CN102899392A - miRNA set detection method and application used in colorectal cancer diagnosis - Google Patents
miRNA set detection method and application used in colorectal cancer diagnosis Download PDFInfo
- Publication number
- CN102899392A CN102899392A CN2011102130152A CN201110213015A CN102899392A CN 102899392 A CN102899392 A CN 102899392A CN 2011102130152 A CN2011102130152 A CN 2011102130152A CN 201110213015 A CN201110213015 A CN 201110213015A CN 102899392 A CN102899392 A CN 102899392A
- Authority
- CN
- China
- Prior art keywords
- mir
- biomarker
- intestinal cancer
- seq
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a miRNA set detection method and an application thereof used in colorectal cancer diagnosis. The set of miRNA is a set comprising miR-129-3p, miR-767-3p, and miR-877* biomarkers. The miRNA sequences are respectively represented by SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3. The detection method comprises the steps that: (1) a human blood serum sample is collected; (2) blood serum total RNA is extracted; (3) reverse transcription and real-time quantitative PCR reaction are carried out upon the biomarkers, and PCR relative quantitative values of the biomarkers are calculated with U6 snRNA as an internal reference; and (4) a P value is calculated according to relative quantitative values of the biomarkers; when P is higher than 0.6621, the sample is considered as a colorectal cancer sample; and when P is smaller than 0.6621, the sample is considered as a non-colorectal-cancer sample. With the set of biomarkers, colorectal cancer detection and diagnosis can be carried out simply and fast, such that better treatment can be promoted.
Description
Technical field
The present invention relates to a kind of little RNA of endogenous non-coding (MicroRNA, miRNA) as biomarker, particularly relate to detection method and application for one group of miRNA of intestinal cancer diagnosis.
Background technology
Large bowel cancer comprises rectum cancer and colon cancer, is one of common cancer.The West Europe such as the U.S., Canada and North America developed country are the highest countries of sickness rate, and sickness rate is up to 35～50,/10 ten thousand, and its sickness rate and case fatality rate are only second to lung cancer and occupy the 2nd in malignant tumour.The pertinent data of China shows that incidence of colorectal is 15.7/10 ten thousand populations, accounts for the 4th～6 of malignant tumour, and the trend that increases is gradually arranged.China's Colorectal Cancer number in 2005 and death toll reach respectively 17.2 ten thousand and 9.9 ten thousand, surpass the U.S..Can this sick prognosis is depended on early diagnosis and surgical radical treatment.Yet because how asymptomatic early stage large bowel cancer is, when Most patients was made a definite diagnosis, a late period, 5 years survival rates only had been 50.21% behind the large bowel cancer radical correction.Carcinomebryonic antigen (Carcinoembryonic antigen, CEA) is the large bowel cancer blood serum tumor markers of finding the earliest, but CEA all has in various degree rising in most of malignant tumour serum, and specificity is lower, and is not high to the early diagnosis value of large bowel cancer.Therefore seek desirable high specificity, tumor markers that susceptibility is high is one of important means that improves control.
MicroRNA (miRNA) is the non-coding RNA molecule that the length found in animal and plant body is about 21～25 Nucleotide, mainly suppresses to finish it to the negative regulation of target gene by cutting off degraded and translation.Because the diversity of its sequence, structure, abundance and phraseology makes it that widely effect be arranged in the eukaryotic gene expression regulation and control.As the positive participant of human tumor signal path, miRNA is not only playing the part of the role of proto-oncogene and cancer suppressor gene, and is also relevant with the transfer apoptosis of tumour.Because different tumours demonstrates specific miRNA express spectra, miRNA has very high stability in the tissue that formalin is fixed, in serum and plasma, also stable expression can be arranged so increasing scientist proposes miRNA, and can be used as potential novel tumor mark.Single miRNA can affect hundreds of protein expressions, and the length of 21-25 Nucleotide has determined that also miRNA does not have complicated structure and modification, and these characteristics have all indicated the superiority of miRNA as Biomarkers.Existing research finds that miR-141 has obvious up-regulated in comprising the epithelial cell Serum of Cancer Patients of human prostata cancer, and prompting miR-141 can be used as the Biomarkers of judging tumor type.The ovarian cancer patients that lacks obvious clinical symptom and effective Biomarkers also can detect to improve with serum miRNA the possibility of early diagnosis and early stage treatment.Scientists find and confirmed miR-21,92,93,126 and 29a obvious overexpression is arranged in the tumour serum sample, and miR-155,127 and the expression of 99b obviously reduce.The expression of miR-21 is obviously increased in this external diffuse large B cell lymphoma serum, and the miR-21 that increases has also hinted preferably without the recurrence survival rate.This result shows, the specific expressed early diagnosis that not only helps tumour of check miRNA, and the prognosis that also can be used for patient is judged.These researchs confirm fully that all the mensuration of serum and blood plasma miRNA is one and detects the up-and-coming field of carcinobiology mark.Thereby, develop a kind of miRNA biomarker of assisting intestinal cancer diagnosis, can set up a kind of more responsively, more accurate making a definite diagnosis in early days and even the method for early treatment intestinal cancer has widely scientific research value and potential applicability in clinical practice.
Summary of the invention
The technical problem to be solved in the present invention provides detection method and the application for one group of miRNA of intestinal cancer diagnosis, especially relates to one group of miRNA biomarker for detection of intestinal cancer (miR-129-3p, miR-767-3p and miR-877*), method and application thereof.Utilize this group biomarker can carry out simply, quickly the intestinal cancer diagnosis and detection, so that better treatment.
For solving the problems of the technologies described above, one group of the present invention is used for the miRNA biomarker that intestinal cancer detects, and is the respectively miR-129-3p of miRNA sequence, miR-767-3p and miR-877* shown in SEQ IDNO.1, NO.2, NO.3.This group miRNA specific expressed rise in patients with bowel cancer serum.
This group biomarker can also be applied to the diagnosis of intestinal cancer.
In addition, the present invention also provides a kind of and has utilized above-mentioned biomarker group to carry out the method that intestinal cancer detects, and specifically may further comprise the steps:
(1) collector's serum sample;
(2) extract total RNA (comprising miRNA) in the serum;
(3) miR-129-3p, miR-767-3p and miR-877* biomarker are carried out reverse transcription and real-time quantitative PCR (RT-PCR), and calculate the PCR relative quantification value of each biomarker;
(4) calculate P value (the possible probability of intestinal cancer) according to the PCR relative quantification value of each biomarker, when the P value greater than 0.6621 the time, then think the intestinal cancer sample, less than 0.6621 o'clock, then think it is non-intestinal cancer sample.
Wherein, the concrete operations of step (1) collector's serum sample are: the blood sample of collecting is put into the test tube that does not contain EDTA (ethylenediamine tetraacetic acid (EDTA)), leave standstill solidify after, get supernatant, at 4 ℃ of lower 600g～900g after centrifugal 5～15 minutes, get again supernatant and centrifugal 5～15 minutes of 4 ℃ of lower 12000g～16000g, get again supernatant and get final product.
Total RNA extracting in the step (2) can operate according to business-like RNA extraction agent box, and measures the concentration of RNA.
Reverse transcription in the step (3) can be carried out according to business-like reverse transcription test kit; RT-PCR reaction also can operate according to commercialization RT-PCR reaction kit, wherein, in the RT-PCR reaction, with U6snRNA as confidential reference items, and the primer of designed, designed U6snRNA, and use 2
-Δ CtFormula calculates the PCR relative quantification value of each biomarker, Δ Ct=Ct in the formula
Biomarker-Ct
U6, Ct is the thresholding cycle number, Ct
BiomarkerThe Ct value of each biomarker, Ct
U6It is the Ct value of U6snRNA.The reverse transcription reaction condition is: 37 ℃ 1 hour, 95 ℃ 5 minutes.The primer sequence of U6 snRNA is designed to TTCGTGAAGCGTTCCATATTTT (shown in the SEQ ID NO.4) in the RT-PCR reaction, the primer sequence of miR-129-3p biomarker is AAGCCCTTACCCCAAAAAGC (shown in the SEQ ID NO.5), the primer sequence of miR-767-3p biomarker is TCTGCTCATACCCCATGGTTTCT (shown in the SEQ ID NO.6), the primer sequence of miR-877* biomarker is TCCTCTTCTCCCTCCTCCCAG (shown in the SEQ ID NO.7), its RT-PCR reaction conditions be 95 ℃ 15 minutes, then circulate, cycling condition is: 94 ℃ 15 seconds, 55 ℃ 30 seconds, 70 ℃ 34 seconds, totally 40 circulations.
P value in the step (4) (intestinal cancer may probability) circular is: according to Logistic regression equation logit (P)=-1.4867-8.2881* (the PCR relative quantification value of miR-129-3p)+87.1459* (the PCR relative quantification value of miR-767-3p)+0.1681* (the PCR relative quantification value of miR-877*) calculates logit (P), and draws corresponding P value according to the logit (P) [with reference to table 3 (quoting from Medcalc software application guide)] of gained.
Moreover, the present invention also provides a kind of biomarker group detection kit for the intestinal cancer detection, this detection kit comprises: conventional real-time quantitative PCR reagent (comprising: Taq enzyme, dNTP reagent, fluorescent reagent, PCR damping fluid, DEPC process water etc.), the detection primer of confidential reference items U6 snRNA (shown in the SEQ ID NO.4), the detection primer of miR-129-3p, miR-767-3p, miR-877* (shown in SEQ ID NO.5, NO.6 and the NO.7).Wherein, the working method of this detection kit can be carried out with reference to the method for utilizing above-mentioned biomarker group to carry out the intestinal cancer detection.
Experimental data of the present invention shows that tumour and normal sample all have specific serum miRNA express spectra.MiR-129-3p among the present invention, miR-767-3p and miR-877* there are differences expression in normal people and patients with bowel cancer serum, significant up-regulated is arranged in intestinal cancer serum.In addition, it is that threshold value is according to concrete experimental data and statistical formula gained as the foundation of judging intestinal cancer that the P value of biomarker group among the present invention (intestinal cancer possibility probability) gets 0.6621, wherein, experimental data comprises embodiment 1 and the embodiment 2 in the following specific embodiment.Therefore, can become the effective tool that intestinal cancer detects diagnosis, pathological grading, clinical stages, the judgement for the treatment of curative effect, have good potential applicability in clinical practice.
Description of drawings
The present invention is further detailed explanation below in conjunction with accompanying drawing and embodiment:
Fig. 1 is normal serum sample among the embodiment 2 and the miR-129-3p in the intestinal cancer serum sample (Fig. 1-A), miR-767-3p (Fig. 1-B), miR-877* (Fig. 1-C) and the miR-634 (comparison diagram of gene expression abundance (case figure) of Fig. 1-D), wherein, ordinate zou is the PCR relative quantification value of each biomarker;
Fig. 2 judges biomarker miR-129-3p (Fig. 2-A), miR-767-3p (Fig. 2-B), miR-877* (Fig. 2-C) and the miR-634 (diagnostic value in the intestinal cancer sample (ROC graphic representation) of Fig. 2-D) according to ROC curve (receiver operating characteristic curve, recipient's operating characteristic curve) among the embodiment 2;
Fig. 3 judges the diagnostic value (ROC graphic representation) of biomarker group in the intestinal cancer sample according to the ROC curve among the embodiment 2.
Embodiment
The foundation of the miRNA biomarker combinations that the intestinal cancer that is used for embodiment 1 detects
1. collection serum sample
Gather 10 normal peoples, 7 front peripheral blood 2mL (blood sampling time is generally morning or the morning) of the different stadium patient of colorectal cancer patients art, wherein, the concrete clinical data of these 17 serum samples is as shown in table 1.The 2mL peripheral blood that gathers is changed over to rapidly in the common test tube that does not contain EDTA, leave standstill 15～30 minutes to solidifying fully 22～25 ℃ (room temperatures).Get 0.6ml～1mL supernatant and go in the clean 1.5mL centrifuge tube, at 1 hour (under the room temperature condition) or carried out following operation in 2 hours in (under 4 ℃ of conditions): centrifugal 10 minutes of 4 ℃ of lower 820g; Again draw supernatant and go in the clean 1.5mL centrifuge tube, centrifugal 10 minutes of 4 ℃ of lower 16000g carefully draw supernatant in new centrifuge tube, place-80 ℃ to save backup.
The concrete clinical data of table 117 serum sample
2. total RNA (comprising miRNA) extracting in the serum
Every increment is originally got 400 μ L serum, uses the mirVana of Applied Biosystem company
TMPARIS
TMTest kit, step extracted total RNA to specifications, and get 1 μ LRNA, use NanoDrop ND-1000 Spectrophotometer instrument by specification step to measure RNA concentration and be placed on-80 ℃ of preservations.
3. gene chip hybridization
Get the serum RNA of 100ng institute extracting, use the miRNA Complete Labeling and Hyb test kit of Agilent Technologies company, step is carried out sample labeling and concentrated to specifications, uses the people microRNA chip of expression spectrum of Agilent Technologies company to hybridize.Use chip scanner to carry out after the image scanning, data importing GeneSpring GX11.0 software is carried out the standardization of data and follow-up analysis, the valid data after the chip normalization method are used Pearson correlation carry out cluster analysis.
4. data analysis and checking
Chip data analysis finds that the sample and the normal sample that derive from colorectal cancer are all assembled together separately, the sample that prompting serum miRNA express spectra can distinguishing different.Utilize the information biology means such as multiple analysis, t check, cluster analysis to carry out differential genes expression analysis, seek possible differential gene, and further with the real-time quantitative PCR checking, finishing screen is selected 4 miRNA---miR-129-3p, miR-634, miR-767-3p and the miR-877* of specific expressed rise in intestinal cancer.
Embodiment 2 applying biological mark groups are carried out the method that intestinal cancer detects
1. collection serum sample
Gather the front peripheral blood 2mL of art of 24 routine onset colorectal cancer patients, and mate 18 routine normal people's blood samples originally, the clinical data of 42 routine serum samples is as shown in table 2.Operate according to " collection serum sample " step among the embodiment 1, but centrifugal condition wherein changes into: centrifugal 15 minutes of 4 ℃ of lower 600g; Again draw supernatant and go in the clean 1.5mL centrifuge tube, centrifugal 15 minutes of 4 ℃ of lower 12000g carefully draw supernatant in new centrifuge tube, and the serum that obtains at last saves backup in-80 ℃.
The concrete clinical data of table 242 serum sample
2. total RNA (comprising miRNA) extracting in the serum
As operating according to embodiment 1.
3. reverse transcription and Real time-PCR (RT-PCR) reaction
The RNA that gets the extracting of 60ng institute uses the miScript Reverse Transcription reverse transcription test kit of Qiagen company to carry out reverse transcription reaction.20 μ L reaction systems: the RNA+Rnase free water that 60ng extracts (summation of RNA and Rnase free water is 15 μ L), 5 * miScript RT Buffer, 4 μ L, miScript Reverse Transcriptase Mix 1 μ L.Carry out reverse transcription reaction at thermal cycler, reaction conditions is as follows: 37 ℃ 1 hour, 95 ℃ 5 minutes.
Get the reverse transcription product of 1.5 μ L as the template of real-time quantitative PCR reaction, use the miScript SYBR Green PCR test kit of Qiagen company to carry out the real-time quantitative PCR reaction.Quantitative PCR is take U6 snRNA as confidential reference items, and designs the primer of these confidential reference items.20 μ L reaction systems: 1.5 μ L reverse transcription products, 2 * QuantiTect SYBR Green PCR Master Mix, 10 μ L, 10 * miScript Universal Primer, 2 μ L, the Auele Specific Primer of each biomarker or confidential reference items U6 snRNA (concentration is 20 μ M) 2 μ L, Rnase free water 4.5 μ L.The primer sequence of miR-129-3p is shown in the SEQ ID NO.5, the primer sequence of miR-767-3p is shown in the SEQ ID NO.6, the primer sequence of miR-877* is shown in the SEQ ID NO.7, the primer sequence of miR-634 is shown in the SEQ ID NO.8 (AACCAGCACCCCAACTTTG), and the primer sequence of U6 snRNA is shown in the SEQ ID NO.4.Reaction is carried out at 7300 quantitative PCR instrument of Applied Biosystem company, and condition is 95 ℃ of preheatings 15 minutes, then circulates, and cycling condition is: 94 ℃ 15 seconds, 55 ℃ 30 seconds, 70 ℃ 34 seconds, the PCR of totally 40 circulations reaction.
The PCR relative quantification of each biomarker uses 2
-Δ CtFormula calculates, wherein Δ Ct=Ct
Biomarker-Ct
U6The result shows the miR-129-3p in the intestinal cancer serum sample, and miR-767-3p, the expression amount of miR-877* and miR-634 all obviously raise.The PCR relative quantification value of the average miR-129-3p of intestinal cancer is 0.29, and the PCR relative quantification value of the average miR-129-3p of normal sample only is 0.068, and difference has significance (p=0.019).The PCR relative quantification value of the average miR-767-3p of intestinal cancer is 0.038, and the PCR relative quantification value of the average miR-767-3p of normal sample only is 0.0054, and difference has significance (p=0.00067).The PCR relative quantification value of the average miR-877* of intestinal cancer is 28.90, and the PCR relative quantification value of the average miR-877* of normal sample only is 3.19, and difference has significance (p=0.0018).The PCR relative quantification value of the average miR-634 of intestinal cancer is 0.040, and the PCR relative quantification value of the average miR-634 of normal sample only is 0.0087, and difference has significance (p=0.0070) (Fig. 1).Find when further judging the diagnostic value of each biomarker in the intestinal cancer sample according to the ROC curve, susceptibility when alone serum miR-129-3p relative quantification value (greater than 0.12) is carried out the intestinal cancer diagnosis is 62.5%, specificity is 88.89%, and the AUC area that can produce the ROC curve is 0.796; Susceptibility when alone miR-767-3p relative quantification value (greater than 0.011) is carried out the intestinal cancer diagnosis is 62.5%, and specificity is 83.33%, and the AUC area that can produce the ROC curve is 0.803; Susceptibility when alone serum miR-877* relative quantification value (greater than 7.63) is carried out the intestinal cancer diagnosis is 70.83%, and specificity is 88.89%, and the AUC area that can produce the ROC curve is 0.836; Susceptibility when alone serum miR-634 relative quantification value (greater than 0.011) is carried out the intestinal cancer diagnosis is 75%, and specificity is 70.59%, and the AUC area that can produce the ROC curve is 0.752 (Fig. 2).More than the AUC area that produces of each independent biomarker all more than 0.7, point out these 4 biomarkers as the Case definition of intestinal cancer certain accuracy to be arranged all separately.
4. with miR-129-3p, miR-767-3p and miR-877* are as the biomarker group of intestinal cancer detection
Take above-mentioned 4 biomarkers as the basis, further use step logistic regression to screen best biomarker combinations, to obtain optimal diagnosis effect.Regression Analysis Result shows, use miR-129-3p, the ROC tracing analysis is carried out in the combination of miR-767-3p and miR-877* can obtain best AUC area (area under the curve, area under curve) (AUC=0.868), increase miR-634 and can not promote diagnostic value, thereby the final biomarker (Fig. 3) of determining that use miR-129-3p, miR-767-3p and miR-877* detect as intestinal cancer.
Calculate P value (the possible probability of intestinal cancer) according to the PCR relative quantification value of miR-129-3p, miR-767-3p and miR-877*: at first according to Logistic regression equation: logit (P)=-1.4867-8.2881* (the PCR relative quantification value of miR-129-3p)+87.1459* (the PCR relative quantification value of miR-767-3p)+0.1681* (the PCR relative quantification value of miR-877*) calculates logit (P), then draws corresponding P value with reference to table 3 (quoting from Medcalc software application guide).When the P value greater than 0.6621 the time, then think the intestinal cancer sample, less than 0.6621 o'clock, then think it is non-intestinal cancer sample.According to the ROC tracing analysis, when the P value greater than 0.6621 the time, the susceptibility when miR-129-3p, miR-767-3p and miR-877* biomarker combinations carry out the intestinal cancer diagnosis is 66.7%, specificity is 100%.
The corresponding table with the P value of table 3logit (p) value
Embodiment 3 detection kit and application
The miR-129-3p that is used for the intestinal cancer detection in the present embodiment, miR-767-3p and miR-877* biomarker group detection kit, except containing conventional real-time quantitative PCR reagent, the detection primer (shown in the SEQ ID NO.4) and the miR-129-3p that also comprise confidential reference items U6 snRNA, the detection primer of miR-767-3p and miR-877* (SEQ ID NO.5 is shown in NO.6 and the NO.7).Wherein, conventional real-time quantitative PCR reagent comprises that Taq enzyme, dNTP reagent, fluorescent reagent, PCR damping fluid, DEPC (diethylpyrocarbonate) process water (Rnase free water).
When utilizing above-mentioned detection kit to detect, its concrete working method can be carried out the detection of sample and the judgement of intestinal cancer with reference to the working method of embodiment 2, wherein, the centrifugal condition in " collection serum sample " step can also be centrifugal 5 minutes of 4 ℃ of lower 900g; Again draw supernatant and go in the clean 1.5mL centrifuge tube, centrifugal 5 minutes of 4 ℃ of lower 16000g.
The detection kit of using in the present embodiment can be carried out the detection of biomarker group simply, fast, expediently, to judge the intestinal cancer situation, is convenient to treatment.
Sequence table
Claims (10)
1. one group is used for the miRNA biomarker that intestinal cancer detects, and it is characterized in that: described miRNA biomarker is respectively miR-129-3p, miR-767-3p and the miR-877* of miRNA sequence shown in SEQ ID NO.1, NO.2, NO.3.
2. the miRNA biomarker for the intestinal cancer detection as claimed in claim 1 is characterized in that: described miR-129-3p, miR-767-3p and the miR-877* specific expressed rise in patients with bowel cancer serum.
3. miR-129-3p as claimed in claim 1 or 2, miR-767-3p and miR-877* biomarker also are applied to the diagnosis of intestinal cancer.
4. the confidential reference items during the real-time quantitative PCR that is applied to the biomarker group as claimed in claim 1 reacts, it is characterized in that: described confidential reference items are U6snRNA, its primer sequence is shown in SEQ ID NO.4.
5. the biomarker group of utilizing as claimed in claim 1 is carried out the method that intestinal cancer detects, and comprises step:
(1) collector's serum sample;
(2) extract total RNA in the serum;
(3) to miR-129-3p, miR-767-3p and miR-877* biomarker carry out reverse transcription and real-time quantitative PCR reaction, and calculate the PCR relative quantification value of each biomarker;
(4) calculating intestinal cancer according to the PCR relative quantification value of each biomarker may the probability P value, when the P value greater than 0.6621 the time, then think the intestinal cancer sample, less than 0.6621 o'clock, then think it is non-intestinal cancer sample.
6. the biomarker group of utilizing as claimed in claim 5 is carried out the method that intestinal cancer detects, it is characterized in that: the concrete operations of described step (1) collector's serum sample are: the human blood sample of collecting is put into the test tube that does not contain EDTA, leave standstill solidify after, get supernatant at 4 ℃ of lower 600g～900g after centrifugal 5～15 minutes, get again supernatant, and centrifugal 5～15 minutes of 4 ℃ of lower 12000g～16000g, get supernatant and get final product.
7. the biomarker group of utilizing as claimed in claim 5 is carried out the method that intestinal cancer detects, it is characterized in that: in the real-time quantitative PCR reaction in the described step (3), with U6snRNA as confidential reference items, the primer sequence of these confidential reference items is shown in SEQ ID NO.4, and the primer sequence of miR-129-3p, miR-767-3p and miR-877* biomarker group is respectively shown in SEQ ID NO.5, NO.6 and NO.7; And use 2
-Δ CtFormula calculates the PCR relative quantification value of each biomarker, Δ Ct=Ct in the formula
Biomarker-Ct
U6
8. the biomarker group of utilizing as claimed in claim 5 is carried out the method that intestinal cancer detects, it is characterized in that: intestinal cancer in the described step (4) may probability P value circular be: according to Logistic regression equation logit (P)=-1.4867-8.2881* (the PCR relative quantification value of miR-129-3p)+87.1459* (the PCR relative quantification value of miR-767-3p)+0.1681* (the PCR relative quantification value of miR-877*), calculate logit (P), and draw corresponding P value according to the logit (P) of gained.
9. the biomarker group detection kit that detects for intestinal cancer as claimed in claim 1, it is characterized in that: described detection kit comprises: conventional real-time quantitative PCR reagent, the detection primer of confidential reference items U6 snRNA shown in SEQ ID NO.4, respectively the detection primer of miR-129-3p, the miR-767-3p shown in SEQ ID NO.5, NO.6, NO.7 and miR-877* biomarker.
10. the biomarker group detection kit that detects for intestinal cancer as claimed in claim 9, it is characterized in that: described conventional real-time quantitative PCR reagent comprises: Taq enzyme, dNTP reagent, fluorescent reagent, PCR damping fluid, DEPC process water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011102130152A CN102899392A (en) | 2011-07-28 | 2011-07-28 | miRNA set detection method and application used in colorectal cancer diagnosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011102130152A CN102899392A (en) | 2011-07-28 | 2011-07-28 | miRNA set detection method and application used in colorectal cancer diagnosis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102899392A true CN102899392A (en) | 2013-01-30 |
Family
ID=47571879
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011102130152A Pending CN102899392A (en) | 2011-07-28 | 2011-07-28 | miRNA set detection method and application used in colorectal cancer diagnosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102899392A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103882129A (en) * | 2014-03-19 | 2014-06-25 | 江苏大学 | Fluorescent quantitative PCR (polymerase chain reaction) method and kit for detecting miR-9 in human plasmas |
| CN107557467A (en) * | 2017-08-10 | 2018-01-09 | 李永东 | A kind of clinical marker thing related to cerebral aneurysm and its application |
| CN109852686A (en) * | 2019-02-26 | 2019-06-07 | 浙江大学医学院附属妇产科医院 | The internal reference collection of excretion body miRNA a kind of and more internal reference combination with standard sizing techniques |
| CN114317743A (en) * | 2021-12-23 | 2022-04-12 | 广西百谷生物科技有限公司 | miRNA detection kit for colorectal cancer prognosis |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101657547A (en) * | 2006-07-13 | 2010-02-24 | 俄亥俄州立大学研究基金会 | Be used to diagnose and treat the method and composition based on Microrna of colon cancer-related diseases |
| WO2011076142A1 (en) * | 2009-12-24 | 2011-06-30 | Fudan University | Compositions and methods for microrna expession profiling in plasma of colorectal cancer |
-
2011
- 2011-07-28 CN CN2011102130152A patent/CN102899392A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101657547A (en) * | 2006-07-13 | 2010-02-24 | 俄亥俄州立大学研究基金会 | Be used to diagnose and treat the method and composition based on Microrna of colon cancer-related diseases |
| WO2011076142A1 (en) * | 2009-12-24 | 2011-06-30 | Fudan University | Compositions and methods for microrna expession profiling in plasma of colorectal cancer |
Non-Patent Citations (3)
| Title |
|---|
| JESSICA A. WEBER ET AL.: "The MicroRNA Spectrum in 12 Body Fluids", 《CLINICAL CHEMISTRY》, vol. 56, no. 11, 30 November 2010 (2010-11-30), pages 1735 - 2, XP055188106, DOI: doi:10.1373/clinchem.2010.147405 * |
| SHUYANG WANG ET AL.: "Improvement of tissue preparation for laser capture microdissection: application for cell", 《BMC GENOMICS》, vol. 11, no. 163, 31 December 2010 (2010-12-31), pages 1471 - 2164 * |
| 林茂松: "人结直肠癌microRNA表达谱及其临床意义的研究", 《中国博士学位论文全文数据库》, 26 September 2010 (2010-09-26), pages 1 - 90 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103882129A (en) * | 2014-03-19 | 2014-06-25 | 江苏大学 | Fluorescent quantitative PCR (polymerase chain reaction) method and kit for detecting miR-9 in human plasmas |
| CN107557467A (en) * | 2017-08-10 | 2018-01-09 | 李永东 | A kind of clinical marker thing related to cerebral aneurysm and its application |
| CN107557467B (en) * | 2017-08-10 | 2021-05-11 | 李永东 | Clinical marker related to cerebral aneurysm and application thereof |
| CN109852686A (en) * | 2019-02-26 | 2019-06-07 | 浙江大学医学院附属妇产科医院 | The internal reference collection of excretion body miRNA a kind of and more internal reference combination with standard sizing techniques |
| CN114317743A (en) * | 2021-12-23 | 2022-04-12 | 广西百谷生物科技有限公司 | miRNA detection kit for colorectal cancer prognosis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111961725B (en) | Kit or device for detecting pancreatic cancer and detection method | |
| Augello et al. | MicroRNA profiling of hepatocarcinogenesis identifies C19MC cluster as a novel prognostic biomarker in hepatocellular carcinoma | |
| US20200157631A1 (en) | CIRCULATING miRNAs AS MARKERS FOR BREAST CANCER | |
| US20130137593A1 (en) | Early detection and staging of colorectal cancer using a panel of micro rnas | |
| CN101824464A (en) | Application of miRNA (Micro-Ribonucleic Acid) expression profile in predicting sensibilities of lung cancer patients to radiotherapy | |
| WO2009119809A1 (en) | Marker for determination of breast cancer, test method, and test kit | |
| CN105018638A (en) | Detection and application of gastric carcinogenesis associated molecular marker IncRNA (long non-coding RNA) HOTTIP (HOXA transcript at the distal tip) | |
| CN102899392A (en) | miRNA set detection method and application used in colorectal cancer diagnosis | |
| CN105176983A (en) | Kit for detecting esophageal squamous carcinoma associated serum miRNAs genes | |
| CN112020566B (en) | Kit, device and method for detection of bladder cancer | |
| Ghanbari et al. | Expression Analysis of Previously Verified Fecal and Plasma Down-regulated MicroRNAs (miR-4478, 1295-3p, 142-3p and 26a-5p), in FFPE Tissue Samples of CRC Patients. | |
| Chu et al. | The potential of circulating exosomal RNA biomarkers in cancer | |
| CN112980947A (en) | Primer and kit for detecting circulating microRNA (microribonucleic acid) related to lung cancer diagnosis and treatment | |
| CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
| CN102605042A (en) | Application of miR-378 biomarker in detection and diagnosis of gastric cancer | |
| CN102154475A (en) | Kit for detecting ERCC1 mRNA (Excision Repair Cross Complement Group 1 Messenger Ribonucleic Acid) expression by using fluorescence quantitative PCR (Polymerase Chain Reaction) technology | |
| WO2010004562A2 (en) | Methods and compositions for detecting colorectal cancer | |
| EP3473729A1 (en) | Mmp1 gene transcript for use as marker for diagnosis of ovarian cancer prognosis, and test method | |
| CN101555520A (en) | Has-mir-122 kit for early prediction of hepatocirrhosis developed from chronic hepatitis B and detection method thereof | |
| CN108753981B (en) | Application of quantitative detection of HOXB8 gene in colorectal cancer prognosis judgment | |
| CN109576266B (en) | Marker and kit for predicting sensitivity of HER2 positive metastatic breast cancer patient to trastuzumab | |
| CN107858424B (en) | Application of miRNA-4731-3p as primary lung cancer diagnosis marker | |
| CN112553341A (en) | Kidney clear cell carcinoma SCNN1 primer, diagnosis kit and application thereof | |
| CN111500740A (en) | Plasma miRNA combination as liver metastasis marker for diagnosing colorectal cancer | |
| CN109280705A (en) | A kind of circular rna hsa-circ-0044506 and its specificity amplification primer and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130130 |