CN103146620A - Bacteroides fragilis with characteristics of probiotics - Google Patents
Bacteroides fragilis with characteristics of probiotics Download PDFInfo
- Publication number
- CN103146620A CN103146620A CN2013100951267A CN201310095126A CN103146620A CN 103146620 A CN103146620 A CN 103146620A CN 2013100951267 A CN2013100951267 A CN 2013100951267A CN 201310095126 A CN201310095126 A CN 201310095126A CN 103146620 A CN103146620 A CN 103146620A
- Authority
- CN
- China
- Prior art keywords
- bacteroides fragilis
- probiotics
- bacterium
- probiotic
- cfu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to the technical field of microbial application, and in particular relates to bacteroides fragilis with characteristics of probiotics. The bacteroides fragilis with the characteristics of probiotics is separated and purified from excrement of well-developed infants. Experiments prove that the bacteroides fragilis is harmless to animals, belongs to probiotics, and can be used for preparing foods or medicines containing the microbe.
Description
Technical field
The present invention relates to technical field of microbe application, be specifically related to a kind of bacteroides fragilis with probiotic properties.
Background technology
A kind of bacterium useful to animal of prebiotic fungus strain, they can directly be taken as foodstuff additive, to maintain the balance of Intestinal flora.When human body is occupied enough probiotic bacteriums, the people will be in healthy state, once but flora overbalance in body, such as ratio between bacterial classification occurs significantly to change or while exceeding regime values, so diarrhoea, irritated, have no appetite, tired, immunizing power is low etc., and a series of illnesss will be following, the health of human body will send out a warning, and at this moment suitably adds probiotic bacterium, assist colony balance in body, could allow the people reappear state of health.
In probiotic bacterium, humans and animals there is the bacterial strain of fine effect after absorption by the bifidus bacillus of extensive concern and milk-acid bacteria, their specific bacterial strain can be settled down on intestinal mucosa, the built-in group of enteron aisle and prevent that harmful microorganism from adhering to thereon, by keeping the microbial preparation of growing of natural microorganisms fauna promotion biont health in intestines, to help to maintain the health of humans and animals.File CN1350460A discloses a kind of lactic bacterium strains of anti-diarrhea in advance; File CN1420781A discloses a kind of bifidus bacillus of anti-diarrhea in advance.
Bacteroides fragilis
(Bacteroides fragilis) as a kind of Gram-negative, shaft-like, blunt round and dense the dying in two ends, pod membrane is arranged, without brood cell, motorless obligate anaerobes, minute produce enterotoxin type and non-product enterotoxin type.Bacteroides fragilis, as the part of people and animal intestinal normal microflora, mainly is stored in colon, in addition, but the also field planting growth of respiratory tract, gi tract and urogenital tract mucous membrane.What research was more at present is that bacteroides fragilis is as a kind of conditioned pathogen, when host's mucous membrane is impaired, can invade submucosa, cause infection, also can flow through blood, cause that other organ of health is as enteron aisle, abdominal cavity, liver, lung, cerebral tissue pyogenic infection the abscess and cause acute and chronic diarrhea etc. of occurring together.In addition, its generation to colorectal cancer also has promoter action.
Summary of the invention
The purpose of this invention is to provide a kind of bacteroides fragilis with probiotic properties.
In order to address the above problem, the technical solution adopted in the present invention is:
Provide a kind of fragility with probiotic properties to intend, described bacteroides fragilis depositary institution name is called China Committee for Culture Collection of Microorganisms's common micro-organisms center, the depositary institution address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, preservation date is on March 12nd, 2013, deposit number is CGMCC NO.7280, and Classification And Nomenclature is
Bacteroides fragilis.
This bacterial strain 16SrRNA has the nucleotide sequence shown in SEQ ID NO:1, and sequence length is 887bp.
The invention has the beneficial effects as follows: the present invention is the bacteroides fragilis that separation and purification obtains having probiotic properties from well-developed infant faeces, experimental results show that to separate the bacteroides fragilis obtain harmless to animal, belong to probiotic bacterium, can be used for food or medicine that preparation contains this microorganism.
The accompanying drawing explanation
The schematic diagram of the colonial morphology of the embodiment 1 that Fig. 1 is the bacteroides fragilis with probiotic properties of the present invention.
Colonial morphology schematic diagram under the microscope of the embodiment 1 that Fig. 2 is the bacteroides fragilis with probiotic properties of the present invention.
The BLAST sequence alignment of the embodiment 1 that Fig. 3 is the bacteroides fragilis with probiotic properties of the present invention is figure as a result.
Embodiment
Below by embodiment, the present invention is described in further details, these embodiment only are used for illustrating the present invention, do not limit the scope of the invention.
the separation and purification of embodiment 1 bacteroides fragilis CGMCC NO .7280
(1) separate bacteroides fragilis CGMCC NO .7280 in infant faeces
Take 0.5 gram stool by " normal microflora test procedure ", be placed in the test tube that 4.5ml physiological saline first is housed, with this serial dilution, become 10
-1~ 10
-6, by the rare long-pending degree of height, to low rare long-pending degree, dripped on the Bd culture medium flat plate, be placed in the anaerobic gas generation box and add the anaerobic gas generation bag and carry out the anaerobism cultivation.Put 37 ℃, can opening inspection after 2 ~ 7 days.Menu one bacterium colony carries out pure culture, dyeing microscopic examination, cultural characters, Physiology and biochemistry detection.
Colonial morphology as shown in Figure 1.
Microscopic examination as shown in Figure 2.
(2) the 16SrRNA gene of bacteroides fragilis CGMCC NO.7280 carries out sequential detection
Gained 16SrRNA sequence is as follows:
GAGTCGCTACAGCCTTCGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGGCGCTAGCCTGAACCAGCCAAGTAGCGTGAAGGATGAAGGCTCTATGGGTCGTAAACTTCTTTTATATAAGAATAAAGTGCAGTATGTATACTGTTTTGTATGTATTATATGAATAAGGATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACTGGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGTCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAAGAACTCCGATTGCGAAGGCAGCTCACTGGACTGCAACTGACACTGATGCTCGAAAGTGTGGGTATCAAACAGGATTAGATACCCTGGTAGTCCACACAGTAAACGATGAATACTCGCTGTTTGCGATATACAGTAAGCGGCCAAGCGAAAGCATTAAGTATTCCACCTGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTAAATTGCAGTGGAATGATGTGGAAACATGTCAGTGAGCAATCACCGCTGTGAAGGTGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGCTTAAGTGCCATAACGAGCGCAACCCTTATCTTTAGTTACTAACAGTTATGCTGAGGACTCTAGAGAGCTG（SEQ?ID?NO:1）。
(4) carry out the BLAST sequence alignment
Result as shown in Figure 3.
(5) bacterium that increases of bacteroides fragilis CGMCC NO.7280 is cultivated and bacterium solution preparation
Choose single colony inoculation after purifying is increased bacterium and is cultivated in the Tryptones meat soup of improvement, the centrifugation of gained bacterium liquid, rotating speed 3000r/min, centrifugal 15min, remove supernatant, after throw out washs with physiological saline, the throw out normal saline dilution, do the bacterium number with the Maxwell opacity tube and measure, be diluted to 10
8cfu/ml, 10
9cfu/ml, 10
10cfu/ml, save backup.
embodiment 2 bacteroides fragilis virulence experiments
Adopt the bacteroides fragilis bacterium liquid of embodiment 1 preparation to carry out following experiment:
(1) chmice acute virulence experiment
Get 60 of body weight 22 ± 2 gram C57BR/C mouse (male and female half and half), be divided into high dose group, low dose group and control group, each organizes 20.Every mouse gavage every day 10 of high dose group
12cfu/ml bacterium liquid 0.5ml, low dose group gavage every day 10
9cfu/ml bacterium liquid 0.5ml, control group gavage every day 0.5ml physiological saline.Continuous Observation 14 days.
Experimental result: the mouse normal growth, have no dead, LD50 does not measure.
(2) rat virulence experiment
Get 30 of 150 ± 20 gram SD rats (male and female half and half), be divided into 3 groups: high low dose group and control group.Every rat gavage every day 10 of high dose group
12cfu/ml bacterium liquid 2ml, low dose group gavage every day 10
9cfu/ml bacterium liquid 2ml, control group gavage every day 2ml physiological saline.Continuous Observation 14 days, phlebotomize after 14 days and survey blood picture, liver kidney merit.Get stomach and intestine liver spleen tissue and do the pathological section electron microscopic observation.
Experimental result: be showed no obvious abnormalities.
(3) rhesus monkey virulence experiment
Get 10 of rhesus monkeies (male and female half and half), be divided into 2 groups: high low dose group and control group.Every of high dose group rhesus monkey every day oral 10
12cfu/ml bacterium liquid 100ml, low dose group every day oral 10
9cfu/ml bacterium liquid 100ml.Continuous Observation 60 days.Phlebotomize respectively after 14 days, 30 days, 45 days, 60 days and survey blood picture, liver kidney merit, thought-read electrograph.Get stomach and intestine liver spleen tissue and do the pathological section electron microscopic observation.
Experimental result: be showed no obvious abnormalities.
The experimental result explanation, the bacteroides fragilis CGMCC NO.7280 that the present invention's separation obtains, to animal toxicological harmless effect, belongs to probiotic bacterium.
Claims (2)
1. have the bacteroides fragilis of probiotic properties, it is characterized in that: described bacteroides fragilis deposit number is CGMCC NO.7280.
2. the bacteroides fragilis with probiotic properties as claimed in claim 1, it is characterized in that: this bacterial strain 16SrRNA has the nucleotide sequence shown in SEQ ID NO:1, and sequence length is 887bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100951267A CN103146620A (en) | 2013-03-25 | 2013-03-25 | Bacteroides fragilis with characteristics of probiotics |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100951267A CN103146620A (en) | 2013-03-25 | 2013-03-25 | Bacteroides fragilis with characteristics of probiotics |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103146620A true CN103146620A (en) | 2013-06-12 |
Family
ID=48544943
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013100951267A Pending CN103146620A (en) | 2013-03-25 | 2013-03-25 | Bacteroides fragilis with characteristics of probiotics |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103146620A (en) |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103404707A (en) * | 2013-08-19 | 2013-11-27 | 广州知光生物科技有限公司 | Application of bacteroides fragilis in preparation of compositions for preventing intestinal diseases of animals |
| WO2017071346A1 (en) * | 2015-10-29 | 2017-05-04 | 广州知易生物科技有限公司 | Applications of bacteroides fragilis in resistance against aquacultural pathogenic bacteria |
| US10322151B2 (en) | 2015-06-15 | 2019-06-18 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10391128B2 (en) | 2015-11-23 | 2019-08-27 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10391130B2 (en) | 2015-06-15 | 2019-08-27 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10456444B2 (en) | 2014-12-23 | 2019-10-29 | 4D Pharma Research Limited | Pirin polypeptide and immune modulation |
| US10471108B2 (en) | 2015-11-20 | 2019-11-12 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10485830B2 (en) | 2016-12-12 | 2019-11-26 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10493112B2 (en) | 2015-06-15 | 2019-12-03 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10500237B2 (en) | 2015-06-15 | 2019-12-10 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10583158B2 (en) | 2016-03-04 | 2020-03-10 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10610549B2 (en) | 2016-07-13 | 2020-04-07 | 4D Pharma Plc | Composition comprising bacterial strains |
| US10610550B2 (en) | 2015-11-20 | 2020-04-07 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10736926B2 (en) | 2015-06-15 | 2020-08-11 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10744166B2 (en) | 2015-11-23 | 2020-08-18 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| CN111635874A (en) * | 2020-06-05 | 2020-09-08 | 江南大学 | Bacteroides fragilis capable of regulating and controlling relative abundance of akkermansia in intestinal tract |
| US10851137B2 (en) | 2013-04-10 | 2020-12-01 | 4D Pharma Research Limited | Polypeptide and immune modulation |
| US10987387B2 (en) | 2017-05-24 | 2021-04-27 | 4D Pharma Research Limited | Compositions comprising bacterial strain |
| US11007233B2 (en) | 2017-06-14 | 2021-05-18 | 4D Pharma Research Limited | Compositions comprising a bacterial strain of the genus Megasphera and uses thereof |
| US11013773B2 (en) | 2011-07-14 | 2021-05-25 | 4D Pharma Research Limited | Lactic acid bacterial strains |
| US11123379B2 (en) | 2017-06-14 | 2021-09-21 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11123378B2 (en) | 2017-05-22 | 2021-09-21 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11224620B2 (en) | 2016-07-13 | 2022-01-18 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US11266698B2 (en) | 2011-10-07 | 2022-03-08 | 4D Pharma Research Limited | Bacterium for use as a probiotic for nutritional and medical applications |
| US11723933B2 (en) | 2014-12-23 | 2023-08-15 | Cj Bioscience, Inc. | Composition of bacteroides thetaiotaomicron for immune modulation |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1029857C (en) * | 1990-05-03 | 1995-09-27 | 张季阶 | Bacterial strain and its utilization |
| CN101177712A (en) * | 2006-11-10 | 2008-05-14 | 佳能株式会社 | Probe, probe set, probe-immobilized carrier, and genetic testing method |
| CN103156886A (en) * | 2013-03-18 | 2013-06-19 | 广州知光生物科技有限公司 | Application of bacteroides fragilis in preparation of composition for treating bacterial vaginitis |
-
2013
- 2013-03-25 CN CN2013100951267A patent/CN103146620A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1029857C (en) * | 1990-05-03 | 1995-09-27 | 张季阶 | Bacterial strain and its utilization |
| CN101177712A (en) * | 2006-11-10 | 2008-05-14 | 佳能株式会社 | Probe, probe set, probe-immobilized carrier, and genetic testing method |
| CN103156886A (en) * | 2013-03-18 | 2013-06-19 | 广州知光生物科技有限公司 | Application of bacteroides fragilis in preparation of composition for treating bacterial vaginitis |
Non-Patent Citations (1)
| Title |
|---|
| CERDENO-TARRAGA,A.M ET AL: "NCTC 9343 16S ribosomal RNA, complete", 《GENBANK》 * |
Cited By (45)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11013773B2 (en) | 2011-07-14 | 2021-05-25 | 4D Pharma Research Limited | Lactic acid bacterial strains |
| US11266698B2 (en) | 2011-10-07 | 2022-03-08 | 4D Pharma Research Limited | Bacterium for use as a probiotic for nutritional and medical applications |
| US11414463B2 (en) | 2013-04-10 | 2022-08-16 | 4D Pharma Research Limited | Polypeptide and immune modulation |
| US10851137B2 (en) | 2013-04-10 | 2020-12-01 | 4D Pharma Research Limited | Polypeptide and immune modulation |
| CN103404707A (en) * | 2013-08-19 | 2013-11-27 | 广州知光生物科技有限公司 | Application of bacteroides fragilis in preparation of compositions for preventing intestinal diseases of animals |
| US10973872B2 (en) | 2014-12-23 | 2021-04-13 | 4D Pharma Research Limited | Pirin polypeptide and immune modulation |
| US10456444B2 (en) | 2014-12-23 | 2019-10-29 | 4D Pharma Research Limited | Pirin polypeptide and immune modulation |
| US11723933B2 (en) | 2014-12-23 | 2023-08-15 | Cj Bioscience, Inc. | Composition of bacteroides thetaiotaomicron for immune modulation |
| US10864236B2 (en) | 2015-06-15 | 2020-12-15 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10744167B2 (en) | 2015-06-15 | 2020-08-18 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11433106B2 (en) | 2015-06-15 | 2022-09-06 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11040075B2 (en) | 2015-06-15 | 2021-06-22 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10493112B2 (en) | 2015-06-15 | 2019-12-03 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11389493B2 (en) | 2015-06-15 | 2022-07-19 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10322151B2 (en) | 2015-06-15 | 2019-06-18 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10736926B2 (en) | 2015-06-15 | 2020-08-11 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11273185B2 (en) | 2015-06-15 | 2022-03-15 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10500237B2 (en) | 2015-06-15 | 2019-12-10 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11331352B2 (en) | 2015-06-15 | 2022-05-17 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10780134B2 (en) | 2015-06-15 | 2020-09-22 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10391130B2 (en) | 2015-06-15 | 2019-08-27 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| WO2017071346A1 (en) * | 2015-10-29 | 2017-05-04 | 广州知易生物科技有限公司 | Applications of bacteroides fragilis in resistance against aquacultural pathogenic bacteria |
| US10471108B2 (en) | 2015-11-20 | 2019-11-12 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10610550B2 (en) | 2015-11-20 | 2020-04-07 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11058732B2 (en) | 2015-11-20 | 2021-07-13 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10744166B2 (en) | 2015-11-23 | 2020-08-18 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10391128B2 (en) | 2015-11-23 | 2019-08-27 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10583158B2 (en) | 2016-03-04 | 2020-03-10 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US11224620B2 (en) | 2016-07-13 | 2022-01-18 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10967010B2 (en) | 2016-07-13 | 2021-04-06 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10610549B2 (en) | 2016-07-13 | 2020-04-07 | 4D Pharma Plc | Composition comprising bacterial strains |
| US10610548B2 (en) | 2016-07-13 | 2020-04-07 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10960031B2 (en) | 2016-07-13 | 2021-03-30 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10543238B2 (en) | 2016-12-12 | 2020-01-28 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10898526B2 (en) | 2016-12-12 | 2021-01-26 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US10485830B2 (en) | 2016-12-12 | 2019-11-26 | 4D Pharma Plc | Compositions comprising bacterial strains |
| US11123378B2 (en) | 2017-05-22 | 2021-09-21 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11376284B2 (en) | 2017-05-22 | 2022-07-05 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11382936B2 (en) | 2017-05-22 | 2022-07-12 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US10987387B2 (en) | 2017-05-24 | 2021-04-27 | 4D Pharma Research Limited | Compositions comprising bacterial strain |
| US11123379B2 (en) | 2017-06-14 | 2021-09-21 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11007233B2 (en) | 2017-06-14 | 2021-05-18 | 4D Pharma Research Limited | Compositions comprising a bacterial strain of the genus Megasphera and uses thereof |
| US11660319B2 (en) | 2017-06-14 | 2023-05-30 | 4D Pharma Research Limited | Compositions comprising bacterial strains |
| US11779613B2 (en) | 2017-06-14 | 2023-10-10 | Cj Bioscience, Inc. | Compositions comprising a bacterial strain of the genus Megasphera and uses thereof |
| CN111635874A (en) * | 2020-06-05 | 2020-09-08 | 江南大学 | Bacteroides fragilis capable of regulating and controlling relative abundance of akkermansia in intestinal tract |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103146620A (en) | Bacteroides fragilis with characteristics of probiotics | |
| CN111235070B (en) | Breast milk infant source lactobacillus plantarum BF _15 and application thereof | |
| CN108004189A (en) | A kind of compound probiotic lactic acid bacteria powder and preparation method and application | |
| CN102453689B (en) | Lactobacillus plantarum strain producing extracellular polysaccharide, and application thereof | |
| CN112175864B (en) | Bifidobacterium animalis and breeding method and application thereof | |
| CN102533588B (en) | Lactobacillus brevis for producing extracellular exopolysaccharide and application thereof | |
| WO2017020784A1 (en) | Bacteroides fragilis and application thereof | |
| CN104232515B (en) | A kind of animal bifidobacteria and its application | |
| CN103156888A (en) | Application of bacteroides fragilis in preparation of composition for treating inflammatory bowel diseases | |
| BR112012011315A2 (en) | probiotic bifidobacterial strain | |
| CN112725219B (en) | Bifidobacterium adolescentis strain and application thereof | |
| CN104805040B (en) | A kind of bacillus subtilis formulation and preparation method and application | |
| CN104498383A (en) | Lactobacillus fermentum strain suo for adjusting intestinal tract motion and preventing constipation and use thereof | |
| CN109749957A (en) | A kind of preparation and application of the lactobacillus gasseri preparation with aquatic pathogenic bacterium antagonistic properties | |
| CN105420150A (en) | Lactobacillus acidophilus and application thereof | |
| CN104531549A (en) | Lactobacillus fermentum zhao capable of regulating intestinal movement and preventing constipation | |
| CN104430847A (en) | Lactobacillus fermentum Lee working leavening agent product and constipation-prevention and health application thereof | |
| Ghatani et al. | Assessment of probiotic characteristics of lactic acid bacteria isolated from fermented yak milk products of Sikkim, India: Chhurpi, Shyow, and Khachu | |
| CN104381440A (en) | Lactobacillus fermentum Lee working fermenting agent product and application thereof to prevent constipation and keep healthy | |
| CN106434427A (en) | Lactic acid bacillus probiotic CGMCC NO.12421 and applicaiton to preparing lipid-lowering drugs | |
| CN112625979A (en) | Lactobacillus casei for resisting helicobacter pylori and application thereof | |
| CN110200186B (en) | Probiotic solid beverage and preparation method thereof | |
| CN115381860A (en) | Composition for protecting alcoholic liver injury and preparation method and application thereof | |
| CN103082294A (en) | Application of bacteroides fragilis in preparation of composition for treating diarrhea | |
| CN105199991A (en) | Neovison vison klebsiella peneumoniae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130612 |