CN103382579B - A kind of method of in-vitro screening polypeptide - Google Patents
A kind of method of in-vitro screening polypeptide Download PDFInfo
- Publication number
- CN103382579B CN103382579B CN201310282255.7A CN201310282255A CN103382579B CN 103382579 B CN103382579 B CN 103382579B CN 201310282255 A CN201310282255 A CN 201310282255A CN 103382579 B CN103382579 B CN 103382579B
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- tetracycline
- dna
- screening
- mrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to chemicobiology technical field, disclose a kind of method of in-vitro screening polypeptide.For the limitation of triage techniques in existing polypeptide born of the same parents, by building a random dsDNA library and being transcribed into mRNA, being first make itself and end with the oligonucleotide chain Annealing complementary of tetracycline before template carries out vivoexpression with mRNA.When translation closes to an end, tetracycline enters rrna and catches newly-generated polypeptide chain and forms covalent structure, through reverse transcription, forms the express polypeptide random library that combines corresponding to its coded message cDNA.After screening terminates, the cDNA that design primer pair obtains carries out pcr amplification, and enters lower whorl screening, through too much repeating query ring, finally obtains target polypeptides and coded message thereof.The present invention adopts complete in-vitro screening technology, and library capacity can reach 10
13~ 10
15; Stable system, easy and simple to handle, screening efficiency is high.
Description
Technical field
The invention belongs to chemicobiology technical field, relate to the in-vitro screening of polypeptide, be specifically related to structure cDNA-polypeptide libraries and by the method set up, in-vitro screening carried out to specific objective polypeptide.
Background technology
According to Darwinian Evolution Theory, the principle that what the selection of occurring in nature biomacromolecule and evolution were followed is all " survival of the fittest, the survival of the fittest in natural selection ", but this process often needs to experience year up to ten thousand, the even longer time.How under lab to simulate the evolutionary process of biomacromolecule, produce the molecule of given activity fast, be a dream of scientists always.
The eighties in last century, the G.P.Smith of University of Missouri at Columbia establishes the display technique that can carry out peptide molecule selection and Study on Evolution in test tube first, i.e. phage display (Phage display), its principle is the surface that after a kind of capsid polypeptide amalgamation and expression by allogenic polypeptide and phage, fusion polypeptide is illustrated in phage, and the DNA of this syzygy of encoding then is arranged in the genome of phage.Genotype and phenotype organically combine by the maximum feature of display technique of bacteriophage and advantage exactly, and namely the particular phenotype (polypeptide matter) of phage surface is corresponding with the coded message (DNA) in phage.If obtain certain specific polypeptide, Random Sequence Library need only be inserted in phage genome, carry out specificity screening, then the DNA on the polypeptide filtered out is checked order, can know and express the gene order of this polypeptide, Sequence Transformedly can realize large-scale production and application in engineering bacteria by this section.But owing to all relating to cell transfecting when phage display technology is shown in and builds library and screening, library capacity is limited in 10 by the impact of transfection efficiency
9~ 10
10, reduce library screening efficiency, in addition, phage display library, once build up, is difficult to carry out effective external sudden change and restructuring again, and then limits the diversity of library Middle molecule heredity.After display technique of bacteriophage, the scientist of countries in the world successively establishes plasmid display, bacterium and yeast surface display etc. again.But they all depend on gene expression in vivo, build the restriction that the capacity in library and molecular diversity finally will be subject to the many factors such as transformation efficiency, born of the same parents' environment.So the complete external display systems that finding does not affect by the factor such as cell transfecting and expression becomes inevitable.Under this background, the L.C.Mattheakis of Afflymax institute of the U.S. and the J.W.Szostak of Harvard Medical School successively proposes ribosomal display and mRNA shows two kinds of screening methods based on external cell-free expression system, but these two kinds of methods are all take RNA as template, the RNA-polypeptide fusion formed is difficult to withstand harsh screening requirement, particularly easily be subject to the degraded of RNA enzyme, thus affect whole screening process.
The DNA display technique that we propose is a kind of Novel screen choosing method that can carry out in vitro, and except not affecting by cell transfecting efficiency, the DNA-polypeptide fusion that it is formed is also more stable.Therefore, DNA shows as a kind of emerging polypeptide triage techniques, will at new drug development, and the aspect such as protein interaction and proteomics demonstrates application space more widely.
Summary of the invention
The object of the invention is the limitation for prior art, set up a kind of method can screening specific objective polypeptide from Large Copacity cDNA-polypeptide libraries.
Technical scheme of the present invention is as follows:
By 5' position modified purine mycin, See Figure:
Carry out being connected with the DNA of one section of fixed sequence program by solid phase phosphoramidite triester method and obtain the DNA of 5'-end with tetracycline; The DNA library of chemical synthesis coding peptide library, includes the sequences such as T7 promotor, enhanser and initiator codon near 5' end regions, then with the addition of affinity purification label near 3' end; Utilize t7 rna polymerase that DNA is transcribed into mRNA in vitro, and include one section of energy and have the primer of tetracycline to form the fixed sequence program of complementary structure at the 3' end of mRNA with 5' end band; When carrying out vivoexpression, with primer and the mRNA library translation altogether in cell-free translation system of tetracycline, the tetracycline in latter stage of translation can enter rrna and catch newly-generated polypeptide chain and form covalent structure, through reverse transcription, obtain the express polypeptide random library that combines corresponding to its coded message cDNA, i.e. cDNA-polypeptide libraries, realizes genotype and phenotypic combination; When carrying out in-vitro screening, first target is fixed on the solid phase carriers such as magnetic bead, then with it, specificity selection is carried out to the cDNA-polypeptide libraries containing target polypeptides; After screening terminates, design pair of primers carries out pcr amplification to the cDNA obtained, and enters lower whorl screening, through too much repeating query ring, finally obtains target polypeptides and coded message thereof.
The structure of the DNA library in coded polypeptide storehouse involved in the present invention, first synthesize a single-stranded DNA banks with stochastic sequence by chemical process, bamboo product one and single-stranded DNA banks 3' hold the downstream primer of fixed sequence program complementation, through the pcr amplification of two circulations, obtaining can the double-stranded DNA library in coded polypeptide storehouse.
T7 promotor involved in the present invention is the integral part of gene, is the DNA sequence dna of RNA polymerase specific recognition and combination, controls to become from genetic transcription that mRNA's is initial.
Enhanser involved in the present invention is a bit of on DNA can combination with polypeptide, the region of intensifying genes Transcription.
Initiator codon involved in the present invention refers to starting point mRNA starting to translate into polypeptide, is made up of, is generally AUG 3 bases.What wherein procaryotic initiator codon AUG translation was corresponding is formylmethionine, and what Eukaryotic initiator codon AUG translation was corresponding is methionine(Met).
Primer with tetracycline involved in the present invention is one section of oligonucleotide sequence having tetracycline in 5' end band, base numerical control is between 30-60, tetracycline be then modified by chemical process after be coupled to the end of oligonucleotide, because the structure of tetracycline is similar to the amino-terminal end gene that adenosine in aminoacyl tRNA molecules is connected, ribosomal A site can be entered when expressing and form covalent structure with the polypeptide chain extended.
Cell-free translation system involved in the present invention refers to the external polypeptide translation synthesis system not having intact cell, usually utilize rrna, transfer ribonucleic acid, enzyme, amino acid, energy supply system and mineral ion etc. that cell-free extract provides required, in test tube, instruct the synthesis of polypeptide with additional mRNA; Conventional cell-free extract has rabbit reticulocyte lysate and wheat germ extract etc.; The present invention uses rabbit reticulocyte lysate, first anneals transcription templates with the primer of tetracycline during reaction, joins in rabbit reticulocyte lysate after forming complementary structure, and 30 DEG C of reaction 20min can complete the expression of polypeptide; In order to form more DNA and Polypeptide fusions, after expression terminates, reaction tubes can be placed in 40min on ice, add Repone K afterwards, magnesium chloride makes K
+, Mg
2+ionic concn reaches 500mM and 50mM respectively and places 50min in room temperature.
Genotype involved in the present invention and phenotypic combination refer to that genetic information is corresponding with the polypeptide of its coding and combine, and in the present invention, genotype and phenotypic combination are entered rrna by tetracycline in the latter stage of expressing and catch the effect that newly-generated polypeptide chain forms covalent structure to realize.
Target involved in the present invention is fixedly referred to be fixed on by chemical process on the solid phase carriers such as magnetic bead by target according to different screening objects and includes can select with the material of target generation affinity interaction expectation, refers to target to be fixed on magnetic bead to be herein used for carrying out specificity selection to the cDNA-polypeptide libraries containing target polypeptides; CDNA-polypeptide fusion with target polypeptides is separated by combining with the target specificity on solid phase carrier, then with elutriant, cDNA-polypeptide fusion is eluted from solid phase carrier performing PCR amplification of going forward side by side, thus realize the enrichment to target polypeptides encoding gene.
As used herein, following word/term has following meanings, unless otherwise indicated.
" DNA ": thymus nucleic acid.Be the biomacromolecule of a class with genetic information, being formed by connecting by 3', 5'-phosphodiester bond by 4 kinds of main deoxynucleotides (dAMP, dGMP, dCMP and dTMP), is the carrier of genetic information.
" cDNA ": complementary DNA (cDNA).Take mRNA as template, under the existence of suitable primer, obtain through ThermoScript II catalysis with the single stranded deoxyribonucleic acid of mRNA complementation.
" random dsDNA library ": refer to the double stranded DNA combination including and there is different base on each base positions and form.
" RNA ": Yeast Nucleic Acid.It is the polymer be formed by connecting by 3', 5'-phosphodiester bond by ribonucleotide.
" mRNA ": messenger RNA(mRNA).It is the class singlestranded RNA that can instruct protein synthesis carrying genetic information.
" PCR ": polymerase chain reaction.It is a kind of method of external enzyme' s catalysis specific DNA fragment, reacted by a few step such as high-temperature denatured, low-temperature annealing and thermophilic extension and form one-period, circulation is carried out, and makes target DNA be able to rapid amplification, has high specificity, highly sensitive, easy and simple to handle, the feature such as save time.
" tetracycline ": a kind of microbiotic, is widely used as the inhibitor of protein synthesis.The AMP structural similitude that its structure and aminoacyl-tRNA 3 ' are held, peptidy transeferace can impel amino acid to be combined with tetracycline and form peptide acyl tetracycline, comes off from rrna, thus makes protein synthesis react interruption.
" vivoexpression ": expression is biologically the central dogma according to genetic code, by the decoding that puts in order of base in the messenger RNA molecule of maturation, and generates the process of corresponding specific amino acid sequence.Vivoexpression then refers to the protein expression process of carrying out in cell-free system.
" primer ": the single stranded RNA of a section short or DNA fragmentation, can be combined in region complementary with it in nucleic acid chains, its function is the starting point as nucleotide polymerization effect, and nucleic acid polymerase can synthesize new nucleic acid chains by its 3' holds.
" in-vitro screening ": refer to the molecule obtaining having sp act in extracellular by screening repeatedly from the random library of nucleic acid or polypeptide.
The method disclosed in the present key is: whole screening process is all carry out in vitro, and library very high capacity, considerably increases potential target polypeptides selective; On the other hand, due to the effect of tetracycline, the cDNA-polypeptide libraries of formation can make effective polypeptide obtain enrichment by pcr amplification and enter lower whorl screening after screening, finally obtains target polypeptides by multi-turns screen.The method is easy, stable, efficient, can be applicable to find the new polypeptide ligands such as RNA, small molecules, protein and illustrate polypeptide and the interaction mechanism of medicine in cell.The present invention has the advantage being obviously better than prior art, and its major advantage comprises:
1. library capacity is large.Existing display technique of bacteriophage, owing to all relating to cell transfecting when building library and screening, library capacity is limited in 10 by the impact of transfection efficiency
9~ 10
10, reduce library screening efficiency, in addition, phage display library, once build up, is difficult to carry out effective external sudden change and restructuring again, and then limits the diversity of library Middle molecule heredity.And the institute that the present invention relates to is all carry out in cell-free system in steps, the size in library, not by the impact of transfection efficiency, can reach 10
13~ 10
15.
2. stability is high.Existing display technique of bacteriophage is by the surface of polypeptide display in phage, the situation that not folding polypeptide is degraded in bacterium is easily there is in screening process, and the polypeptide expressed by the present invention take cDNA as carrier, stability is high, can meet harsh screening conditions.
3. easy and simple to handle.Existing display technique of bacteriophage has to pass through Bacterial Transformation, phage packaging, and some display systems also will through cross-film secretion process, complex operation, and the present invention does not all relate to these operations.
4. screening efficiency is high.Because the present invention has the advantages such as library capacity is large, principle is simple, easy and simple to handle, just can complete whole polypeptide screening process in several weeks, screening efficiency improves greatly.
Accompanying drawing explanation
Fig. 1 is the schematic flow sheet of specific embodiment 1 in-vitro screening polypeptide.
Fig. 2 is the schematic flow sheet that specific embodiment 1 tetracycline is modified.
Fig. 3 is the schematic flow sheet of specific embodiment 1 tetracycline and oligonucleotide linked reaction.
Fig. 4 is the expression of results figure of specific embodiment 1.
Fig. 5 is the reverse transcription result figure of specific embodiment 1.
Embodiment
Below in conjunction with accompanying drawing, further illustrate the present invention by example.One skilled in the art will understand that these examples are only for illustration of the present invention, and be not used in and limit the scope of the invention.
Embodiment 1, in-vitro screening polypeptide
The flow process of in-vitro screening polypeptide is shown in Fig. 1.
(1) the double-stranded DNA library comprising stochastic sequence is built.By the single-stranded DNA banks of chemical process synthesis with stochastic sequence, add the pcr amplification that isocyatic downstream primer carries out two circulations, final acquisition comprises the double-stranded DNA random library of T7 promotor, enhanser, initiator codon, stochastic sequence, affinity purification label coding sequence.
Single stranded DNA stochastic sequence (SEQ ID NO 1):
TAATACGACTCACTATAGGAGGACGAAATG(NNN)
9CACCACCACCATCATCATCAGCTGCGTAACTC
Downstream primer (SEQ ID NO 2): GAG TTA CGC AGC TGA TGA
Reaction system and PCR condition:
Add ddH
2system is supplied 100 μ l by O.
PCR condition is: 95 DEG C of preheating 1min; 95 DEG C of sex change 30s, 45 DEG C of renaturation 45s, 72 DEG C extend 45s, 2 circulations.
(2) in-vitro transcription.Take double-stranded DNA as template, transcribe under polysaccharase effect and obtain mRNA, reaction system is as follows:
System is supplied 160 μ l by ultrapure water.
(3) vivoexpression of polypeptide.Be before template carries out polypeptide translation, first make itself and end with the oligonucleotide chain Annealing complementary of tetracycline with mRNA, add rabbit reticulocyte lysate and express, add Repone K after reaction terminates, magnesium chloride makes K
+, Mg
2+ionic concn reaches 500mM and 50mM respectively and places 50min in room temperature.For a small amount of expression system, whole reactions steps and system as follows:
Primer (10uM) 1.7ul with tetracycline
MRNA (about 10uM) 1.7ul
ddH
2O 7.6ul
(67 DEG C of heating 10min, room temperature places 5min)
Aminoacid mixture 1 (not containing methionine(Met)) 0.5ul
Aminoacid mixture 2 (not containing leucine) 0.5ul
Rabbit reticulocyte lysate 8.5ul
(30 DEG C of reaction 20min, place 40min on ice)
KCl (3M) 6.3ul (final concentration 500mM)
MgCl
2(0.5M) 3.8ul (final concentration 50mM)
(room temperature places 50min)
When carrying out great expression, reaction system scales up as required.
(4) reverse transcription.After expression terminates, directly in expression system, add ThermoScript II, be templated synthesis cDNA with mRNA, reaction system is as follows:
(42 DEG C of reactions 30min, 75 DEG C of deactivation 10min)
(5) in-vitro screening and PCR enrichment.Target is fixed on magnetic bead and is used for carrying out specificity selection to the cDNA-polypeptide libraries containing target polypeptides, cDNA-polypeptide fusion with target polypeptides is separated by combining with the target specificity on solid phase carrier, then with elutriant, cDNA-polypeptide fusion is eluted from solid phase carrier performing PCR amplification of going forward side by side, thus the enrichment realized target polypeptides encoding gene, PCR system is as follows:
Add ddH
2system is supplied 100 μ l by O.
Upstream primer sequence (SEQ ID NO 3): TAATACGACTCACTATAGGAGGACGAAATG
Downstream primer sequence (SEQ ID NO 4): GAG TTA CGC AGC TGA TGA
PCR condition is: 95 DEG C of preheating 1min; 95 DEG C of sex change 30s, 45 DEG C of renaturation 45s, 72 DEG C extend 45s, 25 circulations.
The chemically modified of embodiment 2, tetracycline
The final product that tetracycline obtains through chemically modified is shown in Fig. 2.Concrete operation step is as follows: 100mg tetracycline is dissolved in CH by a.
3cN (2ml), 0 DEG C of stirring, adds Et
3n (60ul), solution is clarified, and Fmoc-oSu (72mg) is dissolved in CH
3cN (1ml), 0 DEG C drops in reaction solution, continues to stir, and become white opacity liquid after 30min, the reaction times is about 0 DEG C of 2h, RT 1h, and reaction terminates rear funnel filtered and recycled white solid product P1.B. 150mg P1 is dissolved in 2ml pyridine, fully stirs evenly, add 200ul triethylamine, 0 DEG C of stirring; 400mg DMTrCl is dissolved in 2ml pyridine, then is injected in reaction solution with pin, 0 DEG C is stirred to room temperature, crosses post and reclaims product P 2.C. 420mg P2 is dissolved in 6ml pyridine, adds 10mgDMAP, ice-water bath is cooled to 0 DEG C, slowly adds 0.6ml (Ac) with pin
2o, 0 DEG C is stirred 3h, crosses post and reclaims product P 3.D. 380mgP3 is dissolved in the 5ml CH of drying process
2cl
2, ice-water bath is cooled to 0 DEG C, adds 0.2ml dichloro acetic acid, and 0 DEG C is stirred to room temperature, reaction 2h, crosses post and reclaims product P 4.E. 30mg P4 is claimed, N2 strict protection, adds 250ul pyridine, and 35 DEG C are stirred 15min and P4 is dissolved completely, be yellow solution after dissolving, 0 DEG C of stirring, adds 35ul DIPEA, stirs, finally add the sub-phosphoryl chloride of 20ul, 0 DEG C of reaction 1h, 10 DEG C-15 DEG C reaction 4h, developping agent is by methylene dichloride: ethyl acetate=1:3 crosses post through alkaline post and reclaims product P 5; The P5 obtained is connected with the DNA of particular sequence.
Embodiment 3, modified tetracycline are connected with the DNA of one section of fixed sequence program, and reactions steps is substantially identical with present widely used solid phase phosphoramidite triester method, and coupled product is obtained by high performance liquid phase separation and purification.As shown in Figure 3, the Spacer18 representative near DNA 5' end contains the polyoxyethylene glycol of 12 carbon, and rC represents the base that 5'-3' turns round in direction on oligonucleotide chain.
Embodiment 4, Fig. 4 are for template carries out the result after expression of polypeptides with different mRNA.Use isotropic substance
32p marks a length of tape the DNA with mRNA template complementary sequence, and be connected with the coupled product in embodiment 3 under the existence of clamping plate, obtain the band tetracycline primer that can be used for catching polypeptide, then carry out the expression of polypeptide after making the mRNA template annealing complementation of itself and different lengths, obtain the DNA-polypeptide fusion of different lengths.Except mRNA length is from except different in previous reaction system, reactions steps and condition are all identical.The result is analyzed as follows: swimming lane 1 is the expression carried out under the condition not having mRNA template, does not occur DNA-polypeptide fusion in swimming lane; Swimming lane 2 is the mRNA template expression of results including 7 amino-acid residue coded messages, and in swimming lane, top band is DNA-polypeptide fusion; Swimming lane 3 is with the mRNA template expression of results containing 16 amino acid coded messages.The results show reasonableness of the present invention and reliability.
Embodiment 5, Fig. 5 are that different primers carries out the result of reverse transcription by identical mRNA template.Article three, primer all uses isotropic substance
32p marks, as shown in the figure: the band of swimming lane 1 is with a short primed reverse transcription acquisition; Band above swimming lane 2 is the band produced under ThermoScript II effect by the primer of band tetracycline; In swimming lane 3, the band of top then obtains as primed reverse transcription after DNA-polypeptide fusion reclaims; Swimming lane 4 is except without except template, and all the other are identical with swimming lane 3.Experimental result further demonstrates feasibility of the present invention.
Claims (8)
1. a method for in-vitro screening polypeptide, is characterized in that: by 5' position modified purine mycin, See Figure:
Carry out being connected with the DNA of one section of fixed sequence program by solid phase phosphoramidite triester method and obtain the DNA of 5'-end with tetracycline; By building a random dsDNA library and being transcribed into mRNA, being first make itself and 5 '-end with the DNA Annealing complementary of tetracycline before template carries out In Vitro Translation with mRNA; When translation closes to an end, tetracycline enters rrna and catches newly-generated polypeptide chain and forms covalent structure, through reverse transcription, forms the express polypeptide random library that combines corresponding to its coded message cDNA; After screening terminates, pcr amplification is carried out to the cDNA obtained, and enter lower whorl screening, through too much repeating query ring, final acquisition target polypeptides and coded message thereof.
2. the method for in-vitro screening polypeptide according to claim 1, it is characterized in that: described random dsDNA library is the fixed sequence program of encoding gene that two ends comprise T7 promotor, ribosome bind site, affinity purification label, and middle open reading frame includes the double-stranded DNA library of some stochastic sequences.
3. the method for in-vitro screening polypeptide according to claim 1, is characterized in that: described mRNA transcribes acquisition by dsDNA under the effect of t7 rna polymerase, transcribes and carries out in vitro.
4. the method for in-vitro screening polypeptide according to claim 1, it is characterized in that: described tetracycline is a kind of Peptide systhesis inhibitor, structure is similar to the amino-terminal end gene that adenosine in aminoacyl tRNA molecules is connected, and can enter ribosomal A site form covalent structure with the polypeptide chain extended when expressing.
5. according to the method for the in-vitro screening polypeptide described in claim 1, it is characterized in that: described 5 '-end can be complementary with the DNA sequence dna being connected to mRNA 3' end near the sequence that the part that 3' holds contains more than one section of 15 base with the DNA of tetracycline.
6. according to the method for the in-vitro screening polypeptide described in claim 1, it is characterized in that: described In Vitro Translation refers to that mRNA template and end carry out common translation after annealing with the oligonucleotide chain of tetracycline in rabbit reticulocyte lysate, obtains the DNA-polypeptide fusion comprising target polypeptides.
7. according to the method for the in-vitro screening polypeptide described in claim 1, it is characterized in that: described reverse transcription refer to tetracycline catch polypeptide form DNA-polypeptide fusion after be template with mRNA under effect in ThermoScript II, the oligonucleotide of band tetracycline is primer synthesis cDNA.
8. according to the method for the in-vitro screening polypeptide described in claim 1, it is characterized in that: described screening refers to carries out specificity selection with the target be fixed on Myoglobin carrier to the cDNA-polypeptide libraries containing target polypeptides.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310282255.7A CN103382579B (en) | 2013-07-06 | 2013-07-06 | A kind of method of in-vitro screening polypeptide |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310282255.7A CN103382579B (en) | 2013-07-06 | 2013-07-06 | A kind of method of in-vitro screening polypeptide |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103382579A CN103382579A (en) | 2013-11-06 |
| CN103382579B true CN103382579B (en) | 2015-10-21 |
Family
ID=49490497
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310282255.7A Active CN103382579B (en) | 2013-07-06 | 2013-07-06 | A kind of method of in-vitro screening polypeptide |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103382579B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104774923B (en) * | 2015-03-11 | 2017-10-27 | 华中农业大学 | A kind of method for determining transcription control complex |
| WO2018168999A1 (en) * | 2017-03-17 | 2018-09-20 | 国立研究開発法人理化学研究所 | Method for producing complex of rna molecule and peptide, and utilization thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU775997B2 (en) * | 1998-12-02 | 2004-08-19 | Bristol-Myers Squibb Company | DNA-protein fusions and uses thereof |
| PT1870417E (en) * | 1999-07-27 | 2012-06-01 | Bristol Myers Squibb Co | Peptide acceptor ligation methods |
| US20010046680A1 (en) * | 1999-10-01 | 2001-11-29 | Zhongping Yu | Identification of polypeptides and nucleic acid molecules using linkage between DNA and polypeptide |
-
2013
- 2013-07-06 CN CN201310282255.7A patent/CN103382579B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| DNA展示技术的原理及应用;张永钢 等;《国际生物制品学杂志》;20060630;第29卷(第3期);全文 * |
| In vitro display technologies: novel developments and applications;Patrick Amstutz, etc;《Current Opinion in Biotechnology》;20011231;第12卷(第4期);第400页右栏，图1 * |
| 体外展示技术研究进展;卢明锋;《生命科学》;20100831;第22卷(第8期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103382579A (en) | 2013-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101258244B (en) | Method for carrying out the selective evolution of proteins in vitro | |
| Obi et al. | The design and synthesis of circular RNAs | |
| US20220163515A1 (en) | Pumilio domain-based modular protein architecture for rna binding | |
| CN106754904A (en) | A kind of specific molecular label of cDNA and its application | |
| AU2020423979B2 (en) | Method for large-scale synthesis of long-chain RNA and method for site-specific modification thereof | |
| CN107541510A (en) | Dendritic gene cluster nano material and preparation method and application | |
| CN115003867A (en) | Construction method of sequencing library of RNA (ribonucleic acid) of sample to be detected | |
| Autour et al. | Optimization of fluorogenic RNA-based biosensors using droplet-based microfluidic ultrahigh-throughput screening | |
| CA3114892A1 (en) | Methods and compositions for increasing capping efficiency of transcribed rna | |
| CN103382579B (en) | A kind of method of in-vitro screening polypeptide | |
| CN101935670B (en) | Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers | |
| CN107119040A (en) | A kind of method of isothermal nucleic acid amplification | |
| CN110724728B (en) | Preparation method of circular DNA | |
| CN103194441B (en) | Method for obtaining miRNA (Ribose Nucleic Acid) candidate target gene and special reverse transcription primer for method | |
| CN105986020A (en) | Method and device for constructing sequencing library | |
| CN109137086A (en) | A kind of banking process of the full length mRNA sequencing of improvement | |
| González-Delgado et al. | Simultaneous multi-site editing of individual genomes using retron arrays | |
| Moon et al. | In vitro transcription of modified RNAs | |
| CN114196714B (en) | Method for synthesizing oligonucleotide chain containing non-natural base by using terminal deoxyribonucleotide transferase without template and application thereof | |
| CN104892711B (en) | The method that scale quickly prepares single oligonucleotides is carried out based on chip | |
| Phillips et al. | Role of RNA Domain Structure and Orientation in the Coxsackievirus B3 Virulence Phenotype | |
| Binzel et al. | Enzymatic Synthesis and Modification of RNA Nanoparticles | |
| US11629366B2 (en) | Method for selective translation of desired proteins in the presence of a specified nucleic acid ligand | |
| CN105274088A (en) | Method for synthesizing nucleotide pools in high-throughput manner by aid of semiconductor chips and assembling double-stranded DNA (deoxyribonucleic acid) | |
| Dmitriev et al. | Adequate system for studying translation initiation on the human retrotransposon L1 mRNA in vitro |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |