03-27 | 中国农业科学院作物科学研究所 | Soybean stress-resistance-related protein GmNF-YB24 and application of coding gene thereof |
| CN112501184A (en) * | 2020-12-22 | 2021-03-16 | 东北农业大学 | Soybean GmMT1 gene, vector containing GmMT1 gene, and preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005047516A2 (en) * | 2003-11-13 | 2005-05-26 | Mendel Biotechnology, Inc. | Plant transcriptional regulators |
| WO2009037279A1 (en) * | 2007-09-18 | 2009-03-26 | Basf Plant Science Gmbh | Plants with increased yield |
| CN101442902A (en) * | 2004-12-21 | 2009-05-27 | 孟山都技术有限公司 | Transgenic plants with enhanced agronomic traits |
| CN102964437A (en) * | 2012-11-16 | 2013-03-13 | 东北农业大学 | Soybean nuclear factor protein and encoding genes of protein and applications of protein and encoding genes |
-
2013
- 2013-12-26 CN CN201310731227.9A patent/CN103709239A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005047516A2 (en) * | 2003-11-13 | 2005-05-26 | Mendel Biotechnology, Inc. | Plant transcriptional regulators |
| CN101442902A (en) * | 2004-12-21 | 2009-05-27 | 孟山都技术有限公司 | Transgenic plants with enhanced agronomic traits |
| WO2009037279A1 (en) * | 2007-09-18 | 2009-03-26 | Basf Plant Science Gmbh | Plants with increased yield |
| CN102964437A (en) * | 2012-11-16 | 2013-03-13 | 东北农业大学 | Soybean nuclear factor protein and encoding genes of protein and applications of protein and encoding genes |
Non-Patent Citations (1)
| Title |
|---|
| 乔慧蕾等: "沙冬青脱水素基因的克隆及表达载体的构建", 《华北农学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110922458A (en) * | 2018-09-20 | 2020-03-27 | 中国农业科学院作物科学研究所 | Soybean stress-resistance-related protein GmNF-YB24 and application of coding gene thereof |
| CN110922458B (en) * | 2018-09-20 | 2021-05-18 | 中国农业科学院作物科学研究所 | Soybean stress-resistance-related protein GmNF-YB24 and application of coding gene thereof |
| CN112501184A (en) * | 2020-12-22 | 2021-03-16 | 东北农业大学 | Soybean GmMT1 gene, vector containing GmMT1 gene, and preparation method and application thereof |
| CN112501184B (en) * | 2020-12-22 | 2022-06-03 | 东北农业大学 | Soybean GmMT1 gene, vector containing GmMT1 gene, and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103695438B (en) | Arabidopsis MYB family transcription factor AtMYB17 gene, coded sequence and application thereof | |
| CN104480119B (en) | Plant salt stress inducible gene OsSIR1 and its encoding proteins and application | |
| CN108164588A (en) | Application of the cotton transport protein GhBASS5 genes in plant salt tolerance | |
| CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
| AU2020100982A4 (en) | Wheat salt tolerance gene taaap3 and its application | |
| CN108570099A (en) | The application of OsGLP2-1 albumen and its encoding gene in regulating and controlling seed dormancy | |
| CN109021084A (en) | Trifoliate orange Cold resistant genes PtrERF109 and its application in plant cold resistance genetic improvement | |
| CN102964437A (en) | Soybean nuclear factor protein and encoding genes of protein and applications of protein and encoding genes | |
| CN104031924A (en) | Rice stress tolerance correlation MYB transcription factor gene OsMYB1R1 and application | |
| CN102399268B (en) | Plant stress tolerance-related transcription factor GmNAC11, coding gene and application thereof | |
| CN103710357B (en) | Alfalfa stress response gene M sNAC2 and application thereof | |
| CN104725495A (en) | Cotton GhWRKY51 transcription factor, and coding gene and application thereof | |
| CN103951740B (en) | Bermuda grass CCAAT transcription factor CdtNF-YC1 as well as coding gene and application thereof | |
| CN103709239A (en) | Soy nuclear factor protein GmNFYB and coding gene and application thereof | |
| CN104945492B (en) | Plant stress tolerance correlative protein TaAREB3 and its encoding gene and application | |
| CN106432449A (en) | Protein VPS23A related to drought tolerance of plants, encoding gene of protein VPS23A and application | |
| CN103602688B (en) | Helianthus tuberosus L. Na<+>/H<+> reverse transport protein genes HtNHX1 and HtNHX2 and use thereof | |
| CN103468724B (en) | Peanut salt resistance gene AhSOS2, clone method and application | |
| CN107987139A (en) | A kind of Dof transcription factors and its application in terms of plant salt tolerance is improved | |
| CN108841837A (en) | Application of the encoding gene of arabidopsis splicing factor SR45a spliceosome in negative regulation plant salt stress response | |
| CN103421829A (en) | Salt-tolerant gene TaAOC1 for wheat and application of salt-tolerant gene TaAOC1 | |
| CN113913440A (en) | Application of GhD1119 gene in regulating and controlling blossoming of upland cotton | |
| CN103614385B (en) | A gene KT525 is improving the application on plant stress tolerance | |
| CN101993479B (en) | Plant stress tolerance related transcription factor TaWRKY1 as well as coding gene and application thereof | |
| CN104611335A (en) | Specific peanut promoter AhRSP and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140409 |
|
| RJ01 | Rejection of invention patent application after publication |