CN103561726A - Novel compositions and uses of anti-hypertension agents for cancer therapy - Google Patents

Abstract

Methods and compositions for improving the delivery and/or efficacy of cancer therapeutics are disclosed. Methods and compositions for treating or preventing a cancer (e.g., a solid tumor such as a desmoplastic tumor) by administering to a subject an antihypertensive agent, as a single agent or combining the antihypertensive agent with a cancer therapeutic agent (for example, a therapeutic agent ranging in size from a large nanotherapeutic to a low molecular weight chemotherapeutics and/or oxygen radical) are disclosed.

Description

The new compositions and the purposes that are used for the hypotensive agent for the treatment of of cancer

The cross reference of related application

According to 35U.S.C § 119 (e), the application requires the U.S. Provisional Application sequence No.61/415 submitting on November 18th, 2010, the U.S. Provisional Application sequence No.61/438 that on January 31st, 192 and 2011 submits to, 240 priority, by reference by its content separately integral body be incorporated to herein.

Government supports

Under the federal funding of the fund PO1-CA-80124-03 that Shi You of the present invention NIH authorizes, complete.U.S. government enjoys certain right to the present invention.

Background technology

The progress of biomedical research made before clinical and clinical setting (setting) in all introduced novel molecular agent and nanometer therapeutic agent (Jones, D. (2007) Nat Rev Drug Discov6, the 174-175 of several whole body administrations; Moghimi, S.M. etc., (2005) Faseb J19,311-330).Although these novel agents act on unique target spot (more high specific or improved pharmacodynamic profiles for tumor cell are provided), yet the character due to tumor microenvironment, make their effect be subject to its restriction of sending (Jain, R.K. (1998) Nat Med4,655-657; Sanhai, W.R. etc., (2008) Nat Nanotechnol3,242-244).For example, the pegylated liposomal doxorubicin (pegylated liposomal doxorubicin) of ratifying through FDA

with at present represented two kinds of nanometer therapeutic agents (nanotherapeutics) carrying out the oncolytic virus of various clinical test (oncolytic viruses), its size (～100nm) has hindered their interior the distribution and curative effect (Nemunaitis J etc., (2001) J Clin Oncol19:289-298) of tumor.

Therapeutic agent for all kinds, at least two kinds of processes of drug delivery after the administration of domination whole body (that is: spread all over the blood vessel transportation of whole tissue and enter transporting across blood vessel of tissue) are subject to obstruction (Jain, R.K. & Stylianopoulos (2010) the Nat Rev Clin Oncol.139 of physiologic barrier in tumor; Chauhan, V.P. etc., (2009) Biophysical journal97,330-336).These barriers especially exert an influence to suffering from the treatment of short desmoplastic (desmoplastic), fibrosis (fibrotic) tumor patient, described tumor is as cancer of pancreas (Olive, K.P. etc., (2009) Science324,1457-1461), colorectal cancer (Halvorsen, T.B. & Seim, E. (1989) J Clin Pathol42,162-166), pulmonary carcinoma and breast carcinoma (Ronnov-Jessen, L. etc., (1996) Physiol Rev76,69-125).Fibrosis tumor has intensive collagen protein network conventionally, described collagen protein network makes (interfibrillar) spacing between the little fiber of the middle generation of interstitial (interstitium), with retardance, be greater than movement (Netti PA etc., (2000) Cancer Res60:2497-2503 of the granule of 10 nanometers; Pluen A etc., (2001) Proc Natl Acad Sci USA98:4628-4633; Ramanujan S etc., (2002) Biophys J83:1650-1660; And Brown E etc., (2003) Nat Med9:796-800).These barriers have limited and have arrived the amount of the medicine of targeted cancerous cells, and then cause drug effect very low.

At present, very limited for these methods of sending obstacle that overcome nanometer therapeutic agent and low-molecular-weight drug.Therefore; to determining new treatment of cancer, especially having needs to strengthening the novel agent of sending and distributing for the treatment of of cancer; described reagent comprises nanometer therapeutic agent (for example, lipid nanometer granule or polymer nano granules and virus), pharmaceutical grade protein and nucleic acid drug and micromolecule chemotherapeutics.

Summary of the invention

The present invention part is based on following discovery: losartan (losartan), is a kind ofly approved for treatment hypertension (hypertension, angiotensin ii receptor antagonist medicine hypertension) have improved sending and effect of cancer therapeutic agent.Especially; inventor finds that losartan makes collagen protein (the interstitial substrate of solid tumor) normalization; and promote the distribution of chemotherapeutics and/or penetrate (penetration), described chemotherapeutics comprises high molecular chemotherapeutics (for example, nanometer therapeutic agent).For example, Losartan in Reducing type i collagen albumen in cancer associated fibroblast cell (CAF) (in breast carcinoma biopsy (biopsies) separated) level (for example, reducing collagen protein produces), and make the reduction of substrate (stromal) the collagen protein generation dose dependent (dose-dependent) in the short desmoplastic mouse model of HBT, pancreas tumor and cutaneous tumor.Losartan has also improved nano-particle (for example, oncolytic herpes simplex virus (HSV) and pegylated liposomal doxorubicin

) distribution, curative effect and/or penetrate.Inventor also finds, losartan promotes blood vessel blood pressure lowering and blood vessel normalization, and improves the tumor perfusion (tumor perfusion) of low-molecular-weight chemotherapeutics and send, thereby strengthened the curative effect of X-ray therapy and chemotherapeutics.

Therefore, for example disclose, for improving sending and/or the method and composition of effect of therapeutic agent (, cancer therapeutic agent).Disclose in the following way treatment or prophylaxis of cancer (for example, solid tumor, as short desmoplastic tumor) method and composition: by hypotensive agent and/or collagen-modified dose (collagen modifying agent) are given to experimenter or for example, combine and give experimenter with therapeutic agent (, the cancer therapeutic agent of size from large nanometer therapeutic agent to low-molecular-weight chemotherapeutics and/or oxygen-derived free radicals) as single agents.

Therefore, in one aspect, (for example the invention is characterized in treatment or prevention experimenter's hyperproliferative disease (hyperproliferative disorder), cancer) method or improve for example, sending and/or the method for effect for experimenter's treatment (, treatment of cancer).Described method comprises:

To described experimenter, give hypotensive agent and/or collagen-modified dose (being called " AHCM " or " AHCM agent " herein); And

Optionally, in following situation, (for example give described treatment, treatment of cancer): for example, the dosage of AHCM and anticarcinogen be enough to treatment or prevention experimenter described disease (for example, cancer or tumor) or be enough to improve the sending and/or effect for the treatment of (for example, treatment of cancer) offer experimenter.

In one embodiment, described method comprises one or more in following:

A), for example, based on improvement being treated to the needs of sending of (, treatment of cancer) and/or effect, select or definite experimenter that need to accept AHCM;

B) by described AHCM, treatment (for example, treatment of cancer) or the two as hydrodynamic diameter (hydrodynamic diameter) be greater than approximately 1,5,10,15,20,25,30,35,45,50,75,100,150,200nm, but the entity (entity) (for example,, as nano-particle) that is less than 300nm gives;

C) as described herein, experimenter has the treatment hypertension history of (or lacking treatment), for example, in start in cancer diagnosis or AHCM medication 5 days, 10 days, 30 days, 60 days or 100 days, to experimenter, do not give AHCM, the AHCM or any AHCM (for example, being enough to obviously reduce dosage or the sub-resisting hypertension dosage (sub-anti-hypertensive dose) of experimenter's blood pressure) that for example name herein.In one embodiment, experimenter was not hypertension or has suffered from hypertension before giving AHCM;

D) according to dosage regimen as herein described (dosing regimen), experimenter is treated, for example, before giving treatment of cancer, start to give AHCM, for example, at least one day before treatment of cancer, two days, three days or five days or one week, two weeks, three weeks, surrounding, more than five weeks start to give AHCM (for example, at least two weeks gave AHCM before treatment of cancer);

E) according to dosage regimen as herein described, provide AHCM and treatment of cancer, for example, it is first course for the treatment of of sub-resisting hypertension dosage that AHCM is provided, continue take AHCM as higher dosage (for example, AHCM be standard resisting hypertension dosage or higher than the dosage of standard resisting hypertension dosage) second course for the treatment of (for example, wherein, will in the time-histories of the hypertension effect of counteracting anticancer therapy, give described second course for the treatment of);

F) at least 1 hour, 5 hours, 10 hours or 24 hours; At least 2 days, 5 days, 10 days or 14 days; At least 2 weeks, 3 weeks, 4 weeks, 5 weeks or 6 weeks; At least 2 months, 3 months, 4 months, 5 months or 6 months; Or at least 1 year, 2 years, 3 years, 4 years or 5 years; Or in the time period more of a specified duration, give continuously substantially described AHCM;

G) by AHCM and described treatment (for example, treatment of cancer) sequential (sequentially) gives and/or simultaneously (concurrently) give.Can give AHCM and treatment (with identical or different dosage) and/or to give AHCM with the overlapping mode for the treatment of with any order.In one embodiment, before treatment, give AHCM (for example,, described in steps d).In other embodiments, AHCM is given and is given simultaneously (for example, before treatment, give AHCM (for example,, described in steps d) and itself and treatment are given simultaneously) with treatment is sequential.In another embodiment, first treat, and give AHCM after treatment starts.Give at the same time in the embodiment of AHCM and treatment, can in suitable clinically mode, continue giving of described AHCM and described treatment, for example, (i) as therapeutic alliance, give; (ii) in during one section for the treatment of, with described AHCM or described treatment, give; Or (iii) with (i) of random order and combination (ii), give.

In one embodiment, for example, for example, to be enough to change (, the strengthening) distribution for the treatment of (, treatment of cancer) or the amount of effect, give AHCM.In some embodiments, for example, for example, self to be not enough to suppress or to stop (prevent) tumor growth but be enough to change (, the strengthening) distribution for the treatment of (, treatment of cancer) or the amount of effect gives AHCM.

In embodiment, so that cancer therapeutic agent causes that the dosage of following one or more variations gives AHCM in experimenter's tumor or tumor vessel: reduce collagen protein level or generation, reduction tumor fibrosis, improve mesenchymal neoplasm transportation, improve tumor perfusion or enhancing penetrates or spreads.

In one embodiment, AHCM is selected from one or more in following reagent:

Angiotensin-ii receptor blockers (AT ₁blocker);

Renin-angiotensin-aldosterone system antagonist (" RAAS antagonist ");

Angiotensin-Converting (ACE) inhibitor;

Thrombospondin (thrombospondin) 1 (TSP-1) inhibitor;

Transforminggrowthfactor-β1 (TGF-β 1) inhibitor;

Connective Tissue Growth Factor (CTGF) inhibitor; Or

Two or more combination in mentioned reagent.

Unless context is otherwise noted, term " AHCM " can refer to one or more reagent as herein described.

Described method can comprise a kind of, more than two or three AHCM independent or that combine with one or more treatments of cancer.

In one embodiment, AHCM is RAAS antagonist.In embodiment, RAAS antagonist is selected from one or more in following reagent: aliskiren (aliskiren,

), remikiren (remikiren, Ro42-5892), enalkiren (enalkiren, A-64662), SPP635, or the derivant of mentioned reagent.

In another embodiment, AHCM is AT ₁inhibitor.In embodiment, AT ₁blocker is selected from one or more in following reagent: losartan

, Candesartan

eprosartan mesilate (eprosartan mesylate,

), EXP3174, irbesartan

l158,809, Olmesartan (olmesartan,

), Saralasin, telmisartan (telmisartin,

), valsartan

or the derivant of mentioned reagent.

In another embodiment, AHCM is ACE inhibitor.In embodiment, ACE inhibitor is selected from one or more in following reagent: benazepril (benazepril,

), captopril

enalapril

fosinopril

lisinopril

moexipril (moexipril,

), perindopril

quinapril (quinapril,

), ramipril trandolapril (trandolapril,

), or the derivant of mentioned reagent.

In another embodiment, AHCM is TSP-1 inhibitor.In embodiment, TSP-1 inhibitor is selected from one or more in following reagent: ABT-510, CVX-045, LSKL, or the derivant of mentioned reagent.

In one embodiment, AHCM is TGF-β 1 inhibitor, for example, and anti-TGF-beta 1 antibody, TGF-β 1 inhibitor peptides.In some embodiments, TGF-β 1 inhibitor is selected from one or more in following reagent: CAT-192, fresolimumab (GC1008), LY2157299, peptide 144 (P144), SB-431542, SD-208, at United States Patent (USP) serial number 7,846,908 and U.S. Patent Application Publication No. 201I/0008364 in the compound described, or the derivant of mentioned reagent.

In another embodiment, AHCM is CTGF inhibitor.In some embodiments, CTGF inhibitor is selected from one or more in following reagent: DN-9693, FG-3019 and at European patent application publication No. 1839655 and United States Patent (USP) serial number 7, the compound of describing in 622,454, or the derivant of mentioned reagent.

Exemplary AHCM described herein is nonrestrictive, and for example, the derivant of AHCM described herein can be used for method described herein.

AHCM dosage and dosage form

Method of the present invention is strengthened treatment (for example, treatment of cancer) with AHCM.

In one embodiment, to be equivalent to the dosage of therapeutic dose standard (a standard of care dose), give AHCM.The therapeutic dose standard of AHCM is obtainable in this area.For example,, if AHCM is AT ₁inhibitor (losartan), the therapeutic dose standard for mankind's resisting hypertension purposes is about 25-100mg/ days.In the method, losartan every day orally separately can be given or gives (once a day or twice) with treatment of cancer Combined with Oral described herein.Can for example, with the dosage form (, oral tablet) of about 12.5mg, 25mg, 50mg or 100mg, provide losartan.

AT for other for mankind's resisting hypertension purposes or heart failure resistance purposes ₁inhibitor, exemplary therapeutic dose standard is as follows: Candesartan

for example, for 4mg/ days-32mg/ days (, the form with the peroral dosage form that contains 4mg, 8mg, 16mg or 32mg Candesartan can obtain); Eprosartan mesilate

for example, for 400mg/ days-800mg/ days (, the form with the peroral dosage form that comprises 400mg or 600mg eprosartan can obtain); Irbesartan

for example, for 150mg/ days-300mg/ days (, the form with the peroral dosage form that comprises 150mg or 300mg irbesartan can obtain); Olmesartan

for 20mg/ days-40mg/ days (form with the peroral dosage form that comprises 5mg, 20mg or 40mg Olmesartan can obtain); Telmisartan

for example, for 20mg/ days-80mg/ days (, the form with the peroral dosage form that comprises 20mg, 40mg or 80mg telmisartan can obtain); And valsartan

for example, for 80mg/ days-320mg/ days (, the form with the peroral dosage form that comprises 40mg, 80mg, 160mg or 320mg valsartan can obtain).

In one embodiment, with sub-resisting hypertension dosage, give AHCM and (for example,, when giving hypertension experimenter, mean arterial pressure is not there is to the dosage of appreciable impact; Or lower than the dosage of antihypertensive therapy Dose standard).In embodiment, not reduce substantially the amount of experimenter's mean arterial pressure, do not give AHCM, for example, for given dose, with this dosage, giving after pre-determined number, for example under steady state blood plasma level, measure.In embodiment, with following dosage, give AHCM at least one times: make experimenter's mean arterial pressure reduce the dosage that is less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%.In embodiment, with following dosage, give AHCM: make the reduction of blood pressure be less than reduction that the antihypertensive therapy Dose standard by this AHCM causes 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or make the less dosage of reduction of blood pressure.In embodiment, with following dosage, give AHCM: lower than the blood pressure that can make experimenter enter normal range (for example, systolic pressure be approximately 120 and diastolic pressure be approximately 80) 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% dosage of AHCM dosage; Or lower than the blood pressure that can make experimenter, to enter systolic pressure be that 120+/-5, diastolic pressure are 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% dosage of AHCM dosage in the scope of 80+/-5.

In embodiment, with following dosage, give AHCM: for example, lower than the dosage of the therapeutic dose standard for resisting hypertension purposes or heart failure resistance purposes 0.01,0.02,0.03,0.04,0.05,0.06,0.07,0.08,0.09,0.1,0.2,0.3,0.4,0.5,0.6,0.7 dosage of the therapeutic dose standard for resisting hypertension purposes or heart failure resistance purposes (, lower than).The therapeutic dose standard of AHCM is obtainable in this area.For example,, if AHCM is AT ₁inhibitor (losartan), therapeutic dose standard is about 25mg/ days-100mg/ days, the antihypertensive drug of suboptimum (suboptimal) can, for 0.25-17.5mg/ days, 0.5-15mg/ days, 1.3-12mg/ days, 1.5-12mg/ days, 2-12mg/ days, 2-10mg/ days, 2-5mg/ days, 2-3mg/ days, be generally 2mg/ days.In one embodiment, AHCM is losartan, and it is given with the dosage lower than 25mg/ days, 20mg/ days, 15mg/ days, 10mg/ days, 5mg/ days, 4mg/ days, 3mg/ days, 2mg/ days, 1mg/ days.Can combine individually or with cancer therapeutic agent as herein described, every day was with the oral losartan (once a day or twice) that gives of sub-resisting hypertension dosage of 2-3mg/ days.For other AT ₁inhibitor, exemplary therapeutic dose standard is as follows: Candesartan

for 4mg/ days-32mg/ days; Eprosartan mesilate for 400mg/ days-800mg/ days; Irbesartan for 150mg/ days-300mg/ days; Olmesartan

for 20mg/ days-40mg/ days; Telmisartan

for 20mg/ days-80mg/ days; And valsartan

for 80mg/ days-320mg/ days.In embodiment, with following dosage, give AHCM: lower than the dosage of the therapeutic dose standard of resisting hypertension purposes or heart failure resistance purposes (for example,, for other AT ₁inhibitor (as Candesartan, eprosartan (eprosartan), irbesartan, Olmesartan, telmisartan and valsartan) is 0.01,0.02,0.03,0.04,0.05,0.06,0.07,0.08,0.09,0.1,0.2,0.3,0.4,0.5,0.6,0.7 dosage of the therapeutic dose standard lower than resisting hypertension purposes or heart failure resistance purposes).

In some embodiments, described AHCM is mixed with to following dosage form: for example, lower than the dosage form of the therapeutic dosage forms standard of resisting hypertension or heart failure resistance 0.01,0.02,0.03,0.04,0.05,0.06,0.07,0.08,0.09,0.1,0.15,0.16,0.2,0.3,0.4,0.5,0.6,0.7 dosage form of therapeutic dosage forms standard (standard of care dosage form) (, lower than).For example, if AHCM is losartan, dosage form can be about 0.5mg-11mg, 1mg-10mg, 1mg-5mg, or 1mg, 2mg, 3mg, 4mg, 5mg, 6mg, 7mg, 8mg, 9mg or 10mg.In some embodiments, can for example, with lower than 12.5mg (, about 0.1mg, about 0.2mg, about 0.3mg, about 0.4mg, about 0.5mg, about 0.6mg, about 0.7mg, about 0.8mg, about 0.9mg, about 1mg, about 2mg, about 3mg, about 4mg, about 5mg, about 6mg, about 7mg, about 8mg, about 9mg, about 10mg, about 11mg or about 12mg) dosage form (for example, oral tablet) losartan is provided.

In one embodiment, AHCM is mixed with to tablet (for example, oral tablet).In other embodiments, AHCM is mixed with for other route of administration, for example, subcutaneous administration or intravenous administration.

In some embodiments, the sub-resisting hypertension dosage of AHCM or the dosage lower than the therapeutic dose standard for resisting hypertension purposes or heart failure resistance purposes of AHCM can be following dosage: while giving experimenter separately by the AHCM of this dosage, be not enough to suppress or stop tumor growth or development.

In another embodiment, with following dosage, give AHCM: for example, higher than the dosage of the therapeutic dose standard for resisting hypertension purposes or heart failure resistance purposes 1.1,1.5,1.7,2,3,4,5 or 10 times of above dosage of the therapeutic dose standard of resisting hypertension purposes or heart failure resistance purposes (, higher than).The therapeutic dose standard of AHCM is obtainable in this area; In this article some of them are given an example.

In other embodiments, described AHCM is mixed with to following dosage form: higher than the dosage form (for example,, higher than 1.1,1.5,1.7,2,3,4,5 or 10 times of described therapeutic dosage forms standard above dosage forms) of the therapeutic dosage forms standard of resisting hypertension or heart failure resistance.The therapeutic dosage forms standard of AHCM is obtainable in this area; In this article some of them are given an example.

In some embodiments, be equivalent to or can be following dosage higher than the AHCM dosage of resisting hypertension or heart failure resistance therapeutic dose standard: while giving experimenter separately by the AHCM of this dosage, being not enough to suppress or stop tumor growth or development.

In other embodiments, for example, than reference dose (dosage, therapeutic dose standard or the maximum tolerated dose (MTD) in description (package insert)), with larger dosage or make the scheme that anticarcinogen level is higher give anticarcinogen.

In some embodiments, for example, than reference dose (, the dosage in description, therapeutic dose standard or MTD), with less dosage or make the scheme that anticarcinogen level is lower give anticarcinogen.In some embodiments, give the anticarcinogen of following amount: when giving separately the anticarcinogen of this amount, for suppress stop tumor growth or develop invalid; But during by the anticarcinogen of this amount and AHCM administering drug combinations, be enough to suppress or stop tumor growth or development.

In some embodiments, when with AHCM administering drug combinations, by treatment of cancer or cancer therapeutic agent, with following dosage, give experimenter: lower than in the situation that existing without AHCM for the dosage of the lowest dose level of experimenter's cancer being treated or preventing.

In some embodiments, when to experimenter, give AHCM and treatment of cancer or cancer therapeutic agent the two time, the dosage of described hypotensive agent and/or collagen-modified dose can be following dosage: lower than the dosage of the lowest dose level for hypertension associated conditions or heart failure are treated; And the dosage of described treatment of cancer or cancer therapeutic agent can be following dosage: lower than in the situation that existing without AHCM for the dosage of the lowest dose level of experimenter's cancer being treated or preventing.

In some embodiments, when giving experimenter's treatment of cancer or the dosage of cancer therapeutic agent when being used for the treatment of separately cancer patient's lowest dose level, as adjuvant drug (adjuvant), give the lowest dose level that the dosage of experimenter's AHCM reagent can be when being used for the treatment of cancer separately.In this type of embodiment, the dosage that gives experimenter's AHCM reagent as adjuvant drug can be sub-resisting hypertension dosage or can be and is equivalent to or higher than the dosage that is used for the treatment of the therapeutic dose standard of hypertension or heart failure.

In some embodiments, when giving experimenter's treatment of cancer or the dosage of cancer therapeutic agent when being used for the treatment of cancer patient's lowest dose level in the situation that existing without AHCM, as adjuvant drug, give the lowest dose level that the dosage of experimenter's AHCM reagent can be when being used for the treatment of cancer separately, but this dosage is enough to improve effect or cancer therapeutic agent the sending to tumor for the treatment of of cancer.In this type of embodiment, the dosage that gives experimenter's AHCM reagent as adjuvant drug can be sub-resisting hypertension dosage or can be and is equivalent to or higher than the dosage that is used for the treatment of the therapeutic dose standard of hypertension or heart failure.

The method of measuring the lowest dose level that any reagent (for example, anticarcinogen and/or AHCM) is used for the treatment of is well-known to those skilled in the art.For example, those skilled in the art can be by for example giving the AHCM of animal various dose and/or anticarcinogen the monitoring tumor growth than contrast, measure AHCM and/or anticarcinogen in being equivalent to the animal model of specific types of cancer to treating effective lowest dose level.Contrast can be the animal for the treatment of with independent anticarcinogen (that is, in the situation that not there is not AHCM).

As described herein, can combine and give described AHCM and treatment (for example, treatment of cancer) by for example sequential mode that gives and/or give simultaneously.Can give described AHCM and treatment (with same dose or various dose) and/or to give AHCM with the overlapping mode for the treatment of with random order.In one embodiment, before treatment, give AHCM.In other embodiments, AHCM is given and is given simultaneously (for example, before treatment, give AHCM and itself and treatment are given simultaneously) with treatment is sequential.In another embodiment, first give treatment of cancer, and give AHCM after described treatment of cancer starts.Give at the same time in the embodiment of AHCM and treatment, can be following clinically suitable mode continue giving of described AHCM and described treatment of cancer: (i) as therapeutic alliance, give; (ii) in during one section for the treatment of, with described AHCM or described treatment of cancer, give; Or (iii) with (i) of random order and combination (ii), give.

Can be of AHCM is continuous substantially.For example, AHCM give can be at least 1 hour, 5 hours, 10 hours, 24 hours; 2 days, 5 days, 10 days, 14 days; Or be continuous substantially in the longer time.

In other embodiments, described AHCM can be intermittence (intermittent), for example, can in the course for the treatment of, have the interruption of predetermined space.In some embodiments, can give separately or for example, combine and give two doses or multi-agent AHCM more with treatment (, treatment of cancer).In one embodiment, in the course for the treatment of, with suboptimum hypotensive agent amount and resisting hypertension dosage, give AHCM.For example, can be in treatment (for example, treatment of cancer) (for example, the treatment of carrying out to improve the anticarcinogen of mean arterial pressure, for example, the treatment of for example, carrying out with anti-angiogenic medicaments (, Arastin (Avastin), Sutent (sunitinib) or Sorafenib (sorafenib))) before or in treatment, give the AHCM of suboptimum resisting hypertension dosage; Continue with the AHCM of second hypertension dosage.

The size of therapeutic agent entity

Method as herein described make use or the scope of selected treatment pattern (treatment modalities) in, for example, aspect therapeutic agent entity big or small, the motility being enhanced.Therefore, in one embodiment, the form that AHCM is greater than to the entity of about 1nm, 5nm, 10nm, 100nm, 500nm or 1000nm with hydrodynamic diameter gives.For example, described AHCM can be protein (for example, antibody).Described AHCM also can nano-particle form (for example, polymer nano granules or liposome) give, described nano-particle includes for example, AHCM as micromolecule therapeutic agent or protein (, antibody).

In embodiment, treatment of cancer is cancer therapeutic agent (in this article also referred to as " anticarcinogen "), or the form that the second therapeutic agent is greater than to the entity of about 1nm, 5nm, 10nm, 20nm, 50nm, 75nm, 100nm, 150nm, 200nm, 500nm or 1,000nm with hydrodynamic diameter gives.For example, described anticarcinogen can be protein (for example, antibody).Also described anticarcinogen can be given for example, form with nano-particle (polymer nano granules or liposome); as micromolecule therapeutic agent (described nano-particle includes; hydrodynamic diameter is the molecule below about 1nm) or the anticarcinogen of protein (for example, antibody).

In embodiment, AHCM (is for example greater than to about 1nm with hydrodynamic diameter, be greater than about 1nm, 5nm, 10nm, 20nm, 50nm, 75nm, 100nm, 150nm, 200nm, 500nm or 1, the form of entity 000nm) gives, and anticarcinogen be take to the form of the entity of hydrodynamic diameter below about 1nm gives.In one embodiment, described AHCM is present in the entity without chemotherapeutics.AHCM can be made to spacetabs type, for example, for the slow releasing preparation of continuous release substantially a few hours, a couple of days, several weeks, several months or several years.

In embodiment, AHCM be take to the form of the entity of hydrodynamic diameter below about 1nm to be given, and by anticarcinogen take hydrodynamic diameter more than about 1nm (for example, be greater than about 1nm, 5nm, 10nm, 20nm, 50nm, 75nm, 100nm, 150nm, 200nm, 500nm or 1, the form of entity 000nm) gives.

In embodiment, the form that AHCM is less than or equal to the entity of about 1nm with hydrodynamic diameter gives, and the form that anticarcinogen is less than to the entity of about 1nm with hydrodynamic diameter gives.

In embodiment, AHCM (is for example greater than to about 1nm with hydrodynamic diameter, be greater than about 1nm, 5nm, 10nm, 20nm, 50nm, 75nm, 100nm, 150nm, 200nm, 500nm or 1, the form of entity 000nm) gives, and anticarcinogen (is for example greater than to about 1nm with hydrodynamic diameter, be greater than about 1nm, 5nm, 10nm, 20nm, 50nm, 75nm, 100nm, 150nm, 200nm, 500nm or 1, the form of entity 000nm) gives.Described AHCM and anticarcinogen can be in different entities or same entities.For example, if provided with different entities, AHCM can be provided as the first nano-particle, and anticarcinogen (is for example provided as the second nano-particle, described the second nano-particle have be different from the first nano-particle architectural characteristic (for example, size or form) or the situation of functional characteristic (for example, release dynamics or pharmacodynamic profiles) under).Or, can on same entity (for example,, in same nano-particle), provide AHCM and anticarcinogen.

In embodiment, AHCM is selected from the therapeutic agent entity with following hydrodynamic diameter: be equal to or less than 1nm or 2nm; 2-20nm, 10-25nm, 20-40nm, 40-150nm, 50-150nm; 10-100nm, 15-100nm, 20-100nm, 25-100nm, 35-100nm, 40-100nm, 45-100nm, 50-100nm; 10-200nm, 15-200nm, 20-200nm, 25-200nm, 35-200nm, 40-200nm, 45-200nm, 50-200nm; 10-500nm, 15-500nm, 20-500nm, 25-500nm, 35-500nm, 40-500nm, 45-500nm, 50-500nm, 75-500nm, 100-500nm, 150-500nm, 200-500nm, 300-500nm; 10-1000nm, 15-1000nm, 20-1000nm, 25-1000nm, 35-1000nm, 40-1000nm, 45-1000nm, 50-1000nm, 75-1000nm, 100-1000nm, 150-1000nm, 200-1000nm, 300-1000nm; Or 10nm, 15nm, 20nm, 25nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm or 200nm.

In embodiment, AHCM is: micromolecule therapeutic agent; Protein (for example, antibody); Or provide in nano-particle.

In embodiment, anticarcinogen or the second therapeutic agent are selected from the therapeutic agent entity with following hydrodynamic diameter: be equal to or less than 1nm or 2nm; 2-20nm, 10-25nm, 20-40nm, 40-150nm, 50-150nm; 10-100nm, 15-100nm, 20-100nm, 25-100nm, 35-100nm, 40-100nm, 45-100nm, 50-100nm; 10-200nm, 15-200nm, 20-200nm, 25-200nm, 35-200nm, 40-200nm, 45-200nm, 50-200nm; 10-500nm, 15-500nm, 20-500nm, 25-500nm, 35-500nm, 40-500nm, 45-500nm, 50-500nm, 75-500nm, 100-500nm, 150-500nm, 200-500nm, 300-500nm; 10-1000nm, 15-1000nm, 20-1000nm, 25-1000nm, 35-1000nm, 40-1000nm, 45-1000nm, 50-1000nm, 75-1000nm, 100-1000nm, 150-1000nm, 200-1000nm, 300-1000nm; Or 10nm, 15nm, 20nm, 25nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm or 200nm.

In embodiment, anticarcinogen is: hydrodynamic diameter is 1nm or less micromolecule therapeutic agent; Protein (for example, antibody); Or provide in nano-particle.

In embodiment, described AHCM or anticarcinogen or the second therapeutic agent can be independently of one another provide to have the form of the entity of following magnitude range (take nm): be less than or equal to 1nm or be the hydrodynamic diameter of 0.1-1.0nm, for example, typical micromolecular hydrodynamic diameter; The hydrodynamic diameter of 5-20nm or 5-15nm, for example, the hydrodynamic diameter of protein (for example, antibody); Or 10-5,000nm, 20-1,000nm, 10-500nm, 10-200nm, 10-150nm or 10-100nm, 10-25nm, 20-40nm, 40-150nm, 50-150nm; 10-100nm, 15-100nm, 20-100nm, 25-100nm, 35-100nm, 40-100nm, 45-100nm, 50-100nm; 10-200nm, 15-200nm, 20-200nm, 25-200nm, 35-200nm, 40-200nm, 45-200nm, 50-200nm; 10-500nm, 15-500nm, 20-500nm, 25-500nm, 35-500nm, 40-500nm, 45-500nm, 50-500nm, 75-500nm, 100-500nm, 150-500nm, 200-500nm, 300-500nm; And 10-1000nm, 15-1000nm, 20-1000nm, 25-1000nm, 35-1000nm, 40-1000nm, 45-1000nm, 50-1000nm, 75-1000nm, 100-1000nm, 150-1000nm, 200-1000nm, 300-1000nm; Or the hydrodynamic diameter of 10nm, 15nm, 20nm, 25nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm or 200nm, for example, the scope of typical nano-particle.

Experimenter

Method as herein described can be used for treating having the experimenter of feature defined herein or needs.In embodiment, according to feature selection experimenter as herein described or experimenter's treatment.In one embodiment, method as herein described allows patient and treatment to carry out optimization selection.

In some embodiments, can before experimenter being carried out aspect method as herein described any, select or definite experimenter.

In one embodiment, select or determine to exist on the basis of optimization treatment and accept the experimenter that AHCM needs, for example, to improving, treatment (for example, treatment of cancer) is sent and/or the needs of effect.

In one embodiment, when AHCM treatment starts or to carrying out the patient of AHCM administration while selecting, experimenter does not suffer from hypertension or hypertension is not treated.

In embodiment, in start in cancer diagnosis or AHCM medication 5 days, 10 days, 30 days, 60 days or 100 days, for example, to experimenter (, patient), do not give the AHCM (for example, herein AHCM or any AHCM of name) of doses.

In embodiment, according to AHCM need to be to experimenter (for example, there is normal arterial pressure or hypotensive experimenter) select or determine, for example, select or determine to exist on optimization treatment basis and (for example accept experimenter that AHCM needs, for example, to improving sending and/or the needs of effect of described treatment (, treatment of cancer)).

In some embodiments, based on being the treatment of cancer generating portion response to independent or the experimenter who does not respond to improving sending or the needs of effect or the needs based on to optimization treatment for the treatment of of cancer, exist the experimenter who accepts AHCM and need.

In embodiment, according to AHCM, optimize the ability for the treatment of of cancer (for example, improving sending and/or effect of described treatment of cancer), select AHCM to treat experimenter.

In embodiment, the experimenter for the treatment of is not hyperpietic, for example, does not have hypertension history or with hypotensive agent, does not carry out treatment.In one embodiment, the experimenter for the treatment of has normal mean arterial pressure or low mean arterial pressure.In other embodiments, the experimenter for the treatment of does not experience or does not carry out antihypertensive therapy.

In one embodiment, experimenter needs treatment of cancer.In another embodiment, experimenter needs or is considered to give anticancer to treat (treatment of for example, carrying out with any anticancer therapeutic agent as herein described).In some embodiments, described method comprises whether definite patient suffers from the step of cancer (for example, solid tumor cancer or fibrosis cancer); And the step that gives AHCM and anticarcinogen for above-mentioned definite result.

In other embodiments, in the risk of experimenter in cancer development or cancer return, for example, there is the experimenter (experimenter for example, with BRCA1 sudden change of preneoplastic lesion (pre-neoplasia) or cancer genetic predisposition; Or the patient with breast cancer who treats by auxiliary treatment (adjuvant setting) (for example,, with tamoxifen)).

In other embodiments, (for example, mid-term) cancer or metastatic cancer that experimenter suffers from early-stage cancer or further develops.

In one embodiment, experimenter has and is selected from following one or more entity fibrosis tumor: cancer of pancreas (pancreatic cancer) (for example, pancreas adenocarcinoma (pancreatic adenocarcinoma)), breast carcinoma, colorectal cancer, pulmonary carcinoma are (for example, small cell lung cancer or nonsmall-cell lung cancer), skin carcinoma, ovarian cancer, carcinoma of prostate, cervical cancer, human primary gastrointestinal cancers (for example, carcinoid (carcinoid) or substrate cancer), gastric cancer, incidence cancer, renal carcinoma or hepatocarcinoma, or described cancer metastasis focus (metastatic lesion).In other embodiments, described experimenter has hyperproliferative cancer state (cancerous condition) (for example, state (pre-malignant condition) or malignant tumor state (malignant condition) before benign state, malignant tumor).Experimenter can be the experimenter in ill risk, and for example, its relatives suffer from the experimenter of described disease or have the experimenter of the inherited character (genetic trait) relevant to the ill risk of described disease.In one embodiment, described experimenter can be for Symptomatic or asymptomatic.In embodiment, in experimenter's oncogene or gene outcome, exist and change.In embodiment, experimenter for example, for accepting the patient for the treatment of of cancer (, identical or other anticarcinogen, operation and/or radiation).In embodiment, experimenter for example, for accepting the patient for the treatment of of cancer (, other anticarcinogen, operation and/or radiation).In one embodiment, described experimenter had not accepted treatment of cancer.

In one embodiment, described experimenter is the patient who suffers from metastatic cancer, for example, (cancer of pancreas (for example for cancer disclosed herein, pancreas adenocarcinoma), transitivity form for example, in breast carcinoma, colorectal cancer, pulmonary carcinoma (, small cell lung cancer or nonsmall-cell lung cancer), skin carcinoma, ovarian cancer or hepatocarcinoma one or more).

In one embodiment, described experimenter is for suffering from the patient of intractable (treatment-resistant) cancer or hyperproliferative disease.

In some embodiments, the selected method of acceptance this paper that is used for or the experimenter of pharmaceutical composition do not suffer from nephropathy or the relevant disease of kidney.

In one embodiment, the experimenter for the treatment of is mammal, and for example, primate, is generally mankind's (for example, suffering from cancer as herein described or tumor or the patient in described cancer or the ill risk of tumor).

In one embodiment, the experimenter for the treatment of suffers from hyperproliferative disease, for example, and hyperproliferative connective tissue disease (for example, hyperproliferative fibrotic disease).In one embodiment, described hyperproliferative fibrotic disease is multisystem or organ specific.Exemplary hyperproliferative fibrotic disease includes but not limited to: multisystem disease (for example, scleroderma graft versus host disease (sclerodermatous graft-versus-host disease) in Sjogren's syndrome disease, multifocal fibrosclerosis disease (multifocal fibrosclerosis), bone marrow transplantation receptor, the systemic fibrosis of kidney source property (nephrogenic), scleroderma) and organ specificity disease (for example, the fibrosis of lung, liver, heart, kidney, pancreas, skin and other organ).

In other embodiments, the experimenter for the treatment of suffers from hyperproliferative heredity disease, for example, is selected from the syndromic hyperproliferative heredity of Marfan Cotard or Loeys-Dietz disease.

In other embodiments, described hyperproliferative disease (for example, hyperproliferative fibrosis disease) is selected from one or more in following: chronic obstructive pulmonary disease, asthma, aortic aneurysm, radiation-induced fibrosis, skeletal muscle myopathy, diabetic nephropathy and/or arthritis.

Therapeutic alliance

In one embodiment, for example, by AHCM and treatment,, treatment of cancer (for example, one or more anticarcinogen, operation and/or radiation) is combined and is given.Term " chemotherapeutant/chemotherapeutics (chemotherapeutic/chemotherapeutic agent) " and " anticarcinogen " are used interchangeably in this article.Giving of AHCM and treatment of cancer can be sequential (overlapping or not overlapping) or while.Can for example, in treatment (, treatment of cancer) process continuously or carry out off and on the administration of AHCM.

In embodiment, before starting to give treatment of cancer, start AHCM administration, for example, before treatment of cancer at least 1 day, 2 days, 3 days or 5 days or 1 week, 2 weeks, 3 weeks, more than 4 weeks or 5 weeks start AHCM administration (for example, giving AHCM for minimum two weeks before treatment of cancer).In embodiment, before treatment of cancer starts, be no more than 5 days, start AHCM administration when 10 days, 20 days, 30 days, 60 days or 120 days.In embodiment, before treatment of cancer, start AHCM administration; And, for example, for example, when reaching standard (, time-based standard (, giving AHCM predetermined number of days or predetermined AHCM administration number of times)), just start described treatment of cancer.In embodiment, described standard is for reaching previously selected AHCM level, for example, and the chosen in advance level in serum or blood plasma.In one embodiment, described standard is that biomarker reaches previously selected level in blood plasma or serum, and described biomarker includes but not limited to: collagen protein I, collagen protein III, collagen protein IV, transforminggrowthfactor-β1 (TGF-β 1), Connective Tissue Growth Factor (CTGF) or Thrombospondin 1 (TSP-1).In another embodiment, described standard is that shape of tumor changes the previously selected level that reaches.

In one embodiment, as described herein, described AHCM administration and treatment (for example, treatment of cancer) are carried out and/or are carried out simultaneously for sequential.

In embodiment, the chosen in advance of accepting treatment of cancer experimenter gives AHCM or maintains the AHCM (for example, the blood plasma level of AHCM) of chosen in advance level in the time period.For example, during giving treatment of cancer whole or in retaining during anticarcinogen whole of chosen in advance level, maintain AHCM treatment in experimenter.

Conventionally, at whole treatment of cancer planning period, all continue AHCM treatment.In another embodiment, before stopping, treatment of cancer ends AHCM administration.In other embodiments, after stopping, treatment of cancer proceeds AHCM administration.

In embodiment, give separately or combine with treatment of cancer to give two doses or multi-agent AHCM more.In one embodiment, in the course for the treatment of, with sub-resisting hypertension dosage and resisting hypertension dosage, give described AHCM.For example, can treatment of cancer (for example, the treatment of carrying out to improve the anticarcinogen of mean arterial pressure, for example, the treatment of for example, carrying out with anti-angiogenic medicaments (, Arastin, Sutent or Sorafenib)) before or in treatment, give the AHCM of sub-resisting hypertension dosage; Continue with the AHCM of follow-up hypertension dosage.

In one embodiment, within the following time or at least following time, give continuously substantially AHCM (giving separately or combine to give): 15 minutes, 30 minutes, 45 minutes; Or 1 hour, 5 hours, 10 hours, 24 hours; 2 days, 5 days, 10 days, 14 days; 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks; 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months; 1 year, 2 years, 3 years, 4 years, 5 years; Or the time more of a specified duration.In one embodiment, described AHCM is given with slow releasing preparation.In some embodiments, AHCM is mixed with for sending continuously, for example, orally sends continuously, subcutaneous send continuously or intravenous is sent continuously.In one embodiment, for example, for example, via implantable device (, pump (, subcutaneous pump), implant or bank agent (depot)), give AHCM.Can be optimized described delivering method, make within predetermined period (for example,, in the following time or at least following time: 15 minutes, 30 minutes, 45 minutes; 1 hour, 5 hours, 10 hours, 24 hours; 2 days, 5 days, 10 days, 14 days; 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks; 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months; 1 year, 2 years, 3 years, 4 years, 5 years; Or the time more of a specified duration), in experimenter, give and/or maintain AHCM dosage as described herein (for example, standard dose, sub-hypertension dosage or higher than the dosage of standard dose).The AHCM substantially continuous or release delivery that extends or preparation (have or do not have chemotherapy) is used in and in a few hours, a couple of days, several weeks, several months or several years, cancer is prevented or treat.In one embodiment, described treatment of cancer is selected from one or more in following: nanometer (is for example treated, virus cancer therapeutic agent (for example, oncolytic herpes simplex virus (HSV)), lipid nanometer granule (for example, Liposomal formulation (for example, pegylated liposomal doxorubicin

)) or polymer nano granules); Be bonded to the antibody of cancer target spot; RNAi or antisense RNA reagent; Chemotherapeutics (for example, cytotoxic agent or cytostatic agent (cytostatic agent)); Radiation; Or hands art; Or the combination in any of above-mentioned treatment.Other example that can be used for the anticancer therapy of combining with AHCM is below provided.

In other embodiments, described AHCM and/or treatment are (for example, treatment of cancer or hyperplasia treatment) for example, combine and give with the inhibitor (" short fibrosis approach restrainer ") of short fibrosis approach (, depending on or do not rely on the approach of TGF-β and/or CTGF activation).In one embodiment, described AHCM and/or treatment of cancer are combined and are given with one or more in following reagent: Endothelin 1 inhibitor, PDGF inhibitor, Wnt/ beta-catenin (catenin) inhibitor, IGF-1 inhibitor, TNF-alpha inhibitor and/or IL-4 inhibitor.In another embodiment, described AHCM and/or treatment of cancer are combined and are given with Endothelin 1 inhibitor and/or PDGF inhibitor.In other embodiments, described AHCM and/or treatment of cancer are combined and are given with the inhibitor of following one or more reagent: 4 type chemokine receptors (CXCR4) (for example, AMD3100, MSX-122); Stromal cell derived factor-1 (SDF-1) (for example, tannic acid); Hedgehog (for example, GDC-0449, cyclopamine or GANT58).

The administration of AHCM, treatment of cancer and/or fibrosis approach restrainer can be sequential (being with or without overlapping) or (for example, as described herein) simultaneously.

Treatment of cancer

The cancer for the treatment of in one embodiment, is epithelium malignant tumor, mesenchyme malignant tumor or hematologic malignancies.In embodiment, the cancer for the treatment of be solid tumor (for example, carcinoid, cancer (carcinoma) or sarcoma (sarcoma)), soft tissue neoplasms (for example, haemachrome malignant tumor (heme malignancy)) and metastatic lesion (for example, any cancer metastasis focus disclosed herein).In one embodiment, the cancer for the treatment of is fibrosis solid tumor or short desmoplastic solid tumor, the cancer of for example, treating is the tumor with following one or more features: limited tumor perfusion, hard pressed blood vessel or Fibrotic mesenchyma stroma of tumors.In one embodiment, described solid tumor is selected from one or more in following: cancer of pancreas (for example, pancreas adenocarcinoma), breast carcinoma, colorectal cancer, pulmonary carcinoma (for example, small cell lung cancer or nonsmall-cell lung cancer), skin carcinoma, ovarian cancer or hepatocarcinoma.Other example of the cancer for the treatment of is provided herein hereinafter.

In another embodiment, described AHCM and treatment of cancer (for example, one or more anticarcinogen, operation and/or radiation) combined and given.In one embodiment, described treatment of cancer comprises one or more in following: cancer therapeutic agent, comprise that for example nanometer treatment (for example, one or more nanometer therapeutic agents, (for example comprise viral cancer therapeutic agent, oncolytic herpes simplex virus (HSV)), lipid nanometer granule (for example, pegylated liposomal doxorubicin

) or polymer nano granules); One or more treatment of cancer antibody (for example, Anti-HER 2, anti-egfr antibodies, anti-CD 20 antibodies); RNAi and antisense RNA reagent; One or more chemotherapeutics (for example, low-molecular-weight chemotherapeutics, comprises cytotoxic agent or cytostatic agent); Radiation; Or hands art; Or the combination in any of above-mentioned treatment.Can use the combination in any of one or more AHCM and one or more treatment patterns, (for example, first, second, third) nanometer therapeutic agent, antibody reagent, low-molecular-weight chemotherapeutics, radiation.Exemplary cancer therapeutic agent includes but not limited to: nanometer therapeutic agent (for example, one or more lipid nanometer granules (for example, Liposomal formulation (for example, pegylated liposomal doxorubicin

or liposome paclitaxel (for example,

)) or polymer nano granules), one or more low-molecular-weight chemotherapeutics (for example, gemcitabine (gemcitabine), cisplatin, epirubicin (epirubicin), 5-fluorouracil, paclitaxel (paclitaxel), oxaliplatin or folinic acid (leucovorin)), one or more anticancer target spots (for example, growth factor receptors is as HER-2/neu, HER3, VEGF) antibody, one or more tyrosine kinase inhibitors, for example, comprise low-molecular-weight reagent and antibody reagent, as Sutent, Erlotinib (erlotinib), gefitinib (gefitinib), Sorafenib, Conmana (icotinib), Lapatinib (lapatinib), HKI-272 (neratinib), ZD6474 (vandetanib), BIBW2992 or XL-647, anti-egfr antibodies (for example, Cetuximab (cetuximab), Victibix (panitumumab), prick calamite monoclonal antibody (zalutumumab), Buddhist nun's trastuzumab (nimotuzumab), how former times wood monoclonal antibody (necitumumab) or horse trastuzumab (matuzumab)).Additional examples for the chemotherapeutics of therapeutic alliance has below been described.

The chemotherapeutics of in one embodiment, combining use with AHCM is cytotoxic agent or cytostatic agent.Exemplary cytotoxic agent (for example comprises anti-microtubule agent, topoisomerase enzyme inhibitor, irinotecan (irinotecan)) or taxanes (for example, docetaxel), antimetabolite, mitotic inhibitor, alkylating agent, intercalator (intercalating agents), can interfering signal Signal Transduction Pathways reagent, promote the reagent of apoptosis and radiation.In other embodiments, described method can for example, be combined use with immunomodulator (, IL-1, IL-2, IL-4, IL-6 or IL-12 or interferon-ALPHA or interferon gamma or immune cell growth factor are as GM-CSF).

In one embodiment, during disease active (active disorder) or disease alleviate (remission) or more inactive during, AHCM is combined and given individually or with one or more treatments of cancer as herein described, for example, for cancer prevention (, give separately or combine and give with cancer prevention agent).Can be before treatment or prevention, with treatment or prevention simultaneously, after treatment or prevention, or during disease relaxes, AHCM is combined and is given individually or with one or more treatments of cancer as herein described, with prophylaxis of cancer.In one embodiment, described treatment of cancer is given with AHCM simultaneously, the sequential form that gives or combine with both gives.

In one embodiment, described AHCM is given separately or combine and give with cancer prevention agent, for example, for example, with excessive risk experimenter (, suffer from preneoplastic lesion or there is the experimenter (experimenter for example, with BRCA1 sudden change) of cancer genetic predisposition; Or the patient with breast cancer who treats with tamoxifen) in, cancer is treated or prevented.

In some embodiments, AHCM independent or that combine with treatment of cancer is the First Line treatment (first line treatment) to cancer, for example, in the experimenter of another medicine who is used for before treating cancer, uses described AHCM.

In other embodiments, AHCM independent or that combine with treatment of cancer is second line treatment to cancer, for example, in the experimenter of another medicine who has been used for before treating cancer, uses described AHCM.

In other embodiments, independent or the AHCM that combine with treatment of cancer for to the 3rd line treatment of cancer, the 4th line is treated or more than the treatment of the 4th line, for example, given before two kinds, three kinds or surpass the experimenter of three kinds of other medicines that are used for treating cancer in use described AHCM.

In other embodiments, using described AHCM as attached treatment, (adjunct therapy) gives, for example, and the treatment except primary treatment.

In one embodiment, using described AHCM as auxiliary treatment, (adjuvant therapy) gives.

In other embodiments, using described AHCM as new auxiliary treatment, (neoadjuvant therapy) gives.

In some embodiments, at the excision of cancer/give described AHCM to experimenter before or after removing.

In some embodiments, before the radiotherapy of cancer, during or to experimenter, give described AHCM afterwards.

In some embodiments, for example, for example, to experimenter's (being about to accept, accept or accepted the cancer patient for the treatment of of cancer (treatment of, carrying out with chemotherapeutics, radiotherapy and/or operation)), give described AHCM.

In other embodiments, before described treatment of cancer, give described AHCM.In other embodiments, described AHCM and described treatment of cancer give simultaneously.In other embodiments, before treatment of cancer and with treatment of cancer, give described AHCM simultaneously.In situation about giving at the same time, can after stopping, described treatment of cancer continue to give described AHCM.

In other embodiments, by described AHCM and described treatment of cancer is sequential gives.For example, can with treatment of cancer, treat start before or after treatment of cancer stops, give AHCM.In one embodiment, described AHCM administration and treatment of cancer is overlapping and continue after treatment of cancer stops.In one embodiment, described AHCM is given simultaneously, sequentially gives or give with the combination (a combination of concurrent administration) of while administration, then carry out the single therapy (monotherapy) for the treatment of of cancer or AHCM.

In one embodiment, described method comprises AHCM is given as the first therapeutic agent, gives subsequently treatment of cancer (treatment of for example, carrying out with the second therapeutic agent, radiotherapy and/or operation).In another embodiment, described method comprises and first gives treatment of cancer (for example, the treatment of carrying out with the first therapeutic agent, radiotherapy and/or operation), gives subsequently AHCM as the second therapeutic agent.In other embodiments, described method comprises AHCM and the second therapeutic agent, the 3rd therapeutic agent or more other therapeutic agents (for example, anticarcinogen as herein described) is combined and given.

AHCM as herein described and/or anticarcinogen can be carried out to whole body administration (for example, oral administration, parenteral, subcutaneous administration, intravenous administration, rectally, intramuscular administration, intraperitoneal administration, intranasal administration, percutaneous dosing or by inhaler or intracavitary unit (intracavitary installation) administration) to experimenter.Conventionally, the oral AHCM that gives.In some embodiments, in tumor, give (for example,, via oncolytic virus) described AHCM and/or anticarcinogen.

In some embodiments, described AHCM is given as pharmaceutical composition, described pharmaceutical composition comprises one or more AHCM and pharmaceutically acceptable excipient.

In embodiment, described AHCM gives in compositions or described AHCM is present in compositions, for example pharmaceutical composition (for example, same Nanoparticulate compositions).

In other embodiments, described AHCM and treatment of cancer for example, for example, are given with different compositions (, pharmaceutical composition (, Nanoparticulate compositions)).In other embodiments, by described AHCM and treatment of cancer respectively but give (for example, be oral give or be intravenous give) via same approach.In some embodiments, described AHCM and treatment of cancer give (for example, the oral AHCM of giving and intravenous gives cancer therapeutic agent) via different approaches.In other situation, AHCM and treatment of cancer for example, are given in same compositions (, pharmaceutical composition).

Monitoring experimenter

Method of the present invention can further comprise the step that experimenter is monitored, and for example, monitors the variation (for example, increase or reduce) of following one or more indexs: tumor size; Level or the signal of one or more in transforminggrowthfactor-β1 (TGF-β 1), Connective Tissue Growth Factor (CTGF) or Thrombospondin 1 (TSP-1); Tumor collagen protein I level; Fibrotic amount, interstitial pressure (interstitial pressure); Blood plasma biomarker or serum biomarker, for example, collagen protein I, collagen protein III, collagen protein IV, TGF-β 1, CTGF, TSP-1; The level of one or more cancer markers; The speed of new pathological changes appearance, metabolism, anoxia evolution (hypoxia evolution); The appearance of new disease related symptom; The size of piece of tissue, for example, reduces or stablizes; Quality of life, for example, the degree of disease association pain; Whether histologic analysis, lobule pattern (lobular pattern) and/or mitotic cell exist; The vascularization of tumor invasiveness, primary tumo(u)r, transfer diffusion; Tumor size and the position that can use multi-modal imaging technology (multimodal imaging techniques) to observe; Or any other parameter relevant to clinical effectiveness (clinical outcome).Can in following period one or more, to experimenter, monitor: before treatment starts; During treatment; Or after having given one or more treatment key elements.Monitoring can be used for evaluating to same AHCM separately or combine with same anticarcinogen and carry out the demand of further treating or for evaluating the demand of the reagent with extra being carried out to additional procedures.Conventionally, the reduction of above-mentioned one or more parameters shows the improvement of experimenter's situation.

Method of the present invention can further comprise the step that the nucleic acid from experimenter or protein are analyzed, and for example, experimenter's genotype is analyzed.Described analysis for example can be used for evaluating the suitability of optional treatment, or makes a choice between it, for example the including in of given dose, delivery modality, Delivery time, attached treatment (for example,, with the second reagent administering drug combinations); Or be generally used for measuring experimenter's possible medicine response Phenotype or genotype.Can to nucleic acid or protein, analyze in any stage for the treatment of, but preferably before AHCM and/or anticarcinogen, analyze giving, thereby be identified for the suitable dosage of AHCM and the therapeutic scheme (for example, amount or the therapeutic frequency of each treatment) of experimenter's preventative or therapeutic treatment.

Dosage form

On the other hand, the invention is characterized in pharmaceutically acceptable compositions, described compositions comprises AHCM and anticarcinogen in single dosage form, for example, and micromolecule or protein (for example, antibody).In another embodiment, in nano-particle, provide one of AHCM and anticarcinogen or the two is provided.AHCM and anticarcinogen can be in different entities or same entities.For example, if provide with different entities, can AHCM be provided and provide anticarcinogen (for example with the second nano-particle by the first nano-particle, wherein said the second nano-particle (for example has the architectural characteristic different from described the first nano-particle, size or composition) or functional characteristic (for example, release dynamics or pharmacodynamic profiles)).Or, can on same entity (for example,, in same nano-particle), provide AHCM and anticarcinogen.

On the other hand, the invention is characterized in the pharmaceutically acceptable compositions (for example, nano-particle) that comprises AHCM (for example, AHCM as herein described).In one embodiment, AHCM is in dosage form as herein described, for example, and therapeutic dosage forms standard, sub-resisting hypertension dosage form or higher than the dosage form of therapeutic dosage forms standard.

In one embodiment, AHCM is mixed with for example, according to the dosage form of antihypertensive therapy dosage form standard or heart failure resistance therapeutic dosage forms standard (, as described herein therapeutic dosage forms standard).

In some embodiments, AHCM lower than the dosage form of antihypertensive therapy dosage form standard or heart failure resistance therapeutic dosage forms standard (is for example mixed with, for example, the dosage form of 0.01 times, 0.02 times, 0.03 times, 0.04 times, 0.05 times, 0.06 times, 0.07 times, 0.08 times, 0.09 times, 0.1 times, 0.15 times, 0.16 times, 0.2 times, 0.3 times, 0.4 times, 0.5 times, 0.6 times, 0.7 times lower than therapeutic dosage forms standard (, therapeutic dosage forms standard as herein described)).

In other embodiments, AHCM higher than the dosage form of antihypertensive therapy dosage form standard or heart failure resistance therapeutic dosage forms standard (is for example mixed with, for example, 1.1 times, 1.5 times, 1.7 times, 2 times, 3 times, 4 times, 5 times or 10 times of above dosage forms higher than therapeutic dosage forms standard (, therapeutic dosage forms standard as herein described)).

On the other hand, the invention is characterized in the pharmaceutically acceptable compositions that comprises anticarcinogen (for example, anticarcinogen as herein described), for example, as nano-particle (, being configured for the nano-particle of methods described herein).

On the other hand, the invention is characterized in treatment test kit (for example, being used for the treatment of cancer), the AHCM that described test kit comprises independent AHCM or for example, combines with treatment as herein described (, anticarcinogen), and optionally comprise operation instruction.In embodiment, described test kit comprises one or more dosage forms as herein described, pharmaceutical preparation or nano-particle.

Delivering method

On the other hand, the invention is characterized in and to destination organization (for example make reagent (for example, whole body administration reagent, as diagnostic agent or developer), approaching optimization or making reagent for example, to the optimized method of sending of destination organization (, cancer) cancer).Described method comprises:

To experimenter, give hypotensive agent and/or collagen-modified dose (" AHCM "); And

Optionally, to described experimenter, give reagent (for example, diagnostic agent or developer).

In embodiment, described method comprises one or more in following:

A) AHCM is hypotensive agent, and is given with therapeutic dose standard, sub-resisting hypertension dosage or higher than the dosage of therapeutic dose standard;

B) hydrodynamic diameter of reagent (for example, diagnostic agent or developer) is greater than 1nm, 5nm or 20nm, for example, is nano-particle;

C) reagent is developer, for example, and radioreagent, NMRA reagent, contrast agent (contrast agent); Or

D) with dosage regimen as herein described, experimenter is treated, for example, before giving described reagent, (for example, giving before described reagent at least 1 day, 2 days, 3 days or 5 days; Or 1 week, 2 weeks, 3 weeks, 4 weeks or 5 weeks are when above) start to give AHCM.

In embodiment, for example, to be enough to change (, the strengthening) distribution of described reagent or the amount of effect, give described AHCM.In one embodiment, for example, to be enough to change the distribution of (, strengthening) described reagent or effect but self to be not enough to suppress or to stop the amount of tumor growth or development to give AHCM.

In embodiment, so that cancer therapeutic agent produces the dosage of following one or more variations in experimenter's tumor or tumor vessel, give AHCM: reduce collagen protein level or generation, reduction tumor fibrosis, improve mesenchymal neoplasm transportation, improve tumor perfusion or strengthen and penetrate or spread.

In embodiment, for example, with treatment of cancer (, treatment as described herein) described experimenter is further treated.

In embodiment, described experimenter behaves or non-human animal (for example, mice, rat, non-human primate, horse or cattle).

On the other hand, the invention is characterized in diagnostic kit (for example, for cancer diagnosis), described test kit comprise independent AHCM or with reagent described herein (for example, diagnostic agent or developer) AHCM of associating, and optionally comprise operation instruction.

Screening test method

On the other hand, the invention is characterized in method or the algoscopy for the identification of AHCM.Described method or algoscopy comprise the steps: to provide cancerous cell or cancer relevant cell (for example, the culture of cancer associated fibroblast cell); Described cancerous cell or cancer relevant cell are contacted with candidate agent; Detect the variation of cancerous cell when having or not candidate agent.In one embodiment, the variation detecting comprises one or more of following variation: raising or the reduction of the raising of the raising of TGF-β 1 level or reduction, Connective Tissue Growth Factor (CTGF) level or reduction or collagen protein (for example, collagen protein I) level.In one embodiment, described candidate agent is selected from one or more in following reagent: renin-angiotensin-aldosterone system antagonist (" RAAS " antagonist), Angiotensin-Converting (ACE) inhibitor, angiotensin-ii receptor blockers (AT ₁blocker), Thrombospondin 1 (TSP-1) inhibitor, transforminggrowthfactor-β1 (TGF-β 1) inhibitor and Connective Tissue Growth Factor (CTGF) inhibitor.Applicable candidate agent has reduced for example, in TGF-β 1 level (, total TGF-β 1 and/or activation TGF-β 1), Connective Tissue Growth Factor (CTGF) level or collagen protein level one or more.

Described method or algoscopy can further comprise the steps: Therapeutic Method or algoscopy and reference value to compare, and the difference between Therapeutic Method and contrast method is compared, described reference value is for example, the value obtaining when not there is not candidate agent or for example, by (adding contrast agents, positive reagent (for example, losartan) or negative agents (for example, saline control)) value that obtains.

Described method or algoscopy can be in vitro, in body or both are in conjunction with carrying out.In one embodiment, described method or algoscopy comprise: in vitro candidate agent is evaluated to (culture that for example, uses cancer relevant cell).In this type of embodiment, described candidate agent is added into culture medium; And the increase and decrease of TGF-β 1 level of conditioned medium, Connective Tissue Growth Factor (CTGF) level or collagen protein level is analyzed.

In another embodiment, described candidate agent is given to experimenter (for example, animal model, for example, animal tumor model).In this type of embodiment, by candidate agent, give experimenter under optimum conditions; And the increase and decrease of experimenter's TGF-β 1 level, Connective Tissue Growth Factor (CTGF) level or collagen protein level is analyzed.In one embodiment, according to the description in appended embodiment, the level of these parameters is analyzed.

In other embodiments, in vivo to using the candidate agent of external test method evaluation to test.

On the other hand, the invention is characterized in compositions or the purposes of AHCM agent (AHCM agent independent or that combine with anticarcinogen as herein described) in treatment cancer as herein described or tumor that is used for the treatment of cancer as herein described or tumor.

Title or with the key element of numeral or alpha code, for example, (a), (b), (i) etc., only exists for easy-to-read.In presents to title, with the use of the key element of numeral or alpha code and do not require that described step or key element carry out, also do not require described step or key element all discrete (discrete) mutually in alphabetical order.

For whole publications mentioned in this article, patent application, patent and other list of references, by reference its integral body is incorporated to herein.

From specification, drawings and the claims, will obviously find out other features, objects and advantages of the present invention.

Accompanying drawing explanation

Fig. 1 is for showing that losartan (10 μ mol/L) is in vitro on one of the impact of following aspect group of block diagram: total TGF-β level and activation TGF-β level and cancer associated fibroblast cell (CAF) are synthetic to collagen protein I's.

Fig. 2 A-Fig. 2 B shows the impact that losartan is produced collagen protein in tumor.

Fig. 2 A shows and is presented in 2 time-of-weeks, than in contrast, through the collagen protein level (evaluating by SHG imaging) of the HSTS26T of losartan treatment tumor, there is one group of photo that dose dependent reduces (10mg/kg/ days, 20mg/kg/ days and 60mg/kg/ days).Scale=200 μ m.

The dose response curve of the losartan dosage that Fig. 2 B shows 10mg/kg/ days, 20mg/kg/ days and 60mg/kg/ days on the impact of SHG level, when within 15 days, finishing, the losartan dosage of 10mg/kg/ days, 20mg/kg/ days and 60mg/kg/ days makes respectively SHG level reduce by 20%, 33% and 67%, show in the tumor through losartan treatment the dependent reduction of collagen protein level generation dosage.Between matched group and two higher dosage groups (20mg/kg/ days and 60mg/kg/ days), exist statistically-significant difference (*).20mg/kg/ days groups and within 60mg/kg/ days, between group, also exist statistically-significant difference ( ).

Fig. 3 is the block diagram that is presented at the dose response of losartan and collagen content in HSTS26T tumor.The losartan treatment of 20mg/kg/ days and 60mg/kg/ days makes respectively collagen protein I dyeing reduce by 42% and 63%.Dyeing in each treatment group and the matched group of accepting saline are compared.

Fig. 4 is for showing that losartan reduces the block diagram of the effect of mean arterial pressure (MABP) in mice in the mode of dose dependent.Although MABP had been reduced to 10mm Hg (* p < 0.04) in 20mg/kg/ days, MABP still remains on interior (70mmHg-95mmHg) (13) normal range of SCID mice.On the contrary, when animal being treated with 60mg/kg/ days, reduced the MABP of 35mm Hg (* * p < 0.04) lower than the normal MABP scope of SCID mice.

Fig. 5 A-Fig. 5 D shows the impact of losartan on collagen protein level in tumor.

Fig. 5 A shows the collagen protein I of tumor biopsy and the result of nucleus immunostaining in the tumor of L3.6pl and MMTV contrast and losartan treatment (20mg/kg/ days).Scale=100 μ m.Losartan treatment (for example, 20mg/kg/ days) has significantly reduced the collagen protein level in the tumor for the treatment of.

Fig. 5 B is the block diagram of having summed up the effect after two weeks with the losartan treatment of 20mg/kg/ days; Losartan treatment has significantly reduced the collagen protein I immunostaining in L3.6pL (p < 0.03) and FVB MMTV PyVT respectively 50% (p < 0.05) and 47% (P < 0.05).

Fig. 5 C is the collagen protein I of tumor biopsy and one group of photo of nucleus immunostaining in the tumor of demonstration HSTS26T and MU89 contrast and losartan treatment (20mg/kg/ days).Notice the reduction that can not detect at the collagen protein I immunostaining apart from HSTS26T borderline tumor 200 μ m places.This phenomenon is not obvious in the Mu89 tumor through treatment, wherein, and the dyeing that has some stubbornnesses in marginal area and the central area of tumor.Scale=100 μ m.

Fig. 5 D makes collagen protein I immunostaining significantly reduce separately the block diagram of the effect of 44% (p < 0.02) and 20% (p < 0.05) for having summed up losartan in HSTS26T and Mu89.

Fig. 6 shows losartan one group of block diagram on the impact of TSP-1, activation TGF-β 1 and total TGF-β 1 and collagen protein I in HSTS26T tumor.The losartan (15mg/kg/ days) of the animals received for the treatment of in drinking water.In treatment, cut tumor after two weeks, homogenization, and by total TGF-β 1 level of elisa assay and activation TGF-β 1 level.Notice after losartan treatment, TSP-1 has reduced by 3.5 times, activation TGF-β 1 and has reduced by 4 times and collagen protein I has reduced by 2 times (p < 0.05).

Fig. 7 A shows the effect that losartan makes tumor TSP-1 immunostaining reduce in MU89 and HSTS26T tumor.In HSTS26T tumor, after losartan treatment, the variation of TSP-1 is consistent with the variation of collagen protein I immunostaining; TSP-1 level reduces at tumor center place, but apart from borderline tumor 200 μ m places, is still keeping high level.TSP-1 border (margin) is larger (the 500 μ m apart from edge) in Mu89 tumor.Scale=100 μ m.

Fig. 7 B makes TSP-1 immunostaining significantly reduce separately the block diagram of the effect of 73% (p < 0.04) and 24% (p < 0.03) for having summed up losartan treatment in HSTS26T and Mu89 tumor.

Fig. 8 A-Fig. 8 C shows losartan in the effect improving aspect the sending of nano-particle and nanometer therapeutic agent.

Fig. 8 A shows the nano-particle of the diameter 100nm that in total dross, (i.t.) injects at two photos (contrast and losartan) and the block diagram of the distribution of HSTS26T tumor.Losartan has significantly improved the nano-particle injecting in (p < 0.001) tumor, and in the distribution of two kinds of tumor types, (HSTS26T is 1.5 times; In Mu89, be 4 times).The analysis of distribution pattern is shown to control tumor has nano-particle in less tumor, and most nano-particle is returned to and is accumulated on tumor surface by needle track.On the contrary, the tumor through treatment has nano-particle in a considerable number of tumor.Scale=100 μ m.

Two photos (contrast and losartan) and the block diagram of the distribution of viral infection when Fig. 8 B shows after the HSV that sums up intratumor injection expressing green fluorescent protein 24 hours.In control tumor, HSV infects and is limited to the cell that is close to injection site place, and the tumor of losartan treatment has wider HSV transmission of infection in tumor.Scale=1mm.Losartan has significantly increased the virus disseminating in (p < 0.05) HSTS26T and Mu89 tumor.

Fig. 8 C has shown that the nano-particle of the diameter 100nm that summary intravenous (i.v.) injects is at two photos (contrast and losartan) and the block diagram of the distribution of L3.6pl tumor.Nano-particle is positioned near the blood vessel of perfusion.Compare with control tumor, in the tumor of losartan treatment, the content of nano-particle has improved 2 times (p < 0.05).Scale=100 μ m.

Fig. 9 is for showing the block diagram of the variation of HSTS26T tumor aspect diffusion coefficient after losartan treatment.To implanting the IgG diffusion coefficient of the HSTS26T tumor of SCID mouse back window chamber (dorsal window chamber), measure.Treatment animal is injected acceptance (40mg/kg/ days) losartan by i.p., and control animals received saline.Result shows that the diffusion coefficient by multiphoton fluorescence recovery (multiphoton fluorescence recovery after photobleaching, FRAP) records after photobleaching significantly improves (p < 0.04).

Figure 10 is the representative distribution curve that basis and tumor vascular distance (penetration depth) are described the nanosphere mark (fractions) of injection.After from intravenous injection nanosphere, in the frozen section of the tumor of excision in 24 hours, nanosphere penetration depth is analyzed.18 ± 5 μ ms (meansigma methods ± SE) of average characteristics penetration length from contrast are increased to 37 ± 6 μ m in the tumor after losartan treatment.Each tumor has been carried out the analysis in 10 regions in the tumor of 6 parts of contrasts and 6 parts of treatments.

Figure 11 A-Figure 11 D shows losartan and is significantly delaying use

or the effect of the growth aspect of the tumor of HSV treatment.

Figure 11 A-Figure 11 B shown from the linear graph of result that carries the mice of HSTS26T (A) and Mu89 (B) tumor, described mice before i.t. injection HSV with losartan or brine treatment 2 weeks.Independent losartan does not affect the growth of Mu89 or HSTS26T tumor.Compare with the independent tumor with HSV treatment, the delayed growth of the HSTS26T tumor for the treatment of with losartan and HSV is significantly more of a specified duration.The i.t. injection of HSV does not delay Mu89 tumor growth, but losartan and HSV therapeutic alliance have significantly slowed down the growth of Mu89 tumor.

Figure 11 C shows the effect aspect mouse tumor volume, with regard to L3.6p1 tumor, at i.v., pours into accept before losartan treatment (losartan and

) mice with accept independent

(only

) mice compare, there is less tumor.Between the mice of noticing at brine treatment and the mice of losartan treatment, there is not the difference of tumor size.

Figure 11 D is for being presented at the image of the obvious difference in size while pouring into latter a week between control tumor (left hurdle) and the tumor (right hurdle) of losartan treatment.Scale=1em.

perfusion is in the time of latter one week, and the tumor of losartan treatment (right hurdle) is less than control tumor (left hurdle).

Figure 12 A-Figure 12 B shows the relation between collagen structure and viral infection and necrosis.

In Figure 12 A, near Mu89 tumor boundaries, observe tumor collagen protein bundle.These collagen protein bundle occasionals are given prominence to (project) to tumor (black arrow), and tumor is separated into independent compartment.These compartments have seemed to limit the movement of HSV; This can be proved by the necrotic zone in the region surrounding at collagen protein bundle.When these tumors being treated with losartan, the collagen protein bundle at tumor boundaries place remains intact, but ledge becomes looser (illustration).This may allow virus disseminating (propagation) and necrosis to extend across limit (boundaries).Scale=100 μ m.

In Figure 12 B, the dense grid shape collagen protein network in HSTS26T is limited in injection point close region around by viral infection.When with losartan treatment, the density of described network reduces, and may allow virion to infect larger region and more tumor cells.Arrow is indicated respectively the cell of living cells and viral infection.Scale=100 μ m.

Figure 13 A-Figure 13 B shows the schematic diagram that the virus in Mu89 (A) and HSTS26T (B) tumor distributes and infects.Described schematic diagram has illustrated the impact of different collagen protein network structures on virus disseminating and distribution.Collagen fiber (1) limiting virus granule (spherosome, 2) is mobile and to not infecting the infection (3) of the cancerous cell of (4).

In Figure 13 A, the collagen protein bundle in Mu89 tumor is separated into tumor the isolated area that can not make virion pass.Losartan treatment makes described collagen protein bundle become unstable, and allows virion to move to another region from a region.

In Figure 13 B, the collagen structure in HSTS26T tumor is latticed sieve.Virion still can be propagated through described sieve, but can not extend from injection site far.Losartan treatment makes the network in inside tumor region become significantly unstable, and allows virus disseminating and infect larger region.

Viral infection (HSV immunostaining) and necrosis after Figure 14 A shows and inject HSV in HSTS26T and Mu89 21 days time.The brazilwood extract dyeing that has shown complete tumor region, necrosis and HSV immunostaining.Necrotic zone is marked by black arrow.Although do not have the difference that can detect between HSTS26T and the necrotic zone of Mu89, in Mu89, necrosis is limited in specific region, and slough (take HSV immunostaining as boundary) spreads all over HSTS26T tumor.Scale=2mm.

Figure 14 B is that the necrosis being presented in the tumor (HSTS26T and Mu89) of accepting losartan before HSV injects has produced the block diagram of the increase (p < 0.05) of twice.

Figure 15 shows the proliferation in vivo speed that losartan is processed rear HSTS26T and Mu89.Thereby tumor resection also dyes multiplication rate is assessed Ki67.After losartan treatment, there is not statistically-significant difference aspect positive Ki67 dyeing in HSTS26T and Mu89 tumor.Yet between the propagation of two kinds of tumor types, have significant difference, in HSTS26T tumor, the quantity of Ki67 positive cell exceeds 3 times.

Figure 16 shows the pcr analysis result that AGTR1 expresses in CAF, MU89 and HSTS26T cell.MU89 cell and CAF express AGTR1 and HSTS26T cell is not expressed.HUVEC is as positive control.GAPDH level discloses the cDNA that whole three kinds of samples have roughly the same amount.

Figure 17 A-Figure 17 D shows with AT ₁the effect of the angiotensin blocking-up that blocker or ACE inhibitor are carried out in making tumor microenvironment normalization.Shown the research to ARB, losartan.Angiotensin blocking-up: (A) make the breast tumor (MMTV) of mice and the interstitial density of matrix of pancreas tumor (L3.6PL) reduce; (B) reduced the compressive stress (compressive stress) in breast tumor (E0771) and pancreas tumor (Pan-02).(C) this has improved the mark of Perfused vessel (arrow) in tumor (E0771 illustrates), make to produce (D) medicine and oxygen send aspect more efficient and more effective normalization blood vessel network (E0771 illustrates).

Figure 18 A-Figure 18 D shows with AT ₁the effect of the angiotensin blocking-up that blocker or ACE inhibitor are carried out in improving the transportation of tumor Chinese medicine and distributing.Shown the research to ARB, losartan herein.Through tumor normalization, angiotensin blocking-up: (A) improve tumor oxygenate (oxygenation) (E0771 illustrates) by the perfusion strengthening, (B) makes blood vessel delivering drugs more quickly simultaneously.The restructuring of interstitial substrate (reorganization) also (C) has improved nano-particle penetrating in the short desmoplastic tumor (L3.6PL illustrates) (D).

Figure 19 A-Figure 19 E shows with AT ₁the blocking-up of angiotensin that blocker or ACE inhibitor are carried out is in the effect of improving aspect treatment of cancer effect.Shown the research to ARB, losartan.Combine the angiotensin blocking-up giving with chemotherapy: (A) improved the effect of low-molecular-weight chemotherapeutics doxorubicin in breast cancer model; (B) tumor growth that slowed down; And (C) increased animal survival rate (E0771 illustrates).Similarly, angiotensin blocking-up (D, E) has for example improved nano-particle by reducing tumor weight (D) and/or tumor size or volume (E)

effect in pancreas tumor (L3.6PL illustrates).

The specific embodiment

The present invention is at least partly based on following discovery: losartan (a kind of hypotensive agent) can improve sending and effect of cancer therapeutic agent.

For example, in being permitted eurypalynous cancer (, cancer of pancreas, breast carcinoma, pulmonary carcinoma, colorectal cancer), the abnormal substrate of tumor has limited sending of nanometer therapeutic agent.The undue growth of fibrous tissue hinders nanometer therapeutic agent to move in tumor with two kinds of mechanism: viscoelasticity resistance and sterically hindered.Fibrous tissue is highly viscoelastic, means that it is quite thick and hard, therefore the movement of these medicines is reduced to the sub-fraction of its typical rate.This type of is organized is extremely intensive grid substantially, there is the aperture roughly the same with the size of nanometer therapeutic agent, therefore described organize do not give the too many space of these medicines, and often by by described drug limits in (in intravenous injection in the situation that) near blood vessel or approach injection site place (at intratumor injection in the situation that) their movement is stopped.Except the cerebral tumor may be an exception, this barrier is present in all solid tumors, yet this barrier is the most remarkable in cancer of pancreas, breast carcinoma, pulmonary carcinoma and colorectal cancer.Nanometer therapeutic agent is because its size is larger with respect to the Kong Eryan that forms tumor microenvironment, thereby especially by fibrous tissue, hindered.

In some embodiments, applicant has proved that losartan has stoped the generation of substrate molecule (as collagen protein), and described substrate molecule is the ingredient of fibrous tissue dense grid.Losartan is considered to by suppressing TGF-β path and CTGF path, fibroblast and tumor cell be worked, and has limited thus their short fibrosis (pro-fibrotic) activity.It is by 1 receptor (AT of blocking-up Angiotensin II ₁) realize, described AT ₁in the fibroblast of kinds cancer and tumor cell, all highly express.Therefore, losartan has been blocked AT in many A signal pathways ₁downstream active, comprise the activation of TGF-β and CTGF.Because these two paths promote the collagen protein of fibrous tissue and the generation of other component, they are blocked permission fibrosis disappear (subside).Result makes to organize and is more similar to normal peripheral organs, is therefore easier to penetrate.

Proved that the treatment of carrying out with losartan has significantly reduced the collagen protein level (Fibrotic label) in a few types tumor herein, described tumor comprises pancreas tumor, breast tumor, cutaneous tumor and soft tissue neoplasms.And fibrosis reduction makes nanometer therapeutic agent have the mobility of improvement in tumor, this allows it to be easier to penetrate tumor; And it is wider to allow these medicines to distribute in whole tumor, this makes it more effective aspect neoplasm growth.Therefore, losartan makes nanometer therapeutic agent more effective for anticancer.

Particularly, applicant finds that losartan makes collagen protein (the interstitial substrate of several solid tumors) normalization, therefore contributes to penetrating of chemotherapeutant (for example, as high molecular (, nanoscale) chemotherapeutant).For example, Losartan in Reducing in breast carcinoma biopsy the level of the collagen protein I in isolated cancer associated fibroblast cell (CAF), and make the dependent reduction of substrates collagen generation dosage in the short desmoplastic mouse model of HBT, pancreas tumor and cutaneous tumor.Losartan has also improved nano-particle (for example, oncolytic herpes simplex virus (HSV) and pegylated liposomal doxorubicin

) distribution, curative effect and/or penetrate.

Low-molecular-weight therapeutic agent (much smaller than nanometer therapeutic agent) is not limited by interstitial substrate barrier, but is subject to similarly other barrier (as blood vessel abnormal and wither (collapsed)) impact.

In other embodiments, applicant finds that losartan promotes blood vessel blood pressure lowering, therefore improves sending of tumor perfusion and low-molecular-weight chemistry chemotherapeutics, thereby promotes sending of radiation and chemotherapeutics by blood vessel normalization.

Therefore, these reagent improve send (Figure 18 A-Figure 18 B) of molecule little as oxygen molecule (radiation and chemotherapy sensitizer) by blood vessel normalization; Also by interstitial substrate normalization, strengthen penetrate (Figure 18 C, Figure 18 D) of larger reagent simultaneously.By this reparation to whole tumor microenvironment, these reagent have strengthened low-molecular-weight chemotherapeutant and the effect of nanometer therapeutic agent in breast cancer model and cancer of pancreas model: cause tumor growth to decline and animals survived prolongation (Figure 19 A-Figure 19 E).Therefore, angiotensin inhibitor (for example, angiotensin receptor blocker) and ACE inhibitor can strengthen sending of therapeutic agent, and therefore carrying out therapeutic alliance for the anticarcinogen with all kinds has the suitability widely, described anticarcinogen comprises low-molecular-weight chemotherapeutant, micromolecule chemotherapeutant, biological preparation, nucleic acid reagent and nano-particle treatment.

Compare with other method, angiotensin blockers provides many advantages.Antiangiotensin treatment only makes blood vessel normalization, and is only approved for the indication of limited quantity.Meanwhile, ARB and ACE-I are had the hypotensive agent of controlled side effect by FDA approval conduct.Can make the extracellular matrix degrading enzyme of collagen matrices normalization not there is selectivity to tumor, can strengthen and invade profit and shift.ARB and ACE-I do not reinvent (matrix remodeling) relevant significant complications in normal structure to substrate, this makes it as hypotensive agent, have safety.As micromolecule reagent, ARB and ACE-I also can for example, send via the nano-carrier that contains chemotherapeutant (, liposome, nano-particle), to strengthen it, are positioned to tumor, thus further limiting toxicity.Anti-angiogenic agent (unique accessory drugs (adjunct) of sending to tumor through the enhancing medicine of FDA approval) is owing to reducing " hole " size of blood vessel wall, thereby can not improve sending of larger particles.Angiotensin blockers can be improved the antitumor diagnosis of all kinds and sending for the treatment of.

Therefore, disclose for improving sending and/or the method and composition of effect of cancer therapeutic agent.Disclose in the following way treatment or prophylaxis of cancer (for example, solid tumor, as short desmoplastic tumor) method and composition: by giving experimenter using hypotensive agent as single agents or for example, combining and give experimenter with cancer therapeutic agent (, the cancer therapeutic agent of size from large nanometer therapeutic agent to low-molecular-weight chemotherapeutics and/or oxygen).

First particular term is defined.

" approximately/approximately/roughly (about/approximately) " is often referred in the situation that consider character or the degree of accuracy of measurement, the acceptable error degree of institute's measured value.Exemplary error degree set-point or span 20% within; Generally within 10%; More generally within 5%, 4%, 3%, 2% or 1%.

Under the background of sending to tumor at reagent, " the sending " of using herein refer to by described reagent be placed as with following in one or more (or all) enough approaching to there is Expected Results: tumor vessel, mesenchyma stroma of tumors substrate or tumor cell or Tumor-assaciated cell (for example, fibroblast).Described reagent for example can be, treatment of cancer (for example, as described herein cancer therapeutic agent) or diagnostic agent or developer.Unless otherwise noted, the normally used term of this paper " reagent " can comprise one or more reagent.

In one embodiment, cancer therapeutic agent for example comprises, the combination of one or more micromolecule, protein or nucleic acid drug, oncolytic virus, vaccine, antibody or its fragment or mentioned reagent.Described cancer therapeutic agent can be " independently (free) ", or packed or prepare into delivery vector, for example, and granule (for example, nano-particle, as lipid nanometer granule, polymer nano granules or virion).Therapeutic agent delivery is characterised in that: thus therapeutic agent is placed as and enough approaches cell and change cytoactive (for example, cell killing and/or reduce its splitting ability).

In other embodiments, described reagent is diagnostic agent or developer (for example, one or more in following reagent: radioreagent, NMRA agent, contrast agent etc.).Described diagnostic agent or developer can be " independently ", or packed or prepare into delivery vector.Diagnostic agent or developer are sent and are characterised in that thereby reagent is placed as and enough approaches target cell or target tissue and allow described target cell or target tissue to detect.

In embodiment, strengthen the sending of (or improvement) (comparing with same or analogous sending (except carrying out)) and can comprise one or more in following situations in the non-existent situation of AHCM:

Reagent increases to tumor vascular amount or concentration of sending reagent in increase or tumor vessel;

Reagent for example, for example, increases to the amount of sending reagent in enhancing or tumor (, tumor vessel interstitial substrate) or the concentration of tumor (, tumor vessel interstitial substrate);

Reagent for example, for example, increases to the amount of sending reagent in enhancing or tumor cell or Tumor-assaciated cell (, fibroblast) or the concentration of tumor cell or Tumor-assaciated cell (, fibroblast);

Flow velocity in tumor vessel (for example, the flow velocity of reagent) increases;

Improve the vascular morphology (for example, tumor shape level is low) of (or normalization);

Tumor vascular decompression;

In tumor, the diffusion rate of the hole size of (for example,, in interstitial substrate) increase or reagent improves;

Reagent perfusion of (for example,, in interstitial substrate) in tumor strengthens;

The distribution of reagent in whole tumor more extensively and/or more even;

The distribution of reagent in whole mesenchyma stroma of tumors substrate more extensively and/or more even;

For example, in tumor (, the mesenchyma stroma of tumors substrate) ratio of (rather than nonneoplastic tissue (for example, peripheral blood)) of reagent increases;

The inhibition of (for example,, in tumor vessel interstitial substrate) TGF-β path in tumor;

The inhibition of (for example,, in tumor vessel interstitial substrate) CTGF path in tumor;

The inhibition of 1 receptor activity of Angiotensin II;

(for example,, in tumor vessel interstitial substrate) Fibrotic reduction in tumor; Or

The reduction of (for example,, in tumor vessel interstitial substrate) collagen protein or collagen deposition in tumor.

In some embodiments, strengthen the amount increase that (comparing with same or analogous sending (except carrying out)) also can comprise the reagent of at least a portion that is distributed in tumor of sending of (or improvement) in the non-existent situation of AHCM.In some embodiments, in the situation that AHCM exists, the reagent that is delivered to the amount increase of tumor can be uniformly distributed or uneven distribution in whole tumor.

In treatment (for example, treatment of cancer) under background, " effect " used herein can be regarded as treatment and bring the degree of Expected Results, described effect to include but not limited to (no matter being detectable or undetectable): symptom alleviate that (alleviation), disease degree reduce, morbid state stablize, disease progression delays or slow down, morbid state amelioration (amelioration) or relax (palliation) and alleviation (no matter being part or all of).

Under the background of the effect for the treatment of of cancer, one or more in can following situations of the effect of improving be feature: compare with same or analogous treatment (except carrying out in the situation that not existing AHCM to treat), the antitumous effect for the treatment of of cancer strengthens and/or the less desirable side effect (for example, toxicity) for the treatment of of cancer reduces.In one embodiment, the enhancing for the treatment of of cancer antitumous effect comprises one or more in following situations: suppress primary tumo(u)r or metastatic tumo(u)r growth; Reduce quality or the volume of primary tumo(u)r or metastatic tumo(u)r; Reduce size or the quantity of metastatic lesion; Suppress the development of new metastatic lesion; One or more of the volume of reduction Noninvasive tumor or metabolism; Be provided the life cycle of prolongation; The Progression free survival phase of prolongation is provided; The progress time (prolonged time to progression) of prolongation is provided; And/or improve the quality of living.

In some embodiments, for the treatment of cancer of combining with AHCM, term as used herein " effect of improvement " can refer to and carry out treatment of cancer (separately, without AHCM) during the growth of primary tumor or metastatic tumo(u)r reduce compare, the reducing of primary tumor or metastatic tumo(u)r growth increased at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, upper to and comprise 100%.In some embodiments, with carry out treatment of cancer (separately, without AHCM) during the growth of primary tumor or metastatic tumo(u)r reduce compare, AHCM with give combining for the treatment of of cancer to make primary tumor or metastatic tumo(u)r growth reduce increase at least about 1 times, at least about 2 times, at least about 3 times, at least about 5 times, at least about 6 times, at least about 7 times or higher.For monitoring the method for tumor growth in vivo, know in the art, such as, but not limited to: the medical imaging method of X ray, CT scan, MRI and the approval of other this area.

In some embodiments, for the treatment of cancer of combining with AHCM, term as used herein " effect of improvement " can refer to compare with independent perfusion anticarcinogen (that is, without AHCM), anticarcinogen (for example, low-molecular-weight therapeutic agent or nanometer therapeutic agent, as

) perfusion in tumor for example increased, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, upper to and comprise 100%.In some embodiments, compare with the charging efficiency of independent anticarcinogen (that is, without AHCM), AHCM with give combining for the treatment of of cancer to make anticarcinogen (for example, low-molecular-weight therapeutic agent or nanometer therapeutic agent, as

) to the perfusion in tumor increase at least about 1 times, at least about 2 times, at least about 3 times, at least about 5 times, at least about 6 times, at least about 7 times or higher.The method of measuring in-vivo tumour perfusion has been able to abundant foundation in this area, described method includes but not limited to: positron emission computerized tomography (PET) and ultrasonic or radiography enhancing ultrasonic (contrast-enhanced ultrasound).

In some embodiments, for the treatment of cancer of combining with AHCM, term as used herein " effect of improvement " can refer to and give separately treatment of cancer (, without AHCM) time at least one cancer biomarkers thing expression reduction compare, at least one cancer biomarkers thing (for example, in biological sample, as blood sample, blood serum sample, in plasma sample or biopsy sample) reduction of expression for example increased, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, go up to and comprise 100%.In some embodiments, with give separately treatment of cancer (, without AHCM) time at least one cancer the reduction of biomarker expression compare, AHCM with give (for example can to make at least one cancer biomarkers thing combining for the treatment of of cancer, in biological sample, in blood sample, blood serum sample, plasma sample or biopsy sample) reduction of expression increase at least about 1 times, at least about 2 times, at least about 3 times, at least about 5 times, at least about 6 times, at least about 7 times or higher.The example of serum/plasma cancer biomarkers thing can include but not limited to: TGF-β 1, TGF-β 2, CTGF, TSP-1, collagen protein I, collagen protein II, collagen protein III, collagen protein IV.Can utilize any analytical method (for example, PCR, immunoblotting, ELISA and/or immunostaining) of this area approval on transcript degree and/or protein level, the expression of serum/plasma cancer biomarkers thing to be measured.

Conventionally based on systolic pressure and diastolic pressure, " blood pressure " classified." systolic pressure " or Psys refer to the blood pressure in blood vessel when heart beating." diastolic pressure " or Pdias refer to the pressure between heart beating and heart beating.Systolic pressure or diastolic pressure measured value higher than the generally acknowledged normal value of Individual Age are classified as hypertension early stage (prehypertension) or hypertension.Systolic pressure or diastolic pressure measured value lower than the generally acknowledged normal value of Individual Age are classified as hypotension.For adult, " normally " systolic pressure is generally 90mmHg-120mmHg; " normally " diastolic pressure is generally 60mmHg-80mmHg.In crowd, adult's mean blood pressure (ratio of Psys/Pdias) can be 110/65mmHg-140/90mmHg; For the baby of 1 years old, be 95/65mmHg; And for the 6-9 child in year, be 100/65mmHg.

Hypertension has several subclassification, comprising: hypertension early stage (120/80mmHg-139/89mmHg); Hypertension I phase (140/90mmHg-159/99mmHg), hypertension II phase (greater than or equal to 160/100mmHg) and isolated systolic hypertension (isolated systolic hypertension) (greater than or equal to 140/90mmHg).Isolated systolic hypertension refers to that systolic pressure raises and diastolic pressure is normal, is common in old people.After twice or patient's tranquillization blood pressure of repeatedly reading during outpatient service are averaged, make these classification.

Conventionally take and continue hypertension as according to carrying out office hypertension.Conventionally, need within one week, carry out at interval at least three times independently sphygomanometer measure.This often needs three independently doctor's outpatient services.First assessment to hyperpietic should comprise whole medical histories and physical examination.

" hypertension (hypertension/high blood pressure) " used herein refer to systolic pressure be more than 120 (be generally more than 140), diastolic pressure is more than 80 hypertension early stage or hypertension phase (whole blood pressures herein all represent with mmHg).

Term used herein " mean arterial pressure " is (MAP) this area approval, refer to the meansigma methods in cardiac cycle, and by cardiac output (CO), systemic vascular resistance (systemic vascular resistance, SVR) and central venous pressure (CVP) determine, MAP=(CO * SVR)+CVP.MAP can be by the measurement of systolic pressure (Psys) and diastolic pressure (Pdias) is roughly determined, when in normal resting heart rate, MAP is about Pdias+1/3 (Psys-Pdias).

" hypotensive agent " using herein refers to conventionally make the reagent (for example, compound, protein) of patient (for example, hyperpietic) Blood pressure drop when selecting dosage (being referred to herein as " resisting hypertension dosage ").Hypotensive agent is conventional for treating suffering from hypertensive patient with dosage known in the art clinically.Exemplary hypotensive agent includes but not limited to: renin-angiotensin-aldosterone system antagonist (" RAAS antagonist "), Angiotensin-Converting (ACE) inhibitor and angiotensin-ii receptor blockers (AT ₁blocker).Some exemplary resisting hypertension dosage in these reagent is also disclosed herein.

" sub-resisting hypertension dosage " used herein refers to the dosage of the hypotensive agent that is usually less than the lowest dose level for patient's hypertension is treated.In embodiment, sub-hypotensive agent measurer has one or more in following properties:

It does not reduce experimenter's (for example, hypertension experimenter) blood pressure (for example, mean arterial pressure) substantially;

It has reduced less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% experimenter's mean arterial pressure;

Its make Blood pressure drop be less than reduction that the antihypertensive therapy Dose standard by this AHCM causes 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or reduce still less;

It is less than can make experimenter's blood pressure enter normal range (for example, systolic pressure be 120 and diastolic pressure be 80) AHCM dosage 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%; Or be less than that to make experimenter's blood pressure enter systolic pressure be that 120+/-5 and diastolic pressure are 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% of AHCM dosage in the scope of 80+/-5; Or

It is lower than antihypertensive therapy Dose standard.

In some embodiments, one or more ability that dosage meets in these standards can be made measurement for example, after previously selected dosage number (, 1,2,5 or 10) or for example, after the sufficient dosage of acquisition steady-state level (, blood plasma level).

" AHCM " used herein can be one or more the reagent having in following character:

It is renin-angiotensin-aldosterone system antagonist (" RAAS antagonist ");

It is Angiotensin-Converting (ACE) inhibitor;

It is angiotensin-ii receptor blockers (AT ₁blocker);

It is Thrombospondin 1 (TSP-1) inhibitor;

It is transforminggrowthfactor-β1 (TGF-β 1) inhibitor; Or

It is Connective Tissue Growth Factor (CTGF) inhibitor.

" treatment " used herein tumor, is commonly referred to as one or more in following situations:

Suppress primary tumor or metastatic tumo(u)r growth;

Reduce quality or the volume of primary tumor or metastatic tumo(u)r;

Reduce size or the quantity of metastatic lesion;

Suppress the development of new metastatic lesion;

One or more of the volume of reduction Noninvasive tumor or metabolism;

Be provided the life cycle of prolongation;

The Progression free survival phase of prolongation is provided;

The progress time of prolongation is provided; And/or improve the quality of living.

Below many aspects of the present invention are further described in detail.Other is defined in whole application documents and states.

hypotensive agent and/or collagen-modified dose (AHCM agent)

In some embodiments, for the AHCM agent of method and composition of the present invention, can be selected from one or more of following reagent: renin-angiotensin-aldosterone system antagonist (" RAAS antagonist "), Angiotensin-Converting (ACE) inhibitor, angiotensin-ii receptor blockers (AT ₁blocker), Thrombospondin 1 (TSP-1) inhibitor, transforminggrowthfactor-β1 (TGF-β 1) inhibitor and Connective Tissue Growth Factor (CTGF) inhibitor.That described method can comprise is a kind of, more than two or three independent AHCM agent or the AHCM agent of combining with one or more cancer therapeutic agents.

Exemplary renin-angiotensin-aldosterone system (RAAS) antagonist includes but not limited to: aliskiren

remikiren (Ro42-5892), enalkiren (A-64662), SPP635, and the derivant of mentioned reagent.

Exemplary Angiotensin-Converting (ACE) inhibitor comprises but is not limited to: benazepril captopril

enalapril fosinopril

lisinopril

moexipril

perindopril

quinapril

ramipril

trandolapril

and the derivant of mentioned reagent.

Exemplary angiotensin-ii receptor blockers (AT ₁blocker) include but not limited to: losartan

candesartan

eprosartan mesilate

eXP3174, irbesartan

l158,809, Olmesartan

saralasin, telmisartan

valsartan

and the derivant of mentioned reagent.

In one embodiment, AT ₁blocker is losartan or derivatives thereof.Losartan is the hypotensive agent that security risk is minimum (Johnston CI (1995) Lancet346:1403-1407).In addition,, except its possesses antihypertensive properties, losartan has still been proved to be antifibrotic agents (Habashi JP etc., (2006) Science312:117-121 that reduces heart and renal fibrosis sickness rate; And Cohn RD etc., (2007) Nat Med13:204-210).The fibrosis effect of losartan is partly caused by following process: TGF-β 1 activator (as Thrombospondin 1 (TSP-1)) via I receptor (AGTR1) mediation of Angiotensin II is lowered, and the level of the transforminggrowthfactor-β1 (TGF-β 1) of activation is suppressed to (Habashi JP etc., (2006) Science312:117-121; Cohn RD etc., (2007) Nat Med13:204-210; Lavoie P etc., (2005) J Hypertens23:1895-1903; Chamberlain JS (2007) Nat Med13:125-126; And Dietz HC (2010) J Clin Invest120:403-407).

Exemplary Thrombospondin 1 (TSP-1) inhibitor comprises but is not limited to: ABT-510, CVX-045, LSKL, and the derivant of mentioned reagent.

Exemplary transforminggrowthfactor-β1 (TGF-β 1) inhibitor comprises but is not limited to: CAT-192, fresolimumab (GC1008), LY2157299, peptide 144 (P144), SB-431542, SD-208, at United States Patent (USP) serial number 7,846,908 and U.S. Patent Application Publication No. 2011/0008364 in the compound described, and the derivant of mentioned reagent.

Exemplary Connective Tissue Growth Factor (CTGF) inhibitor comprises but is not limited to: DN-9693, FG-3019 and at European patent application publication No. 1839655 and United States Patent (USP) serial number 7,622, the compound of describing in 454, and the derivant of mentioned reagent.

Exemplary Beta receptor blockers includes but not limited to: atenolol

betaxolol

bisoprolol

metoprolol

metoprolol sustained-release agent

nadolol

propranolol long-acting Propranolol

timolol

acebutolol (acebutolol)

penbutolol (penbutolol)

pindolol, carvedilol

labetalol

and the derivant of mentioned reagent.

In one embodiment, described AHCM agent is TGF-β 1 inhibitor, for example, and anti-TGF-beta 1 antibody, TGF-β 1 inhibitor peptides.In some embodiments, TGF-β 1 inhibitor is selected from one or more in following reagent: CAT-192, fresolimumab (GC1008), LY2157299, peptide 144 (P144), SB-431542, SD-208, at United States Patent (USP) serial number 7,846,908 and U.S. Patent Application Publication No. 2011/0008364 in the compound described, or the derivant of mentioned reagent.

Antihypertensive therapy Dose standard based on the obtainable AHCM agent in this area, can be to assessing for the applicable dosage of AHCM agent administration.

For AT ₁inhibitor, therapeutic dose standard and the therapeutic dosage forms standard of its exemplary resisting hypertension in people and heart failure resistance are as follows: losartan is that the 25-100mg/ days forms with the peroral dosage form that comprises 12.5mg, 25mg, 50mg or 100mg losartan can obtain); Candesartan

for example, for 4-32mg/ days (, the form with the peroral dosage form that comprises 4mg, 8mg, 16mg or 32mg Candesartan can obtain); Eprosartan mesilate

for example, for 400-800mg/ days (, the form with the peroral dosage form that comprises 400mg or 600mg eprosartan can obtain); Irbesartan

for example, for 150-300mg/ days (, the form with the peroral dosage form that comprises 150mg or 300mg irbesartan can obtain); Olmesartan

for 20-40mg/ days (form with the peroral dosage form that comprises 5mg, 20mg or 40mg Olmesartan can obtain); Telmisartan

for example, for 20-80mg/ days (, the form with the peroral dosage form that comprises 20mg, 40mg or 80mg telmisartan can obtain); And valsartan for example, for 80-320mg/ days (, the form with the peroral dosage form that comprises 40mg, 80mg, 160mg or 320mg valsartan can obtain).

For ACE inhibitor, therapeutic dose standard and the therapeutic dosage forms standard of its exemplary resisting hypertension in people and heart failure resistance are as follows: benazepril

for 10-40mg/ days (Lotensin (benazepril) provides as the oral tablet that contains 5mg, 10mg, 20mg or 40mg benazepril hydrochlorate); Captopril

for 25-100mg/ days (form with the peroral dosage form that comprises 12.5mg, 25mg, 50mg or 100mg captopril can obtain); Enalapril

for 5-40mg/ days (form with the peroral dosage form that comprises 2.5mg, 5mg, 10mg or 20mg enalapril can obtain); Fosinopril

for 10-40mg/ days (form with the peroral dosage form that comprises 10mg, 20mg or 40mg fosinopril can obtain); Lisinopril

for 10-40mg/ days (form with the peroral dosage form that comprises 2.5mg, 5mg, 10mg, 20mg, 30mg or 40mg lisinopril can obtain); Moexipril

for 7.5-30mg/ days (form with the peroral dosage form that comprises 7.5mg or 15mg moexipril can obtain); Perindopril

for 4-8mg/ days (form with the peroral dosage form that comprises 2mg, 4mg or 8mg perindopril can obtain); Quinapril

for 10-80mg/ days (form with the peroral dosage form that comprises 5mg, 10mg, 20mg or 40mg quinapril can obtain); Ramipril

for 2.5-20mg/ days (form with the peroral dosage form that comprises 1.25mg, 2.5mg, 5mg or 10mg ramipril can obtain); Trandolapril

for 1-4mg/ days (form with the peroral dosage form that comprises 1mg, 2mg or 4mg trandolapril can obtain).

In one embodiment, therapeutic dose standard and the therapeutic dosage forms standard (for example, dosage as herein described or dosage form) with resisting hypertension and heart failure resistance gives AHCM agent.

In some embodiments, the sub-resisting hypertension dosage of AHCM agent or the dosage form dosage of the AHCM agent of therapeutic dose standard or therapeutic dosage forms standard (for example, lower than) are expected.In one embodiment, sub-resisting hypertension dosage or dosage form for hypertension experimenter's blood pressure have minimum impact (for example, in hypertension experimenter, mean arterial pressure has been reduced be less than 20%, 10% 5% or still less).In some embodiments, with for example, 0.01,0.05,0.1,0.2,0.3,0.4,0.5,0.6,0.7,0.8,0.9 dosage or dosage form lower than antihypertensive therapy Dose standard (, lower therapeutic dose standard), give AHCM agent.In one embodiment, described dosage or dosage form be for the therapeutic dose standard of resisting hypertension and heart failure resistance purposes or for example 0.01-0.9 of therapeutic dosage forms standard doubly, 0.02-0.8 doubly, 0.05-0.7 doubly, 0.1-0.5 doubly, 0.1-0.2 doubly.The therapeutic dose standard of AHCM or therapeutic dosage forms standard are obtainable in this area, in this article some of them are given an example.

In other embodiments, with following dosage or dosage form, give AHCM agent: higher than dosage or the dosage form (for example,, higher than 1.1,1.5,1.7,2,3,4,5 or 10 times of the therapeutic dose standard for resisting hypertension or heart failure resistance purposes or therapeutic dosage forms standard above dosage or dosage forms) of the therapeutic dose standard for resisting hypertension or heart failure resistance purposes or therapeutic dosage forms standard.In one embodiment, described dosage or dosage form be the therapeutic dose standard of resisting hypertension and heart failure resistance purposes or for example 1.1-10 of therapeutic dosage forms standard doubly, 1.5-5 doubly, 1.7-4 doubly or 2-3 doubly.The therapeutic dose standard of AHCM or therapeutic dosage forms standard are obtainable in this area, in this article some of them are given an example.

For example, for many AHCM (, losartan), therapeutic dose standard and therapeutic dosage forms standard are provided herein.In embodiment, described dosage and/or dosage form are lower than (or higher than) therapeutic dose standard and/or therapeutic dosage forms standard.In exemplary embodiment, described dosage or dosage form are lower than 0.01,0.02,0.05,0.1,0.2,0.5,0.7,0.8,0.9 times of therapeutic dose standard or therapeutic dosage forms standard.In embodiment, within the AHCM that described dosage or dosage form comprise measures the scope of the reduction that falls into therapeutic dose standard and/or therapeutic dosage forms standard.For example, the 0.01-0.9 of therapeutic dose standard or therapeutic dosage forms standard doubly, 0.02-0.8 doubly, 0.05-0.7 doubly, 0.1-0.5 doubly, 0.1-0.2 AHCM dosage form doubly.In some embodiments, described dosage or dosage form scope for the dosage of reduction enumerated herein or the 0.5-2.0 of dosage form doubly, as long as the value of described dosage or dosage form is lower than therapeutic dose standard or therapeutic dosage forms standard.For example, the therapeutic dosage forms standard of losartan is 12.5mg.Therefore, in embodiment, described dosage form is 0.125mg (0.01 * 12.5mg), 0.625mg (0.05 * 12.5mg), 1.25mg (0.1 * 12.5mg), 2.5mg (0.2 * 12.5mg) or 6.25mg (0.5 * 12.5mg).In embodiment, AHCM dosage form is 0.5-2.0 (* 0.125mg)=0.0625-0.25mg, 0.5-2.0 (* 0.625mg)=0.312-1.25mg; Like that, as long as the value of described dosage or dosage form is lower than therapeutic dose standard or therapeutic dosage forms standard.This calculating can be applicable to any therapeutic dose standard and/or the therapeutic dosage forms standard of any AHCM as herein described.In some embodiments, described value is worth standard lower than treatment.In other embodiments, described value is worth standard higher than treatment.

In one embodiment, based on the Fibrotic order of severity in tumor sample, the dosage of AHCM agent is calculated.

In some embodiments, the dosage of AHCM agent can be sub-resisting hypertension dosage, and described dosage does not have any antitumous effect (for example,, when giving separately, not having the remarkable result that suppresses or stop tumor growth or development).In some embodiments, the dosage of AHCM agent can be equal or higher with therapeutic dose standard or therapeutic dosage forms standard for resisting hypertension or heart failure resistance purposes, and (for example do not there is any antitumous effect, when giving separately, do not there is the remarkable result that suppresses or stop tumor growth or development).

therapeutic Method

On the one hand, for example the present invention relates to, by giving independent to patient or for example, carrying out the method for overmedication proliferative disorders (, cancer) with the AHCM agent of therapeutic agent (, anticarcinogen as herein described) associating.

Unless otherwise specified, term as used herein " treatment (treat/treating/treatment) " refers to therapeutic treatment and preventative (prophylactic) or preventive measures, wherein, object is prevention or slows down (minimizing) less desirable physiological change or disease (as the ill of cancer or diffusion).Clinical effectiveness useful or expectation includes but not limited to (no matter being detectable or undetectable): symptom alleviates, disease degree reduces, morbid state stablize (that is, not worsening), disease progression delays or slow down, morbid state amelioration or mitigation and alleviate (no matter partly or whole)." treatment " also can mean that the expection when not receiving treatment compares life cycle, extended life cycle.Need the experimenter for the treatment of to comprise the experimenter of existing symptom or disease and be easy to suffer from the experimenter of described symptom or disease or the experimenter that will prevent described symptom or disease.

For example, the in the situation that for the treatment of cancer, in some embodiments, therapeutic treatment can refer to after giving or give pharmaceutical composition as herein described according to method as herein described, suppress or reduce tumor growth or development.For example, after treatment tumor growth develop suppressed or reduced at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40% or at least about 50%.In another embodiment, treat rear tumor growth or develop suppressed or reduced over 50%, for example, at least about 60% or at least about 70%.In one embodiment, for example, compare tumor growth or develop suppressed or reduced at least about 80%, at least about 90% or higher with contrasting (, without pharmaceutical composition as herein described).

In another embodiment, described therapeutic treatment refers to that at least one symptom relevant to cancer alleviates.Measurable any statistically significant decline that reduces to comprise the rear measurable label for the treatment of or symptom, as the measurement to cancer biomarkers thing (as the serum/plasma cancer biomarkers thing in blood sample).In one embodiment, at least one cancer biomarkers thing or symptom alleviated at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40% or at least about 50%.In another embodiment, at least one cancer biomarkers thing or symptom have alleviated over 50%, for example, and at least about 60% or at least about 70%.In one embodiment, for example, compare with contrasting (, without pharmaceutical composition as herein described), at least one cancer biomarkers thing or symptom have alleviated at least about 80%, at least about 90% or higher.

Unless separately there is certain illustrated, term used herein " prevention/prevention (prevent/preventing/prevention) " is conceived to start to suffer the behavior occurring before cancer regrowth and/or the behavior that suppresses or reduce the cancer order of severity patient.

Unless separately there is certain illustrated, " the treatment effective dose " of compound used herein for example, in disease (being enough to, cancer) in treatment, provide the amount for the treatment of benefit or be enough to make one or more diseases (for example, cancer) relevant symptoms to delay or minimized amount.The treatment effective dose of compound refers to independent or the amount of the therapeutic agent for the treatment of benefit is provided while combining with other therapeutic agent in the treatment of disease or management.Term " treatment effective dose " can contain improve overall treatment amount, reduce or avoid the symptom of disease (for example, cancer) or the amount of the cause of disease or strengthen the amount of the curative effect of another therapeutic agent.

Unless separately there is certain illustrated, " the prevention effective dose " of compound used herein for example, for being enough to prevent the amount of disease (symptom that, cancer regrowth or one or more cancers are relevant or stop its recurrence).The prevention effective dose of compound refers to independent or the amount of the compound of prevention benefit is provided while combining with other therapeutic agent in disease prevention.The amount of improving overall prevention or the amount that strengthens the prevention effect of another preventive can be contained in term " prevention effective dose ".

Term used herein " patient " or " experimenter " refer to will become or become the animal for the treatment of, observation and/or experimental subject, be generally the mankind (, the sex of any age bracket), for example, pediatric patients (for example, baby, children and adolescents) or adult patient (for example, adolescence, middle age or old people)); Or other mammal, for example, as primate (, machin (cynomolgus monkey), Rhesus Macacus (rhesus monkey)); Business related mammalian, as cattle, pig, horse, sheep, goat, cat and/or Canis familiaris L.; And/or birds, comprise the business birds (as chicken, duck, goose and/or turkey) of being correlated with.When contacting of described term and compound or medicine used, described patient has become treatment, observation and/or has given the object of described compound or medicine.Method as herein described and/or pharmaceutical composition also can be used for treating performing animal or house pet (as cat and Canis familiaris L.).

" cancer (cancer) " used herein and " tumor (tumor) " are synonymous terms.

" treatment of cancer (' cancer therapy ' and ' cancer treatment ') " used herein is synonymous term.

" chemotherapy (chemotherapy) " used herein, " chemotherapeutics/chemotherapeutant (chemotherapeutic/chemotherapeutic agent) " and " anticarcinogen (anti-cancer agent) " are synonymous terms.

In some embodiments, AHCM agent independent or associating be that the First Line of cancer is treated, and, in the experimenter of another medicine who be not used for before treating cancer, uses described AHCM that is.

In other embodiments, AHCM agent independent or associating is the second line treatment to cancer,, in the experimenter of another medicine who was once used for before treating cancer, uses described AHCM that is.

In other embodiments, AHCM agent independent or associating be that the 3rd line treatment or the 4th line of cancer are treated, and, in the experimenter of two or three other medicines who was once used for before treating cancer, uses described AHCM that is.In certain embodiments, before cancer is carried out to radiotherapy or operative treatment, during and/or afterwards, to experimenter, give AHCM agent.

In some embodiments, AHCM given separately or combine with treatment of cancer or anticarcinogen before giving at least one treatment of cancer or anticarcinogen (comprising at least two kinds, at least three kinds or at least four kinds of treatments of cancer or anticarcinogen) are not produced to the experimenter of response.In this type of embodiment, can by before AHCM agent and he/her not to its produce the treatment of cancer of response or anticarcinogen combine give experimenter or with once for treatment of cancer that he/her is treated or the different treatment of cancer of anticarcinogen or anticarcinogen, combined and gave experimenter.

In other embodiments, using AHCM agent as attached treatment, (that is, the treatment except primary treatment) gives.In embodiment, the attached effect of combining the AHCM giving with primary treatment can be cumulative (additive).

In some embodiments, described cancer is epithelium malignant tumor, mesenchyme malignant tumor or hematologic malignancies.In some embodiments, the cancer for the treatment of is solid tumor (for example, carcinoid, cancer or sarcoma), soft tissue neoplasms (for example, haemachrome malignant tumor) and metastatic lesion (for example, any cancer metastasis focus disclosed herein).In one embodiment, the cancer for the treatment of is fibrosis solid tumor or short desmoplastic solid tumor, the cancer of for example, treating is the tumor with following one or more features: limited tumor perfusion, hard pressed blood vessel or Fibrotic mesenchyma stroma of tumors.In one embodiment, described solid tumor is selected from one or more in following: cancer of pancreas (for example, pancreas adenocarcinoma), breast carcinoma, colorectal cancer, pulmonary carcinoma (for example, small cell lung cancer (SCLC) or nonsmall-cell lung cancer (NSCLC)), skin carcinoma, ovarian cancer, hepatocarcinoma, the esophageal carcinoma, carcinoma of endometrium, gastric cancer, incidence cancer, renal carcinoma or carcinoma of prostate.

" hyperproliferative Cancerous disease or disease " refers to growth and the propagation (no matter pernicious or optimum) of whole neoplastic cells (neoplastic cell), comprises all transformants and tissue and all cancerous cell and tissue.Hyperproliferative disease or disease include but not limited to: precancerous lesion, abnormal cell growth, benign tumor, malignant tumor and " cancer ".

Term used herein " cancer ", " tumor " or " tumor tissues " refer to the abnormal structure's piece being caused by excessive cell division, are the tissue that comprises expression, crosses the cell of expression or unconventionality expression hyperplasia cell protein in some cases.Cancer, tumor or tumor tissues comprise " tumor cell ", and described tumor cell is the neoplastic cell that has misgrowth characteristic and do not have useful physical function.Cancer, tumor, tumor tissues and tumor cell can be optimum or pernicious.Cancer, tumor or tumor also can comprise " non-tumor cell of Tumor-assaciated ", for example, form the vascular cell of the blood vessel of supply tumor or tumor tissues.Non-tumor cell can be copied by tumor cell induction and develop, and for example, in tumor or tumor tissues, induction of vascular generates.

The example of cancer includes but not limited to: cancer, lymphoma, blastoma, sarcoma and leukemia or lymph malignant tumor (lymphoid malignancies).Listed this type of cancer example more specifically below, it comprises: squamous cell carcinoma (for example epithelium squamous cell carcinoma), pulmonary carcinoma (comprises small cell lung cancer, nonsmall-cell lung cancer, adenocarcinoma of lung and lung squamous cancer), peritoneal cancer, hepatocarcinoma (hepatocellular cancer), gastric cancer (gastric cancer/stomach cancer) (comprising human primary gastrointestinal cancers), cancer of pancreas, glioblastoma multiforme, cervical cancer, ovarian cancer, hepatocarcinoma (liver cancer), bladder cancer, hepatoma (hepatoma), breast carcinoma, colon cancer, rectal cancer, colorectal cancer, carcinoma of endometrium or uterus carcinoma, salivary gland carcinoma, renal carcinoma (kidney cancer/renal cancer), carcinoma of prostate, carcinoma vulvae (vulvar cancer), thyroid carcinoma, hepatocarcinoma (hepatic carcinoma), anus cancer, carcinoma of penis, and incidence cancer.Term " cancer " (for example comprises primary malignancy cell or tumor, its cell had not migrated to the tumor in the site except initial malignant tumor or tumor in subject) and Secondary cases malignant cell or tumor are (for example, by the tumor shift producing, described transfer is that malignant cell or tumor cell migration are to the Secondary cases site different from initial tumor site).

Other example of cancer or malignant tumor includes but not limited to: children acute lymphoblastic leukemia (Acute Childhood Lymphoblastic Leukemia), acute lymphoblastic leukemia, acute lymphoblastic leukemia (Acute Lymphocytic Leukemia), acute myelogenous leukemia, adrenocortical carcinoma, adult's (constitutional) hepatocarcinoma, adult's (constitutional) hepatocarcinoma, adult's acute lymphoblastic leukemia, adult's acute myelogenous leukemia, adult's Hodgkin (Adult Hodgkin ' s Disease), adult's Hodgkin lymphoma, adult lymphoid cellularity leukemia, adult's non-Hodgkin lymphoma, Adult Primary hepatocarcinoma, adult soft tissue sarcoma, AIDS associated lymphoma, AIDS associated malignancies, anus cancer, astrocytoma (Astrocytoma), cancer of biliary duct, bladder cancer, osteocarcinoma, brain stem glioma, the cerebral tumor, breast carcinoma, renal pelvis and carcinoma of ureter (Cancer of the Renal Pelvis and Ureter), central nervous system's (constitutional) lymphoma, central nervous system lymphoma, cerebellar astrocytoma (Cerebellar Astrocytoma), large cerebral astrocytoma (Cerebral Astrocytoma), cervical cancer, child's (constitutional) hepatocarcinoma, child's (constitutional) hepatocarcinoma, children acute lymphoblastic leukemia, children acute myelomatosis, child's brain stem glioma, Cerebellar Astrocytoma in Children. An, the large cerebral astrocytoma of child, child's extracranial germ cell tumor (Childhood Extracranial Germ Cell Tumors), child's Hodgkin, study on Hodgkin lymphoma in children, child's hypothalamus and pathways for vision glioma (Childhood Hypothalamic and Visual Pathway Glioma), child's lymphoblastic leukemia, Children Medulloblastoma (Childhood Medulloblastoma), Non-Hodgkin Lymphoma in Children, the upper primitive neuroectodermal tumor (Childhood Pineal and Supratentorial Primitive Neuroectodermal Tumors) of child's pinus and curtain, child's primary hepatocarcinoma, Children Rhabdomyosarcoma (Childhood Rhabdomyosarcoma), child's soft tissue sarcoma, children's vision path and hypothalamic gliomas, chronic lymphocytic leukemia, chronic granulocytic leukemia (Chronic Myelogenous Leukemia), colon cancer, cutaneous T cell lymphoma (Cutaneous T-Cell Lymphoma), endocrine islet-cell carcinoma (Endocrine Pancreas Islet Cell Carcinoma), carcinoma of endometrium, ependymoma (Ependymoma), epithelial cancer, the esophageal carcinoma, ewing's sarcoma (Ewing ' s Sarcoma) and related neoplasms, exocrine pancreas cancer (Exocrine Pancreatic Cancer), extracranial germ cell tumor, Extragonadal germ cell tumor (Extragonadal Germ Cell Tumor), cholangiocarcinoma (Extrahepatic Bile Duct Cancer), cancer eye, women with breast cancer, gaucher's disease (Gaucher ' s Disease), carcinoma of gallbladder, gastric cancer, gastrointestinal associated cancers tumor (Gastrointestinal Carcinoid Tumor), gastroenteric tumor, germ cell tumor, gestational trophoblastic tumor (Gestational Trophoblastic Tumor), hairy cell leukemia (Hairy Cell Leukemia), incidence cancer, hepatocarcinoma, Hodgkin, Hodgkin lymphoma, hypergammaglobulinemia (Hypergammaglobulinemia), hypopharyngeal cancer (Hypopharyngeal Cancer), intestinal cancer, ophthalmic melanoma (Intraocular Melanoma), islet-cell carcinoma, islet cells cancer of pancreas (Islet Cell Pancreatic Cancer), Kaposi sarcoma, renal carcinoma, laryngeal carcinoma (Laryngeal Cancer), lip and oral cancer (Lip and Oral Cavity Cancer), hepatocarcinoma, pulmonary carcinoma, lymphoproliferative disease (Lymphoproliferative Disorders), macroglobulinemia (Macroglobulinemia), male breast carcinoma, malignant mesothe (Malignant Mesothelioma), malignant thymoma (Malignant Thymoma), medulloblastoma, melanoma, mesothelioma, transitivity concealment constitutional squamous cervical region cancer (MetastaticOccult Primary Squamous Neck Cancer), transitivity constitutional squamous cervical region cancer (Metastatic Primary Squamous Neck Cancer), transitivity squamous cervical region cancer, multiple myeloma (Multiple Myeloma), multiple myeloma/plasma cell tumor (Multiple Myeloma/Plasma Cell Neoplasm), myelodysplastic syndrome (Myelodysplastic Syndrome), myelocytic leukemia, myelomatosis, myeloproliferative diseases (Myeloproliferative Disorders), nose and paranasal sinuses cancer (Nasal Cavity and Paranasal Sinus Cancer), nasopharyngeal carcinoma (Nasopharyngeal Cancer), neuroblastoma (Neuroblastoma), pregnancy duration non-Hodgkin lymphoma (Non-Hodgkin ' s Lymphoma During Pregnancy), nonmelanoma skin cancer, nonsmall-cell lung cancer, invisible constitutional transitivity squamous cervical region cancer, oropharynx cancer (Oropharyngeal Cancer), bone/malignant fibrous sarcoma (Osteo-/Malignant Fibrous Sarcoma), osteosarcoma/malignant fibrohistiocytoma (Osteosarcoma/Malignant Fibrous Histiocytoma), osteosarcoma/malignant fibrous histiocytoma of bone, epithelial ovarian cancer (Ovarian Epithelial Cancer), ovarian germ cell tumors, ovary low potential malignancy potential tumor (Ovarian Low Malignant Potential Tumor), cancer of pancreas, paraproteinemia (Paraproteinemias), purpura, parathyroid carcinoma, carcinoma of penis, pheochromocytoma (Pheochromocytoma), pituitary tumor, plasma cell tumor/multiple myeloma, primary central nervous system lymphoma, primary hepatocarcinoma, carcinoma of prostate, rectal cancer, renal cell carcinoma, renal pelvis and ureter cancer, retinoblastoma (Retinoblastoma), rhabdomyosarcoma, salivary gland carcinoma, sarcoidosis sarcoma (Sarcoidosis Sarcomas), Sezary syndrome, skin carcinoma, small cell lung cancer, carcinoma of small intestine, soft tissue sarcoma, squamous cervical region cancer, gastric cancer, original neuroderm and Pinealoma on curtain, t cell lymphoma, carcinoma of testis, thymoma, thyroid carcinoma, renal pelvis and transitional cell carcinoma of ureter (Transitional Cell Cancer of the Renal Pelvis and Ureter), renal pelvis and the ureter cancer (Transitional Renal Pelvis and Ureter Cancer) of dividing a word with a hyphen at the end of a line, trophoblastic tumor (Trophoblastic Tumors), ureter and renal pelvis cell carcinoma, carcinoma of urethra, uterus carcinoma, sarcoma of uterus, cancer of vagina, pathways for vision and hypothalamic gliomas, carcinoma vulvae, WaldenstromShi macroglobulinemia, WilmShi tumor, and any other hyperproliferative disease except neoplasia (neoplasia) that is positioned at the tract going out listed above.

In other embodiments, the AHCM agent above and is herein for for example, for example, treating hyperproliferative disease (, hyperproliferative connective tissue disease (, hyperproliferative fibrotic disease)).In one embodiment, described hyperproliferative fibrotic disease is multisystem or organ specific.Exemplary hyperproliferative fibrotic disease includes but not limited to: multisystem disease (for example, scleroderma graft versus host disease in Sjogren's syndrome disease, multifocal fibrosclerosis disease, bone marrow transplantation receptor, kidney source property systematicness fibrosis, scleroderma) and organ specificity disease (for example, the fibrosis of lung, liver, heart, kidney, pancreas, skin and other organ).

In other embodiments, the experimenter who treats suffers from hyperproliferative heredity disease, for example, is selected from the syndromic hyperproliferative heredity of Marfan Cotard or Loeys-Dietz disease.Proved that losartan can treat mankind Marfan Cotard, Marfan Cotard is the caused connective tissue disease of the sudden change (Dietz in the gene of Codocyte extracellular matrix protein fibrillin-1 (fibrillin-1), H.C. etc., (2010) New Engl J Med363 (9): 852-863).The component of the microfibril that fibrillin-1 comprises Elastic tissue (microfibril) and many other connective tissues.The patient who affected by Marfan Cotard has aberrant angiogenesis situation (as aortic aneurysm).Described angiopathy can childhood period and subsequently cause in life angiorrhexis and death.First Dietz etc. find in the mouse model of Marfan Cotard, and the overactivity of resting form TGF-β has important function in pathophysiology.They use losartan to affected mice, and this demonstrates remarkable result aspect blood vessel structure, prevented aortic aneurysm generation simultaneously improving.They also treat suffering from the child of Marfan Cotard with losartan, prove that this medicine can significantly prevent the development of aorta and muscle changes.Arotic disease outside Marfan Cotard also can be benefited from the use of losartan.Therefore, the cyclical level of the part inhibition of resting form TGF-β activation and activation TGF-β is reduced and can the connective tissue component beyond the collagen protein in the extracellular matrix of cancerous tissue be exerted an influence, this has changed sending and effect of nanometer therapeutic agent.

In other embodiments, hyperproliferative disease (for example, hyperproliferative fibrosis disease) is selected from one or more in following: chronic obstructive pulmonary disease, asthma, aortic aneurysm, radiation-induced fibrosis, skeletal muscle myopathy, diabetic nephropathy and/or arthritis.

Other the exemplary hyperproliferative disease that can be treated by method and composition of the present invention is disclosed in Sounni, and N.E. etc., in (2010) Diseases Models & Mechanisms3:317-332.

therapeutic alliance

Will be appreciated that, above can for example, combine and give with one or more other treatment (, as radiotherapy, operation) and/or one or more therapeutic agents with AHCM agent as herein described, cancer as herein described is treated.

" associating " is not intended to imply that described treatment or therapeutic agent must give simultaneously and/or prepare for send simultaneously, although within these delivering methods also fall into scope of the present invention.Can be when giving one or more other additional procedures or therapeutic agent, before or give afterwards described pharmaceutical composition.Conventionally, each reagent is according to giving for definite dosage and/or the timetable of this reagent.To further recognize, other therapeutic agent of applying in this associating can give together or give respectively in different compositionss in single compositions.The specific expectation curative effect that will consider the compatibility of pharmaceutical composition of the present invention and other therapeutic active agents and/or want to realize of combining adopting in scheme.

Level when conventionally, being expected at other therapeutic agent of using in associating and using separately to be no more than it is used.In some embodiments, the level of the level adopting in associating when using separately lower than it.

In one embodiment, described AHCM and/or treatment are (for example, treatment of cancer or hyperplasia treatment) for example, combine and give with the inhibitor (" short fibrosis approach restrainer ") of short fibrosis approach (, depending on or do not rely on the approach of TGF-β and/or CTGF activation).In one embodiment, described AHCM and/or treatment of cancer are combined and are given with one or more in following reagent: Endothelin 1 inhibitor, PDGF inhibitor, Wnt/ beta-catenin inhibitor, IGF-1 inhibitor, TNF-alpha inhibitor and/or IL-4 inhibitor.In another embodiment, described AHCM and/or treatment of cancer are combined and are given with Endothelin 1 inhibitor and/or PDGF inhibitor.In other embodiments, described AHCM and/or treatment of cancer are combined and are given with the inhibitor of following one or more reagent: 4 type chemokine receptors (CXCR4) (for example, AMD3100, MSX-122); Stromal cell derived factor-1 (SDF-1) (for example, tannic acid); Hedgehog (for example, GDC-0449, cyclopamine or GANT58).

In other embodiments, described AHCM combines and gives with low-molecular-weight chemotherapeutant or micromolecule amount chemotherapeutant.Exemplary low-molecular-weight chemotherapeutant or little molecular weight chemotherapeutant include but not limited to: 13-cis-vitamin A acid (13-cis-retinoic acid) (Accutane (isotretinoin),

), 2-CdA (2-chlorodeoxyadenosine (chlorodeoxyadenosine), Cladribine (cladribine), LEUSTATIN ^TM), 5-azacitidine (5-azacitidine) (azacitidine,

), 5 FU 5 fluorouracil (5-FU, fluorouracil,

), Ismipur (6-MP, purinethol,

), 6-TG (6-thioguanine, thioguanine, THIOGUANINE

),Abraxane (protein combination type taxol), actinomycin D (actinomycin-D) (actinomycin D (dactinomycin),

), A Li vitamin A acid (alitretinoin)

ATRA (ATRA, vitamin A acid,

), hemel (altretamine) (hexamethyl melamine, HMM,

), amethopterin (amethopterin) (methotrexate (MTX) (methotrexate), methotrexate sodium, MTX, TREXALLTM,

),Amifostine

Arabinosylcytosine (arabinosylcytosine) (Ara-C, cytarabine (cytarabine),

), arsenic trioxide

Asparaginase (Erwinia (Erwinia) L-ASP, L-ASP,

), BCNU (BCNU (carmustine),

),Bendamustine (bendamustine) Bexarotene (bexarotene) Bleomycin (bleomycin) Busulfan

Calciumlevofolinate (calcium leucovorin) (folinic acid (Citrovorum Factor), folinic acid (folinic acid), folinic acid (leucovorin)), camptothecin-11 (CPT-11, Irinotecan,

),Capecitabine (capecitabine)

Carboplatin

BCNU disk (containing the prolifeprospan20 of BCNU implant,

Disk), CCI-779 (CCI-779 (temsirolimus),

), CCNU (lomustine, CeeNU), CDDP (cis-platinum,

), Chlorambucil (chlorambucil) (Leukeran (leukeran)),Endoxan

Dacarbazine (dacarbazine) (DIC, DTIC, Imidazole carboxamide,

), daunomycin (daunorubicin, daunomycin hydrochloride, rubidomycin hydrochloride (rubidomycin hydrochloride),

), Decitabine (decitabine) Dexrazoxane (dexrazoxane)

DHAD (mitoxantrone, ), docetaxel

Doxorubicin

Epirubicin (ELLENCE ^TM), Estramustine (estramustine) Etoposide (VP-16, Etoposide phosphate,

), floxuridine

Fludarabine (fludarabine)

Fluorouracil (emulsifiable paste) (CARAC ^TM, ), gemcitabine Hydroxycarbamide (

DROXIA ^TM, MYLOCEL ^TM), idarubicin

Ifosfamide Ipsapirone (ixabepilone) (IXEMPRA ^TM), LCR (vincristin (leurocristine), vincristine (vincristine), VCR,

VINCASAR

), L-PAM (Phenylalanin-Lost (L-sarcolysin), melphalan (melphalan), phenylalanine mustard,

), mechlorethamine (mechlorethamine) (mechlorethamine hydrochloride, mustargen (mustine), mustargen (nitrogen mustard),

), mesna (mesna) (MESNEX ^TM), mitomycin (Mitomycin-C, MTC,

), nelarabine (nelarabine)

Oxaliplatin (ELOXATIN ^TM), taxol (

ONXAL ^TM), Pegaspargase (pegaspargase) (PEG-L-asparaginase,

), PEMETREXED

Pentostatin (pentostatin)

Procarbazine (procarbazine)

Streptozotocin

Temozolomide

Teniposide (teniposide) (VM-26,

), TESPA (thio-phosphamide (thiophosphoamide), thiophene for group, TSPA,

),TPT (topotecan) Vinblastine (vinblastine) (vinblastine sulfate, vinblastine (vincaleukoblastine), VLB, ), vinorelbine (vinorelbine tartrate,

) and SAHA (vorinostat)

In another embodiment, combine with biological preparation and give described AHCM agent.At useful biological preparation aspect treatment cancer, be well known in the art, and can be by binding molecule of the present invention, for example, the biological preparation known with this type of combined and given.

For example, FDA has ratified the following biological preparation that is used for the treatment of breast carcinoma:

(Herceptin (trastuzumab), Genentech Inc., South San Francisco, Calif.; The Humanized monoclonal antibodies in HER2 positive breast cancer with anti-tumor activity); (fulvestrant (fulvestrant), AstraZeneca Pharmaceuticals, LP, Wilmington, Del.; The estrogen receptor antagon that is used for the treatment of breast carcinoma); (Anastrozole (anastrozole), AstraZeneca Pharmaceuticals, LP; The non-steroid class aromatase inhibitor of blocking-up aromatase (a kind of required enzyme of estrogen of manufacturing));

(exemestane (exemestane), Pfizer Inc., New York, N.Y.; The irreversible steroid class aromatase inactivator that is used for the treatment of breast carcinoma);

(letrozole, Novartis Pharmaceuticals, East Hanover, N.J.; The non-steroid class aromatase inhibitor that is used for the treatment of breast carcinoma by FDA approval); And

(tamoxifen, AstraZeneca Pharmaceuticals, LP; By FDA approval, be used for the treatment of the non-steroid class estrogen antagonist agent of breast carcinoma).Other biological preparation that can combine with binding molecule of the present invention comprises:

(Avastin (bevacizumab), Genentech Inc.; The first approval of FDA for suppressing the treatment of angiogenesis); And

(ibritumomab tiuxetan (ibritumomab tiuxetan), Biogen Idec, Cambridge, Mass.; Approval is at present used for the treatment of the radioactive label monoclonal antibody of B cell lymphoma).

In addition, FDA has ratified the following biological preparation that is used for the treatment of colorectal cancer:

(Cetuximab, ImClone Systems Inc., New York, N.Y., and Bristol-Myers Squibb, New York, N.Y.; For the monoclonal antibody for EGF-R ELISA (EGFR));

(imatinib mesylate (imatinib mesylate); Kinases inhibitor); And

(levamisole hydrochloride (levamisole hydrochloride), Janssen Pharmaceutica Products, LP, Titusville, N.J.; The immunomodulator that nineteen ninety is ratified by FDA, is carrying out, after excision, combining as auxiliary treatment with 5-fluorouracil to suffering from the patient of Dukes C phase colon cancer).

For the treatment of pulmonary carcinoma, exemplary biological preparation comprises

(Erlotinib (erlotinib) HCL, OSI Pharmaceuticals Inc., Melville, N.Y.; Micromolecule for targeted human ErbB1 (HER1) path).

For the treatment of multiple myeloma, exemplary biological preparation comprises velcade (bortezomib (bortezomib), Millennium Pharmaceuticals, Cambridge Mass.; Proteasome inhibitor).Other biological preparation comprises (Thalidomide, Clegene Corporation, Warren, N.J.; Immunomodulator, and show and there is multiple effect, comprise myeloma cell's growth and the ability of survival and angiogenesis inhibitor of suppressing).

Other exemplary treatment of cancer antibody includes but not limited to: 3F8, A Bafu monoclonal antibody (abagovomab), A De wood monoclonal antibody (adecatumumab), atropic pearl monoclonal antibody (afutuzumab), trainingization A Zhu monoclonal antibody (alacizumab pegol), A Lun pearl monoclonal antibody (alemtuzumab)

Pentetic Acid Altumomab (altumomab pentetate) Anatumomab mafenatox (anatumomab mafenatox), peace Lu Zhu monoclonal antibody (anrukinzumab) (IMA-638), Ah pool pearl monoclonal antibody (apolizumab), Arcitumomab (arcitumomab) Bar soil former times monoclonal antibody (bavituximab), Bectumomab (bectumomab)

Baily wood monoclonal antibody (belimumab)

Shellfish rope monoclonal antibody (besilesomab)

Avastin

Than cutting down pearl monoclonal antibody (bivatuzumabmertansine), lantol not monoclonal antibody (blinatumomab), brentuximab vedotin, U.S. bank pearl monoclonal antibody (cantuzumab mertansine), capromab pendetide (capromab pendetide)

Block appropriate rope monoclonal antibody (catumaxomab)

CC49, Cetuximab (C225,

), his pearl monoclonal antibody (citatuzumab bogatox) of Bo Xi, western appropriate wooden monoclonal antibody (cixutumumab) but, that wooden monoclonal antibody (conatumumab) of clivatuzumab tetraxetan, darcy pearl monoclonal antibody (dacetuzumab), Shu Dankang (denosumab)

Detumomab (detumomab), Yi Mei former times monoclonal antibody (ecromeximab), edrecolomab (edrecolomab) According to her not monoclonal antibody (epitumomab cituxetan), epratuzumab (epratuzumab), E Masuo monoclonal antibody (ertumaxomab) of Lip river pearl monoclonal antibody (elotuzumab), west

Dust daclizumab (etaracizumab), method trastuzumab (farletuzumab), fragrant appropriate wooden monoclonal antibody (figitumumab), husband bush monoclonal antibody (fresolimumab), markon's former times monoclonal antibody (galiximab),Lucky trastuzumab ozogamicin (gemtuzumab ozogamicin)

Lucky auspicious former times monoclonal antibody (girentuximab), glembatumumab vedotin, ibritumomab tiuxetan (ibritumomab tiuxetan)

Igovomab (igovomab)

Should appropriate wooden monoclonal antibody (intetumumab), Yi Zhu monoclonal antibody ozogamicin (inotuzumab ozogamicin), her wooden monoclonal antibody (ipilimumab), her appropriate wooden monoclonal antibody (iratumumab), draw shellfish pearl monoclonal antibody (labetuzumab)

Come husky wooden monoclonal antibody (lexatumumab), lintuzumab (lintuzumab), Shandong card wood monoclonal antibody (lucatumumab), Shandong former times monoclonal antibody (lumiliximab), horse Victibix (mapatumumab), horse trastuzumab, meter La Zhu monoclonal antibody (milatuzumab), minretumomab (minretumomab), mitumomab (mitumomab), Nacolomab tafenatox (nacolomab tafenatox),Ta Namo monoclonal antibody (naptumomab estafenatox), how former times wood monoclonal antibody, Buddhist nun's trastuzumab

Nofetumomab merpentan (nofetumomab merpentan)

Method wood monoclonal antibody (ofatumumab) difficult to understand

Olaratumab, pearl monoclonal antibody not difficult to understand (oportuzumab monatox), Ao Gefu monoclonal antibody (oregovomab)

Victibix

Pemtumomab

Pertuzumab (pertuzumab)

Smooth and proper monoclonal antibody (pintumomab), general standing tree monoclonal antibody (pritumumab), thunder be Lu Dankang (ramucirumab), Lucentis (ranibizumab) not

Profit appropriate wooden monoclonal antibody (rilotumumab), Rituximab (rituximab)

The appropriate wooden monoclonal antibody of sieve (robatumumab), satumomab pendetide (satumomab pendetide), sibrotuzumab (sibrotuzumab), match appropriate former times monoclonal antibody (siltuximab), loose trastuzumab (sontuzumab),Tacatuzumab tetraxetan

Pa Tamo monoclonal antibody (taplitumomab paptox), for appropriate not monoclonal antibody (tenatumomab), TGN1412, for former times wood monoclonal antibody (ticilimumab) (Sibutramine Hydrochloride wood monoclonal antibody (tremelimumab)), for adding pearl monoclonal antibody (tigatuzumab), TNX-650, tositumomab (tositumomab)

Herceptin

Sibutramine Hydrochloride wood monoclonal antibody, Celmoleukin monoclonal antibody (tucotuzumab celmoleukin), dimension trastuzumab (veltuzumab), volt Lip river former times monoclonal antibody (volociximab), Votumumab (votumumab)

Prick calamite monoclonal antibody And prick wooden monoclonal antibody (zanolimumab)

In other embodiments, combine and give described AHCM with viral cancer therapeutic agent.Exemplary viral cancer therapeutic agent includes but not limited to: vaccinia virus (vvDD-CDSR), express the Measles virus (carcinoembryonic antigen-expressing measles virus) of carcinoembryonic antigen, vaccinia virus recombinant (TK-disappearance adds GM-CSF), Seneca Valley virus-001, Newcastle virus (Newcastle virus), Coxsackie virus (coxsackie virus) A21, GL-ONC1, express restructuring improvement vaccine Ankara vaccine (EBNA1C-terminal/LMP2chimeric protein-expressing recombinant modified vaccinia Ankara vaccine) of EBNA1C end/LMP2 chimeric protein, express the Measles virus of carcinoembryonic antigen, G207 oncolytic virus, express the improvement vaccinia virus ankara vaccine of p53, OncoVEX GM-CSF modification herpes simplex virus 1 (OncoVEX GM-CSF modified herpes-simplex1virus), fowlpox virus vaccine carrier (fowlpox virus vaccine vector), recombinant vaccinia prostate specific antigen vaccine, human papilloma virus 16/18L1 virus-like particle/AS04 vaccine, MVA-EBNA1/LMP2Inj. vaccine, tetravalence HPV vaccine, tetravalence human papillomavirus's (6 types, 11 types, 16 types, 18 types) recombiant vaccine

restructuring fowl pox-CEA (6D)/TRICOM vaccine, recombinant vaccinia-CEA (6D)-TRICOM vaccine, restructuring improvement vaccine Ankara-5T4 vaccine, restructuring fowl pox-TRICOM vaccine, oncolytic herpesvirus NV1020, HPV L1VLP vaccine V504, human papillomavirus's bivalence (16 types and 18 types) vaccine

copy-deficiency herpes simplex virus I-type (HSV-1) carrier (NP2), wild type reovirus (reovirus), the SV 59 virus Dearing of herpes simplex virus HF10, Ad5CMV-p53 gene, recombinant vaccinia DF3/MUC1 vaccine, recombinant vaccinia-MUC-1 vaccine, recombinant vaccinia-TRICOM vaccine, ALVAC MART-1 vaccine, expression Human preproenkephalin (Preproenkephalin)

oncolytic virus HSV1716, the vaccine of the coding Epstein-Barr virus target antigen based on restructuring improvement vaccine Ankara (MVA), restructuring fowl pox-prostate specific antigen vaccine, recombinant vaccinia-prostate specific antigen vaccine, recombinant vaccinia-B7.1 vaccine, rAd-p53 gene, Ad5-A24RGD, HPV vaccine 580299, JX-594 (vaccinia virus of thymidine kinase disappearance adds GM-CSF), HPV-16/18L1/AS04, fowlpox virus vaccine carrier, vaccine-tryrosinase vaccine, MEDI-517HPV-16/18VLP AS04 vaccine, the adenovirus vector TK99UN of the thymidine kinase that contains herpes simplex virus, HspE7, FP253/ fludarabine, the former treatment vaccine of ALVAC (2) melanoma multi-resistance, ALVAC-hB7.1, canary pox (canarypox)-hIL-12 melanoma vaccines, Ad-REIC/Dkk-3, rAd-IFN SCH721015, TIL-Ad-INFg, Ad-ISF35, and CA 21 (CVA21,

).

In other embodiments, combine with Nano medication and give described AHCM.Exemplary cancer Nano medication includes but not limited to:

(albumin bound type taxol nanoparticle), CRLX101 (CPT puting together with the polymer based on linear cyclodextrin), CRLX288 (docetaxel is conjugated to biodegradable polymers poly lactic coglycolic acid), cytarabine liposome (liposome Ara-C, DEPOCYT ^tM), daunomycin liposome

mycocet

the liposome of encapsulation daunomycin citrate

and the anti-VEGF aptamer of PEG

In some embodiments, with paclitaxel or formulation for paclitaxel (for example, protein binding type paclitaxel (for example,

)) combine and give described AHCM.Exemplary formulation for paclitaxel includes but not limited to: albumin bound type taxol nanoparticle (

commercially available by Abraxis Bioscience), docosahexenoic acid conjunction type paclitaxel (DHA-paclitaxel, Taxoprexin, commercially available by Protarga), polyglutamic acid conjunction type paclitaxel (PG-paclitaxel, PPX (paclitaxel poliglumex), CT-2103, XYOTAX, commercially available by Cell Therapeutic), tumor-activated prodrug (TAP), ANG105 (being bonded to the Angiopep-2 of three paclitaxel molecules, commercially available by ImmunoGen), paclitaxel-EC-1 (be bonded to the paclitaxel of erbB2 identification polypeptide EC-1; Referring to Li etc., Biopolymers (2007) 87:225-230) and the paclitaxel that is conjugated with glucose (for example, 2 '-paclitaxel methyl 2-glucopyranosyl succinate, referring to Liu etc., Bioorganic Medicinal Chemistry Letters (2007) 17:617-620).

The exemplary RNAi that is used for the treatment of cancer and antisense RNA agent include but not limited to: CALAA-01, siG12D LODER (Local Drug EluteR) and ALN-VSP02.

Other cancer therapeutic agent includes but not limited to: cell factor (for example, Aldesleukin (IL-2, proleulzin,

)), IFN-α (IFN-α, interferon-' alpha ',

(Interferon Alpha-2b),

(Intederon Alpha-2a)); Epoetin alfa (Epoetin alfa)

Filgrastim (filgrastim) (G-CSF, granulocyte colony stimulating factor,

), GM-CSF (granulocyte macrophage colony stimulating factor, Sargramostim (sargramostim), LEUKINE ^TM), IL-11 (interleukin-11, oprelvekin (oprelvekin),

), Interferon Alpha-2b (PEG conjugate) (PEG interferon, PEG-INTRON ^TM) and Pei Feisi booth (pegfilgrastim) (NEULASTA ^TM)); Hormone therapy agent (for example, aminoglutethimide (aminoglutethimide)

Anastrozole

Bicalutamide (bicalutamide)

Exemestane

Fluoxymesterone

Flutamide

Fulvestrant Goserelin

Letrozole

Leuproside (ELIGARD ^TM,

LUPRON

VIADUR ^TM), megestrol acetate (megestrol acetate,

), Nilutamide (nilutamide)

Octreotide (octreotide acetate,

), Raloxifene Luo meter Si booth (romiplostim)

TAM

And Toremifene

); PLA 2 inhibitors (for example, anagrelide

); Biological response modifying agent (for example, BCG And Aranesp (Darbepoetin alfa)

); Target therapeutic agent (for example, bortezomib

Dasatinib (dasatinib) (SPRYCEL ^TM),Denileukin toxin attachment

Tarceva

Everolimus

Gefitinib

Imatinib mesylate (STI-571, GLEEVEC ^TM), Lapatinib

Sorafenib

And SU11248 (Sutent,

)); Immunomodulator and anti-angiogenic agent (for example, CC-5013 (lenalidomide (lenalidomide),

) and Thalidomide

); Glucocorticoid (for example, cortisone (hydrocortisone, hydrocortisone sodium phosphate, hydrocortisone sodium succinate,

Hydrocortone phosphate

), decadron (dexamethasone, dexamethasone acetate, dexamethasone sodium phosphate,

), methylprednisolone (6-methylprednisolone, acetic acid methylprednisolone, methylprednisolone sodium succinate,

), prednisolone

And prednisone

); And diphosphonates (for example, Pamidronate (pamidronate)

; And zoledronic acid (zoledronic acid) ).

In some embodiments, for example, combine and use described AHCM agent with tyrosine kinase inhibitor (, receptor tyrosine kinase (RTK) inhibitor).Exemplary tyrosine kinase inhibitor includes but not limited to: epidermal growth factor (EGF) pathway inhibitor (for example EGF-R ELISA (EGFR) inhibitor), (for example vascular endothelial growth factor receptor (VEGFR) inhibitor (for example for VEGF (VEGF) pathway inhibitor, VEGFR-1 inhibitor, VEGFR-2 inhibitor, VEGFR-3 inhibitor), (for example platelet derived growth factor receptor (PDGFR) inhibitor (for example for platelet derived growth factor (PDGF) pathway inhibitor, PDGFR-beta inhibitor)), RAF-1 inhibitor, KIT inhibitor and RET inhibitor.The anticarcinogen of in some embodiments, combining use with AHCM agent is selected from the group being comprised of following reagent place: Ah former times is for Buddhist nun (AG013736), SKI-606 (SKI-606), AZD2171 (cediranib) (RECENTIN ^tM, AZD2171), Dasatinib (

bMS-354825), Erlotinib

gefitinib

imatinib (

cGP57148B, STI-571), Lapatinib

lestaurtinib (lestaurtinib) (CEP-701), HKI-272 (HKI-272), AMN107 (nilotinib)

sU5416 (semaxinib, SU5416), Sutent (

sU11248), toceranib

zD6474 (

zD6474), vatalanib (PTK787, PTK/ZK), Herceptin avastin rituximab

cetuximab

victibix lucentis aMN107

sorafenib

a Lun pearl monoclonal antibody

lucky trastuzumab ozogamicin

eNMD-2076, PCI-32765, AC220, the many Weis of lactic acid are for Buddhist nun (dovitinib lactate) (TKI258, CHIR-258), BIBW2992 (TOVOK ^tM), SGX523, PF-04217903, PF-02341066, PF-299804, BMS-777607, ABT-869, MP470, BIBF1120

aP24534, JNJ-26483327, MGCD265, DCC-2036, BMS-690154, CEP-11981, tivozanib (AV-951), OSI-930, MM-121, XL-184, XL-647, XL228, AEE788, AG-490, AST-6, BMS-599626, CUDC-101, PD153035, Pei Li for Buddhist nun (pelitinib) (EKB-569), ZD6474 (zactima), WZ3146, WZ4002, WZ8040, ABT-869 (linifanib), AEE788, AP24534 (ponatinib), AV-951 (tivozanib), Ah former times is for Buddhist nun, BAY73-4506 (regorafenib), alanine Bu Linibu (brivanib alaninate) (BMS-582664), Bu Linibu (BMS-540215), AZD2171 (AZD2171), CHIR-258 (dovitinib), CP673451, CYC116, E7080, Ki8751, Masitinib (masitinib) (AB1010), MGCD-265, diphosphonic acid is not for husky Buddhist nun (motesanib diphosphate) (AMG-706), MP-470, OSI-930, hydrochloric acid pazopanib, PD173074, Sorafenib Tosylate (nSorafenib Tosylate) (BAY43-9006), SU5402, TSU-68 (SU6668), vatalanib, XL880 (GSK1363089, EXEL-2880).Selected tyrosine kinase inhibitor is selected from Sutent, Erlotinib, gefitinib or Sorafenib.In one embodiment, described tyrosine kinase inhibitor is Sutent.

In one embodiment, combine and give described AHCM with one or more in following reagent: anti-angiogenic agent or blood-vessels target agent or angiorrhexis agent (vascular disrupting agent).Exemplary anti-angiogenic agent includes but not limited to: VEGF inhibitor (for example, VEGF antibody (for example, Avastin)); Vegf receptor inhibitor (for example, itraconazole (itraconazole)); The cell proliferation of endotheliocyte and/or the inhibitor of migration (for example, CAI (carboxyamidotriazole), TNP-470); The inhibitor of angiogenic factors (for example, suramin (suramin)).Blood-vessels target agent (VTA) or angiorrhexis agent (VDA) are designed to destroy the blood vessel (blood vessel) of cancer so that its generative center downright bad (at for example Thorpe, commenting in P.E. (2004) Clin.Cancer Res.Vol.10:415-427).VTA can be micromolecule.Exemplary micromolecule VTA includes but not limited to: microtubule removes to stablize medicine (microtubule destabilizing drugs) (for example, Combretastatin A-4 disodium hydrogen phosphate (combretastatin A-4disodium phosphate) (CA4P), ZD6126, AVE8062, Oxi4503); And vadimezan (ASA404).

Will recognize, with isotope-labeled anti-tumour antibody successfully for the cell in solid tumor and lymphoma/leukemia being destroyed in the mankind in animal model and some situation.Exemplary radiosiotope comprises: ⁹⁰y, ¹²⁵i, ¹³¹i, ¹²³i, ¹¹¹in, ¹⁰⁵rh, ¹⁵³sm, ⁶⁷cu, ⁶⁷ga, ¹⁶⁶ho, ¹⁷⁷lu, ¹⁸⁶re and ¹⁸⁸re.Radionuclide works by producing ionizing radiation, and described ionizing radiation causes many chain interruptions in core DNA, causes cell death.Isotope for generation for the treatment of conjugate conventionally produces and has high-octane alpha-particle or beta-particle, and described particle has short path (path length).This type of radionuclide kills their cell (neoplastic cell that for example, described conjugate adheres to or enters) of next-door neighbour.Described radionuclide has very little impact or does not have impact non-location (non-localized) cell.Radionuclide substantially right and wrong is immunogenic.

According to instruction herein, also it will be appreciated that, for diagnosis and therapeutic purposes, binding molecule can be puted together from different radioactive labels.For this day, U.S. Patent number 6,682,134,6,399,061 and 5,843,439 mentioned above disclosed before treating antibody the treatment conjugate for the labelled with radioisotope of diagnosing tumor " imaging "." In2B8 " conjugate comprises people CD20 antigen is had to specific Mus resource monoclonal antibody 2B8, described antibody by BC's agent (, MX-DTPA (diethylene triamine pentacetic acid (DTPA)), wherein comprises 1: 1 mixture of 1-isothiocyanic acid benzyl-3-methyl D TPA and 1-methyl-3-isothiocyanic acid benzyl-DTPA) be attached to ¹¹¹in.Especially preferred as diagnostic radioactive nucleic ¹¹¹in, does not produce detectable toxicity because it can give safely the about 10mCi of about 1-; And imaging data conventionally can be to subsequently ⁹⁰the antibody of y labelling distributes and has predictability.Many imaging research are used 5mCi's ¹¹¹the antibody of In labelling because this dosage not only safety, but also have with more low dosage compare the imaging efficiency of lifting, after giving antibody, there is optimal imaging 3-6 days time.For example,, referring to Murray, J.Nuc.Med.26:3328 (1985) and Carraguillo etc., J.Nuc.Med.26:67 (1985).

In some embodiments, (for example give simultaneously, simultaneously or on the same day or in same therapeutic scheme, give two kinds of reagent) and/or sequential (for example giving, within a period of time, give a kind of reagent, at second segment, in the time or in different therapeutic schemes, give subsequently another reagent) AHCM agent and other anticarcinogen.

In one embodiment, before anticarcinogen, give AHCM.In other embodiments, before anticarcinogen, give AHCM, and give subsequently described AHCM and described anticarcinogen simultaneously.

In some embodiments, give AHCM agent and other anticarcinogen simultaneously.For example, in some embodiments, simultaneously, on the same day or in same therapeutic scheme, give AHCM agent and other anticarcinogen.In some embodiments, on the same day or in same therapeutic scheme, before other anticarcinogen, give AHCM agent.

In some embodiments, within a period of time, give AHCM agent with other anticarcinogen simultaneously, after above-mentioned putting, stop the treatment of carrying out with other anticarcinogen, the treatment that continuation is carried out with AHCM.

In other embodiments, within a period of time, give AHCM agent with other anticarcinogen simultaneously, after above-mentioned putting, stop the treatment of carrying out with AHCM, the treatment that continuation is carried out with other anticarcinogen.

In some embodiments, sequential AHCM agent and the other anticarcinogen of giving.For example, in some embodiments, after having stopped, the therapeutic scheme of other anticarcinogen gives AHCM agent.In some embodiments, after having stopped, the therapeutic scheme of AHCM agent gives other anticarcinogen.

In some embodiments, mode that can pulsatile administration gives AHCM agent and anticarcinogen.In other embodiments, described reagent can be given the mode with pulse-chase administration, for example, within the of short duration time, give AHCM agent (pulse), give in a long time anticarcinogen (for example, chase) subsequently; Or vice versa.

diagnostic method and algoscopy

AHCM agent is used in diagnosis, treatment, prevention and/or the prognosis that improves cancer in mammal (the preferably mankind).These diagnostic assay methods can be in vivo or external carrying out (for example, carrying out in blood sample, biopsy or autopsy tissue).

Therefore, the invention provides diagnostic method useful during cancer diagnosis, described method comprises the steps: the target protein in the tissue from individual or other cell or body fluid or the expression of transcript to measure; And the standard target expression in the expression recording and normal structure or body fluid is compared, wherein, the raising of comparing expression with standard shows to exist disease.

The cell that embodiment provides abnormal hyperproliferative in convection cell or tissue sample (for example, precancerous cell or cancerous cell) whether exist the method detecting, described method to comprise the steps: the expression of target in individual tissue or humoral sample to analyze; And whether the objective expression recording in sample is existed or objective expression level and one group of normal structure or humoral sample in described objective expression whether exist or objective expression level compares, wherein, objective expression or objective expression comparison with standard being detected increases and shows to exist abnormal hyperproliferative Growth of Cells.

One aspect of the invention is the method that detects or diagnose in the body that carries out cancer in experimenter, described experimenter is preferably mammal and most preferably is the mankind.In one embodiment, diagnosis comprises: a) to experimenter, (for example give, parenteral gives, subcutaneous give or intraperitoneal gives) traget antibody or its fragment of anticancer antigen of effective dose, described experimenter had carried out AHCM treatment or had carried out AHCM treatment; B) after giving, wait for a period of time, so that traget antibody preferentially concentrates on the site (and unconjugated labelled molecule is removed to background level) of expressing target in experimenter; C) measure background level; And d) labelled molecule in experimenter is detected, when the detection of labelled molecule is during higher than background level, show that experimenter suffers from specified disease or the disease relevant to target unconventionality expression.Can to background level, measure by several different methods, described method comprises for specific system, and the amount of the labelled molecule detecting and the standard value of measuring are before compared.

The imaging system that will be appreciated that experimenter's size in this area and use will determine to produce the amount of the required imaging moiety of diagnostic image.With regard to the situation of radiosiotope part, for human experimenter, radioactive amount of injection will be generally about 5-20 millicurie, for example 5-20 millicurie ⁹⁹tc.The binding molecule of labelling (for example, antibody or antibody fragment) then will preferentially accumulate on the cell position place of containing specified protein.In-vivo tumour is imaged on S.W.Burchiel etc., " Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments. " (the 13rd chapter in Tumor Imaging: The Radiochemical Detection of Cancer, S.W.Burchiel and B.A.Rhodes work, Masson Publishing Inc. (1982)) in, describe to some extent.

According to several variable factors (type and the administering mode that comprise labelling used), after administration for make labelled molecule experimenter preferentially concentrate on site and unconjugated labelled molecule be eliminated to the interval of background level be 6-48 hour or 6-24 hour or 6-12 hour.In another embodiment, the described interval after administration is 5-20 days or 7-10 days.

Can use the method for body interscan known in the art whether to detect the existence of patient's labelled molecule.These methods depend on the type of labelling used.Those skilled in the art can be identified for detecting the proper method of specific markers.The method and apparatus that can be used for diagnostic method of the present invention includes but not limited to: computed tomography (CT), body scan (as positron emission computerized tomography (PET), nuclear magnetic resonance (MRI) and ultrasound investigation (sonography)), sciagraphy, NMR (Nuclear Magnetic Resonance)-imaging (NMR), cat scan or electron spin resonance imaging (ESR).

pharmaceutical composition

Compositions as herein described can be incorporated among the multiple preparation for administration.More specifically, described compositions can be by combining and be made into pharmaceutical composition with suitable, pharmaceutically acceptable carrier or diluent, and can be made into the preparation (as capsule, powder agent, granule, gel, slurry agent, unguentum, solution, suppository, injection, inhalant and aerosol) of semisolid, liquid or gas form.Similarly, the administration of described compositions may be implemented in a variety of ways, and comprises administration in oral administration, buccal administration, rectally, parenteral, intraperitoneal administration, intradermal administration, percutaneous dosing, trachea.In addition, described compositions can be with local mode rather than systemic fashion administration in bank dosage form or slow release formulation.

In addition, described compositions can be prepared and is pressed into together with usual excipients, diluent or carrier tablet, or be mixed with elixir (elixir) or solution to facilitate oral administration, or by intramuscular or intravenous route administration.Described compositions percutaneous can be given, and can be formulated as slow release formulation etc.Compositions can be given separately, combine and give to each other, or it can combine use with other known compound (compound of discussing) herein.

For applicable dosage form of the present invention, be recorded in Remington ' s Pharmaceutical Sciences (1985).In addition, about the summary of delivery method, referring to: Langer (1990) Science249:1527-1533.The mode of can those skilled in the art knowing is manufactured pharmaceutical composition as described herein, for example, by mixing, dissolving, pelletize, manufacture sugar-coat, porphyrize, emulsifying, encapsulation, embedding or frozen dried, is undertaken.Following method and excipient are only for exemplary restrictive anything but.

For oral administration, can be by being combined to prepare described compositions with pharmaceutically acceptable carrier known in the art.Examples of such carriers makes described compound can be configured to pill, capsule, Emulsion, lipotropy and hydrophilic suspensoid, liquid agent, gel, syrup, slurry agent, suspensoid etc., for the patient's orally ingestible by be treated.For the pharmaceutical preparation orally using, can obtain through the following steps: by described compositions and mixed with excipients; and after adding applicable auxiliary agent (words if necessary); granulate mixture is processed, to obtain the core (dragee core) of tablet or sugar-coat agent.Especially, applicable excipient is: filler, as sugar (comprising lactose, sucrose, mannitol or sorbitol); Cellulose preparation, as corn starch, wheaten starch, rice starch, potato starch, gelatin, Tragacanth, methylcellulose, hydroxypropyl emthylcellulose, sodium carboxymethyl cellulose and/or polyvinylpyrrolidone (PVP).

For inhalation, form that can aerosol spray preparation for the compositions of purposes of the present invention is sent easily, described aerosol spray preparation comes from pressurized package or the aerosol apparatus of the applicable propellant (propellant) (for example, dichlorodifluoromethane, Arcton 11, dichlorotetra-fluoroethane, carbon dioxide or other applicable gas) of use or comes from the Diskus without propellant.With regard to pressurised aerosol, can determine dosage unit by being provided for sending the valve of regulation quantity delivered.For the capsule of for example gelatin that uses at inhaler or insufflator and cartridge case (cartridge), can be formulated into the mixed-powder that comprises described compound and applicable powder base (powder base) (as lactose or starch).

Described compositions can be mixed with to the parenteral for for example, being undertaken by injection (, team is noted (bolus injection) or continuous infusion).Can be in the situation that there is added antiseptic and for example, exist with unit dosage forms (, in ampoule or multi-dose container) for the preparation injected.Described compositions can adopt following form: suspensoid, solution or the Emulsion in oiliness or aqueous carrier, and can contain formula agent (formulator agent) (as suspending agent, stabilizing agent and/or dispersant).

Also described compositions can be formulated as to rectal compositions (as suppository or retention enema (retention enemas)), described compositions for example contains traditional suppository substrate (as cocoa butter, Carbowax (carbowax), Polyethylene Glycol or other glyceride), all these substrates are all melted under body temperature, and at room temperature solidify.

In addition, also described compositions can be mixed with to bank agent.This type of long-acting preparation can pass through drug delivery implant (for example, subcutaneous or intramuscular administration) or pass through administered intramuscular.Therefore, for example, compound and applicable polymer or hydrophobic substance (for example, the Emulsion in acceptable oil) or ion exchange resin can be prepared together, or for example, be prepared with the form of slightly soluble derivant (, slightly soluble salt).

Lipid granule (for example, liposome) and Emulsion are the known medium of sending (vehicle) for hydrophobic drug or the example of carrier.Can use long circulating liposomes (for example, hidden liposome (stealth liposome)).U.S. the patent No. 5,013, in 556 describe, in general terms this lipoid plastid.Compound of the present invention also can carry out administration by controlled release means and/or delivery apparatus, described controlled release means and/be described in U.S. Patent number 3,845 as delivery apparatus, in 770,3,916,899,3,536,809,3,598,123 and 4,008,719.

Be suitable for pharmaceutical composition of the present invention and comprise the compositions that wherein contains the active component for the treatment of effective dose.The amount nature of the compositions giving will depend on experimenter, experimenter's body weight, the order of severity, administering mode and the prescriber's of slight illness the judgement for the treatment of.To the definite of effective dose, be within those skilled in the art's limit of power, especially under based on detailed disclosed situation provided herein.Conventionally, the suitable daily dose of AHCM agent and/or cancer therapeutic agent can be the amount that compound produces the lowest dose level of effective curative effect.This effective dose can depend on above-mentioned factor conventionally.

The experimenter who accepts this treatment is any animal needing that has, and comprises primate (the particularly mankind), horse, cattle, pig, sheep, poultry, Canis familiaris L., cat, Mouse and rat.

Can every day, every two days, on every Wendesdays time, twice weekly, weekly or within every two weeks, give described compound.Therapeutic regimen can comprise " drug holiday ", that is, can two weeks stop one week or administration stops one week for three weeks or administration surrounding is stopped one week etc.; Or serially, without drug holiday ground administration.Can give described compound by oral, intravenous, intraperitoneal, part, percutaneous, intramuscular, subcutaneous, intranasal, Sublingual or any other approach.

Owing to for example, combining and giving AHCM agent with other treatment (other chemotherapeutics, radiation or operation), the dosage of each reagent or treatment can be lower than the corresponding dosage for single agents treatment.To the definite of administering mode and correct dose, be well-known to those skilled in the art.

In one embodiment, for example, via implantable infusion device (, pump), give AHCM.Implantable infusion device generally includes the shell that contains reservoir, and described reservoir can be full of by penetrating the hypodermic needle percutaneous of charging door barrier film.Medicament reservoir is connected with device outlet via inner flow passage conventionally, with by liquid by catheter delivery to patient body site.Typical infusion device also comprises controller and fluid transfer mechanism (as pump or valve) conventionally, for liquid being transferred to device from bin by inner flow passage, exports.

nano-particle

AHCM agent as herein described, anticarcinogen (for example, low-molecular-weight anticarcinogen as herein described, middle molecular weight anticarcinogen) or both can be packaged in nano-particle.

Conventionally, the diameter of nano-particle is 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm or 200nm, or 200-1,000nm, for example, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm or 200nm, or 20-400nm, 30-400nm, 50-400nm.Less granule is easy in system, remove sooner.Medicine can be embedded in nano-particle inside or is connected to nano-particle (for example, covalently bound) or adheres to nano-particle.

Nano-particle based on lipid or the nano-particle based on oily (as elaioplast nanometer particle and solid-state lipid nanometer granule) can be used for sending reagent as herein described.

example for elaioplast nanometer particle.Solid-state lipid nanometer granule for delivering carcinostatic agent is described in Serpe etc., and (2004) Eur.J.Pharm.Bioparm.58:673-680 and Lu etc., (in 20060Eur.J.Pharm.Sci.28:86-95.Nano-particle based on polymer (for example, the nano-particle based on PLGA) can be used for sending reagent as herein described.These nano-particle tend to rely on biodegradable skeleton, and therapeutic agent inserts in (being with or without covalently bound with polymer) polymeric matrix.PLGA is widely used in polymer nano granules, referring to Hu etc., (2009) J.Control.Release134:55-61; Cheng etc., (2007) Biomaterials28:869-876; And Chan etc., (2009) Biomaterials30:1627-1634.The nano-particle based on PLGA of PEGization also can be used for delivering carcinostatic agent, referring to, for example, Danhhier etc., (2009) J.Control.Release133:11-17; Gryparis etc. (2007) Eur.J.Pharm.Biopharm.67:1-8.Nano-particle based on metal (for example nano-particle based on golden) also can be used for delivering carcinostatic agent.Nano-particle based on protein (for example,, based on albuminous nano-particle) can be used for sending reagent as herein described.For example, reagent can be bonded to human albumin nano-particle.Exemplary anticarcinogen/protein nano granule is

wherein, paclitaxel is bonded to albumin nanometer rice grain.

Nano-particle can adopt initiatively targeting, passive target or the two.Initiatively targeting can be dependent on to comprise and for example, locates with previously selected site (, solid tumor) or part that near the target it combines.Passive target nano-particle can spread and the accumulation of interested site (for example, the site that the blood capillary of excessive seepage of take is feature, for example in tumor and inflammation site viewed)

This area scope-aware is nano-particle widely.Exemplary method is included in the method as described in Publication about Document: WO2010/005726, WO2010/005723, WO2010/005721, WO2010/121949, WO2010/0075072, WO2010/068866, WO2010/005740, WO2006/014626,7,820,788,7,780,984, by reference the content whole of above-mentioned document is incorporated to herein.

The present invention can any one in the paragraph of numbering below define:

1. improve treatment of cancer sending or the method for effect in experimenter, described method comprises:

Based on to improving sending or the needs of effect of described treatment of cancer, to accepting the experimenter of hypotensive agent and/or collagen-modified dose (" AHCM "), identify; And (a) or (b) any one or (a) and (b) both:

(a) to described experimenter, give described AHCM; Or

(b) give described treatment of cancer,

Wherein, be enough to improve described treatment of cancer send or the dosage of effect gives described AHCM.

2. a method of in experimenter, cancer being treated or being prevented, described method comprises:

Based on to improving sending or the needs of effect for the treatment of of cancer, to accepting the experimenter of hypotensive agent and/or collagen-modified dose (" AHCM "), identify; And (a) or (b) any one or (a) and (b) both:

(a) to described experimenter, give described AHCM; Or

(b) give described treatment of cancer,

Wherein, described cancer is treated or the dosage that prevents gives described AHCM being enough to.

3. the method as described in section 1 or 2, described method comprises one or more in following:

A) described AHCM, described treatment of cancer or the two are greater than to 1nm, 5nm, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm, 200nm as hydrodynamic diameter, but the entity that is less than 300nm gives;

B), within start in cancer diagnosis or described AHCM medication 5 days, 10 days, 30 days, 60 days or 100 days, to described experimenter, do not give AHCM dosage;

C) described experimenter was not hypertension or has suffered from hypertension before giving described AHCM;

D) before giving described treatment of cancer, give described AHCM when at least 1 day, 2 days, 3 days or 5 days; Or before giving described treatment of cancer 1 week, 2 weeks, 3 weeks, give described AHCM when more than 4 weeks or 5 weeks;

E) before giving described treatment of cancer, give described AHCM when at least 1 day, 2 days, 3 days or 5 days; Or before giving described treatment of cancer 1 week, 2 weeks, 3 weeks, give described AHCM when more than 4 weeks or 5 weeks, and described AHCM and described treatment of cancer are given simultaneously; Or

F) described AHCM is given continuously within the time period of at least 1 hour, 5 hours, 10 hours or 24 hours; In the time period of at least 2 days, 5 days, 10 days or 14 days, give continuously; In the time period at least 2 weeks, 3 weeks, 4 weeks, 5 weeks or 6 weeks, give continuously; In the time period of at least 2 months, 3 months, 4 months, 5 months or 6 months, give continuously; Or give continuously in the time period of at least 1 year, 2 years, 3 years, 4 years or 5 years.

4. the method as described in any one in section 1-3, wherein, described AHCM is selected from one or more in following reagent:

(i) angiotensin-ii receptor blockers (AT ₁blocker);

(ii) renin-angiotensin-aldosterone system antagonist (" RAAS antagonist ");

(iii) Angiotensin-Converting (ACE) inhibitor;

(iv) Thrombospondin 1 (TSP-1) inhibitor;

(v) transforminggrowthfactor-β1 (TGF-β 1) inhibitor; Or

(vi) Connective Tissue Growth Factor (CTGF) inhibitor.

5. the method as described in any one in section 1-4, wherein, described AHCM is AT ₁blocker, described AT ₁blocker is selected from one or more in following reagent: losartan

candesartan

eprosartan mesilate

eXP3174, irbesartan

l158,809, Olmesartan

saralasin, telmisartan

valsartan

or the derivant of mentioned reagent.

6. the method as described in any one in section 1-5, wherein, described AHCM is losartan.

7. the method as described in any one in section 1-6, wherein, described AHCM is RAAS antagonist, described RAAS antagonist is selected from one or more in following reagent: aliskiren

remikiren (Ro42-5892), enalkiren (A-64662), SPP635, or the derivant of mentioned reagent.

8. the method as described in any one in section 1-7, wherein, described AHCM is ACE inhibitor, described ACE inhibitor is selected from one or more in following reagent: benazepril captopril

enalapril

fosinopril

lisinopril

moexipril

perindopril quinapril

ramipril

trandolapril

or the derivant of mentioned reagent.

9. the method as described in any one in section 1-8, wherein, described AHCM is TSP-1 inhibitor, described TSP-1 inhibitor is selected from one or more in following reagent: ABT-510, CVX-045, LSKL, or the derivant of mentioned reagent.

10. the method as described in section 4, wherein, described TGF-β 1 inhibitor is selected from one or more in following reagent: anti-TGF-beta 1 antibody or TGF-β 1 inhibitor peptides.

11. methods as described in section 4, wherein, described CTGF inhibitor is selected from one or more in following reagent: DN-9693, FG-3019, or the derivant of mentioned reagent.

12. methods as described in any one in section 1-11, wherein, to be enough to the strengthening distribution of described treatment of cancer or the amount of effect gives described AHCM.

13. methods as described in any one in section 1-12, wherein, so that described treatment of cancer causes that the dosage of following one or more variations gives described AHCM in described experimenter's tumor or tumor vessel: reduce collagen protein level or generation, reduction tumor fibrosis, improve mesenchymal neoplasm transportation, improve tumor perfusion or enhancing penetrates or spreads.

14. methods as described in any one in section 1-13, wherein, described AHCM is losartan, and the amount with 25-100mg/ days gives by it.

15. methods as described in any one in section 1-14, wherein, described AHCM is losartan, and the dosage form with 12.5mg, 25mg, 50mg or 100mg provides by it.

16. methods as described in any one in section 1-15, wherein, described AHCM is losartan, and it is given with the sub-resisting hypertension dosage in following scope: 0.25-17.5mg/ days, 0.5-15mg/ days, 1.3-12mg/ days, 1.5-12mg/ days, 2-12mg/ days, 2-10mg/ days, 2-5mg/ days, 2-3mg/ days or 2mg/ days.

17. methods as described in any one in section 1-16, wherein, described AHCM is losartan, and more than 1.1 times, 1.5 times, 1.7 times, 2 times, 3 times, 4 times, 5 times or the 10 times dosage with the therapeutic dose standard higher than resisting hypertension purposes or heart failure resistance purposes give by it.

18. methods as described in any one in section 1-17, wherein, give described AHCM: the described AHCM with sub-resisting hypertension dosage carried out for first course for the treatment of as follows; With standard hypertension dosage or higher than the described AHCM of standard hypertension dosage, carried out for second course for the treatment of subsequently.

19. methods as described in any one in section 1-18, wherein, described AHCM is greater than 1nm, 5nm, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm, 200nm as hydrodynamic diameter, but the entity that is less than 300nm gives.

20. methods as described in section 19, wherein, described AHCM gives as polymer nano granules or lipid nanometer granule.

21. methods as described in any one in section 1-20, wherein, described treatment of cancer is cancer therapeutic agent, described cancer therapeutic agent is greater than 1nm, 5nm, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm, 200nm as hydrodynamic diameter, but the entity that is less than 300nm gives.

22. methods as described in section 21, wherein, described cancer therapeutic agent gives as polymer nano granules or lipid nanometer granule.

23. methods as described in any one in section 1-22, wherein, provide described AHCM or described cancer therapeutic agent independently of one another to have the entity of following magnitude range (take nm): hydrodynamic diameter is less than or equal to 1nm or as 0.1-1.0nm; Hydrodynamic diameter is 5-20nm or 5-15nm; Or hydrodynamic diameter is 1nm, 5nm, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm, 200nm, but be less than 300nm.

24. methods as described in any one in section 1-23, wherein, described experimenter has following one or more situations:

(i) do not suffer from hypertension;

(ii) when described AHCM treatment starts, hypertension is not treated; Or

(iii) there is normal arterial pressure or hypotension.

25. methods as described in any one in section 1-24, wherein, within start 5 days, 10 days, 30 days, 60 days or 100 days, did not give described AHCM to described experimenter in cancer diagnosis or described AHCM medication.

26. methods as described in any one in section 1-25, wherein, described experimenter needs or is considering to carry out treatment of cancer.

27. methods as described in any one in section 1-26, wherein, described method comprises the steps: to determine whether described experimenter suffers from cancer; And give described AHCM and described treatment of cancer for described definite result.

28. methods as described in any one in section 1-27, wherein, described experimenter is in solid tumor, the ill risk of fibrosis tumor; Or suffer from solid tumor, fibrosis tumor.

29. methods as described in section 28, wherein, described experimenter has preneoplastic lesion state or cancer susceptibility.

30. methods as described in any one in section 1-29, wherein, described cancer is selected from one or more in following cancer: cancer of pancreas, breast carcinoma, colorectal cancer, pulmonary carcinoma, skin carcinoma, ovarian cancer, carcinoma of prostate, cervical cancer, human primary gastrointestinal cancers, gastric cancer, incidence cancer, renal carcinoma or hepatocarcinoma, or above-mentioned cancer metastasis focus.

31. methods as described in any one in section 1-30 wherein, are combined and are given described AHCM before described treatment of cancer and/or with described treatment of cancer.

32. methods as described in any one in section 1-31, wherein, described treatment of cancer is selected from one or more in anticarcinogen, operation and/or radiation.

33. methods as described in any one in section 1-32 wherein, give described AHCM when at least 1 day, 2 days, 3 days or 5 days before described treatment of cancer; Or before described treatment of cancer 1 week, 2 weeks, 3 weeks, give described AHCM when more than 4 weeks or 5 weeks.

34. methods as described in any one in section 1-33 wherein, maintain described AHCM in described experimenter accepts the previously selected part-time section for the treatment of of cancer.

35. methods as described in any one in section 1-34, wherein, are giving to maintain described AHCM in the whole time period of described treatment of cancer.

36. methods as described in any one in section 1-35 wherein, give described AHCM continuously within the time period of at least 1 hour, 5 hours, 10 hours or 24 hours; In the time period of at least 2 days, 5 days, 10 days or 14 days, give continuously; In the time period at least 2 weeks, 3 weeks, 4 weeks, 5 weeks or 6 weeks, give continuously; In the time period of at least 2 months, 3 months, 4 months, 5 months or 6 months, give continuously; Or give continuously in the time period of at least 1 year, 2 years, 3 years, 4 years or 5 years.

37. methods as described in any one in section 1-36, wherein, described AHCM gives as slow releasing preparation.

38. methods as described in any one in section 1-37, wherein, are mixed with described AHCM for oral, subcutaneous or intravenous and send continuously.

39. methods as described in any one in section 1-38, wherein, described AHCM gives by subcutaneous pump, implant or bank agent.

40. methods as described in any one in section 1-39, wherein, described treatment of cancer is selected from one or more in following:

(i) cancer therapeutic agent, described cancer therapeutic agent is selected from the lipid nanometer granule of viral cancer therapeutic agent, anticancer therapeutic agent, the polymer nano granules of anticancer therapeutic agent, the antibody for cancer target, dsRNA reagent, antisense RNA reagent or chemotherapeutant;

(ii) radiation;

(iii) hands art; Or

(iv) (i)-combination in any (iii).

41. methods as described in section 40, wherein, described lipid nanometer granule is selected from pegylated liposomal doxorubicin or liposome paclitaxel (for example, ).

42. methods as described in section 40, wherein, described chemotherapeutant is selected from gemcitabine, cisplatin, epirubicin, 5-fluorouracil, paclitaxel, oxaliplatin or folinic acid.

43. methods as described in section 40, wherein, the described antibody for cancer target is selected from anti-HER-2/neu antibody, anti-HER3 antibody, VEGF antibody or anti-egfr antibodies.

44. methods as described in any one in section 1-39, wherein, described treatment of cancer is tyrosine kinase inhibitor, and described tyrosine kinase inhibitor is selected from: Sutent, Erlotinib, gefitinib, Sorafenib, Conmana, Lapatinib, HKI-272, ZD6474, BIBW2992 or XL-647; Or described treatment of cancer is anti-egfr antibodies, described anti-egfr antibodies is selected from: Cetuximab, Victibix, bundle calamite monoclonal antibody, Buddhist nun's trastuzumab, how former times wood monoclonal antibody or horse trastuzumab.

45. methods as described in section 40, wherein, described chemotherapeutant is cytotoxic agent or cytostatic agent.

46. methods as described in section 40 or 45, wherein, described chemotherapeutant is selected from: anti-microtubule agent, topoisomerase enzyme inhibitor, taxane, antimetabolite, mitotic inhibitor, alkylating agent or intercalator.

47. methods as described in any one in section 1-46, wherein, described treatment of cancer is selected from one or more in following reagent: anti-angiogenic agent, blood-vessels target agent or angiorrhexis agent.

48. methods as described in any one in section 1-47, wherein, described AHCM or described treatment of cancer give described experimenter by whole body administration, and described whole body administration is selected from: oral administration, parenteral, subcutaneous administration, intravenous administration, rectally, intramuscular administration, intraperitoneal administration, intranasal administration, percutaneous dosing or by inhaler or intracavitary unit administration.

49. methods as described in any one in section 1-48, described method further comprises monitors in following variation aspect one or more described experimenter:

Tumor size;

Level or the signal of one or more in transforminggrowthfactor-β1 (TGF-β 1), Connective Tissue Growth Factor (CTGF) or Thrombospondin 1 (TSP-1);

Tumor collagen protein I level;

Fibrotic amount;

Interstitial pressure;

Blood plasma biomarker or serum biomarker, described biomarker is selected from collagen protein I, collagen protein III, collagen protein IV, TGF-β 1, CTGF or TSP-1;

The level of one or more cancer markers;

The speed that new pathological changes appearance, metabolism, anoxia develop;

The appearance of new disease related symptom;

The size of piece of tissue;

The degree of disease association pain;

Whether histologic analysis, lobule pattern and/or mitotic cell exist; Or

The vascularization of tumor invasiveness, primary tumo(u)r or transfer diffusion.

49. 1 kinds of pharmaceutical compositions that comprise nano-particle, described nano-particle comprises AHCM.

50. a pharmaceutical composition that comprises nano-particle, described nano-particle comprises AHCM and cancer therapeutic agent.

51. pharmaceutical compositions as described in section 50, wherein, described cancer therapeutic agent is selected from the lipid nanometer granule of viral cancer therapeutic agent, anticarcinogen, the polymer nano granules of anticarcinogen, the antibody for cancer target, dsRNA reagent, antisense RNA reagent or chemotherapeutant.

52. pharmaceutical compositions as described in any one in section 49-51, wherein, described nano-particle is polymer nano granules or lipid nanometer granule.

53. pharmaceutical compositions as described in any one in section 49-51, wherein, are mixed with following dosage form by described AHCM: the dosage form that the therapeutic dosage forms standard according to described AHCM in resisting hypertension purposes or heart failure resistance purposes is mixed with.

54. pharmaceutical compositions as described in any one in section 49-51, wherein, described AHCM is mixed with to following dosage form: the dosage form of 0.01 times, 0.02 times, 0.03 times, 0.04 times, 0.05 times, 0.06 times, 0.07 times, 0.08 times, 0.09 times, 0.1 times, 0.15 times, 0.16 times, 0.2 times, 0.3 times, 0.4 times, 0.5 times, 0.6 times, 0.7 times of the therapeutic dosage forms standard lower than described AHCM in resisting hypertension purposes or heart failure resistance purposes.

55. pharmaceutical compositions as described in any one in section 49-51, wherein, described AHCM is mixed with to following dosage form: 1.1 times, 1.5 times, 1.7 times, 2 times, 3 times, 4 times, more than 5 times or 10 times dosage forms of the therapeutic dosage forms standard higher than described AHCM in resisting hypertension purposes or heart failure resistance purposes.

56. 1 kinds of AHCM dosage forms, wherein, described AHCM is mixed with to following dosage form: the dosage form of 0.01 times, 0.02 times, 0.03 times, 0.04 times, 0.05 times, 0.06 times, 0.07 times, 0.08 times, 0.09 times, 0.1 times, 0.15 times, 0.16 times, 0.2 times, 0.3 times, 0.4 times, 0.5 times, 0.6 times, 0.7 times of the therapeutic dosage forms standard lower than described AHCM in resisting hypertension purposes or heart failure resistance purposes.

57. 1 kinds of AHCM dosage forms, wherein, described AHCM is mixed with to following dosage form: 1.1 times, 1.5 times, 1.7 times, 2 times, 3 times, 4 times, more than 5 times or 10 times dosage forms of the therapeutic dosage forms standard higher than described AHCM in resisting hypertension purposes or heart failure resistance purposes.

58. 1 kinds make reagent to the approaching optimization or make cancer from reagent to the optimized method of sending of cancer, and described reagent is for example diagnostic agent or developer, and described method comprises:

To experimenter, give hypotensive agent and/or collagen-modified dose (" AHCM "); And

Optionally, to described experimenter, give described reagent, wherein, described method comprises one or more in following:

A) hydrodynamic diameter of described diagnostic agent or developer is greater than 1nm, 5nm or is 20-150nm;

B) described reagent is radioreagent, NMRA reagent, contrast agent; Or

C) with AHCM administration, described experimenter is treated, wherein, before giving described reagent, start described AHCM administration when at least 2 days, 3 days or 5 days; Or before giving described reagent 1 week, 2 weeks, 3 weeks, start described AHCM administration when more than 4 weeks or 5 weeks.

59. 1 kinds of method or algoscopys for hypotensive agent and/or collagen-modified dose (AHCM) are identified, described method or algoscopy comprise:

Cancerous cell or cancer relevant cell are contacted with candidate agent;

Variation described in when described candidate agent is existed or do not existed in cancerous cell detects, wherein, the variation detecting comprises one or more in following variation: the increase and decrease of increase and decrease, the increase and decrease of TGF-β 1 level, the increase and decrease of Connective Tissue Growth Factor (CTGF) level or collagen protein (for example collagen protein I) level of activation TGF-β.

60. method or algoscopys as described in section 59, wherein, described candidate agent is selected from one or more in following reagent: renin-angiotensin-aldosterone system antagonist (" RAAS antagonist "), Angiotensin-Converting (ACE) inhibitor, angiotensin-ii receptor blockers (AT ₁blocker), Thrombospondin 1 (TSP-1) inhibitor, transforminggrowthfactor-β1 (TGF-β 1) inhibitor or Connective Tissue Growth Factor (CTGF) inhibitor.

61. method or algoscopys as described in section 59 or 60, wherein, described candidate agent reduces one or more in following: activation TGF-β, TGF-β 1 level, Connective Tissue Growth Factor (CTGF) level or collagen protein level.

62. method or algoscopys as described in any one in section 59-61, described method or algoscopy further comprise the steps: Therapeutic Method or algoscopy and reference value to compare; And the difference between treatment value and described reference value is compared.

63. method or algoscopys as described in any one in section 59-62, described method or algoscopy in vitro, in body or both are in conjunction with carrying out.

64. method or algoscopys as described in any one in section 59-63, described method or algoscopy comprise in the following way to be evaluated described candidate agent in vitro: described candidate agent is added into culture medium; And the increase and decrease of the activation TGF-β in conditioned medium, TGF-β 1 level, Connective Tissue Growth Factor (CTGF) level or collagen protein level is analyzed.

65. method or algoscopys as described in any one in section 59-64, described method or algoscopy comprise the steps: described candidate agent to give animal tumor model; And the increase and decrease of described experimenter's activation TGF-β, TGF-β 1 level, Connective Tissue Growth Factor (CTGF) level or collagen protein level is analyzed.

66. 1 kinds are used hypotensive agent and/or collagen-modified dose (AHCM) separately or combine with cancer therapeutic agent the compositions of using so that cancer is treated; Or, described hypotensive agent independent or that combine with cancer therapeutic agent and/or the collagen-modified dose of AHCM purposes in cancer is treated.

67. 1 kinds for the treatment of test kits that are used for the treatment of cancer, described test kit comprises:

Independent or combine with cancer therapeutic agent hypotensive agent and/or collagen-modified dose (AHCM); And

Description.

68. 1 kinds of diagnostic kits for cancer diagnosis, described test kit comprises:

Independent or combine with developer hypotensive agent and/or collagen-modified dose (AHCM); And

Description.

69. 1 kinds of methods for selecting accepting the experimenter of hypotensive agent and/or collagen-modified dose (" AHCM "), described method comprises:

Based on to improving sending or the needs of effect for the treatment of of cancer, to accepting the experimenter of described AHCM, select; And (a) or (b) any one or (a) and (b) both:

(a) to described experimenter, give described AHCM; Or

(b) give described treatment of cancer,

Wherein, be enough to improve described treatment of cancer send or the dosage of effect gives described AHCM.

Embodiment

With reference to the following example, by being easier to understand at present by the present invention of general description, only for illustrating the object of some aspect of the present invention and embodiment, comprise described embodiment, and do not mean that restriction the present invention.

In the following example 1-embodiment 6, inventor to AHCM agent (for example, losartan, a kind of angiotensin ii receptor antagonist of clinical approval, be generally used for treating hypertension) can strengthen penetrating with effect of Nano medication and carried out evaluating (for example,, by fibrosis effect).Although nanometer therapeutic agent provides new hope for treatment of cancer, its clinical efficacy not too large (Jain RK etc., (2010) Nat Rev Clin Oncol7:653-664; Davis ME etc., (2008) Nat Rev Drug Discov7:771-782; Peer D etc., (2007) Nat Nanotechnol2:751-760; And Torchilin VP (2005) Nat Rev Drug Discov4:145-160).Do not wish bound by theory, collagen protein network intensive in tumor can reduce penetrating and effect of nanometer therapeutic agent conventionally.Partly cause is because penetrating especially of they hindered in fibrosis tumor, in described fibrosis tumor, between the fubril in interstitial, spacing has blocked movement (Netti PA etc., (2000) Cancer Res60:2497-2503 of the granule that is greater than 10 nanometers; Pluen A etc., (2001) Proc Natl Acad Sci USA98:4628-4633; Ramanujan S etc., (2002) Biophys J83:1650-1660; And Brown E etc., (2003) Nat Med9:796-800).Pegylated liposomal doxorubicin through FDA approval

and at present at the oncolytic virus that carries out various clinical test, represented that its size (～100nm) has hindered two kinds of nanometer therapeutic agents (Nemunaitis J etc., (2001) J Clin Oncol19:289-298) of distribution and curative effect its tumor in.Substrate improver (matrix modifier) improves for the collagen protein network to tumor or proteoglycan network as antibacterial Collagenase, relaxin (relaxin) and Fibroblast collagenase and Matrix metalloproteinase-8, and effect (Brown E etc., (2003) the Nat Med9:796-800 of the oncolytic virus of (i.t.) injection in tumor have been improved; McKee TD etc., (2006) Cancer Res66:2509-2513; Mok W etc., (2007) Cancer Res67:10664-10668; Ganesh S etc., (2007) CancerRes67:4399-4407; And Kim J-H etc., (2006) J Natl Cancer Inst98:1482-1493).In addition, relaxin can improve the transportation via tumor stroma, but can not promote send (US6,719,977) of low-molecular-weight reagent.For example, for example, yet these reagent can produce normal structure toxicity (, antibacterial Collagenase) or make the risk of tumor development increase (, relaxin, matrix metalloproteinase).

Be approved for and control the security risk that the hypertensive losartan of patient (Johnston CI (1995) Lancet346:1403-1407) does not have these many kinds.And except its possesses antihypertensive properties, losartan has still been proved to be antifibrotic agents (Habashi JP etc., (2006) Science312:117-121 that can reduce heart and renal fibrosis incidence rate; And Cohn RD etc., (2007) Nat Med13:204-210).The fibrosis effect of losartan is partly caused by following process: TGF-β 1 activator (as Thrombospondin 1 (TSP-1)) via I receptor (AGTR1) mediation of Angiotensin II is lowered, and the level of the transforminggrowthfactor-β1 (TGF-β 1) of activation is suppressed to (Habashi JP etc., (2006) Science312:117-121; Cohn RD etc., (2007) Nat Med13:204-210; Lavoie P etc., (2005) JHypertens23:1895-1903; Chamberlain JS (2007) Nat Med13:125-126; And Dietz HC (2010) J Clin Invest120:403-407).

As follows, AHCM agent (for example, losartan) has suppressed the generation of the collagen protein I of cancer associated fibroblast cell (separated in breast carcinoma biopsy).In addition, AHCM agent (for example, losartan) makes the dependent reduction of substrates collagen generation dosage in the short desmoplastic mouse model of human mammary tumor, pancreas tumor and cutaneous tumor.For example, and AHCM agent (, losartan) has improved distribution and the curative effect of the oncolytic herpes simplex virus (HSV) of intratumor injection.In addition AHCM agent, (for example, losartan) has also strengthened the pegylated liposomal doxorubicin of intravenous injection

effect.Therefore, AHCM agent (for example, losartan) for example, can strengthen the effect of nanometer therapeutic agent in the patient who suffers from short desmoplastic tumor with the administering drug combinations of cancer therapeutic agent (, cancer nanometer therapeutic agent).

Use has the dosage of minimum influence to mean arterial pressure (MABP), inventor has proved: AHCM agent (for example, losartan) in four kinds of tumor models, reduced the level of collagen protein I, described four kinds of tumor models are: fibrosarcoma (HSTS26T) and the melanoma (Mu89) of spontaneous mouse breast cancer (FVB MMTV PyVT), original position (orthotopic) pancreas adenocarcinoma (L3.6p1) and subcutaneous transplantation.In addition, inventor has proved: AHCM agent (for example, losartan) can also improve in the tumor of nano-particle of (i.t.) in tumor or intravenous (i.v.) injection and penetrates.

In addition, inventor (has for example assessed AHCM agent, losartan) can how to affect distribution and effect (Hu JC etc., (2006) the Clin Cancer Res12:6737-6747 of the oncolytic HSV of administration in tumor (in gene therapy to experimenter's administration time widely used method); Senzer NN etc., (2009) J Clin Oncol27:5763-5771; Breitbach CJ etc., (2010) Cytokine Growth Factor Rev21:85-89); And how to affect intravenous administration effect.As shown below, AHCM agent (for example, losartan) has improved the oncolytic HSV of intratumor injection and intravenous injection

both effect.In tumor, the result of (i.t.) experiment shows, AHCM agent (for example, losartan) can strengthen nano-particle penetrating in interstitial space by improving interstitial transportation.In addition, the discovery of intravenous (i.v.) research shows, AHCM agent (for example, losartan) can improve the nanometer therapeutic agent of whole body administration to fibrosis solid tumor or even the effect to the solid tumor of high fiber (as pancreas adenocarcinoma).Therefore, AHCM agent (for example, losartan, a kind of antihypertensive drug through FDA approval) is used in the effect of improving various nanometer therapeutic agents in kinds of tumors type.

embodiment 1: losartan suppresses cancer associated fibroblast cell (CAF) to collagen protein I's synthetic

Losartan has been carried out detecting (Fig. 1) at mammary gland CAF to the expression of the generation of collagen protein I and TGF-β 1 and the impact aspect activation.Losartan has reduced the activation of TGF-β 1 and the generation of collagen protein I in cancer associated fibroblast cell in vitro.Losartan with 10 μ mol/L is processed cell 24 hours.Losartan in Reducing activation TGF-β 1 level 90%, and total TGF-β 1 level is uninfluenced.There is corresponding 27% reduction in collagen protein I level.(the student t check p < 0.05) that be reduced to statistically significant of activation TGF-β 1 and collagen protein I.Because the collagen protein in tumor is produced by CAF mostly, therefore checked the impact of losartan on collagen content in tumor.

embodiment 2: losartan reduces the collagen protein I in tumor in dose-dependent mode

For the dose response of losartan collagen protein level in tumor is measured, the losartan of intraperitoneal (i.p.) injection 10mg/kg/ days, 20mg/kg/ days and 60mg/kg/ days, then the fibrous collagen protein of the HSTS26T tumor in skin of back fold chamber (dorsal skin fold chambers) is carried out to second harmonic generation (second harmonic generation, SHG) imaging (Fig. 2 A-Fig. 2 B), and tumor biopsy is carried out to collagen protein I immunostaining (Fig. 3 A-Fig. 3 D).Although SHG signal intensity can comprise by collagen protein I and other, form fibril (fibril) collagen protein (for example, collagen protein III or collagen protein V) contribution signal, collagen protein I is generally main collagen-type (Gelse K etc. in most of soft tissues, (2003) Adv Drug Deliv Rev55:1531-1546), therefore in SHG signal as main source.In addition, in human pancreas's tumor, collagen protein I is main fibrous collagen protein, and the level of collagen protein V significantly lower (Mollenhauer J etc., (1987) Pancreas2:14-24).The losartan dosage of 20mg/kg/ days and 60mg/kg/ days has significantly reduced the SHG signal intensity in tumor, and the lowest dose level of 10mg/kg/ days does not have appreciable impact (Fig. 2 A and Fig. 2 B) to SHG signal intensity.The losartan injection of 60mg/kg/ days and 20mg/kg/ days also makes the immunostaining of collagen protein I significantly reduce respectively 65% and 42% (Fig. 3) in HSTS26T tumor.The processing of carrying out with the dosage of 60mg/kg/ days has produced the highest collagen protein I and has reduced, and is accompanied by reduction (the p < 0.04 of the mean arterial pressure (MABP) that reaches 35mm Hg; Fig. 4).In following examples, use the dosage (but never limiting the use of method as herein described to other dosage) of 20mg/kg/ days.After losartan treatment 2 weeks, the dosage of 20mg/kg/ days makes MABP reduce 10mm Hg (Fig. 4), therefore the MABP of SCID mice is maintained to normal range with interior (70-95mm Hg) (Kristjansen PE etc., (1993) Cancer Res53:4764-4766).And this dosage does not produce the impact (average out to 26 ± 1g after treatment that can detect to the weight of mice; Contrast average out to 26 ± 1g).The dosage of 20mg/kg/ days makes respectively the immunostaining of the collagen protein I in four kinds of tumor types (FVB MMTV PyVT, L3.6pl, HSTS26T and Mu89) reduce by 47% (p < 0.05), 50% (p < 0.03), 44% (p < 0.04) and 20% (p < 0.02) (Fig. 5 A-Fig. 5 D).

embodiment 3: the expression of TSP-1 in Losartan in Reducing tumor

TSP-1 is the crucial regulator of TGF-β 1 activation, and has reported that losartan can reduce TSP-1 expression and TGF-β 1 activation (Dietz HC (2010) J Clin Invest120:403-407) in the mouse model of Marfan Cotard and muscular dystrophy.As shown here, the measurement of the protein level in the HSTS26T tumor of homogenization (homogenized) is shown to losartan does not affect total TGF-β 1 level, but significantly reduced the level (Fig. 6) of TSP-1, activation TGF-β 1 and collagen protein I.Losartan has also reduced the TSP-1 immunostaining (Fig. 7 A-Fig. 7 B) in HSTS26T (73%, p < 0.04) and Mu89 (24%, p < 0.03).In Mu89 and HSTS26T tumor, in the two, the immunostaining pattern (Fig. 5 C-Fig. 5 D) of the immunostaining pattern of TSP-1 (Fig. 7 A-Fig. 7 B) and collagen protein I is all identical.Inventor detects high-caliber TSP-1 and collagen protein I at tumor boundaries place, and losartan has been induced the obvious reduction (Fig. 5 C, Fig. 7 A) of TSP-1 and collagen protein I level at tumor center place.The reduction of the former protein I level of these tables of data gelatin can part be caused by TGF-β 1 activity decreased, and described TGF-β 1 activity decreased to be the TSP-1 that induced by losartan express reduce due to.

embodiment 4: losartan improves interior distribution of tumor of nano-particle and nanometer therapeutic agent

Formerly research (Pluen A etc. based on to mesenchyma stroma of tumors substrate, (2001) Proc Natl Acad Sci USA98:4628-4633 and Brown E etc., (2003) Nat Med9:796-800), inventor manages subsequently collagen content to being caused by losartan and reduces in the tumor that whether can improve nano-particle and distribute and measure.Therefore, inventor has measured after intratumor injection or intravenous injection, in the tumor of fluorescence polystyrene nanoparticles (diameter 100nm) in three kinds of different tumor types (HSTS26T, Mu89 and L3.6p1), distributes.In the mice of intratumor injection nano-particle, losartan has improved the accumulation of tumor center's place's nano-particle and has penetrated (Fig. 8 A; HSTS26T p < 0.001, Mu89p < 0.001).On the contrary, in control tumor center, be seldom with or without nano-particle accumulation.The nano-particle great majority of injecting in control tumor see near tumor boundaries and pin insertion point (Fig. 8 A).Inventor has also measured losartan to the impact distributing in the tumor of oncolytic HSV.In HSTS26T and Mu89, the be significantly increased tumor internal diffusion (Fig. 8 B) of HSV of intratumor injection of losartan.These discoveries demonstrate the distribution that losartan has improved large nano-particle, simultaneously inventor also in HSTS26T, determine losartan improved the interstitial diffusion (Fig. 9) of IgG and on average the pore radius of interstitial substrate (by 9.91 ± 0.43nm to 11.78 ± 0.41nm, based on IgG diffusion data, calculate) (Nugent LJ etc., (1984) Cancer Res44:238-244).

Then, inventor has assessed losartan and in the tumor of the intravenous injection nano-particle in the rat of original position pancreas tumor (L3.6p1), has distributed and the impact of vascular perfusion on suffering from.In the tumor of losartan treatment, away from accumulation in the tumor of the microsphere (beads) of blood vessel with penetrate significantly higher (Fig. 8 C and Figure 10).These results show that losartan has improved transportation and the distribution of the nano-particle of intratumor injection and/or intravenous injection.

embodiment 5: losartan improves effect with oncolytic HSV

Can inventor improve the oncolytic HSV of intratumor injection and intravenous injection to losartan subsequently

effect measure.The effect of in HSTS26T and Mu89 tumor, losartan being combined with the intratumor injection of HSV is measured.Independent losartan administration does not affect tumor growth rate (Figure 11 A and Figure 11 B).Yet, when in the situation that before the intratumor injection of HSV with losartan treatment animal two weeks, losartan has significantly delayed the growth (Figure 11 A and Figure 11 B) of Mu89 and HSTS26T tumor.In 50% the mice with losartan and HSV treatment, the volume of HSTS26T tumor keeps stable and reaches 9 weeks.For Mu89 tumor, with the mice of losartan and HSV treatment, aspect tumor growth, producing and delaying.Yet the delayed growth in Mu89 tumor is of short duration existence only, after virus injection 4 weeks, the size of all tumors during all than begin treatment exceeded 3 times.

In order to measure losartan, can improve the effect of the nanometer therapeutic agent of intravenous injection, use

with losartan to there being the mice of original position pancreas tumor (L3.6p1) to treat.After tumour transplatation surrounding and losartan treatment (20mg/kg/ days) start after two weeks, inventor for example, with sub-antitumor dosage (that is,, for the invalid dosage for the treatment of of cancer,, can not effectively suppress or stop the dosage of tumor growth and/or development)

(4mg/kg, intravenous) treats mice.After 7 days, independent losartan or independent DOXIL do not affect average tumor weight (Figure 11 C).Yet, with losartan and

in the mice that both treat, it is independent that tumor is significantly less than acceptance the tumor (Figure 11 C and Figure 11 D) of mice.

embodiment 6: collagen protein distribution pattern regulates the effect of losartan

In order to study HSTS26T and Mu89 to the difference between the response of losartan-HSV therapeutic alliance, inventor to intratumor injection HSV after the HSV of 21 days infect and downright bad pattern is measured.Figure 12 A and 12B show that between Mu89 (Figure 12 A) and HSTS26T (Figure 12 B) tumor collagen structure separately, there were significant differences.Do not wish bound by theory, these differences of collagen structure have changed the virus disseminating in these tumor types.In Mu89 tumor, collagen fabric network high-sequential also forms finger-shaped outstanding (Figure 12 A and Figure 13 A) in tumor.These are given prominence to tumor are divided into different compartments, and described compartment can not pass by HSV granule, so the necrosis of viral infection and generation is confined to (Figure 14 A) in infected compartment.It is outstanding that losartan treatment has been destroyed described collagen protein to a certain extent, but do not eliminated (Figure 12 A) completely.As a result, in the Mu89 of losartan treatment tumor, exist some virions to pass through between compartment.By changing losartan and/or HSV concentration, can treat outstanding quantity or the degree (for example, partially or completely destroying) of collagen protein of destruction and adjust, so then the distribution in tumor exerts an influence to HSV granule.By contrast, in HSTS26T tumor, intensive collagen protein network disperses more, lower fibrosis and compartmentation (Figure 12 B and Figure 13 B) still less.Described intensive collagen protein network seems the virus disseminating that slowed down, but is not stoped completely, has caused the virus disseminating increasing in this tumor and the downright bad pattern (Figure 14 A) of more disperseing.

Discuss

Report renin-angiotensin-aldosterone system (RAAS) in the adjusting of extracellular matrix components and in producing, worked (Cook KL etc., (2010) Cancer Res70:8319-8328; Rodr í guez-Vita J etc., (2005) Circulation111:2509-2517; And Wolf G (2006) Kidney Int70:1914-1919).Reported that Angiotensin II passes through TGF-β 1 dependent pathway and dependent/non-dependent pathway stimulation collagen protein produces (Yang F etc., (2009) Hypertension54:877-884).Reported that losartan and other RAAS inhibitor can reduce level (the Toblli JE etc. of collagen protein I and collagen protein III and basement membrane collagen protein I V in multiple fibrosis experimental model, (2002) J Urol168:1550-1555 and Boffa JJ etc., (2003) JAm Soc Nephrol14:1132-1144), and in hyperpietic, reverse kidney and cardiac fibrosis (Lim DS etc., (2001) Circulation103:789-791 and Khalil A etc., (2000) J Urol164:186-191).Inventor utilizes four kinds of dissimilar tumors to prove that first losartan can also suppress the generation of collagen protein I in tumor in this article.

Reported that other substrate improver can improve the collagen protein network in tumor or proteoglycan network as antibacterial Collagenase, relaxin and matrix metallopeptidase 1 and Matrix metalloproteinase 8, and effect (Brown E etc., (2003) the Nat Med9:796-800 of the oncolytic virus of (i.t.) injection in tumor have been improved; McKee TD etc., (2006) Cancer Res66:2509-2513; Mok W etc., (2007) Cancer Res67:10664-10668; Ganesh S etc., (2007) Cancer Res67:4399-4407; And Kim J-H etc., (2006) J Natl Cancer Inst98:1482-1493).For example, for example, yet these reagent can produce normal structure toxicity (, antibacterial Collagenase) or make the risk of tumor development increase (, relaxin, matrix metalloproteinase).On the contrary, losartan (Johnston CI (1995) Lancet346:1403-1407) has limited side effect.It is reported, losartan has reduced the incidence rate (Arafat HA etc., (2007) JAm Coll Surg204:996-1005) shifting in some tumor type.

As shown in above-described embodiment, AHCM agent (for example, losartan) can reduce collagen content, and then improves distribution in the interstitial transportation of nano-particle and nanometer therapeutic agent and tumor.Inventor also finds, the general layout (organization) of the fine micronetwork of collagen can exert an influence to the distribution of nano-particle.This discovery is noticeable due to the significant difference of fibrous collagen protein I structural pattern between Mu89 and HSTS26T.In Mu89 tumor, thicker fibrous collagen protein I bundle is around tumor boundaries, and it is outstanding to form finger-shaped, describedly outstanding tumor mass is divided into independently to compartment and viral infection is limited to (Figure 12 A and Figure 13 A) in injection site/independent compartment.On the contrary, HSTS26T tumor has latticed collagen structure, and this structure has hindered virus disseminating but virion has not been confined to injection site place (Figure 12 B and Figure 13 B).Compare with Mu89 tumor, the slower growth rate of HSTS26T tumor also can partly illustrate that losartan combines the effect that has enhancing in HSTS26T tumor with HSV.Therefore, not only collagen content, also have collagen protein network situation all in restriction tumor large therapeutic agent penetrate important role.According to content and/or the general layout of collagen protein network in specific tumors, can be correspondingly for example, to AHCM agent (, losartan) and/or cancer therapeutic agent, (for example, dosage, medication and/or administration frequency HSV) adjusted.

The Pancreas cancer patients for the treatment of with cytotoxic agent has very high recurrence frequency, and 5 years survival rates are lower than 5% (Li J etc., (2010) AAPS J12:223-232).The vascularity that pancreas tumor is not good and higher fibrosis content probably restrictive cell toxin send and effect aspect play an important role (Olive KP etc., (2009) Science324:1457-1461).Inventor proved in the mice model in situ (L3.6p1) of human pancreas cancer, and losartan has improved and in the tumor of nano-particle of intravenous injection, disperses and blood vessel penetration range outward.The distribution of nano-particle reinforcement and exosmose (extravasation) show that losartan can not only improve interstitial transportation (with shown in nano-particle and viral intratumor injection the same), and can also improve the transportation across blood vessel.When independent use, losartan is on not impact of the body weight of the growth of pancreas tumor or the mice treated.Yet, with independent use treatment compare, with

the losartan of associating makes tumor size reduce by 50%.These discoveries show that losartan has improved tumor and penetrated and distribute, and strengthened in mice original position cancer of pancreas medium-sized vein injection

effect.

The effect of losartan is not limited to interstitial space.To the improvement of RAAS system, also can suppress angiogenesis (Fujita M etc., Carcinogenesis26:271-279) or change tumor blood flow (Jain R etc. (2005), (1984) IEEE Trans Son Ultrason31:504-526 and Zlotecki RA etc., (1993) Cancer Res53:2466-2468).The losartan blocking-up of AGTRl also can reduce the expression of VEGFRl in the VEGF that generated by cancerous cell and endotheliocyte, thereby tumor-blood-vessel growth and growth (Otake AH etc. have been suppressed, (2010) Cancer Chemother Pharmacol66:79-87 and Noguchi R etc., (2009) Oncol Rep22:355-360).As shown here, in HSTS26T tumor, losartan does not affect tumor growth or vessel density.Losartan can also reduce the propagation (Rhodes DR etc., (2009) Proc Natl Acad Sci USA106:10284-10289) of the tumor cell of expressing AGTR1.Inventor does not find that in Humanmachine tumour Mu89 cancer cell multiplication reduces the reduction of (Figure 15) or tumor size, and described Humanmachine tumour Mu89 expresses AGTR1 (Figure 16).These researchs may be because dosage is different from the difference between other is formerly studied.15 times (Otake AH etc., (2010) Cancer Chemother Pharmacol66:79-87) of the dosage for example, using in the research of the dosage of losartan up to inventor in formerly research.Inventor proved in this article, while using separately, for treatment of cancer, do not have effect (even in sub-treatment level) that the low dosage losartan of effect can be used for improving treatment of cancer or anticarcinogen to treat cancer.In addition, the losartan of low dosage makes more scheme that can clinical conversion become possibility, and has avoided hypotension complication.

The patient who accepts RAAS antagonist has breast carcinoma and the lung cancer morbidity rate (Lever AF etc., (1998) Lancet352:179-184) of reduction.Reported that different mechanism discusses RAAS antagonist antitumor properties (Ager EI etc., (2008) Carcinogenesis29:1675-1684 when using with high concentration; Lindberg H etc., (2004) Acta Oncol43:142-152; Miyajima A etc., (2002) Cancer Res62:4176-4179; And Rosenthal T etc., (2009) J Hum Hypertens23:623-635).Reported that AGTR1 signal can improve the propagation of stromal cell and tumor cell, and improve transcribe (Deshayes F, Nahmias C (2005) the Endocrinol Metab16:293-299) of inflammatory cytokine and chemotactic factor (promote cancerous cell migration and disseminate).Reported that the decline that gives activation TGF-β 1 level that RAAS antagonist causes by high concentration can reduce transfer (Jakowlew SB (2006) Cancer Metastasis Rev25:435-457).Therefore,, except improving the sending of antitumor agent, losartan can also suppress tumor development and transfer.Only as an example, with low dosage (for example, while giving separately to reducing or invalid dosage is shifted in prevention) losartan that gives and metastasis agent (for example, with the dosage conventionally giving when being used for the treatment of separately and/or preventing transfer, giving) combine and can be used for suppressing tumor development and transfer.

For losartan being used as to accessory drugs in cancer patient's treatment, importantly consider medication and treatment schedule and potential side effect.The result being drawn by dosage and time-dependent Journal of Sex Research shown in this article shows, before anticancer treatment, at least two weeks gives losartan.In order to obtain maximum efficiency in patient, it may be wise at the last fortnight of whole antineoplaston schedule, starting losartan treatment and continue described losartan treatment during this treatment schedule.Owing to confirming that long-term losartan treatment has limited and manageable side effect for hyperpietic, and (for example many antitumor agents have been confirmed, anti-VEGF medicine) can make hypertension (Ager EI etc., (2008) Carcinogenesis29:1675-1684), the losartan of prolongation treat altogether (co-therapy) may be useful to cancer patient.In some embodiments, losartan dosage that can 2mg/kg/ days (being generally used for the patient that treatment suffers from Marfan Cotard) is treated (Brooke BS etc., (2008) N Engl J Med358:2787-2795) to patient.

Although losartan and ARB have limited side effect, for the patient who suffers from known nephropathy, do not recommend losartan treatment.Losartan can bring out renal insufficiency (Sica DA etc., (2005) Clin Pharmacokinet44:797-814) in the patient who suffers from kidney microvascular disease or trunk disease or congestive heart failure.The poor patient of renal function accept potassium supplement simultaneously or the patient of Potassium-sparing diuretic (potassium sparing diuretic) in also may there is hyperkalemia.Finally, in the patient with losartan treatment, can there is the angioedema (angioedema) (Sica DA etc., (2005) Clin Pharmacokinet44:797-814) being caused by high-caliber systemic vascular Angiotensin Converting Enzyme II.

It has been generally acknowledged that drug resistance of tumor occurs in many aspects, comprise drug efflux increase, drug inactivation, by apoptosis, evaded and target path change (Longley DB etc., (2005) J Pathol205:275-292).Because losartan is not antitumor agent, therefore after extended treatment, tumor can come from other mechanism to the drug resistance of losartan treatment.Consider except TSP-1, the activation of TGF-β 1 is also brought out by different reagent (as MMP and integrin), so tumor can be caused by the activation of TGF-β 1 and the variation of signal transduction the drug resistance of losartan.Yet the long-term losartan treatment and the fibrosis characteristic that have been reported in after myocardial infarction reduce and onrelevant (Schieffer B etc., (1994) Circulation89:2273-2282).

As shown in embodiment 1-6, inventor the has proved Losartan in Reducing substrates collagen content in tumor, and improved by tumor and the nano-particle sent of intravenous (

penetrating and curative effect HSV).Losartan also shows blood vessel activation characteristic and metastasis characteristic, and this can increase its clinical practice.In addition,, because losartan has obtained the clinical usage license, it has represented for improve the safe and efficient accessory drugs of the effect of nanometer therapeutic agent cancer patient.

The exemplary experiment scheme of embodiment 1-6

Exemplary materials and methods

In following other materials and methods part, technology has been carried out to more detailed description.

Briefly, before collagen protein and cytokine levels are measured, will be from human breast carcinoma biopsy losartan treatment 24 hours for isolated CAF.With the ELISA test kit being purchased, carry out protein determination.All zooperies are all carried out under the allowance of laboratory animal care and use committee (the Institutional Animal Care and Use Committee).With the concentration intraperitoneal of 10mg/kg/ days, 20mg/kg/ days or 60mg/kg/ days, give losartan and reach 2 weeks.After the losartan treatment of two weeks, with HSV (tumor in administration) and (through tail vein, carrying out intravenous administration) treated mice.For biochemical analysis or in paraformaldehyde, fix and be embedded in paraffin or optimal cutting temperature compound (optimum cutting temperature compound, OCT) for immunohistochemistry the tumor cutting is rapidly freezing.

Other materials and methods:

Cell culture

Use scheme (for example, at Orimo A etc., the scheme of describing in (2005) Cell121:335-348) separation from human breast carcinoma biopsy of this area approval to obtain CAF.CAF is laid in 24 orifice plates with the concentration of 500K cells/well.Before with 10 μ mol/l interpolation losartan 24 hours, give cell 24 hours so that it is attached to described plate (Sch ü ttert JB etc., (2003) Pflugers Arch446:387-393).Treatment completes under low serum, to reduce background collagen protein level.Collection condition culture medium when treatment time finished in 24 hour, and collagen protein level is analyzed.

Protein determination

With I type C-terminal collagen protein propetide enzyme-linked immunosorbent assay (ELISA) test kit (Quidel, San Diego, CA) and Sircol soluble collagen albuminometry (Biocolor Ltd., Britain), carry out the measurement of collagen protein I.End user TGF-β 1ELISA test kit (R & D Systems, Minneapolis, MN) carries out TGF-β 1 algoscopy.Described algoscopy is only measured the mature T GF-β 1 of free form.In order to measure the aggregate level of TGF-β 1, with 1N HCl activation resting form (latent form) TGF-β 1.Employment TSP-1ELISA test kit (R & D Systems, Minneapolis, MN) carries out TSP-1 algoscopy.

Mice and tumor model

All experiments all complete under the approval of laboratory animal care and use committee.People's soft tissue sarcoma (HSTS26T) and Humanmachine tumour (Mu89) tumor are carried out subcutaneous growth (Leunig M etc., (1992) CancerRes52:6553-6560) in the shank of Reconstruction in Sever Combined Immunodeciency (SCID) mice and skin of back fold chamber.Human pancreas's adenocarcinoma cell (L3.6PL) carries out growth in situ in the pancreas of SCID mice.At pancreas afterbody, with (sub-capsular) under peplos, inject 1,000,000 cells and induce L3.6PL tumor.In spontaneous type FVB/N-Tg (MMTV-PyVT) 634MUl/J mice, monitor tumor size, and when tumor size reaches the diameter of 4mm-6mm, the selected tumor (Guy CT etc., (1992) Mol Cell Biol12:954-961) being used for the treatment of.

Losartan preparation and treatment

Use mortar and pestle to grind Cozaar (Losartan Potassium) tablet.Then described powder is soluble in water, the concentration of acquisition 2.5mg/ml.Then filtering solution being stored in sterile chamber.By every day peritoneal injection to give concentration be that the losartan of 10mg/kg/ days, 20mg/kg/ days or 60mg/kg/ days reaches 2 weeks (Melo LG etc., (1999) Am JPhysiol277:R624-R630).

Tissue collecting, embedding and dyeing

From mice, results are for immunostaining analysis and quantitative tumor, and described tumor is fixing in 4% paraformaldehyde, and is embedded in paraffin or optimal cutting temperature compound (OCT) (Sakura Finetek Torrance, CA).Embedding and freezing before, the OCT that is embedded with tumor is soaked in sucrose solution to 24 hours.

Collagen protein I in frozen section and the immunostaining of TSP-1

Frozen section is cut into 10 μ m sections, for immunohistochemistry and imaging.According to previously disclosed scheme (Znati CA etc., (2003) Clin Cancer Res9:5508-5513), use LF-67 antibody (dilution in 1: 100) to detect collagen protein I.With the mountain goat anti-human antibody with mice cross reaction (dilution in 1: 50) (sc-12312, Santa Cruz Biotechnology Inc., Santa Cruz, CA), detect TSP-1.For collagen protein and TSP-1, analyze, from each microscope slide, take 20 times of enlarged images at random.By measuring, higher than the pixel quantity of threshold value, determine collagen protein and TSP-1 content, described threshold value is that the pixel intensity value based on whole microscope slides in analyzing is set.The immunostaining background signal intensity of collagen protein I and Thrombospondin 1 is lower and homogeneous (uniform) all.Inventor confirmed, average signal strength threshold value causes producing the accurate expressivity to collagen protein and Thrombospondin 1 immunostaining, and does not comprise background signal.

The Second Harmonic Imaging of collagen fabric

With customization Multi-photon Laser Scanning Microscopy, in the chamber tumor of back, carry out Second Harmonic Imaging (SHG) (Brown E etc., (2003) Nat Med9:796-800).Use zero level quarter-wave plate (zero order quarter wave plate) (Newport Corporation, Irvine, CA) will be by Ti: sapphire laser (Mai-Tai Broadband:Spectra-Physics, Mountain View, CA) and the polarized light coming is converted into circularly polarized light.Use the excitation wavelength of 810nm and the SHG signal that the inspection of 405nm place is arrived.In dose response experimental session (15 days), with losartan (10mg/kg/ days, 20mg/kg/ days or 60mg/kg/ days) or saline, to carrying the SCID mice of HSTS26T tumor in the chamber of back, treat.In every mice, by vascular markers, the region of interested 4 is positioned and is regularly returned the SHG imaging of same area.With Matlab (The Math Works, Inc., Natick, the MA) code of customization, SHG image is analyzed.The mark of the area-of-interest that SHG signal is positive (ROI) is normalized with respect to the resulting SHG semaphore of dose response research the 1st day (losartan or brine treatment start before).

To the analysis that HSV infects and nano-particle distributes

Intratumor injection: flow velocity perfusion nano-particle and oncolytic HSV with syringe pump (Harvard Apparatus Standard Pump22, Holliston, Massachusetts) with 4 μ l/min.Inventor has injected the HSV (2.5 * 10 of the expressing green fluorescent protein (GFP) of 10ul ⁵t.u.), the fluorescent nano particle of or 10 μ l (diameter 100 μ m; Concentration 1 * 10 ¹³nano-particle/ml).After nanosphere injection, 30min, HSV pour into the tumor that excision in latter 24 hours is injected.With the angle perpendicular to needle track, the tumor cutting is cut in half, fixing and freezing in OCT in paraformaldehyde.To obtain whole tumor biopsies perpendicular to the angle of needle track.With Laser Scanning Confocal Microscope (Olympus BX61WI) 2 * under whole tumor biopsy is carried out to imaging, and be mosaic (mosaic) by image reorganization.Nanosphere distribution and GFP positive region (HSV infection cell) are corresponding to the pixel fraction brighter than background signal.

Intravenous injection: be 3.6 * 10 by tail vein injection cumulative volume 10 μ l, concentration ¹³the nano-particle of nano-particle/ml.After 24 hours, injecting the FITC-coagulation of 50 μ l usually identifies functional blood vessel.At agglutinin, inject latter 5 minutes tumor resections, in paraformaldehyde, fix and be embedded in OCT.Then at co-focusing imaging with before analyzing, tumor is cut into slices.By measuring the pixel fraction brighter than background signal, the distributed degrees of nanosphere is measured.By drawing the circumvascular profile (contours) being poured and recording the pixel fraction in each profile, nanosphere being positive, penetrating of nanosphere measured.The profile extension of each Perfused vessel goes out 30 μ m.The algorithm (Tong RT etc., (2004) Cancer Res64:3731-3736) that inventor's priority of use is described fits to the figure of nanosphere mark exponential function and obtains nanosphere from the relative penetration depth of each blood vessel with the distance apart from blood vessel.

By fluorescence after photobleaching, recover the propagation measurement carrying out

The mice of implanting HSTS26T tumor in skin of back gauffer chamber is treated by intravenous injection losartan (40mg/kg/ days) for one week.According to the scheme (Chauhan VP etc., (2009) Biophys J97:330-336) of describing before, after utilization customization multiphoton microscope carries out photobleaching, fluorescence recovers (FRAP) measurement.By the Fluorescein isothiocyanate (0.5ml of IgG labelling; 2mg/ml) in tumor, inject as tracer.About 10min after injection, analyzes FRAP (SFA-FRAP) by multi-photon FRAP (MP-FRAP) and spatial Fourier diffusion is measured, and uses equation

$\frac{\mathrm{<figure-callout\; id="0"\; label="D\; D"\; filenames="HDA00003530998300011.png,HDA00003530998300022.png"\; state="\{\{state\}\}">D</figure-callout>}}{D_{}}=\frac{1-2.105\mathrm{\&lambda;}+{2.0865\mathrm{\&lambda;}}^3-{1.7068\mathrm{\&lambda;}}^5+{0.72603\mathrm{\&lambda;}}^6}{1-0.7585{7\mathrm{\&lambda;}}^5},$ Utilize SFA-FRAP data to calculate substrate pore size, wherein, D is the diffusion coefficient of probe molecule in tumor; D ₀for its diffusion coefficient in water; And the λ hydrodynamic radius that is probe and the ratio (Nugent LJ etc., (1984) Microvasc Res28:270-274) of pore radius.

Analysis to HSV infection, necrosis and collagen structure

In order to measure the relation between viral infection, necrosis and collagen structure, at HSV, inject after 21 days, with polyclone HSV-1 antibody (DAKO, Glostrup Denmark) or collagen protein I antibody (LF-67), continuous paraffin section is dyeed.For the collagen protein I dyeing in paraffin section, before carrying out antigen retrieval with Target Retrieval Solution (pH9) (DAKO, Carpinteria, CA), with 3% hydrogen peroxide, microscope slide is processed.Then, before using the collagen protein I primary antibodie of dilution in 1: 500, the trypsin with 0.05% is processed described microscope slide.With optical microscope to the section of collagen protein I or HSV dyeing is carried out to imaging.

Pcr analysis

Use the mini test kit of RNeasy (Qiagen, Valencia, CA) to extract RNA, then use RT ²the first chain test kit (SuperArray Biosciences Corporation, Frederick, MD) is translated into cDNA.With ND-200 spectrophotometer (Nanodrop Technologies, Wilmington, DE), the quality of cDNA and concentration are measured.For PCR reaction, the cDNA of whole samples is normalized to 1 μ g/ μ l.Use HotStarTaq Plus archaeal dna polymerase (Qiagen, Valencia, CA) to carry out this reaction.For AGTR1 primer, inventor uses: forward primer-GTCCCGCCTTCGACGCACAA (SEQ ID NO:1), reverse primer-GGGGCGGTAGGAAAGCGTGC (SEQ ID NO:2).

Ki67 dyeing, imaging and analysis

In HSV injection, after 21 days, paraffin section is carried out to Ki67 dyeing.Before detecting, primary antibodie, with Target Retrieval Solution (DAKO, Carpinteria, CA), microscope slide is carried out to microwave treatment.With 2 * amplification, whole tumor biopsy is carried out imaging and is reassembled as mosaic.In each tumor, choose at random 20 regions.By artificial counting, the Ki67 positive cell mark in each region is measured.

treatment and tumor growth delay

Original position pancreas L3.6PL tumor was implanted after two weeks, selected at random mice to carry out losartan or brine treatment.At losartan (20mg/kg/ days), treat after two weeks, via tail vein, carry out venous perfusion sub-antitumor dosage

(4mg/kg).DOXIL injected after one week, excised and measure described tumor.

Viral therapy and tumor growth delay

The Scid mice that carries subcutaneous HSTS26T and MU89 tumor is divided into matched group and losartan treatment group at random.Subsequently each group (matched group and treatment group) is divided into HSV treatment group and non-HSV treatment group.After two weeks, reach 60mm ³tumor be selected for HSV injection in tumor.With PBS or 2.5 * 10 ⁵the 10 μ l intratumor injections of the oncolytic HSV MGH2 of transduced unit (t.u.) (being gifted by E.Antonio Chiocca, Ohio State University, Columbus, OH) are treated described tumor.Given the two minor ticks oncolytic HSV of 24 hours injection.Use Harvard Apparatus Standard Pump22infusion/withdraw syringe pump system (Holliston, Massachusetts) to inject with the flow velocity of 4 μ l/min.Every 2-3 days measures tumor.With V=AB ²/ 2 evaluate gross tumor volume, and wherein, V is gross tumor volume; The minimum and maximum diameter that A and B are the tumor that records with slide calliper rule.

Statistics

In each therapeutic modality, with at least 6 mices, carry out all animals experiment.The tumor growth that carries out HSTS26T and MU89 tumor with at least 8 mices in every group delays research.The effect of the reasonability of mice quantity used based in previously research of inventor calculated (power calculations) (McKee TD etc., (2006) Cancer Res66:2509-2513 and Mok W etc., (2007) Cancer Res67:10664-10668), described research shows that inventor needs at least 8 mices to obtain statistical significance (p < 0.05) in every group.All statistical analysiss that relate to two groups are all used student t to inspect.P value is thought significant lower than 0.05.For a plurality of groups, adopt one factor analysis of variance to continue and check to measure the statistical significance between group with Tuskey ' s post-hoc.In the drawings, statistical significance marks with asterisk (" * ").

embodiment 7: angiotensin blocking-up is passed by making tumor microenvironment normalization improve medicine send

The progress of biomedical research made before clinical and clinical setting in all introduced novel molecular agent and nanometer therapeutic agent (Jones, D. (2007) Nat Rev Drug Discov6, the 174-175 of several whole body administrations; Moghimi, S.M. etc., (2005) Faseb J19,311-330).Although these novel agents act on unique target spot (more high specific or improved pharmacodynamic profiles for tumor cell are provided), yet the character due to tumor microenvironment, make their effect be subject to its restriction of sending (Jain, R.K. (1998) Nat Med4,655-657; Sanhai, W.R. etc., (2008) Nat Nanotechnol3,242-244).The mechanical force that growth is brought out is oppressed and blood vessel is withered, and limited tumor perfusion, and abnormal vascular causes heterogeneous drug extravasation.The 3rd determiner of sending (via the interstitial transportation of tissue) especially hinders nanometer medicament (Jain, R.K. & Stylianopoulos (2010) the Nat Rev Clin Oncol.139 in tumor by abnormal mesenchyma stroma of tumors intensive and distortion; Chauhan, V.P. etc., (2009) Biophysical journal97,330-336).The treatment that these barriers especially affect suffering from the patient of short desmoplastic, fibrosis tumor (has limited the amount that arrives the medicine of target cancer cell, cause the drug effect not good), described tumor comprises cancer of pancreas (Olive, K.P. etc., (2009) Science324,1457-1461), colorectal cancer (Halvorsen, T.B. & Seim, E. (1989) J Clin Pathol42,162-166), pulmonary carcinoma and breast carcinoma (Ronnov-Jessen, L. etc., (1996) Physiol Rev76,69-125).At present, only limited method overcomes the barrier of sending of these nanometer therapeutic agents and low-molecular-weight drug.Before, inventor finds that relaxin can improve the transportation via tumor stroma, but can not promote (B.Seed and the R.K.Jain. " Methods to Potentiate Cancer Therapies " of sending of low-molecular-weight reagent, patent No. US6, on April 13rd, 719,977,2004).

The reagent that one class FDA approval is provided herein, described reagent can make tumor microenvironment normalization, and low-molecular-weight and sending all of high molecular medicine are improved.Particularly, inventor proved, angiotensin blocking-up makes the interstitial substrate " normalization " (Figure 17 A) in solid tumor (comprising breast tumor and pancreas tumor).Whether inventor can change tumor microenvironment and then improve drug delivery and assess via this mechanism angiotensin receptor blocker (ARB) and the angiotensin converting enzyme inhibitor (ACE-I) of FDA approval.Inventor has also determined, thereby ARB and ACE-I improve perfusion (Figure 17 B-Figure 17 D) can to vasodepression; Can increase tumor hydraulic conductivity (hydraulic conductivity) thereby reparation vascular function (Figure 18 B); Thereby and can reduce penetrate (Figure 18 D) that interstitial density of matrix improves nanometer therapeutic agent.These reagent improve send (Figure 18 A-Figure 18 B) of molecule little as oxygen molecule (radiation and chemotherapy sensitizer) by blood vessel normalization; Also by interstitial substrate normalization, strengthen penetrate (Figure 18 C-Figure 18 D) of larger reagent simultaneously.By this reparation to whole tumor microenvironment, these reagent have strengthened low-molecular-weight chemotherapeutant and the effect of nanometer therapeutic agent in breast cancer model and cancer of pancreas model: cause tumor growth to decline and animals survived prolongation (Figure 19 A-Figure 19 E).Inventor proved, ARB and ACE-I can strengthen sending of therapeutic agent, and therefore for the anticarcinogen with all kinds, carrying out therapeutic alliance has the suitability widely, and described anticarcinogen comprises micromolecule chemotherapeutant, biological preparation and nanometer treatment.

Compare with other method, angiotensin blockers provides many advantages.Angiogenesis inhibitor treatment only makes blood vessel normalization, and is only approved for the indication of limited quantity.Meanwhile, ARB and ACE-I are had the hypotensive agent of controlled side effect by FDA approval conduct.Can make the extracellular matrix degrading enzyme of collagen matrices normalization not there is selectivity to tumor, can strengthen and invade profit and shift.ARB and ACE-I do not reinvent relevant complication to substrate conventionally in normal structure, and this makes it as hypotensive agent, have safety.As micromolecule reagent, ARB and ACE-I also can for example, send via the nano-carrier that contains chemotherapeutant (, liposome, nano-particle), to strengthen it, are positioned to tumor, thus further limiting toxicity.Anti-angiogenic agent (unique accessory drugs of sending to tumor through the enhancing medicine of FDA approval) is owing to reducing " hole " size of blood vessel wall, thereby can not improve sending of larger particles.On the contrary, angiotensin blockers provided herein can be improved the antitumor diagnosis of all kinds and sending for the treatment of.

embodiment 8: to reduce the hypotensive agent of collagen content in solid tumor, identify in-vitro screening

The ability that this embodiment provides based on resisting hypertension (AH) agent to reduce collagen protein I level in tumor is carried out the algoscopy of rank.

Because most of collagen protein I are produced by cancer associated fibroblast cell (CAF), those skilled in the art can measure the level of the collagen protein I in the CAF supernatant after AH treatment and molecule determiner [activation TGF-β 1, Thrombospondin 1 (TSP-1) and Connective Tissue Growth Factor (CTGF)] thereof.

For example, inventor has measured, and losartan has reduced the activation of TGF-β 1 and the generation of collagen protein I in mammary gland CAF in vitro.Losartan with 10 μ mol/L is processed cell 24 hours.Losartan in Reducing 90% activation TGF-β 1 level (p < 0.05), and total TGF-β 1 level is uninfluenced.The reduction of corresponding existence 27% (p < 0.05) (referring to Fig. 1) in collagen protein I level.

Exemplary experimental design:

Hypotensive agent: can test the angiotensin receptor blocker (ARB) of any FDA approval.The exemplary title of these reagent and dosage can find in (but being not limited to) following network address: http:// www.globalrph.com/druglist.htm.

Although angiotensin converting enzyme inhibitor (ACE-I) has also reduced collagen protein, however its receptor in targeted cells not, so inventor unmeasured its impact on collagen protein I.Can in the effect aspect collagen protein reduction, evaluate calcium channel blocker equally.

Cell culture

Use previously described scheme (Orimo A etc., (2005) Cell121 (3): 335-348), separation obtains cancer associated fibroblast cell (CAF) from human cancer biopsy.CAF should be laid in 24 orifice plates with the concentration of 500K cells/well, and before adding antihypertensive drug, give to make for 24 hours described cell attachment in described plate.For example,, based on disclosed scheme (Schuttert JB etc., (2003) Pflugers Arch446 (3): 387-393), all losartan research is carried out 24 hours under 10 μ mol/l.Treatment can complete under low serum, to reduce background collagen protein level.Can be when within 24 hours, the treatment phase finishes collection condition culture medium, and total TGF-β 1, activation TGF-β 1, TSP-1, CTGF and collagen protein level are analyzed.

Protein determination

At losartan research (Schuttert JB etc., (2003) Pflugers Arch446 (3): 387-393), use I type C-terminal collagen protein propetide enzyme-linked immunosorbent assay (ELISA) test kit (Quidel, San Diego, CA) and Sircol soluble collagen albuminometry (Biocolor Ltd., United Kingdom) carry out collagen protein I measurement.End user TGF-β 1ELISA test kit (RD Systems, Minneapolis MN) carries out TGF-β 1 algoscopy.Described algoscopy is only measured the mature T GF-β 1 of free form.In order to measure the aggregate level of TGF-β 1, with 1N HCl activation resting form TGF-β 1.Employment TSP-1ELISA test kit (R & D Systems, Minneapolis, MN) carries out TSP-1 algoscopy.CTGF ELISA test kit can be bought by Leinco ( www.leinco.com).

Plan explanation:

Separation or purchase are from the cancer associated fibroblast cell (CAF) of breast carcinoma, cancer of pancreas and colon cancer;

In the culture medium that contains angiotensin I and ACE, cultivate altogether CAF and cancerous cell;

AGTR1 or ACE inhibitor with for example 6 dosage are processed CAF48 hour;

Collect supernatant, and measure TGF-β 1, Connective Tissue Growth Factor (CTGF), Thrombospondin 1 and/or collagen protein I by ELISA.ELISA measure should be in triplicate more than.

Exemplary test in addition:

A) in the tumor model of limited quantity, body internal evidence entity is found outward.

B) feature that makes AH become more effective collagen-modified dose is identified, to screen new AH.

embodiment 9: in conjunction with angiotensin, block and the inhibition of alternative fiber approach is improved the drug delivery of tumor

Inventor has been found that the interstitial substrate normalization of coming by angiotensin signal blocker improves drug delivery by two kinds of mechanism at least in part: relax the intrinsic pressure of tumor, to improve vascular perfusion; And reduce by substrate and directly put on the viscoelasticity resistance of medicament transport and sterically hindered.Angiotensin signal blocker can suppress the activation of short Fibrotic TGF-β and downstream CTGF path safely, thereby produces these variations.In some embodiments, by angiotensin blockers and short fibrosis path (comprising Endothelin 1, PDGF, Wnt/ beta-catenin, IGF-1, TNF-α and IL-4) the inhibitor collocation that does not rely on TGF-β and CTGF activation, these effects be can strengthen, drug delivery and effect further improved.For example, blockade of endothelin receptors agent (ERB) and PDGF inhibitor (PDGF-I) can be combined use with angiotensin blockers.ERB treats pulmonary hypertension, and can be used as a class treatment of cancer (Nelson etc., (2003) Nature Reviews Vol.3:110-116), for example, combine with angiotensin blockers.Reported that PDGF-I has potential anti-angiogenic effect (Baluk etc. in tumor, (2005) Current Opinion in Genetics & Development15:102-111, Andrae etc., (2008) Genes & Development22:1276-1312).Reported that Endothelin blocking-up is at liver (Binder etc., (2009) Mol.Cancer Ther.8:2452-2460), lung (Park etc., (1997) Am J.Respir Crit Care Med Vol.156:600-608) and in heart by the synthetic inhibitory action of TGF-β being reduced to fibrosis, there is (Ogata etc., (2002) Clinical Science103 (Suppl.48): 284S-288S); And reported and Endothelin blocking-up in tumor model, reduced tumor development and transfer (Nelson etc., front; Binder etc., front).Meanwhile, reported that PDGF inhibitory action stops fibrosis that (Grimminger etc., (2010) Nature Reviews Vol.9:956-970 occur in idiopathic (idiopathic) pulmonary fibrosis and scleroderma; Andrae etc., (2008) Genes & Development22:1276-1312); And verified its of inventor can reduce collagen protein level (data are not shown) in tumor.Reported that ERB is well-tolerated, and at carcinoma of prostate (James etc., (2009) European Urology55:1112-1123) and in nonsmall-cell lung cancer (Chiappori etc., (2008) Clin Cancer Res14:1464-1469) there is the potential that improves overall survival rate.Therefore, (in the situation that of careful medication) combined in angiotensin blocking-up with Endothelin 1 and/or PDGF blocking-up should produce cumulative improvement to drug delivery, and has minimum additional toxicity.In some embodiments, Endothelin 1 and/or PDGF blocking-up can sub-therapeutic dose and angiotensin blocking-up associating use, and the latter can sub-resisting hypertension dosage and/or the use of sub-antitumor dosage, to improve drug delivery and/or treatment of cancer.

Equivalent (EQUIVALENTS)

Those skilled in the art are by understanding or can only by normal experiment method, confirm many equivalents of the particular implementation of invention described herein.This type of equivalent is considered as being covered by claims.

Sequence table:

GTCCCGCCTTCGACGCACAA(SEQ?ID?NO：1)

GGGGCGGTAGGAAAGCGTGC(SEQ?ID?NO：2)

Claims (69)

1. improve treatment of cancer sending or the method for effect in experimenter, described method comprises:

Based on to improving sending or the needs of effect of described treatment of cancer, to accepting the experimenter of hypotensive agent and/or collagen-modified dose (" AHCM "), identify; And (a) or (b) any one or (a) and (b) both:

(a) to described experimenter, give described AHCM; Or

(b) give described treatment of cancer,

Wherein, be enough to improve described treatment of cancer send or the dosage of effect gives described AHCM.

2. a method of in experimenter, cancer being treated or being prevented, described method comprises:

Based on to improving sending or the needs of effect for the treatment of of cancer, to accepting the experimenter of hypotensive agent and/or collagen-modified dose (" AHCM "), identify; And (a) or (b) any one or (a) and (b) both:

(a) to described experimenter, give described AHCM; Or

(b) give described treatment of cancer,

Wherein, described cancer is treated or the dosage that prevents gives described AHCM being enough to.

3. method as claimed in claim 1 or 2, described method comprises one or more in following:

A) described AHCM, described treatment of cancer or the two are greater than to 1nm, 5nm, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm, 200nm as hydrodynamic diameter, but the entity that is less than 300nm gives;

B), within start in cancer diagnosis or described AHCM medication 5 days, 10 days, 30 days, 60 days or 100 days, to described experimenter, do not give AHCM dosage;

C) described experimenter was not hypertension or has suffered from hypertension before giving described AHCM;

D) before giving described treatment of cancer, give described AHCM when at least 1 day, 2 days, 3 days or 5 days; Or before giving described treatment of cancer 1 week, 2 weeks, 3 weeks, give described AHCM when more than 4 weeks or 5 weeks;

E) before giving described treatment of cancer, give described AHCM when at least 1 day, 2 days, 3 days or 5 days; Or before giving described treatment of cancer 1 week, 2 weeks, 3 weeks, give described AHCM when more than 4 weeks or 5 weeks, and described AHCM and described treatment of cancer are given simultaneously; Or

F) described AHCM is given continuously within the time period of at least 1 hour, 5 hours, 10 hours or 24 hours; In the time period of at least 2 days, 5 days, 10 days or 14 days, give continuously; In the time period at least 2 weeks, 3 weeks, 4 weeks, 5 weeks or 6 weeks, give continuously; In the time period of at least 2 months, 3 months, 4 months, 5 months or 6 months, give continuously; Or give continuously in the time period of at least 1 year, 2 years, 3 years, 4 years or 5 years.

4. method as claimed in claim 3, wherein, described AHCM is selected from one or more in following reagent:

(i) angiotensin-ii receptor blockers (AT ₁blocker);

(ii) renin-angiotensin-aldosterone system antagonist (" RAAS antagonist ");

(iii) Angiotensin-Converting (ACE) inhibitor;

(iv) Thrombospondin 1 (TSP-1) inhibitor;

(v) transforminggrowthfactor-β1 (TGF-β 1) inhibitor; Or

(vi) Connective Tissue Growth Factor (CTGF) inhibitor.

5. method as claimed in claim 3, wherein, described AHCM is AT ₁blocker, described AT ₁blocker is selected from one or more in following reagent: losartan

candesartan

eprosartan mesilate

eXP3174, irbesartan

l158,809, Olmesartan saralasin, telmisartan valsartan

or the derivant of mentioned reagent.

6. method as claimed in claim 3, wherein, described AHCM is losartan.

7. method as claimed in claim 3, wherein, described AHCM is RAAS antagonist, described RAAS antagonist is selected from one or more in following reagent: aliskiren

remikiren (Ro42-5892), enalkiren (A-64662), SPP635, or the derivant of mentioned reagent.

8. method as claimed in claim 3, wherein, described AHCM is ACE inhibitor, described ACE inhibitor is selected from one or more in following reagent: benazepril

captopril

enalapril

fosinopril

lisinopril

moexipril

perindopril

quinapril

ramipril

trandolapril

or the derivant of mentioned reagent.

9. method as claimed in claim 3, wherein, described AHCM is TSP-1 inhibitor, described TSP-1 inhibitor is selected from one or more in following reagent: ABT-510, CVX-045, LSKL, or the derivant of mentioned reagent.

10. method as claimed in claim 3, wherein, described TGF-β 1 inhibitor is selected from one or more in following reagent: anti-TGF-beta 1 antibody or TGF-β 1 inhibitor peptides.

11. methods as claimed in claim 3, wherein, described CTGF inhibitor is selected from one or more in following reagent: DN-9693, FG-3019, or the derivant of mentioned reagent.

12. methods as claimed in claim 4, wherein, to be enough to the strengthening distribution of described treatment of cancer or the amount of effect gives described AHCM.

13. methods as claimed in claim 4, wherein, so that described treatment of cancer causes that the dosage of following one or more variations gives described AHCM in described experimenter's tumor or tumor vessel: reduce collagen protein level or generation, reduction tumor fibrosis, improve mesenchymal neoplasm transportation, improve tumor perfusion or enhancing penetrates or spreads.

14. methods as claimed in claim 3, wherein, described AHCM is losartan, and the amount with 25-100mg/ days gives by it.

15. methods as claimed in claim 3, wherein, described AHCM is losartan, and the dosage form with 12.5mg, 25mg, 50mg or 100mg provides by it.

16. methods as claimed in claim 3, wherein, described AHCM is losartan, and it is given with the sub-resisting hypertension dosage in following scope: 0.25-17.5mg/ days, 0.5-15mg/ days, 1.3-12mg/ days, 1.5-12mg/ days, 2-12mg/ days, 2-10mg/ days, 2-5mg/ days, 2-3mg/ days or 2mg/ days.

17. methods as claimed in claim 3, wherein, described AHCM is losartan, and more than 1.1 times, 1.5 times, 1.7 times, 2 times, 3 times, 4 times, 5 times or the 10 times dosage with the therapeutic dose standard higher than resisting hypertension purposes or heart failure resistance purposes give by it.

18. methods as claimed in claim 4, wherein, give described AHCM as follows: the described AHCM with sub-resisting hypertension dosage carried out for first course for the treatment of; With standard hypertension dosage or higher than the described AHCM of standard hypertension dosage, carried out for second course for the treatment of subsequently.

19. methods as claimed in claim 4, wherein, described AHCM is greater than 1nm, 5nm, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm, 200nm as hydrodynamic diameter, but the entity that is less than 300nm gives.

20. methods as claimed in claim 19, wherein, described AHCM gives as polymer nano granules or lipid nanometer granule.

21. methods as claimed in claim 4, wherein, described treatment of cancer is cancer therapeutic agent, described cancer therapeutic agent is greater than 1nm, 5nm, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm, 200nm as hydrodynamic diameter, but the entity that is less than 300nm gives.

22. methods as claimed in claim 21, wherein, described cancer therapeutic agent gives as polymer nano granules or lipid nanometer granule.

23. methods as claimed in claim 4, wherein, provide described AHCM or described cancer therapeutic agent independently of one another to have the entity of following magnitude range (take nm): hydrodynamic diameter is less than or equal to 1nm or as 0.1-1.0nm; Hydrodynamic diameter is 5-20nm or 5-15nm; Or hydrodynamic diameter is 1nm, 5nm, 10nm, 15nm, 20nm, 25nm, 30nm, 35nm, 45nm, 50nm, 75nm, 100nm, 150nm, 200nm, but be less than 300nm.

24. methods as claimed in claim 4, wherein, described experimenter has following one or more situations:

(i) do not suffer from hypertension;

(ii) when described AHCM treatment starts, hypertension is not treated; Or

(iii) there is normal arterial pressure or hypotension.

25. methods as claimed in claim 4, wherein, within start 5 days, 10 days, 30 days, 60 days or 100 days, did not give described AHCM to described experimenter in cancer diagnosis or described AHCM medication.

26. methods as claimed in claim 4, wherein, described experimenter need to or consider to carry out treatment of cancer.

27. methods as claimed in claim 4, wherein, described method comprises the steps: to determine whether described experimenter suffers from cancer; And give described AHCM and described treatment of cancer for described definite result.

28. methods as claimed in claim 4, wherein, described experimenter is in solid tumor, the ill risk of fibrosis tumor; Or suffer from solid tumor, fibrosis tumor.

29. methods as claimed in claim 28, wherein, described experimenter has preneoplastic lesion state or cancer susceptibility.

30. methods as claimed in claim 4, wherein, described cancer is selected from one or more in following cancer: cancer of pancreas, breast carcinoma, colorectal cancer, pulmonary carcinoma, skin carcinoma, ovarian cancer, carcinoma of prostate, cervical cancer, human primary gastrointestinal cancers, gastric cancer, incidence cancer, renal carcinoma or hepatocarcinoma, or above-mentioned cancer metastasis focus.

31. methods as claimed in claim 4 wherein, are combined and are given described AHCM before described treatment of cancer and/or with described treatment of cancer.

32. methods as claimed in claim 31, wherein, described treatment of cancer is selected from one or more in anticarcinogen, operation and/or radiation.

33. methods as claimed in claim 32 wherein, give described AHCM when at least 1 day, 2 days, 3 days or 5 days before described treatment of cancer; Or before described treatment of cancer 1 week, 2 weeks, 3 weeks, give described AHCM when more than 4 weeks or 5 weeks.

34. methods as claimed in claim 32 wherein, maintain described AHCM in described experimenter accepts the previously selected part-time section for the treatment of of cancer.

35. methods as claimed in claim 34, wherein, are giving to maintain described AHCM in the whole time period of described treatment of cancer.

36. methods as claimed in claim 4 wherein, give described AHCM continuously within the time period of at least 1 hour, 5 hours, 10 hours or 24 hours; In the time period of at least 2 days, 5 days, 10 days or 14 days, give continuously; In the time period at least 2 weeks, 3 weeks, 4 weeks, 5 weeks or 6 weeks, give continuously; In the time period of at least 2 months, 3 months, 4 months, 5 months or 6 months, give continuously; Or give continuously in the time period of at least 1 year, 2 years, 3 years, 4 years or 5 years.

37. methods as claimed in claim 4, wherein, described AHCM gives as slow releasing preparation.

38. methods as claimed in claim 4, wherein, are mixed with described AHCM for oral, subcutaneous or intravenous and send continuously.

39. methods as claimed in claim 4, wherein, described AHCM gives by subcutaneous pump, implant or bank agent.

40. methods as claimed in claim 4, wherein, described treatment of cancer is selected from one or more in following:

(i) cancer therapeutic agent, described cancer therapeutic agent is selected from the lipid nanometer granule of viral cancer therapeutic agent, anticancer therapeutic agent, the polymer nano granules of anticancer therapeutic agent, the antibody for cancer target, dsRNA reagent, antisense RNA reagent or chemotherapeutant;

(ii) radiation;

(iii) hands art; Or

(iv) (i)-combination in any (iii).

41. methods as claimed in claim 40, wherein, described lipid nanometer granule is selected from pegylated liposomal doxorubicin or liposome paclitaxel (for example,

).

42. methods as claimed in claim 40, wherein, described chemotherapeutant is selected from gemcitabine, cisplatin, epirubicin, 5-fluorouracil, paclitaxel, oxaliplatin or folinic acid.

43. methods as claimed in claim 40, wherein, the described antibody for cancer target is selected from anti-HER-2/neu antibody, anti-HER3 antibody, VEGF antibody or anti-egfr antibodies.

44. methods as claimed in claim 4, wherein, described treatment of cancer is tyrosine kinase inhibitor, and described tyrosine kinase inhibitor is selected from: Sutent, Erlotinib, gefitinib, Sorafenib, Conmana, Lapatinib, HKI-272, ZD6474, BIBW2992 or XL-647; Or described treatment of cancer is anti-egfr antibodies, described anti-egfr antibodies is selected from: Cetuximab, Victibix, bundle calamite monoclonal antibody, Buddhist nun's trastuzumab, how former times wood monoclonal antibody or horse trastuzumab.

45. methods as claimed in claim 40, wherein, described chemotherapeutant is cytotoxic agent or cytostatic agent.

46. methods as claimed in claim 40, wherein, described chemotherapeutant is selected from: anti-microtubule agent, topoisomerase enzyme inhibitor, taxane, antimetabolite, mitotic inhibitor, alkylating agent or intercalator.

47. methods as claimed in claim 4, wherein, described treatment of cancer is selected from one or more in following reagent: anti-angiogenic agent, blood-vessels target agent or angiorrhexis agent.

48. methods as claimed in claim 4, wherein, described AHCM or described treatment of cancer give described experimenter by whole body administration, and described whole body administration is selected from: oral administration, parenteral, subcutaneous administration, intravenous administration, rectally, intramuscular administration, intraperitoneal administration, intranasal administration, percutaneous dosing or by inhaler or intracavitary unit administration.

49. methods as claimed in claim 4, described method further comprises monitors in following variation aspect one or more described experimenter:

Tumor size;

Level or the signal of one or more in transforminggrowthfactor-β1 (TGF-β 1), Connective Tissue Growth Factor (CTGF) or Thrombospondin 1 (TSP-1);

Tumor collagen protein I level;

Fibrotic amount;

Interstitial pressure;

Blood plasma biomarker or serum biomarker, described biomarker is selected from collagen protein I, collagen protein III, collagen protein IV, TGF-β 1, CTGF or TSP-1;

The level of one or more cancer markers;

The speed that new pathological changes appearance, metabolism, anoxia develop;

The appearance of new disease related symptom;

The size of piece of tissue;

The degree of disease association pain;

Whether histologic analysis, lobule pattern and/or mitotic cell exist; Or

The vascularization of tumor invasiveness, primary tumo(u)r or transfer diffusion.

49. 1 kinds of pharmaceutical compositions that comprise nano-particle, described nano-particle comprises AHCM.

50. a pharmaceutical composition that comprises nano-particle, described nano-particle comprises AHCM and cancer therapeutic agent.

51. pharmaceutical compositions as claimed in claim 50, wherein, described cancer therapeutic agent is selected from the lipid nanometer granule of viral cancer therapeutic agent, anticarcinogen, the polymer nano granules of anticarcinogen, the antibody for cancer target, dsRNA reagent, antisense RNA reagent or chemotherapeutant.

52. pharmaceutical compositions as described in any one in claim 49-51, wherein, described nano-particle is polymer nano granules or lipid nanometer granule.

53. pharmaceutical compositions as described in any one in claim 49-51, wherein, are mixed with following dosage form by described AHCM: the dosage form that the therapeutic dosage forms standard according to described AHCM in resisting hypertension purposes or heart failure resistance purposes is mixed with.

54. pharmaceutical compositions as described in any one in claim 49-51, wherein, described AHCM is mixed with to following dosage form: the dosage form of 0.01 times, 0.02 times, 0.03 times, 0.04 times, 0.05 times, 0.06 times, 0.07 times, 0.08 times, 0.09 times, 0.1 times, 0.15 times, 0.16 times, 0.2 times, 0.3 times, 0.4 times, 0.5 times, 0.6 times, 0.7 times of the therapeutic dosage forms standard lower than described AHCM in resisting hypertension purposes or heart failure resistance purposes.

55. pharmaceutical compositions as described in any one in claim 49-51, wherein, described AHCM is mixed with to following dosage form: 1.1 times, 1.5 times, 1.7 times, 2 times, 3 times, 4 times, more than 5 times or 10 times dosage forms of the therapeutic dosage forms standard higher than described AHCM in resisting hypertension purposes or heart failure resistance purposes.

56. 1 kinds of AHCM dosage forms, wherein, described AHCM is mixed with to following dosage form: the dosage form of 0.01 times, 0.02 times, 0.03 times, 0.04 times, 0.05 times, 0.06 times, 0.07 times, 0.08 times, 0.09 times, 0.1 times, 0.15 times, 0.16 times, 0.2 times, 0.3 times, 0.4 times, 0.5 times, 0.6 times, 0.7 times of the therapeutic dosage forms standard lower than described AHCM in resisting hypertension purposes or heart failure resistance purposes.

57. 1 kinds of AHCM dosage forms, wherein, described AHCM is mixed with to following dosage form: 1.1 times, 1.5 times, 1.7 times, 2 times, 3 times, 4 times, more than 5 times or 10 times dosage forms of the therapeutic dosage forms standard higher than described AHCM in resisting hypertension purposes or heart failure resistance purposes.

58. 1 kinds make reagent to the approaching optimization or make cancer from reagent to the optimized method of sending of cancer, and described reagent is for example diagnostic agent or developer, and described method comprises:

To experimenter, give hypotensive agent and/or collagen-modified dose (" AHCM "); And

Optionally, to described experimenter, give described reagent, wherein, described method comprises one or more in following:

A) hydrodynamic diameter of described diagnostic agent or developer is greater than 1nm, 5nm or is 20-150nm;

B) described reagent is radioreagent, NMRA reagent, contrast agent; Or

C) with AHCM administration, described experimenter is treated, wherein, before giving described reagent, start described AHCM administration when at least 2 days, 3 days or 5 days; Or before giving described reagent 1 week, 2 weeks, 3 weeks, start described AHCM administration when more than 4 weeks or 5 weeks.

59. 1 kinds of method or algoscopys for hypotensive agent and/or collagen-modified dose (AHCM) are identified, described method or algoscopy comprise:

Cancerous cell or cancer relevant cell are contacted with candidate agent;

Variation described in when described candidate agent is existed or do not existed in cancerous cell detects, wherein, the variation detecting comprises one or more in following variation: the increase and decrease of increase and decrease, the increase and decrease of TGF-β 1 level, the increase and decrease of Connective Tissue Growth Factor (CTGF) level or collagen protein (for example collagen protein I) level of activation TGF-β.

60. method as claimed in claim 59 or algoscopys, wherein, described candidate agent is selected from one or more in following reagent: renin-angiotensin-aldosterone system antagonist (" RAAS antagonist "), Angiotensin-Converting (ACE) inhibitor, angiotensin-ii receptor blockers (AT ₁blocker), Thrombospondin 1 (TSP-1) inhibitor, transforminggrowthfactor-β1 (TGF-β 1) inhibitor or Connective Tissue Growth Factor (CTGF) inhibitor.

61. method or algoscopys as described in claim 59 or 60, wherein, described candidate agent reduces one or more in following: activation TGF-β, TGF-β 1 level, Connective Tissue Growth Factor (CTGF) level or collagen protein level.

62. method or algoscopys as described in claim 59 or 60, described method or algoscopy further comprise the steps: Therapeutic Method or algoscopy and reference value to compare; And the difference between treatment value and described reference value is compared.

63. method or algoscopys as described in claim 59 or 60, described method or algoscopy in vitro, in body or both are in conjunction with carrying out.

64. method or algoscopys as described in claim 59 or 60, described method or algoscopy comprise in the following way to be evaluated described candidate agent in vitro: described candidate agent is added into culture medium; And the increase and decrease of the activation TGF-β in conditioned medium, TGF-β 1 level, Connective Tissue Growth Factor (CTGF) level or collagen protein level is analyzed.

65. method or algoscopys as described in claim 59 or 60, described method or algoscopy comprise the steps: described candidate agent to give animal tumor model; And the increase and decrease of described experimenter's activation TGF-β, TGF-β 1 level, Connective Tissue Growth Factor (CTGF) level or collagen protein level is analyzed.

66. 1 kinds are used hypotensive agent and/or collagen-modified dose (AHCM) separately or combine with cancer therapeutic agent the compositions of using so that cancer is treated; Or, described hypotensive agent independent or that combine with cancer therapeutic agent and/or the collagen-modified dose of AHCM purposes in cancer is treated.

67. 1 kinds for the treatment of test kits that are used for the treatment of cancer, described test kit comprises:

Independent or combine with cancer therapeutic agent hypotensive agent and/or collagen-modified dose (AHCM); And

Description.

68. 1 kinds of diagnostic kits for cancer diagnosis, described test kit comprises:

Independent or combine with developer hypotensive agent and/or collagen-modified dose (AHCM); And

Description.

69. 1 kinds of methods for selecting accepting the experimenter of hypotensive agent and/or collagen-modified dose (" AHCM "), described method comprises:

Based on to improving sending or the needs of effect for the treatment of of cancer, to accepting the experimenter of described AHCM, select; And (a) or (b) any one or (a) and (b) both:

(a) to described experimenter, give described AHCM; Or

(b) give described treatment of cancer,

Wherein, be enough to improve described treatment of cancer send or the dosage of effect gives described AHCM.

Images