CN103383396B - Artificial dna copies regulating switch and preparation method thereof and the application detecting antibody - Google Patents
Artificial dna copies regulating switch and preparation method thereof and the application detecting antibody Download PDFInfo
- Publication number
- CN103383396B CN103383396B CN201210134412.5A CN201210134412A CN103383396B CN 103383396 B CN103383396 B CN 103383396B CN 201210134412 A CN201210134412 A CN 201210134412A CN 103383396 B CN103383396 B CN 103383396B
- Authority
- CN
- China
- Prior art keywords
- dna
- mcpg
- antigen
- methylate
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of artificial dna copy regulating switch and preparation method thereof and detecting the application in antibody, this artificial dna copies regulating switch and directly combines by specific antigen and antibody and control, and the degree of switch open directly reflects the antibody content in test system.When methylate DNA mCpG associated proteins and methylate DNA mCpG site in conjunction with time, close the synthesis of DNA; The synthesis of DNA is then started when methylate DNA mCpG associated proteins separates with methylate DNA mCpG site.This switch is controlled by the protein-bonded activity of methylate DNA mCpG completely.The protein-bonded activity of methylate DNA mCpG again can by suppressing with the combination of antibody.This regulating switch can carry out the detection of Multiple Antibodies targetedly, can be easy, quick, sensitive and be the determination source of infection of homogeneous phase in clinical detection, provides accuracy and the determination efficiency of mensuration.
Description
Technical field
The present invention relates to a kind of can the material of qualitative and quantitative detection antibody and the method for detecting antibody, particularly relate to a kind of artificial dna and copy regulating switch and preparation method thereof and infected by virus, bacterium and parasite etc. and the application of specific antibody that produces for detecting.
Background technology
Human body is after being subject to pathogeny body (as virus, bacterium and parasite etc.) infection, and pathogeny isoantigen stimulates human immune system to produce antibody.Detection for the specific antibody produced by the source of infection accurately can determine the source of infection, and can treat targetedly according to the determined source of infection, to improve the cure rate of patient.Antibody detection method the most frequently used is at present still euzymelinked immunosorbent assay (ELISA), but the numerous and diverse length consuming time of euzymelinked immunosorbent assay (ELISA) step, and it is high to the training requirement of operator, therefore a kind of easy, quick, sensitive homogeneous phase antibody detection method is badly in need of in current clinical detection, to replace existing method, improve accuracy and the determination efficiency of determining the source of infection.
Find according to research, methylate DNA associated proteins can specificly combine with methylate DNA template.And in methylate DNA associated proteins, methylate DNA mCpG associated proteins family is that a class can with the mCpG site that methylates (the i.e. methylate DNA mCpG site) specific binding in methylate DNA template and interactional protein.There is in such associated proteins the common mCpG binding domain (methyl-CpG-bindingdomain that methylates be made up of 60 ~ 80 amino acid; MBD); this MBD can raise histon deacetylase (HDAC), acetylation of histone enzyme, histone methylase and dnmt rna in methylated promoter region; cause this promoter region chromatin Structure to change and mediated gene silencing, in x chromosome inactivation, imprinted gene silence and tumour cell tumor suppressor gene silence, play critical pivotal role.
Summary of the invention
In order to overcome above-mentioned the deficiencies in the prior art, the invention provides a strain specific antibodies activity test method, this detection method can easy in clinical detection, quick, sensitive and equal corresponding antibody of molybdenum determination pathogeny isoantigen.
The present invention in order to the technical scheme solving its technical matters and adopt is:
A kind of artificial dna copies regulating switch, comprises antigen-MBD fusion, the methylate DNA template in the mCpG site that methylates containing at least one and DNA polymerase; Or comprise antigen-methylate DNA template and DNA polymerase;
Described antigen-MBD fusion merges obtained by antigen and the methylate DNA mCpG associated proteins containing MBD mutually, described antigen can carry out specific binding with detected antibody and the methylate DNA mCpG site in the protein-bonded MBD of methylate DNA mCpG and described methylate DNA template can be suppressed to be combined, and recovers the activity of DNA polymerase; Described MBD can carry out specific binding with the mCpG site that methylates in described methylate DNA template and can suppress the activity of DNA polymerase; And described two species specificity combinations only can be carried out selecting a reaction at one time;
Described antigen-methylate DNA template merges obtained by antigen and the methylate DNA template containing at least one mCpG site that methylates mutually, and described antigen can carry out specific binding with detected antibody and can suppress the activity of DNA polymerase.
Further technical scheme of the present invention is:
The described methylate DNA template containing the mCpG site that methylates is made up of the single-stranded DNA primer of a single-stranded DNA templates and a DNA polymerase, on the single-stranded DNA primer that at least one mCpG site that methylates described is positioned at described DNA polymerase and described single-stranded DNA templates.
The length of described single-stranded DNA templates is 70 ~ 100 bases, and the length of the single-stranded DNA primer of described DNA polymerase is 10 ~ 30 bases.
Described antigen is Small molecular class antigen, large point subclass antigen or polypeptide class antigen, preferably divides subclass antigen or polypeptide class antigen greatly, preferred Small molecular class antigen in described antigen-methylate DNA template in described antigen-MBD fusion.
Described artificial dna copies the preparation method of regulating switch, comprises the following steps:
(1) preparation of antigen-MBD fusion: for test antibodies, by at least one in PCR method, the complementary exchange process of DNA and DNA ligase method, the antigen corresponding with test antibodies and methylate DNA mCpG associated proteins are merged, obtains antigen-MBD fusion;
(2) containing the preparation of the methylate DNA template in the mCpG site that methylates: the binding characteristic for MBD in methylate DNA mCpG associated proteins selects single-stranded DNA templates and single-stranded DNA primer, described single-stranded DNA primer can be complementary with 3 ' terminal sequence of described single-stranded DNA templates; The duplex structure of selected single-stranded DNA templates is mixed with the duplex structure of described single-stranded DNA primer and is heated to dissociation temperature and make it all to be dissociated into strand, then be cooled to room temperature the single-stranded complementary sequence of dissociating of described primer and DNA to be matched combine, form the DNA profiling containing CpG site; Then by SssmI enzyme methylation reaction, the DNA profiling potpourri containing CpG site is methylated, obtain the methylate DNA template containing the mCpG site that methylates;
(3) preparation of antigen-methylate DNA template: for test antibodies, is combined antigen and the methylate DNA template of gained in (2) containing the mCpG site that methylates by cross-linking reaction, obtains antigen-methylate DNA template;
(4) DNA polymerase is selected.
Described artificial dna copies regulating switch can be prepared into quantitative measurement corresponding antibodies homogeneous reaction kit according to measured antibody.
Described artificial dna copies regulating switch for detecting the application of antibody, is:
(1) after the SYBR fluorescent dye of antigen-MBD, DNA polymerase damping fluid, dNTP potpourri and 0.5 times being mixed, add antibody samples wherein and keep 10 ~ 15min under room temperature, then add DNA polymerase to react, then in system, synthesis obtains new DNA; The DNA of described new synthesis can be combined with SYBR dyestuff and discharge fluorescence, is determined the amount of new synthetic DNA, thus determine the content of antibody in measured antibody sample by quantitative measurement fluorescence volume;
(2), after the SYBR fluorescent dye of antigen-methylate DNA template, DNA polymerase damping fluid, dNTP potpourri and 0.5 times being mixed, then add after antibody samples keeps 10 ~ 15min under room temperature wherein, add DNA polymerase and react; The DNA of described new synthesis can be combined with SYBR dyestuff and discharge fluorescence, is determined the amount of new synthetic DNA, thus determine the content of antibody in measured antibody sample by quantitative measurement fluorescence volume.
Described antibody samples is the one in serum, blood plasma, saliva, urine and extract.
Advantageous Effects of the present invention is: artificial dna of the present invention copies regulating switch and directly combines by specific antigen and antibody and control, and the degree of switch open directly reflects the antibody content in test system.When methylate DNA mCpG associated proteins and methylate DNA mCpG site in conjunction with time, close the synthesis of DNA; The synthesis of DNA is then started when methylate DNA mCpG associated proteins separates with methylate DNA mCpG site.This switch is controlled by the protein-bonded activity of methylate DNA mCpG completely.The protein-bonded activity of methylate DNA mCpG again can by suppressing with the combination of antibody.The method can adapt to the detection of Multiple Antibodies, can be easy, quick, sensitive and be the determination source of infection of homogeneous phase in clinical detection, provides accuracy and the determination efficiency of mensuration.
Accompanying drawing explanation
Fig. 1 is DNA polymerase containing the normal reaction principle schematic under the DNA polymerase primer effect methylated in the methylate DNA template in mCpG site;
Fig. 2 is that antigen-MBD fusion suppresses DNA polymerase reaction schematic diagram;
Fig. 3 is that specific antibody conjugated antigen-MBD fusion starts DNA polymerase reaction;
Fig. 4 is experimental result data figure in the embodiment of the present invention one, after namely specific antibody is combined with antigen-MBD fusion, recover the activity of archaeal dna polymerase that suppresses by antigen-MBD fusion;
Fig. 5 is experimental result data figure in the embodiment of the present invention two, and namely specific antibody can directly be combined with DNA-HA Antigen Fusion molecule, thus suppresses the activity of DNA polymerase;
Wherein: 101-DNA polymerase; 102-methylate DNA template; 103-antigen-MBD fusion; 104-antibody; The DNA that 105-newly synthesizes.
Embodiment
Utilizing artificial dna to copy regulating switch, to detect the Method And Principle of antibody as described below: artificial dna of the present invention copies regulating switch and directly combines by specific antigen and antibody and control, and the degree of switch open directly reflects the antibody content in test system.
Its detailed description principle is as described below:
Artificial dna described in the present invention copies regulating switch and comprises special DNA profiling, the associated proteins that can combine with this special DNA profiling and DNA polymerase.Wherein special DNA profiling is methylate DNA template; The associated proteins that wherein can combine with special DNA profiling is methylate DNA associated proteins, and this methylate DNA associated proteins can combine with methylate DNA template specifically.By being combined with methylate DNA mCpG site-specific and stoping the feature of nuclease, the manual control switch of a DNA synthesis can be set up according to methylate DNA mCpG associated proteins.When methylate DNA mCpG associated proteins and methylate DNA mCpG site in conjunction with time, close the synthesis of DNA; The synthesis of DNA is then started when methylate DNA mCpG associated proteins separates with methylate DNA mCpG site.This switch is controlled by the protein-bonded activity of methylate DNA mCpG completely.The protein-bonded activity of methylate DNA mCpG again can by suppressing with the combination of antibody.Specifically can adopt protein fusion method, the antigenic determinant molecule of sex pheromone and the protein-bonded MBD of methylate DNA mCpG are merged, obtain antigen-MBD fusion, a special DNA synthesising switch can be set up by this antigen-MBD fusion.Wherein antigen can be Small molecular, polypeptide, or large molecule.Fusion method can adopt gene fusion, chemical commissure, or non-covalent bond combines.Methylation sites can be one or more, preferably one, two or three.
Methylate DNA template as substrate is made up of the DNA primer of a single-stranded DNA templates and DNA polymerase.Methylated mCpG site (as shown in Figure 1, Figure 2 and Figure 3) is had in the DNA primer district of DNA polymerase.When the antibody is not combined with antigentic specificity, antigen-MBD fusion (as in Fig. 2 103) can combine with methylate DNA mCpG site (in Fig. 1 102) and stop that DNA polymerase is active to be synthesized to close new DNA; When there being the antibody (in Fig. 3 104) be combined with antigentic specificity to exist in reaction system, antibody just can combine with the antigen in antigen-MBD fusion, MBD in antigen-MBD fusion after binding antibody will lose the binding function with methylate DNA mCpG site, namely loses and the inhibiting effect of DNA polymerase to be opened in new DNA(Fig. 1 to 105) synthesis.Therefore, just have the synthesis of new DNA when having antibody to exist in reaction system, and new DNA synthetic quantity is directly proportional to the antibody content in reaction system, this pattern can be used for the content of the specific antibody in working sample.
That is:
Without antibody--→ there is function antigen-MBD fusion--→ in conjunction with methylate DNA mCpG site, suppress DNA polymerase--→ synthesize without new DNA;
Antibody exists--→ be combined with antigen-MBD fusion--→ recover DNA polymerase function--→ there is new DNA to synthesize.
In addition, also can by the antigenic determinant of small molecule antigens or protein macromolecule antigen directly and methylate DNA template merge and produce artificial dna and copy regulating switch.Like this, detected antibody can pass through the antigenic determinant directly engaged in methylate DNA template and then the reaction stoping DNA polymerase, or detected antibody directly can stop the combination of DNA primer and DNA profiling in conjunction with DNA primer.At this moment the antibody content in reaction system can directly show from the prevention amount of DNA synthesis, thus reaches the object detecting antibody concentration in sample.Composition can be reduced like this, system is more simplified.
Below in conjunction with specific embodiment, the present invention is described in further detail.The present embodiment illustrates detection method for the antibody detecting HA antigen and produce.But the method for the invention is not limited to the detection of the antibody of HA described in embodiment, is also applicable to the various pathogeny body such as current known viruse, bacterium and parasite and infects and the specific antibody of generation.
Embodiment one:
(1) HA antigen-MBD fusion is set up:
According to the DNA fragmentation of current known common method composite coding HA antigen, the coded sequence of described DNA fragmentation is TACCCATACGATGTTCC AGATTACGCT(SEQ ID NO.1).Because 3 ' end of this DNA fragmentation can be complementary mutually with the C-DNA order in the protein-bonded MBD of methylate DNA mCpG, described can be ATGTATGATGACCCCACCCTGCCTGAAGGCTGGACACGGAAGCTTAAGCAAAGGAA ATCTGGCCGCTCTGCTGGGAAGTATGATGTGTATTTGATCAATCCCCAGGGAAAAG CCTTTCGCTCTAAAGTGGAGTTGATTGCGTACTTCGAAAAGGTAGGCGACACATCC CTGGACCCTAATGATTTTGACTTCACGGTAACTGGGAGAGGGAGCCCCTCCCGGCG AGAGCAGAAACCA(SEQ ID NO.2 with the sequence of 3 ' complementation of above-mentioned DNA fragmentation).
By at least one in PCR method, the complementary exchange process of DNA or DNA ligase method, the DNA fragmentation of the HA antigen of synthesis gained and methylate DNA mCpG binding-protein gene are merged, then the protein-bonded gene of methylate DNA mCpG together with HA antigen dna segment composition is cloned in pBAD expression plasmid according to a conventional method, and by it at expression in escherichia coli.Express the HA antigen-MBD fusion of gained through chromatography, and carry out purifying.
(2) preparation is containing the methylate DNA template in the mCpG site that methylates:
Methylate DNA template to be prepared is made up of the primer of the single stranded DNA (its coded sequence is 3 ' TTTAGAGAGAAAGACTTTTCCCTGTGGATT GATCAAATACACATCATACTTCCCAGCAGACGCGGACAGATTTCACTTAA5 ' (SEQ ID NO.3)) of 80 bases and the single stranded DNA (its coded sequence is 3 ' TTAAGTGAAATCTGTCCGCG5 ' (SEQ ID NO.4)) of 20 bases.The primer of wherein said 20 base single stranded DNAs can hold complementation with 3 ' of the single stranded DNA of described 80 bases, thus as the primer of DNA polymerase, can start new DNA synthesis when DNA polymerase exists.The preparation method that this methylate DNA template is concrete is as follows:
Get above-mentioned two kinds of DNA mixing of 20 μ l, 100 μm of ol/L equivalent, and be heated to 95 DEG C and the double-strand of above-mentioned two kinds of DNA dissociated become strand, then being cooled to room temperature makes the complementary series pairing of described two kinds of DNA single chains combine, and now formed double-stranded DNA part contains two CpG structure sequences.To the above-mentioned 1 times of buffer solution T(Takara Inc being cooled to the SssmI enzyme adding 100 μ l in the DNA potpourri of room temperature, JAPAN) with the SssmI enzyme of 10 units, and add deionized water to 1ml be incubated 2h at 37 DEG C, then described two CpG sequences become mCpG after methylating by SssmI enzyme.Then be heated to 65 DEG C, stop 10min and SssmI enzyme is lost activity, gained is 2 μm of ol containing the amount of the methylate DNA template in the mCpG site that methylates, and is stored in subzero 20 DEG C.
(3) HA antigen-MBD fusion stops active reaction and the detection of DNA polymerase:
Get the HA antigen-MBD of 50 μ l 1nmol/L, DNA polymerase damping fluid, 0.5 × SYBR(Lifetechnologies Inc, and the dNTP potpourri of 0.1mol/L USA), with 20 μ l variable concentrations (100nmol/L, 50 nmol/L, 25 nmol/L, 12.5 nmol/L, 6.25 nmol/L, 3.125 nmol/L, 1.5 nmol/L, 0 nmol/L) antibody samples mix to obtain potpourri I; Gained potpourri I is at room temperature kept 10min, then add the methylate DNA template of preparation in (2) of the 5nmol/L of 10 μ l and mix to obtain potpourri II, gained potpourri II is at room temperature kept 10min, then add the DNA polymerase (1 unit/ml) of 10 μ l, obtain potpourri III.
Use quantitative real time PCR Instrument 7500 type (Applied Biosystems Inc, USA) carry out PCR reaction, record potpourri III change in fluorescence, adopt excitation wavelength to be 485nm, wavelength of transmitted light is 535nm.
Experimental result as shown in Figure 4.High concentration antibody can make the activity of DNA polymerase recover from the suppression of HA antigen-MBD.The fluoroscopic examination that the double-stranded DNA of new synthesis can be discharged by the combination of SYBR out.Along with the concentration of HA antibody in sample declines, the amount of new synthetic DNA also reduces thereupon.By the detection to fluorescence volume, the antibody content measured in sample can be easy to.
Said method does not need to carry out any separation and cleaning step, is the homogeneous reaction of standard.
Embodiment two
(1) if preparation as described in step (2) in embodiment one is containing the methylate DNA template in the mCpG site that methylates;
(2) the direct carboxyl with HA polypeptide and amidized DNA profiling coupling are prepared into DNA-HA Antigen Fusion molecule, and antibody molecule then can combine with the HA antigen on DNA-HA Antigen Fusion molecule, and suppress the activity of DNA polymerase, its specific implementation method is as follows:
Adopt this area common methods by the methylate DNA template amination containing the mCpG site that methylates described in (1), and by this area common methods, the carboxyl on described amination methylate DNA template and HA polypeptide is carried out coupling reaction and be prepared into DNA-HA Antigen Fusion molecule.The antibody samples adding 20 μ l in the DNA-HA Antigen Fusion molecule of 50 μ l 1nmol/L obtains potpourri IV, and wherein the content of antibody is respectively 100nmol/L, 50 nmol/L, 25 nmol/L, 12.5 nmol/L, 6.25 nmol/L, 3.125 nmol/L, 1.5 nmol/L, 0 nmol/L.Keep 10min under gained potpourri IV is positioned over room temperature, the DNA polymerase (1 unit/ml) then inwardly adding 10 μ l obtains potpourri V.
Quantitative real time PCR Instrument 7500 type (Applied Biosystems Inc, USA) is used to carry out PCR reaction, the change in fluorescence of record potpourri V.The excitation wavelength adopted is 485nm, and wavelength of transmitted light is 535nm.
Experimental result as shown in Figure 5.The amount of new DNA synthesis is inversely proportional to the amount of specific antibody in sample, and the amount of antibody increases, the amount minimizing of new DNA synthesis.High concentration antibody can suppress the activity of DNA polymerase.The double-stranded DNA of new synthesis by the fluoroscopic examination that discharges with the combination of SYBR out.Along with the decline of antibody concentration in sample, the DNA amount of new synthesis also increases thereupon.By the detection to fluorescence volume, the antibody content measured in sample can be easy to.The method does not need to carry out any separation and cleaning step yet, is the homogeneous reaction of standard.
Sequence table
Bo Taian bio tech ltd, <110> Suzhou
<120> artificial dna copies regulating switch and preparation method thereof and the application detecting antibody
<130> 2012
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 27
<212> DNA
<213> artificial sequence
<400> 1
tacccatacg atgttccaga ttacgct27
<210> 2
<211> 237
<212> DNA
<213> artificial sequence
<400> 2
atgtatgatg accccaccct gcctgaaggc tggacacgga agcttaagcaaaggaaatct 60
ggccgctctg ctgggaagta tgatgtgtat ttgatcaatc cccagggaaaagcctttcgc 120
tctaaagtgg agttgattgc gtacttcgaa aaggtaggcg acacatccctggaccctaat 180
gattttgact tcacggtaac tgggagaggg agcccctccc ggcgagagcagaaacca 237
<210> 3
<211> 80
<212> DNA
<213> artificial sequence
<400> 3
aattcacttt agacaggcgc agacgaccct tcatactaca cataaactagttaggtgtcc 60
cttttcagaa agagagattt80
<210> 4
<211> 20
<212> DNA
<213> artificial sequence
<400> 4
gcgcctgtct aaagtgaatt20
Claims (8)
1. artificial dna copies a regulating switch, it is characterized in that: comprise antigen-MBD fusion, the methylate DNA template in the mCpG site that methylates containing at least one and DNA polymerase; Described antigen-MBD fusion merges obtained by antigen and the methylate DNA mCpG associated proteins containing MBD mutually, described antigen can carry out specific binding with detected antibody and the methylate DNA mCpG site in the protein-bonded MBD of methylate DNA mCpG and described methylate DNA template can be suppressed to be combined, and recovers the activity of DNA polymerase; Described MBD can carry out specific binding with the mCpG site that methylates in described methylate DNA template and can suppress the activity of DNA polymerase; And described two species specificity combinations only can be carried out selecting a reaction at one time.
2. artificial dna according to claim 1 copies regulating switch, it is characterized in that: the described methylate DNA template containing the mCpG site that methylates is made up of the single-stranded DNA primer of a single-stranded DNA templates and a DNA polymerase, on the single-stranded DNA primer that at least one mCpG site that methylates described is positioned at described DNA polymerase and described single-stranded DNA templates.
3. artificial dna according to claim 2 copies regulating switch, it is characterized in that: the length of described single-stranded DNA templates is 70 ~ 100 bases, and the length of the single-stranded DNA primer of described DNA polymerase is 10 ~ 30 bases.
4. artificial dna according to claim 1 copies regulating switch, it is characterized in that: the antigen in described antigen-MBD fusion is large point subclass antigen or polypeptide class antigen.
5. the artificial dna according to any one of Claims 1 to 4 copies the preparation method of regulating switch, it is characterized in that: comprise the following steps:
(1) preparation of antigen-MBD fusion: for test antibodies, by at least one in PCR method, the complementary exchange process of DNA and DNA ligase method, the antigen corresponding with test antibodies and methylate DNA mCpG associated proteins are merged, obtains antigen-MBD fusion;
(2) containing the preparation of the methylate DNA template in the mCpG site that methylates: the binding characteristic for MBD in methylate DNA mCpG associated proteins selects single-stranded DNA templates and single-stranded DNA primer, described single-stranded DNA primer can be complementary with 3 ' terminal sequence of described single-stranded DNA templates; The duplex structure of selected single-stranded DNA templates is mixed with the duplex structure of described single-stranded DNA primer and is heated to dissociation temperature and make it all to be dissociated into strand, then be cooled to room temperature the single-stranded complementary sequence of dissociating of described primer and DNA to be matched combine, form the DNA profiling containing CpG site; Then by SssmI enzyme methylation reaction, the DNA profiling potpourri containing CpG site is methylated, obtain the methylate DNA template containing the mCpG site that methylates;
(3) DNA polymerase is selected.
6. artificial dna according to claim 5 copies the preparation method of regulating switch, it is characterized in that: described artificial dna copies regulating switch can be prepared into quantitative measurement corresponding antibodies homogeneous reaction kit according to measured antibody.
7. the artificial dna that preparation method according to claim 6 obtains copies regulating switch for detecting the application of antibody, it is characterized in that:
After the SYBR fluorescent dye of antigen-MBD, DNA polymerase damping fluid, dNTP potpourri and 0.5 times is mixed, add antibody samples wherein and keep 10 ~ 15min under room temperature, then add DNA polymerase to react, then in system, synthesis obtains new DNA; The DNA of described new synthesis can be combined with SYBR dyestuff and discharge fluorescence, is determined the amount of new synthetic DNA, thus determine the content of antibody in measured antibody sample by quantitative measurement fluorescence volume.
8. artificial dna according to claim 7 copies regulating switch for detecting the application of antibody, it is characterized in that: described antibody samples is the one in serum, blood plasma, saliva, urine or extract.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210134412.5A CN103383396B (en) | 2012-05-03 | 2012-05-03 | Artificial dna copies regulating switch and preparation method thereof and the application detecting antibody |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210134412.5A CN103383396B (en) | 2012-05-03 | 2012-05-03 | Artificial dna copies regulating switch and preparation method thereof and the application detecting antibody |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103383396A CN103383396A (en) | 2013-11-06 |
CN103383396B true CN103383396B (en) | 2015-08-12 |
Family
ID=49491241
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210134412.5A Active CN103383396B (en) | 2012-05-03 | 2012-05-03 | Artificial dna copies regulating switch and preparation method thereof and the application detecting antibody |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103383396B (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101726601A (en) * | 2009-12-11 | 2010-06-09 | 中国人民解放军第四军医大学 | Double antibody identification based quantitative detection method of MG7-Ag contained in serum |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20010049828A1 (en) * | 2000-04-12 | 2001-12-06 | Orosz Charles G. | Genetic system for controlling background expression of transgene products |
US6511809B2 (en) * | 2000-06-13 | 2003-01-28 | E. I. Du Pont De Nemours And Company | Method for the detection of an analyte by means of a nucleic acid reporter |
US20020072053A1 (en) * | 2000-12-08 | 2002-06-13 | Mcnally Alan J. | Immunoassay based on DNA replication using labeled primer |
US6861231B2 (en) * | 2001-08-17 | 2005-03-01 | Qiagen Gmbh | Suppression of cross-reactivity and non-specific binding by antibodies using protein A |
-
2012
- 2012-05-03 CN CN201210134412.5A patent/CN103383396B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101726601A (en) * | 2009-12-11 | 2010-06-09 | 中国人民解放军第四军医大学 | Double antibody identification based quantitative detection method of MG7-Ag contained in serum |
Also Published As
Publication number | Publication date |
---|---|
CN103383396A (en) | 2013-11-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111821433B (en) | mRNA vaccine and synthetic method and kit thereof | |
Chen et al. | Mass spectroscopic characterization of the coronavirus infectious bronchitis virus nucleoprotein and elucidation of the role of phosphorylation in RNA binding by using surface plasmon resonance | |
Tran et al. | Influenza virus repurposes the antiviral protein IFIT2 to promote translation of viral mRNAs | |
Dubois et al. | The C-terminal p6 domain of the HIV-1 Pr55Gag precursor is required for specific binding to the genomic RNA | |
JP2010508855A5 (en) | ||
HRP20110171T1 (en) | Method for predicting the response to a treatment with a her dimerization inhibitor | |
Sandoval et al. | Stable native RIP 9 complexes associate with C‐to‐U RNA editing activity, PPR s, RIP s, OZ 1, ORRM 1 and ISE 2 | |
EP3383887B1 (en) | Mutated hev polypeptides and the use thereof for assaying anti-hev antibodies | |
Keng et al. | The human severe acute respiratory syndrome coronavirus (SARS-CoV) 8b protein is distinct from its counterpart in animal SARS-CoV and down-regulates the expression of the envelope protein in infected cells | |
US8252535B2 (en) | RNA interference tags | |
CN108680744B (en) | Indirect ELISA detection kit for detecting novel duck reovirus antibody and application thereof | |
CN101556287B (en) | Novel protein molecular weight standard and preparation method thereof | |
BR102019017792A2 (en) | PROTEIN RECEPTACLE, METHOD FOR PRODUCTION OF THE RECEPTACLE, METHOD OF IDENTIFICATION OF PATHOGENS OR DISEASE DIAGNOSIS, AND, USE OF THE RECEPTACLE | |
Li et al. | The epitope study on the SARS-CoV nucleocapsid protein | |
WO2013056501A1 (en) | Compositions and methods for quantitative detection of microorganisms and cells | |
Argentinian AntiCovid Consortium anticovid. arg@ gmail. com Berguer Paula M. 2 3 Blaustein Matías 2 4 5 Bredeston Luis M. 6 7 Craig Patricio O. 8 9 D’Alessio Cecilia 2 4 5 Elias Fernanda 10 Farré Paola C. 11 Fernández Natalia B. 2 4 5 Gentili Hernán G. 4 5 Gándola Yamila B. 4 5 Gasulla Javier 4 5 12 Gudesblat Gustavo E. 2 4 5 Herrera María G. 2 4 5 Ibañez Lorena I. 2 13 Idrovo-Hidalgo Tommy 4 5 Nadra Alejandro D. 2 4 5 Noseda Diego G. 14 Paván Carlos H. 2 15 Pavan María F. 2 13 Pignataro María F. 4 5 7 Roman Ernesto A. 6 8 Ruberto Lucas AM 16 17 18 Rubinstein Natalia 2 4 5 Sanchez María V. 19 Santos Javier 2 4 5 8 Wetzler Diana E. 8 9 Zelada Alicia M. 5 20 | Covalent coupling of Spike’s receptor binding domain to a multimeric carrier produces a high immune response against SARS-CoV-2 | |
CN103383396B (en) | Artificial dna copies regulating switch and preparation method thereof and the application detecting antibody | |
CN102977194A (en) | Duck tembusu virus (DTMUV) E protein gene and application thereof | |
EA200000845A1 (en) | GENE ENCODING NEW CANCER MARKER | |
CN113293178A (en) | Method for detecting neutralizing antibody based on SARS-CoV-2 pseudovirus | |
CN108982847B (en) | Indirect ELISA (enzyme-linked immunosorbent assay) detection method for duck reovirus causing duck spleen necrosis | |
Hasenoehrl et al. | Sulfolobus solfataricus translation initiation factor 1 stimulates translation initiation complex formation | |
Ramm et al. | The Potential of Eukaryotic Cell-Free Systems as a Rapid Response to Novel Zoonotic Pathogens: Analysis of SARS-CoV-2 Viral Proteins | |
RU2010136820A (en) | NEW FER-TYPE PROTEIN CONTAINING ITS PHARMACEUTICAL COMPOSITION AND METHOD OF ITS USE | |
Bulygin et al. | Positioning of CCA-arms of the A-and the P-tRNAs towards the 28S rRNA in the human ribosome |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |