CN102770561B

CN102770561B - Tissue-based micro-RNA methods for diagnosis of different subtypes of lung cancer

Info

Publication number: CN102770561B
Application number: CN201080064794.8A
Authority: CN
Inventors: 吴莹; 卢韶华; 黄威; 朱虹光; 李健
Original assignee: Fudan University
Current assignee: SHANGHAI LABWAY CLINICAL LABORATORY Co.,Ltd.
Priority date: 2009-12-24
Filing date: 2010-12-24
Publication date: 2015-05-06
Anticipated expiration: 2030-12-24
Also published as: CN102770561A

Abstract

The invention provides diagnostic kits comprising a plurality of nucleic acid molecules encoding microRNA sequences for identifying one or more mammalian target cells exhibiting lung cancer, wherein the nucleic acid molecules are differentially expressed in target cells and in control cells. The invention further provides methods for identifying one or more mammalian target cells exhibiting lung cancer by using said nucleic acid molecules, and methods and pharmaceutical compositions for preventing or treating lung cancer.

Description

For diagnosing the micro--RNA method based on tissue of different subtype lung cancer

Invention field

The present invention relates to through the miRNA biomarker that confirms and corresponding method, for the reliably lung cancer of different subtype in tissue in surgical operation and examination of living tissue lung tissue, especially for the lung cancer of difference different subtype.Described lung cancer hypotype comprises gland cancer lung cancer, prognosis of squamous cell lung cancer and small cell lung cancer.

Background of invention

Lung cancer is still modal reason in masculinity and femininity cancer associated death in the world.To have an appointment in 2009 according to estimates 1400000 new cases, with the annual growth (Frost & Sullivan estimates) of average 2.51%, these patient overwhelming majority being diagnosed as lung cancer 15 in 2009 will die from this disease (Higgins, M.J.et al. (2009) Expert Rev Anticancer Ther 9,1365-1378).Although surgical technic and combination therapy have had certain improvement in the past few decades, at total 5 annual survival rates only about 15% of the different patients with lung cancer by stages of US and European.

Lung cancer is categorized as small cell lung cancer (small cell lung cancer, SCLC) or nonsmall-cell lung cancer (non-small cell lung cancer, NSCLC).Main (80%) cancerous lung tissue type is that NSCLC comprises gland cancer and squamous cell shape cell carcinoma.Smoking is the most important risks and assumptions that lung cancer occurs, and accounts for 50% in 80% in world wide in male lung cancer case and female lung cancer patient.

Lung cancer therapy is different according to different cancer hypotypes.Be surgical operation to the therapeutic choice of early stage NSCLC, have total 5 annual survival rates of 40%.But most of patients being in late period when diagnosing, making first-line treatment only be confined to multiple medicines combined chemotherapy and expecting that survival rate is less than 8 months.Latest Development in targeted therapy requires nonsmall-cell lung cancer (NSCLC) 30 Subtypes more accurately.Cancer angiogenesis inhibitor can make squamous cell shape carcinoma patients be easier to abnormal response (Lebanoy, D. (2009) J Clin Oncol 27,2030-2037) occurs.Small cell lung cancer (SCLC) patient is the hypotype that in lung cancer, lethality is the highest, and mortality is higher than 90%.Although often observe high initial reaction rate in early metaphase patient, meta survival rate is also had an appointment 20 months.But surgical operation is almost invalid to the treatment of SCLC, chemotherapy or chemotherapy radiotherapy are combined and are only therapeutic choice.

Except treating the difference of different subtype and different pathogeny lung cancer, the difference between human observer and special, the standardized detection of shortage also limit the ability instantly patient being implemented to fully strategyization appropriate therapeutic.Very fast by based on detailed cancer and host characteristics to the Treatment decsion of patients with lung cancer individuality.Absolute demand for distinguishing the specific molecular biomarker of lung cancer hypotype.

It is generally analysis based on to single molecular indexes that many diagnostic assays are also limited to, and this analysis may affect confidence level and/or the accuracy of detection.In addition, single index can not carry out detailed forecasts to latency stage, cancer progress etc. usually.Therefore, alternative molecular indexes and detection mode is still needed to excavate to overcome these limitations.

One of solution to this problem can based on control RNA molecule; particularly based on the non-coding RNA of the endogenous expression of the evolution conservative by 20-25 nucleic acid size; such RNA can mediate said target mrna and expresses and since it found before 10 years, be proved with this microRNA (miRNA) (Bartel participating in cell development, differentiation, proliferation and apoptosis; D.P. (2004) Cell 116; 281-297; Ambros; V. (2004) Nature 431,350-355; He, L.et al. (2004) Nat Rev Genet 5,522-531).And due to its highly stable and long-term existence in vivo in vitro, miRNA has the unexistent advantage of other mRNA (Lu, J.et al., (2005) Nature 435,834-838 as cancer biomarker; Lim, L.P.et al., (2005) Nature 433,769-773).

MiRNA results from former and transcribes and the precursor (pre-miRNA) being processed into stem-loop structure by RNase III Drosha.After transporte to cells matter, the RNase III of another Dicer by name shears the ring formation short dsrna of pre-miRNA hair clip, and wherein a chain is integrated into miRNA-protein complex (miRNP) with ripe miRNA.MiRNA wherein guides miRNP to play function (Bartel, D.P. (2004) Cell 23,281-292 to said target mrna; He, L.and Hannon, G.J. (2004) Nat Rev Genet 5,522-531).

According to the complementarity between miRNA and its target, the bootable different regulation process of miRNA.With the high complementary mRNA of miRNA by disturbing mechanism that (RNAi) is identical by specific cleavage with RNA.Therefore, in this case, miRNA plays function as short interfering rna (siRNA).The mRNA that target and miRNA are complementary more weak or be directed to cell degradation approach or be translated suppression under the state not affecting mRNA level in-site.But how miRNA suppresses the translating mechanism of said target mrna still disputable.

High path miRNA quantitative technique, as miRNA chip, TaqMan miRNA based on real-time RT-PCR detect, has been proved to be the powerful of the overall miRNA spectrum of the full oncogene group of research.The exception that increasing data presentation miRNA expresses regulates to the generation of particular type cancer and/or is in progress relevant.Such as: two miRNA, miR-15 and miR-16-1 are proved the genetic locus being located at disappearance in lymphocytic leukemia (CLL), and in the CLL patient of 70%, have disappearance or the downward of miR-96 gene.And the downward of miR-15 and miR-16-1 is also found in Colorectal carcinoma becomes, and the expression of miRNA let-7 is everlasting in lung cancer and is reduced (Michael, M.Z.et al. (2003) Mol Cancer Res 1,882-891; Mayr, C.et al. (2007) Science 315,1576-1579).In fact; but change according to the cancer dependency that miRNA expresses and be often positioned at the hereditary district supposition miRNA suppressor oncogene relevant to cancer and oncogene (Esquela-Kerscher with miRNA; A.and Slack, F.J (2006) Nat Rev Cancer 6,259-269; Calin, G.A.and Croce, C.M. (2007) J Clin Invest 117,2059-2066; Blenkiron, C.and Miska, E.A. (2007) Hum Mol Genet 16, R106-R113).In the existing people's cancer described, miRNA expression pattern has highlighted the potential that it can be used to diagnosis and prognosis biomarker.

The express spectra of some research report miRNA in lung cancer (Johnson, S.M.et al. (2005) Cell 120,635-647; Liang, Y.et al. (2008) BMC Med Genomics 1,61; Kumar, M.S.et al. (2008) Proc Natl Acad Sci USA 105,3903-3908; Miko, E.et al. (2009) Exp Lung Res 35,646-664; Xie, Y et al. (2009) Lung Cancer May 13; Lebanony, D.et al. (2009) J Clin Oncol 27,2030-2037; Kauppinen, S.et al. (2009) Clin Cancer Res 15,1177-1183; Mascaux, C.et al. (2009) Eur RespirJ33,352-359).In the same manner, these researchs all show that specific miRNA has unconventionality expression compared with non malignant lung tissue in malignant tissue.And research shows that some miRNA may (Yu, S.L.et al. (2008) Cancer Cell 13,48-57 relevant to prognosis; Raponi, M.et al (2009) Cancer Res69,5776-5783).Therefore, these miRNA can give a clue to vicious transformation and the relevant cell processes that is in progress.

Thus, still need the diagnosis index of (a series of), especially can carry out fast with " expression characteristic (signature) " or " molecular imprinting " form, reliable and save the cell that the qualification of cost property and/or treatment showed as or likely developed into dissimilar lung cancer.In addition, the method identifying simultaneously and treat the target cell of cancer phenotype accordingly is still needed

Goal of the invention and summary of the invention

The object of this invention is to provide through the miRNA biomarker that confirms and corresponding method, for the reliably lung cancer of different subtype in surgical operation and examination of living tissue lung tissue, especially for the lung cancer of difference different subtype.Specifically, by determining multiple nucleic acids molecule, lung cancer shows as gland cancer lung cancer, squamous cell carcinoma and small cell lung cancer, often kind of nucleic acid molecule encoding miRNA sequence, and one or more in described multiple nucleic acids molecule in analyzed target cell compared with in compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions can be used as together a kind of indication lung cancer exist expression of nucleic acid biomarker.

More specifically, target of the present invention is to provide effective miRNA biomarker, and for qualification, one or more shows target mammalian cell and/or difference gland cancer lung cancer, prognosis of squamous cell lung cancer or the small cell lung cancer of lung cancer.

In addition, the present invention also aims to provide corresponding method, for qualification, one or more shows the target mammalian cell of lung cancer, lung cancer and the prevention of difference different subtype or treats this type of disease.

These and other object will become clear from following description, and its theme by independent claim is reached.Certain preferred embodiments of the present invention is then limited by the theme of dependent claims.

In first aspect, the present invention relates to the diagnostic kit of the molecule marker for the identification of one or more target mammalian cell showing gland cancer lung cancer, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents a kind of expression of nucleic acid biomarker together, this biomarker is the indication that gland cancer lung cancer exists.

The expression of nucleic acid biomarker limited herein can comprise at least four kinds of nucleic acid molecule.

In particular embodiments, described expression of nucleic acid biomarker comprises the nucleic acid molecule of at least one coding miRNA sequence, and its expression is raised in one or more target cells compared with one or more normal control cells; And comprising the nucleic acid molecule of at least one coding microrna sequences, its expression is lowered in one or more target cells compared with one or more normal control cells.

In preferred embodiments, described expression of nucleic acid biomarker comprises any one or the multiple nucleic acids molecule of coding hsa-miR-27a, hsa-miR-29a, hsa-miR-34a and hsa-miR-375..

Particularly preferably, compared with one or more normal control cells described, in one or more target cells described, the expression of any one or the multiple nucleic acids molecule of hsa-miR-34a and hsa-miR-375 up-regulated and coding hsa-miR-27a and hsa-miR-29a is lowered.

In an even more preferred embodiment, expression of nucleic acid biomarker comprises in coding hsa-miR-34a/hsa-miR-27a and hsa-miR-34a/hsa-miR-29a and appoints one or more Nucleic acid combinations.Especially expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-29a, hsa-miR-27a and hsa-miR-34a.

Second aspect, the present invention relates to for the identification of one or more diagnostic kit showing the molecule marker of the target mammalian cell of prognosis of squamous cell lung cancer, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents a kind of expression of nucleic acid biomarker together, this biomarker is the indication that prognosis of squamous cell lung cancer exists.

Expression of nucleic acid biomarker defined herein can comprise at least four kinds of nucleic acid molecule.

In preferred embodiments, expression of nucleic acid biomarker comprises the nucleic acid molecule of at least one coding miRNA sequence, and its expression is raised in one or more target cells compared with one or more normal control cells; And comprising the nucleic acid molecule of at least one coding miRNA sequence, its expression is lowered in one or more target cells compared with one or more normal control cells.

In a more preferred embodiment, expression of nucleic acid biomarker comprises any one or the multiple nucleic acids molecule of coding hsa-miR-205, hsa-miR-25, hsa-miR-29a and hsa-miR-375.

Especially preferred, compared with one or more normal control cells described, in one or more target cells described, hsa-miR-205 and hsa-miR-25 is raised, and the expression of the nucleic acid molecule of hsa-miR-29a and hsa-miR-375 that encode is lowered.

In a more preferred embodiment, expression of nucleic acid biomarker comprises coding hsa-miR-205/hsa-miR-29a, any one or the multiple nucleic acids combination of hsa-miR-25/hsa-miR-29a, hsa-miR-205/hsa-miR-375 and hsa-miR-25/hsa-miR-375.Especially, expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-205, hsa-miR-25 and hsa-miR-29a.

In the third aspect, the present invention relates to for the identification of one or more diagnostic kit showing the molecule marker of the target mammalian cell of small cell lung cancer, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents a kind of expression of nucleic acid biomarker together, this biomarker is the indication that small cell lung cancer exists.

Expression of nucleic acid biomarker defined herein can comprise at least five kinds of nucleic acid molecule.

In an even more preferred embodiment, expression of nucleic acid biomarker comprises any one or the multiple nucleic acids molecule of coding hsa-miR-25, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-375.

Especially preferredly be, compared with one or more normal control cells described, in one or more target cells described, hsa-miR-25 and hsa-miR-375 is raised, and the expression of the nucleic acid molecule of encode hsa-miR-27a, hsa-miR-29a and hsa-miR-29b is lowered.

In a more preferred embodiment, expression of nucleic acid biomarker comprises any one or the multiple nucleic acids combination of coding hsa-miR-25/hsa-miR-27a, hsa-miR-375/hsa-miR-27a, hsa-miR-25/hsa-miR-29a and hsa-miR-375/hsa-miR-29a.Especially, expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-29a and hsa-miR-375.

Fourth aspect, the present invention relates to the diagnostic kit for molecule marker prognosis of squamous cell lung cancer and gland cancer lung cancer differentiated, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents a kind of expression of nucleic acid biomarker together, this biomarker is the indication that prognosis of squamous cell lung cancer or gland cancer lung cancer exist.

In preferred embodiments, expression of nucleic acid biomarker comprises the nucleic acid molecule of at least one coding miRNA sequence, and its expression is raised in one or more target cells compared with one or more compared with control cells; And comprising the nucleic acid molecule of at least one coding miRNA sequence, its expression is lowered in one or more target cells compared with one or more compared with control cells.

In a more preferred embodiment, expression of nucleic acid biomarker comprises any one or the multiple nucleic acids molecule of coding hsa-miR-205, hsa-miR-25, hsa-miR-27a and hsa-miR-375.

Especially preferred, compared with one or more compared with control cells described, in one or more target cells described, hsa-miR-205, hsa-miR-25, hsa-miR-27a are raised, and the expression of the nucleic acid molecule of the hsa-miR-375 that encodes is lowered.

In a more preferred embodiment, expression of nucleic acid biomarker comprises any one or the multiple nucleic acids combination of coding hsa-miR-205/hsa-miR-375 and hsa-miR-25/hsa-miR-375.Especially, expression of nucleic acid biomarker comprises a kind of nucleic acid molecule combination of coding hsa-miR-205, hsa-miR-25 and hsa-miR-375.

5th aspect, the present invention relates to the diagnostic kit for molecule marker small cell lung cancer and gland cancer lung cancer differentiated, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents a kind of expression of nucleic acid biomarker together, this biomarker is the indication that small cell lung cancer or gland cancer lung cancer exist.

Expression of nucleic acid biomarker defined herein can comprise at least six kinds of nucleic acid molecule.

In a more preferred embodiment, expression of nucleic acid biomarker comprises any one or the multiple nucleic acids molecule of coding hsa-miR-25, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.

Especially preferredly be, compared with one or more compared with control cells described, in one or more target cells described, hsa-miR-25 and hsa-miR-375 is raised, and the expression of the nucleic acid molecule of encode hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-34a is lowered.

In a more preferred embodiment, expression of nucleic acid biomarker comprises any one or the multiple nucleic acids combination of coding hsa-miR-25/hsa-miR-27a, hsa-miR-375/hsa-miR-27a, hsa-miR-25/hsa-miR-29a and hsa-miR-375/hsa-miR-29a.Especially, expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-25, hsa-miR-34a and hsa-miR-375.

6th aspect, the present invention relates to the diagnostic kit for molecule marker small cell lung cancer and prognosis of squamous cell lung cancer differentiated, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents a kind of expression of nucleic acid biomarker together, this biomarker is the indication that small cell lung cancer or prognosis of squamous cell lung cancer exist.

In preferred described scheme, expression of nucleic acid biomarker comprises any one or the multiple nucleic acids molecule of coding hsa-miR-205, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.

Especially preferredly be, compared with one or more compared with control cells described, in one or more target cells described, hsa-miR-375 is raised, and the expression of the nucleic acid molecule of encode hsa-miR-205, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-34a is lowered.

In a more preferred embodiment, expression of nucleic acid biomarker comprises any one or the multiple nucleic acids combination of coding hsa-miR-375/hsa-miR-27a and hsa-miR-375/hsa-miR-29a.Especially, expression of nucleic acid biomarker comprises coding hsa-miR-29b and hsa-miR-375 Nucleic acid combinations.

7th aspect, the present invention relates to the method for the identification of one or more target mammalian cell showing gland cancer lung cancer, prognosis of squamous cell lung cancer or small cell lung cancer, and described method comprises:

A () collects examination of living tissue or the surgical tissue of patient;

B () prepares tissue slice on slide glass;

C () at least one encoded nucleic acid molecule biomarker of microrna sequences hybridizes in the section on slide glass;

D () under the microscope or carry out quantitatively by digital pathology protocol to the expression of miRNA;

E () determines multiple nucleic acids developed by molecule level in one or more described target cells, often kind of nucleic acid molecule is all encoded microrna sequences;

F () determines the expression level of described multiple nucleic acids molecule in one or more compared with control cells; And

G respective expression level that () is obtained in step (e) and (f) by contrast, one or more nucleic acid molecule of differential expression in target cell and compared with control cells are identified from described multiple nucleic acids molecule, the nucleic acid molecule of one or more differential expressions wherein said represents expression of nucleic acid biomarker as herein defined together, and it is the indication that gland cancer lung cancer, prognosis of squamous cell lung cancer or small cell lung cancer exist.

Especially preferred, the method realizes with in situ hybridization.

In order to carry out quantitative determination, use the miRNA biomarker of 7 empirical tests: hsa-miR-205, hsa-miR-25, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.

In order to the expression level stdn of the nucleic acid molecule biomarker by obtained coding microrna sequences, the coding hsa-miR-24 expression of nucleic acid molecule of stably express in lung tissue can be preferably used in.As the negative control of the nucleic acid molecule biomarker expression level of obtained coding miRNA sequence, the coding hsa-miR-122 expression of nucleic acid molecule of not expressing in lung tissue can be preferably used in.

Eighth aspect, the present invention relates to the method for prevention or treatment lung cancer, the method comprises: (a) identifies expression of nucleic acid biomarker by using method as herein described in one or more target cells; And (b) changes the expression of one or more nucleic acid molecule of the coding microrna sequences that described expression of nucleic acid biomarker comprises in one or more cells described, described change is carried out in such a way, namely its expression is lowered by the expression of the nucleic acid molecule raised in one or more target cells described, and its expression is raised by the expression of the nucleic acid molecule lowered in one or more target cells described.

9th aspect, the present invention relates to the pharmaceutical composition for preventing and/or treating lung cancer, described composition comprises one or more nucleic acid molecule, often kind of equal encoding sequence of nucleic acid molecule, described sequence and the defined herein microrna sequences that it is expressed coded by the nucleic acid molecule that raises in one or more target cells described complementary at least partly, and/or described sequence corresponds to, and defined herein in one or more target cells described, it expresses the microrna sequences coded by the nucleic acid molecule lowered.

Finally, the tenth aspect, the present invention relates to aforementioned pharmaceutical compositions for the preparation of the purposes prevented and/or treated in the medicine of lung cancer.

In detailed description subsequently, other embodiments of the present invention will be illustrated.

Accompanying drawing is sketched

Fig. 1: depicting in brief summary of the invention the 7th aspect according to detected representation is that the present invention of the single of gland cancer lung cancer, prognosis of squamous cell lung cancer or small cell lung cancer or many target cells is for determining the schema of the basic method steps of a certain expression biomarker.Especially in-situ hybridization method is used to distinguish different lung cancer hypotype.

Fig. 2 A: the people miRNA belonging to especially preferred expression biomarker according to the present invention for detected representation being the single of gland cancer lung cancer or many target cells is in a first aspect described.Also show expression level and the accuracy (that is: raise or lower) of these miRNA in gland cancer patients with lung cancer compared with normal lung tissue simultaneously.Data show that the gland cancer lung cancer in FFPE surgical tissue reliably can be distinguished with normal lung tissue.

Fig. 2 B: progressively describe in first aspect present invention for detect in FFPE surgical tissue show gland cancer lung cancer one or more target cell to the logistic regression analysis of group one (hsa-miR-27a, hsa-miR-29a and hsa-miR-34a).Data show that the gland cancer lung cancer in FFPE surgical tissue reliably can be distinguished with normal lung tissue (AUC=0.925).

Fig. 3 A: the people miRNA belonging to especially preferred expression biomarker according to the present invention for detected representation being the single of prognosis of squamous cell lung cancer or many target cells in second aspect is described.Also expression level and the accuracy (that is: raise or lower) of these miRNA in gland cancer patients with lung cancer compared with normal lung tissue is shown.Data show that the prognosis of squamous cell lung cancer in FFPE surgical tissue reliably can be distinguished with normal lung tissue.

Fig. 3 B: progressively describe in second aspect according to for detecting in FFPE surgical tissue the present invention of showing as the single of prognosis of squamous cell lung cancer or many target cells logistic regression analysis to a combination (hsa-miR-205, hsa-miR-25 and hsa-miR-29a).Data show that the gland cancer lung cancer in FFPE surgical tissue reliably can be distinguished with normal lung tissue (AUC=0.961).

Fig. 4 A: the people miRNA belonging to especially preferred expression biomarker according to the present invention for detected representation being the single of small cell lung cancer or many target cells is in a third aspect described.Also expression level and the accuracy (that is: raise or lower) of these miRNA in Patients With Small Cell Carcinoma of The Lung compared with normal lung tissue is shown.Data show that the small cell lung cancer in FFPE surgical tissue reliably can be distinguished with normal lung tissue.

Fig. 4 B: progressively describe in the third aspect according to for detecting in FFPE surgical tissue the present invention of showing as the single of small cell lung cancer or many target cells logistic regression analysis to (hsa-miR-29a and hsa-miR-375) of a combination.Data show that the small cell lung cancer in FFPE surgical tissue reliably can be distinguished with normal lung tissue (AUC=0.998).

Fig. 5 A: illustrate that basis is for differentiating that the present invention of prognosis of squamous cell lung cancer and gland cancer lung cancer belongs to the people miRNA of especially preferred expression biomarker in fourth aspect.Also expression level and the accuracy (that is: raise or lower) of these miRNA in squamous cell lung cancer compared with gland cancer patients with lung cancer is shown.Data show that the prognosis of squamous cell lung cancer in FFPE surgical tissue reliably can be distinguished with gland cancer lung cancer.

Fig. 5 B: progressively describe in fourth aspect according to for differentiate in FFPE surgical tissue prognosis of squamous cell lung cancer can with the logistic regression analysis of the present invention of gland cancer lung cancer to (hsa-miR-205, hsa-miR-25 and the hsa-miR-375) combined.Data show that in FFPE surgical tissue, prognosis of squamous cell lung cancer reliably can be distinguished with gland cancer lung cancer (AUC=0.922).

Fig. 6 A: illustrate that basis is for differentiating to belong to during the present invention of small cell lung cancer and gland cancer lung cancer is in the 5th the people miRNA of especially preferred expression biomarker.Also expression level and the accuracy (that is: raise or lower) of these miRNA in Patients With Small Cell Carcinoma of The Lung compared with gland cancer patients with lung cancer is shown.Data show that the small cell lung cancer in FFPE surgical tissue reliably can be distinguished with gland cancer lung cancer.

Fig. 6 B: progressively describe in the 5th aspect according to for differentiate FFPE surgical tissue small cell lung cancer can with the logistic regression analysis of the present invention of gland cancer lung cancer to (hsa-miR-25, hsa-miR-34a and the hsa-miR-375) combined.Data show that FFPE surgical tissue small cell lung cancer reliably can be distinguished with gland cancer lung cancer (AUC=0.991).

Fig. 7 A: illustrate that basis is for differentiating to belong to during the present invention of small cell lung cancer and prognosis of squamous cell lung cancer is in the 6th the people miRNA of especially preferred expression biomarker.Also expression level and the accuracy (that is: raise or lower) of these miRNA in Patients With Small Cell Carcinoma of The Lung compared with squamous cell lung cancer is shown.Data show that the small cell lung cancer in FFPE surgical tissue reliably can be distinguished with prognosis of squamous cell lung cancer.

Fig. 7 B: progressively describe in the 6th aspect according to for differentiate FFPE surgical tissue small cell lung cancer can with the logistic regression analysis of the present invention of prognosis of squamous cell lung cancer to (hsa-miR-29b and hsa-miR-375) combined.Data show that FFPE surgical tissue small cell lung cancer reliably can be distinguished with prognosis of squamous cell lung cancer (AUC=0.982).

Detailed Description Of The Invention

The present invention reliably can diagnose according to hypersensitivity and specific specific miRNA express spectra based on lung cancer to distinguish with hypotype, and generally includes the discovery in upper and lower tune two outside this expection at these expression biomarkers that this determines.More particularly, by analyze overall miRNA expression pattern and/or separately miRNA expression level can realize distinguishing the early diagnosis of lung cancer and hypotype.The present invention of following illustration can suitably do not exist not in this article concrete disclose one or more element any, one or more restrictions conditions under implement.

The present invention also will be described with reference to accompanying drawing according to specific embodiment, but the present invention is not limited, and only limits by claims.Described accompanying drawing is only schematic, is considered to nonrestrictive.

When term " comprise " be used in specification sheets of the present invention and claims time, it does not get rid of other element or step.For the object of the invention, term " by ... composition " be considered to the preferred embodiment that term " comprises ".If group is restricted to and comprises at least one fixed number object embodiment hereinafter, this is also understood to disclose the group be preferably only made up of these embodiments.

Using indefinite article or definite article such as " one " or " one " when referring to singulative noun, time " described ", comprising the plural form of this noun, unless otherwise indicated.

Term " approximately " refers to that those skilled in the art understand the accuracy interval of the technique effect that still can ensure object feature in the present invention.This term ordinary representation depart from indicator value ± 10%, preferably ± 5%.

In addition, term first, second, third, (a), (b), (c) etc., in the specification and in the claims for element like region class, are not that description order or chronological order are necessary.The term should understanding so application is interchangeable in appropriate situations, and the embodiment that the present invention describes can be different from other sequential operation of described herein or illustration.

Term be defined in following use term further time provide.

Following term or definition only provide to understand the present invention.These definition should not be considered to have the scope being less than those skilled in the art and understanding.

Term used herein " cancer " (also referred to as " cancer (carcinoma) ") is often referred to the malignant growth of any type, namely shows compared with unaffected (health) wild type control cells or has any morphology that the target cell that cancer is inclined to occurs and/or physiology changes (based on hereditary reprogrammed (geneticre-programming)).The example of this change can relate to cell size and shape (become large or diminish), cell proliferation (cell count increase), cytodifferentiation (physiological status change), apoptosis (apoptosis) or cell survival.

Term used herein " lung cancer " refers to uncontrolled cell growth in lung tissue, or the cancerous growths of lung tissue.

Term " different subtype of lung cancer " is used to comprise gland cancer lung cancer, prognosis of squamous cell lung cancer and small cell lung cancer at this.

" gland cancer lung cancer " or " gland lung cancer " is a class nonsmall-cell lung cancer.The lung cancer of 80% is nonsmall-cell lung cancer (NSCLC), and wherein 50% is gland cancer.Gland cancer lung cancer betides the peripheral region of lung, can exist for a long time before diagnosis.Modal Lung Cancer Types in women, also common in non-smoker.

" prognosis of squamous cell lung cancer " is a class nonsmall-cell lung cancer.About 30%NSCLC is prognosis of squamous cell lung cancer.Prognosis of squamous cell lung cancer often betides the segmental bronchus (big airways) of lung central part.Namely a lot of people has symptom in early days, and normal is spitting of blood (bringing up blood).

" small cell lung cancer " (SCLC) is considered to the neuroendocrine cell originating from component part segmental bronchus (air flue) epithelium (serving as a contrast attached).SCLC accounts for 18% of all cases of lung cancer.SCLC has an aggressive very much.Grow very fast and be diffused into liver, lung, bone and brain by blood flow.Be easy to find neoplasm metastasis in these organs when diagnosing.

Refer at least under a cloudly suffer from lung cancer at this term used " patient ", or the people of certain type lung cancer; The Healthy People of term " healthy individuals " or this cancer phenotype of " normal control " Chang Zhiwu.But, in some applications, such as, when more dissimilar lung cancer, have the individuality of other types lung cancer to be often considered to " contrast ".

Sample for detecting in vitro method of the present invention should be collected in clinical acceptable mode usually, preferably to protect the mode of nucleic acid (particularly RNA) or protein to collect.Sample to be analyzed is organized typically.In addition, blood and other type of sample also can use.

Term used herein " microRNA " (or " miRNA ") is that its its ordinary meaning in this area (is summarized see such as Bartel, D.P. (2004) Cell 23,281-292; He, L.and Hannon, G.J. (2004) Nat.Rev.Genet.5,522-531).Therefore, " microRNA " refers to the RNA molecule derived from genomic gene seat, and it is from the transcript processing that can form partial rna precursor miRNA structure.Ripe miRNA normal length is 20,21,22,23,24 or 25 Nucleotide, and the Nucleotide of other number also can exist, such as 18,19,26 or 27 Nucleotide.

MiRNA encoding sequence has the potentiality of matching with flanking genomic sequence, within the RNA duplex making ripe miRNA be placed on non-fully pairing (herein also referred to as stem-ring or hairpin structure or pre-miRNA), described duplex is as the intermediate carrying out miRNA processing from longer precursor transcript.This processing occurs typically via the continuous action of be called Drosha and Dicer two species specific endonucleases.Drosha produces the miRNA precursor (herein also referred to as " pre-miRNA ") being typically folded into hair clip or stem-ring structure from primary transcript (herein also referred to as " pri-miRNA ").From this miRNA precursor, cut miRNA duplex by Dicer, it comprises ripe miRNA at the one arm of hair clip or stem-ring structure, comprises the sections (being commonly referred to miRNA*) of similar size in another arm.Then miRNA is directed to its said target mrna to play its function, and miRNA* is degraded.In addition, miRNA is typically derived from the genome segment different from the protein coding region of prediction.

Term used herein " miRNA precursor " (or " precursor miRNA " or " pre-miRNA ") refers to the part of the miRNA primary transcript processing ripe miRNA from it.Typically, pre-miRNA is folded into stable hair clip (i.e. duplex) or stem-ring structure.Hairpin structure typically length is 50-80 Nucleotide, a preferred 60-70 Nucleotide (counting miRNA residue, the residue matched with miRNA, and anyly interleave sections, but get rid of the sequence of more far-end).

Term used herein " nucleic acid molecule of coding microrna sequences " refers to any nucleic acid molecule of coding microRNA (miRNA).Therefore, this term not only refers to ripe miRNA, also refers to corresponding precursor miRNA as above and elementary miRNA transcript.In addition, the invention is not restricted to RNA molecule, also comprise the DNA molecular of corresponding coding microRNA, such as, by DNA molecular that reverse transcription miRNA sequence produces.The nucleic acid molecule of microrna sequences of the present invention of encoding typically is encoded single miRNA sequence (i.e. individual miRNA).Such as, but the also possibility two or more miRNA sequence of this nucleic acid molecule encoding (i.e. two or more miRNA), a transcription unit is included in the conventional sequence that regulates as the two or more miRNA sequences under promotor or transcription terminator control.

The term used herein nucleic acid molecule of microrna sequences " coding " is also understood to include " having phosphorothioate odn molecule " (i.e. nucleotide sequence (5' → 3') mate or corresponding to molecule of coded miRNA (5' → 3') sequence) and " antisense nucleic acid molecule " (namely nucleic acid array complementation is in coded miRNA (5' → 3') sequence or the molecule of reverse complementary sequence (3' → 5') in other words mating coded miRNA sequence).Term used herein " complementation " refers to that " antisense " sequence of nucleic acid molecules and corresponding " having justice " sequence of nucleic acid molecules (having the sequence being complementary to antisense sequences) form the ability of base pair, preferably Watson-Crick base pair.

Within the scope of the present invention, two nucleic acid molecule (namely " having justice " and " antisense " molecule) can complete complementary, and namely they are containing any base mispairing and/or Nucleotide that is extra or disappearance.Or two molecules comprise one or more base mispairing or different on their total nucleotide number (causing owing to adding or lacking).Preferably, " complementation " nucleic acid molecule comprises at least 10 continuous nucleotides showing complete complementary to the sequence be included in corresponding " having justice " nucleic acid molecule.

Therefore, the multiple nucleic acids molecule being included in the coding miRNA sequence in diagnostic kit of the present invention can comprise one or more " has phosphorothioate odn molecule " and/or one or more " antisense nucleic acid molecules ".Sometimes, diagnostic kit comprises one or more " has phosphorothioate odn molecule " (i.e. miRNA sequence itself), described molecule is considered to the entirety of the miRNA (i.e. molecule marker) constituting differential expression or at least sub-set, the miRNA of described differential expression is the indication that there is or occur particular condition tendency, is lung cancer herein.On the other hand, when diagnostic kit comprises one or more " antisense nucleic acid molecules " sequence of miRNA sequence complementation (namely with), described molecule can comprise probe molecule (for carrying out hybridization assays) and/or the Oligonucleolide primers (such as applying for reverse transcription or PCR) of one or more specific (complementation) miRNA sequences being suitable for detecting and/or in quantitative given sample.

The multiple nucleic acids molecule defined in the present invention can comprise at least 2 kinds, at least 10 kinds, at least 50 kinds, at least 100 kinds, at least 200 kinds, at least 500 kinds, at least 1000 kinds, at least 10000 kinds or at least 100000 kinds of nucleic acid molecule, often kind of molecule encoding miRNA sequence.

Term used herein " differential expression " refers to that the expression level of specific miRNA in target cell is change compared to normal healthy controls cell or other diseases type of sample, and it can be raise (namely miRNA concentration increases in target cell) or lower (namely miRNA concentration reduces or disappears in target cell).In other words, nucleic acid molecule is activated to than level higher or lower in compared with control cells in target cell.

Within the scope of the present invention, nucleic acid molecule is considered to differential expression, if the corresponding expression level of this nucleic acid molecule in target cell and compared with control cells typically differs at least 5% or at least 10%, preferably at least 20% or at least 25%, most preferably at least 30% or at least 50%.Therefore, the value of the latter raises at least 1.3 times or at least 1.5 times corresponding to the expression level of given nucleic acid molecule in target cell respectively compared to wild type control cells, otherwise or expression level in target cell lower at least 0.7 times or at least 0.5 times.

Term used herein " expression level " refers to that specific miRNA sequence is from the transcribed degree of its genomic gene seat, i.e. the concentration of miRNA in one or more analyzed cells.

As mentioned above, term " compared with control cells " typically refers to (health) individual cells sample being collected in and not having lung cancer phenotypic characteristic.Such as, but in some applications, when comparing the dissimilar lung cancer of display, the cell deriving from other types lung cancer is typically considered to " compared with control cells ".

The determination of expression level typically follows the standard program set up well known in the art (see such as Sambrook, J.et al. (1989) Molecular Cloning:A Laboratory Manual.2ndEd., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F.M.et al. (2001) Current Protocols in Molecular Biology.Wiley & Sons, Hoboken, NJ).Determine to carry out at rna level, such as, use miRNA specific probe to carry out Northern engram analysis, or such as carried out at DNA level by quantitative PCR or real time pcr after reverse transcription (and clone) RNA group.Any nucleic acid molecule comprising the above-mentioned miRNA sequence of analysis of encoding " determined " in term used herein.But, because pri-miRNA and re-mRNA half life is short, typically only measure the concentration of ripe miRNA.

In particular embodiments, the standard value of the expression level obtained in some independent measurements (such as two, three, five or ten measurements) of given sample and/or the some measurements in a group target cell or compared with control cells is used to analyze.Standard value can obtain by any method known in the art.Such as, the scope of mean value ± 2SD (standard deviation) or mean value ± 3SD can be used as standard value.

The difference between one or more target cell and expression levels of one or more compared with control cells obtained can stdn (or normalization method, normalize) to the expression level of further contrast nucleic acid such as house-keeping gene, the expression level of house-keeping gene is known not different according to the morbid state of cell.The house-keeping gene of citing comprises beta-actin, glyceraldehyde-3-phosphate dehydrogenase and ribosomal protein P1 etc.In preferred embodiments, the another kind of miRNA that nucleic acid is stably express in the known different non-cancer at cell and cancer (front) state is contrasted.

But, replace the expression level determining one or more compared with control cells in any experiment, also can based on experimental evidence and/or prior art data definition one or more cutoff value for specific cells phenotype (i.e. morbid state).In this case, the corresponding expression level of one or more target cells can be determined with the contrast miRNA for standardized stably express.If the expression level of " stdn " that calculate is higher than the cutoff value of corresponding definition, then this discovery is the indication that genetic expression is raised.Otherwise if the expression level of " stdn " that calculate is lower than the cutoff value of corresponding definition, then this discovery is the indication of down regulation of gene expression.

In the present invention, term " diagnosing and/or distinguish different lung cancer hypotype " also refers to prediction and probability analysis (meaning " diagnosis ").Biomarker described here and method be intended to for comprise therapeutic intervention, Case definition as staging disease surveillance and the clinical decision of Therapeutic mode aspect that monitors.According to the present invention, the stage casing result to an object condition detection can be provided.This stage casing result can be diagnosed the individuality of suffering from this disease together with other information assist physician, nurse or other practitioners.In addition, this invention can be used as carrying out carcinous change to cell sample and detect, and provides the advantageous information in order to diagnosis to doctor.Again, the present invention can be used for the differential diagnosis of different lung cancer hypotype.

In the present invention, the nucleic acid molecule of one or more differential expressions identified represents a kind of expression of nucleic acid biomarker together, and this expression of nucleic acid feature is the indication that there is lung cancer in target cell.Term used herein " expression biomarker " refers to one group of nucleic acid molecule (such as miRNA), wherein different between the expression level of each nucleic acid molecule cell of originating at patients with lung cancer and normal control cells.Herein, expression of nucleic acid biomarker also refers to a group echo and represents minimum object (difference) nucleic acid molecule, and often kind of nucleic acid molecule encoding can identify the miRNA sequence of the phenotypic status of an individuality.

In a more preferred embodiment, expression of nucleic acid feature (signature) comprises the nucleic acid molecule of one or more coding hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-34a (SEQID NO:6) and hsa-miR-375 (SEQ ID NO:7).

Especially preferredly be, compared with one or more compared with control cells, in one or more target cells, hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7) is raised, and encodes (SEQ ID NO:3) and the expression of any one or multiple nucleic acids molecule of hsa-miR-29a (SEQ ID NO:4) is lowered.

In a more preferred embodiment, expression of nucleic acid biomarker comprises the Nucleic acid combinations of any one or Multi-encoding hsa-miR-34a (SEQ ID NO:6)/hsa-miR-27a (SEQ ID NO:3) and hsa-miR-34a (SEQ ID NO:6)/hsa-miR-29a (SEQ ID NO:4).Especially expression of nucleic acid biomarker comprises a kind of nucleic acid molecule combination of coding hsa-miR-29a (SEQ ID NO:4), hsa-miR-27a (SEQ ID NO:3) and hsa-miR-34a (SEQ ID NO:6).

In order to the nucleic acid molecule biomarker of the coding miRNA sequence that stdn obtains, coding hsa-miR-24 (SEQ ID NO:8) the expression of nucleic acid molecule of stably express in lung tissue can be preferably used in.As the negative control of the nucleic acid molecule biomarker expression level of the coding miRNA sequence obtained, coding hsa-miR-122 (SEQ ID NO:9) the expression of nucleic acid molecule of not expressing in lung tissue can be preferably used in.

The above-mentioned miRNA nucleotide sequence related to lists in table 1.

table 1

miRNA	Sequence (5' → 3')
		Biomarker
hsa-miR-27a	uucacaguggcuaaguuccgc
		hsa-miR-29a	uagcaccaucugaaaucgguua
hsa-miR-34a	uggcagugucuuagcugguugu
		hsa-miR-375	uuuguucguucggcucgcguga
Contrast
		hsa-miR-24	uggcucaguucagcaggaacag
hsa-miR-122	uggagugugacaaugguguuug

All miRNA sequences disclosed herein have all been kept at (http://microrna.sanger.ac.uk/ in miRBase database; Also see Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).

Term " at least one nucleic acid " can be any subgroup of nucleic acid molecule multiform as used herein, that is: arbitrary, wantonly two, wantonly three, Ren Si, wantonly five, wantonly six, wantonly seven, wantonly eight, Ren Jiu, wantonly ten nucleic acid molecule by that analogy, each nucleic acid molecule encoding one is contained in the miRNA sequence of the expression of nucleic acid biomarker determined at this.

In second aspect, the present invention relates to the diagnostic kit of the molecule marker for the identification of one or more target mammalian cell showing prognosis of squamous cell lung cancer, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents expression of nucleic acid biomarker together, this biomarker is the indication that there is prognosis of squamous cell lung cancer.

In a more preferred embodiment, expression of nucleic acid biomarker comprises the nucleic acid molecule of one or more coding hsa-miR-205 (SEQ ID NO:1), hsa-miR-25 (SEQ ID NO:2), hsa-miR-29a (SEQID NO:4) and hsa-miR-375 (SEQ ID NO:7).

Especially preferredly be, compared with one or more compared with control cells, in one or more target cells, encoded by the raising expression of any one or multiple nucleic acids molecule of hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7) of hsa-miR-205 (SEQ ID NO:1), hsa-miR-25 (SEQ ID NO:2) is lowered.

In further preferred version, expression of nucleic acid biomarker comprises the Nucleic acid combinations of one or more coding hsa-miR-205 (SEQ ID NO:1)/hsa-miR-29a (SEQ ID NO:4), hsa-miR-25 (SEQID NO:2)/hsa-miR-29a (SEQ ID NO:4), hsa-miR-205 (SEQ IDNO:1)/hsa-miR-375 (SEQ ID NO:7), hsa-miR-25 (SEQ ID NO:2)/hsa-miR-375 (SEQ ID NO:7) arbitrarily.Especially expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-205 (SEQ ID NO:1), hsa-miR-25 (SEQ ID NO:2) and hsa-miR-29a (SEQ ID NO:4).

The above-mentioned miRNA nucleotide sequence related to lists in table 2.

table 2

miRNA	Sequence (5' → 3')
		Biomarker
hsa-miR-205	uccuucauuccaccggagucug
		hsa-miR-25	cauugcacuugucucggucuga
hsa-miR-29a	uagcaccaucugaaaucgguua
		hsa-miR-375	uuuguucguucggcucgcguga
Contrast
		hsa-miR-24	uggcucaguucagcaggaacag
hsa-miR-122	uggagugugacaaugguguuug

The all miRNA sequences disclosed at this have all been kept at (http://microrna.sanger.ac.uk/ in miRBase database; Also see Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).

In the third aspect, the present invention relates to the diagnostic kit of the molecule marker for the identification of one or more target mammalian cell showing small cell lung cancer, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents a kind of expression of nucleic acid biomarker together, this biomarker is the indication that there is small cell lung cancer.

The expression of nucleic acid biomarker limited herein can comprise at least five kinds of nucleic acid molecule.

In a further preferred embodiment, expression of nucleic acid biomarker comprises the nucleic acid molecule of one or more coding hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQID NO:4), hsa-miR-29b (SEQ ID NO:5) and hsa-miR-375 (SEQ ID NO:7).

Especially preferredly be, compared with one or more compared with control cells, in one or more target cells, hsa-miR-25 (SEQ ID NO:2) and hsa-miR-375 (SEQ ID NO:7) is raised, and the expression of one or more nucleic acid molecule any of the hsa-miR-27a that encodes (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQID NO:5) is lowered.

In further preferred embodiment, expression of nucleic acid biomarker comprises the Nucleic acid combinations of one or more coding hsa-miR-25 (SEQ ID NO:2)/hsa-miR-27a (SEQ ID NO:3) arbitrarily, hsa-miR-375 (SEQ ID NO:7)/hsa-miR-27a (SEQ ID NO:3), hsa-miR-25 (SEQ IDNO:2)/hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ IDNO:7)/hsa-miR-29a (SEQ ID NO:4).Especially expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7).

The above-mentioned miRNA nucleotide sequence related to lists in table 3.

table 3

miRNA	Sequence (5' → 3')
		Biomarker
hsa-miR-25	cauugcacuugucucggucuga
		hsa-miR-27a	uucacaguggcuaaguuccgc
hsa-miR-29a	uagcaccaucugaaaucgguua
		hsa-miR-29b	uagcaccauuugaaaucaguguu
hsa-miR-375	uuuguucguucggcucgcguga
		Contrast
hsa-miR-24	uggcucaguucagcaggaacag
		hsa-miR-122	uggagugugacaaugguguuug

In fourth aspect, the present invention relates to the diagnostic kit for differential diagnosis prognosis of squamous cell lung cancer and gland cancer lung cancer, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents expression of nucleic acid biomarker together, this biomarker is the indication that there is prognosis of squamous cell lung cancer or gland cancer lung cancer.

In a further preferred embodiment, expression of nucleic acid biomarker comprises the nucleic acid molecule of one or more coding hsa-miR-205 (SEQ ID NO:1), hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3) and hsa-miR-375 (SEQ ID NO:7).

Especially preferredly be, compared with one or more compared with control cells, in one or more target cells, hsa-miR-205 (SEQ ID NO:1), hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQID NO:3) are raised, and the expression of one or more nucleic acid molecule any of the hsa-miR-375 that encodes (SEQ ID NO:7) is lowered.

In further preferred embodiment, expression of nucleic acid biomarker comprises the Nucleic acid combinations of one or more coding hsa-miR-205 (SEQ ID NO:1)/hsa-miR-375 (SEQ ID NO:7) and hsa-miR-25 (SEQ ID NO:2)/hsa-miR-375 (SEQ ID NO:7) arbitrarily.Especially expression of nucleic acid biomarker comprises a kind of nucleic acid molecule combination of coding hsa-miR-205 (SEQ ID NO:1), hsa-miR-25 (SEQ ID NO:2) and hsa-miR-375 (SEQ ID NO:7).

The above-mentioned miRNA nucleotide sequence related to lists in table 4.

table 4

miRNA	Sequence (5' → 3')
		Biomarker
hsa-miR-205	uccuucauuccaccggagucug
		hsa-miR-25	cauugcacuugucucggucuga
hsa-miR-27a	uucacaguggcuaaguuccgc
		hsa-miR-375	uuuguucguucggcucgcguga
Contrast
		hsa-miR-24	uggcucaguucagcaggaacag
hsa-miR-122	uggagugugacaaugguguuug

In the 5th, the present invention relates to the diagnostic kit for differential diagnosis small cell lung cancer and gland cancer lung cancer, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents expression of nucleic acid biomarker together, this biomarker is the indication that there is small cell lung cancer or gland cancer lung cancer.

The expression of nucleic acid biomarker limited herein can comprise at least six kinds of nucleic acid molecule.

In a further preferred embodiment, expression of nucleic acid feature comprises the nucleic acid molecule of one or more coding hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQID NO:4), hsa-miR-29b (SEQ ID NO:5), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).

Especially preferredly be, compared with one or more compared with control cells, in one or more target cells, hsa-miR-25 (SEQ ID NO:2) and hsa-miR-375 (SEQ ID NO:7) is raised, and the hsa-miR-27a that encodes (SEQ ID NO:3), the expression of one or more nucleic acid molecule any of hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5) and hsa-miR-34a (SEQ ID NO:6) is lowered.

In further preferred embodiment, expression of nucleic acid biomarker comprises the Nucleic acid combinations of one or more coding hsa-miR-25 (SEQ ID NO:2)/hsa-miR-27a (SEQ ID NO:3) arbitrarily, hsa-miR-375 (SEQ ID NO:7)/hsa-miR-27a (SEQ ID NO:3), hsa-miR-25 (SEQ ID NO:2)/hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7)/hsa-miR-29a (SEQ ID NO:4).Especially expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-25 (SEQ ID NO:2), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).

The above-mentioned miRNA nucleotide sequence related to lists in table 5.

table 5

miRNA	Sequence (5' → 3')
		Biomarker
hsa-miR-25	cauugcacuugucucggucuga
		hsa-miR-27a	uucacaguggcuaaguuccgc
hsa-miR-29a	uagcaccaucugaaaucgguua
		hsa-miR-29b	uagcaccauuugaaaucaguguu
hsa-miR-34a	uggcagugucuuagcugguugu
		hsa-miR-375	uuuguucguucggcucgcguga
Contrast
		hsa-miR-24	uggcucaguucagcaggaacag
hsa-miR-122	uggagugugacaaugguguuug

In the 6th, the present invention relates to the diagnostic kit for differential diagnosis small cell lung cancer and prognosis of squamous cell lung cancer, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule encoding microrna sequences, wherein said multiple nucleic acids molecule one or more target cell and in one or more compared with control cells differential expression, and the nucleic acid molecule of one or more differential expressions wherein said represents a kind of expression of nucleic acid biomarker together, this biomarker is the indication that there is small cell lung cancer or prognosis of squamous cell lung cancer.

In a further preferred embodiment, expression of nucleic acid feature comprises the nucleic acid molecule of one or more coding hsa-miR-205 (SEQ ID NO:1), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQID NO:4), hsa-miR-29b (SEQ ID NO:5), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).

Especially preferredly be, compared with one or more compared with control cells, in one or more target cells, hsa-miR-375 (SEQ ID NO:7) is raised, and the expression of one or more nucleic acid molecule any of the hsa-miR-205 that encodes (SEQ ID NO:1), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQID NO:5) and hsa-miR-34a (SEQ ID NO:6) is lowered.

In further preferred embodiment, expression of nucleic acid biomarker comprises the Nucleic acid combinations of one or more coding hsa-miR-375 (SEQ ID NO:7)/hsa-miR-27a (SEQ ID NO:3), hsa-miR-375 (SEQ ID NO:7)/hsa-miR-29a (SEQ ID NO:4) arbitrarily.Especially, expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-29b (SEQ ID NO:5) and hsa-miR-375 (SEQ IDNO:7).

The above-mentioned miRNA nucleotide sequence related to lists in table 6.

table 6

miRNA	Sequence (5' → 3')
		Biomarker
hsa-miR-205	uccuucauuccaccggagucug

hsa-miR-27a	uucacaguggcuaaguuccgc
		hsa-miR-29a	uagcaccaucugaaaucgguua
hsa-miR-29b	uagcaccauuugaaaucaguguu
		hsa-miR-34a	uggcagugucuuagcugguugu
hsa-miR-375	uuuguucguucggcucgcguga
		Contrast
hsa-miR-24	uggcucaguucagcaggaacag
		hsa-miR-122	uggagugugacaaugguguuug

The all miRNA sequences disclosed herein have all been kept at (http://microrna.sanger.ac.uk/ in miRBase database; See also Griffiths-Jones S.et al. (2008) Nucl.Acids Res.36, D154-D158).

A () collects examination of living tissue or the surgical tissue of patient;

B () prepares tissue slice on slide glass;

Especially preferred, the method realizes with in situ hybridization.

In order to quantitative assay, use the miRNA biomarker of 7 empirical tests: hsa-miR-205 (SEQID NO:1), hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5), hsa-miR-34a (SEQID NO:6) and hsa-miR-375 (SEQ ID NO:7).

In order to the expression level that the described labeled nucleic acid molecule thing of standard code miRNA sequence obtains, preferably can use the expression of nucleic acid molecule of described coding hsa-miR-24 (SEQ ID NO:8), it is stably express in lung tissue.And for the negative control of expression level that the described labeled nucleic acid molecule thing of coding miRNA sequence obtains, preferably can use the expression of nucleic acid molecule of described coding hsa-122 (SEQ ID NO:9), it does not express in lung tissue.

Detected in karyomit(e), cell or tissue slice that hybridization in situ technique allows specific nucleic acid molecule to be morphologically saved.Binding immunoassay cytochemistry, in situ hybridization can connect the homogenic activity of microcosmic topology information at DNA, mRNA and protein level.There is the on-radiation hybridizing method of two types: direct method and indirect method.Direct method uses fluorescein or other fluorescein stains and Nucleotide direct-coupling (Baumann, J.G.J.et al. ((1980) Exp.Cell Res.138,485 – 490).Indirect method uses digoxigenin (passing through detection of specific antibody) and vitamin H (streptavidin detection) (Leary, J.L et al (1983) Proc.Natl.Acad.Sci.USA 80,4045 – 4049).

As used herein, term " nucleic acid molecule changing coding miRNA sequence is expressed " refers to and changes to cause the expression level of described molecule any manipulation of specific nucleic acid molecule, namely produces the different corresponding miRNA measured compared with the expression of " wild-type " (i.e. the contrast of unmodified).As used herein, term " different amount " had both comprised amount high compared with the contrast of unmodified, also comprised lower amount.In other words, handling as herein defined can be the expression (namely particularly transcribing) of raising (namely activating) or lowering (namely suppressing) nucleic acid molecule.

In the present invention, the expression of one or more nucleic acid molecule of the coding microrna sequences comprised in expression of nucleic acid feature is modified by this way, and it is expressed and to be lowered by the expression of the nucleic acid molecule raised in one or more target cells described and its expression is raised by the expression of the nucleic acid molecule lowered in one or more target cells described thus.In other words, the modification of expression of the specific nucleic acid molecule of coding miRNA sequence with the generation of the antimode pattern (anti-cyclical) with the regulating effect of described molecule in one or more cancer target cells described, to disturb by " overactivity " of molecule that raise in one or more target cells described and/or to recover by " defect is active " of the molecule lowered.

In a preferred embodiment of the inventive method, lower the expression of nucleic acid molecule and comprise coding is imported in one or more target cells with by the nucleic acid molecule of the sequence of the microrna sequences complementation of nucleic acid molecule encoding lowered.

Term as used herein " complementary sequence " refers to that " complementation " nucleic acid molecule (herein also referred to as " antisense nucleic acid molecule ") imported in one or more cells can form base pair, preferred Watson-Crick base pair with endogenous " having justice " nucleic acid molecule raised.

Two kinds of nucleic acid molecule (namely " having justice " and " antisense " molecule) can be complete complementaries, and namely it is containing any base mispairing and/or interpolation or deleted nucleotides.In other embodiments, these two kinds of molecules comprise one or more base mispairing or its total nucleotide number difference (owing to adding or lacking caused).In further embodiment, " complementation " nucleic acid molecule comprise one section with at least ten continuous nucleotides of sequence complete complementary of comprising in " having justice " nucleic acid molecule raised.

" complementation " nucleic acid molecule (i.e. the nucleic acid molecule of nucleotide sequence of coding and the microrna sequences complementation of the nucleic acid molecule encoding of downward) can be the nucleic acid molecule of the DNA-of natural generation or RNA molecule or the synthesis comprising one or more identical type or one or more dissimilar modified nucleotides in its sequence.

Such as, at least one ribonucleotide main chain unit and at least one deoxyribonucleotide main chain unit may be comprised by this nucleic acid molecule.In addition, described nucleic acid molecule can be 2'-O-methyl group or 2'-O-methoxy group (methylating also referred to as 2'-O-) containing one or more RNA backbone modifications, it prevents nuclease degradation in the medium, and be importantly also prevent the kernel of RNA inducibility silencing complex nuclease to be separated, cause the irreversible suppression of miRNA.Another possible modification (its function equivalence methylates in 2'-O-) comprises locked nucleic acid (LNA), the nucleic acid analog of representative containing one or more LNA nucleotide monomer, described monomer is simulated in sugared conformation at RNA has locking bifuran sugar unit (see such as Orom, U.A.et al. (2006) Gene 372,137-141).

Be developed recently another kind of miRNA expression silencing gene.The chemical engineering oligonucleotide that these are called " antagomirs " is the RNA molecule (Krutzfeldt, J.et al. (2005) Nature 438,685 – 689) of strand 23 Nucleotide puted together with cholesterol.As this chemically modified oligonucleotide another select, create as RNA produce from transgenosis can at the microRNA inhibitor of cells.These competitive inhibitors being called " microRNA sponge (microRNA sponges) " are the transcripts of expressing from strong promoter, multiple series combination site (Ebert containing interested microRNA, M.S.et al. (2007) Nat.Methods 4,721-726).

In order to any potential association of miRNA differentiated in sample before illustrating carcinous or cancer, the preparation function analysis of the discriminating about the combinable mRNA target sequence of described miRNA can be carried out.Based on discovery miRNA both can participate in tumor suppressor also can participate in tumour occur (Esquela-Kerscher, A.and Slack, F.J (2006) are as above; Calin, G.A.and Croce, C.M. (2007) are as above; Blenkiron, C.and Miska, E.A. (2007) are as above), can infer that the mRNA target site of this miRNA comprises tumor suppressor gene and oncogene.

If nucleic acid molecule comprises containing about transcribing and/or the sequential element of translational regulation information, and this sequence " operably connects " in the nucleotide sequence of coded polypeptide, then claim this nucleic acid molecule for " energy express nucleic acid molecule " or can " nucleotide sequence be expressed ".Operably connect is wherein said adjustment sequential element with the sequence be expressed (and/or mutual sequence expressed) so that the mode of genetic expression can be made to carry out the connection be connected.

For the definite character of the required regulatory region of genetic expression can be different in different plant species, but these regions all comprise promotor usually, in prokaryotic organism, it contains two promotors, namely instructs the DNA element of transcription initiation and sends the DNA element of translation initiation signal when being transcribed into RNA.This promoter region generally includes and participates in transcribing the 5' non-coding region with translation initiation, as-35/-10 the box in prokaryotic organism and Shine-Dalgarno element or the TATA box in eukaryotic cell, CAAT sequence and 5'-add cap element.These regions also can comprise enhanser or prevent sub-element and translation signals and leader sequence with by the specific compartment of natural polypeptides target in host cell.In addition, 3' non-coding sequence can containing the regulatory element participating in Transcription Termination, polyadenylation etc.But, if the function of these terminator sequences in specific host cell is unsatisfactory, then can be used in the signal playing function in this cell and replaces.

In addition, also can by such as there is the Nucleotide of modification and affecting (as mentioned above) in the expression of nucleic acid molecule as defined herein.Such as, locked nucleic acid (LNA) monomer is considered to by strengthening the resistance of degrading and the functional half-life (Naguibneva being increased miRNA in body by the stable miRNA-target duplex structure for silencing activity key, I.et al. (2006) Biomed.Pharmacother.60,633 – 638).

Therefore, the nucleic acid molecule of the present invention be imported in one or more cells provided can comprise adjustment sequence, and preferred promoter sequence, optionally also comprises transcription termination sequence.Described promotor can allow composing type or inducible gene expression.Suitable promoter comprises intestinal bacteria (E.coli) lacUV5 and tet (tsiklomitsin response) promotor, T7 promotor and SV40 promotor or CMV promoter.

Nucleic acid molecule of the present invention also can be included in carrier or other cloning vector as in plasmid, phagemid, phage, clay or artificial chromosome.In preferred embodiments, described nucleic acid molecule comprises in the carrier, is particularly included in expression vector.Can comprise except the nucleotide sequence of the genetic constructs that this expression vector defines as the present invention except above-mentioned adjustment sequence and coding and copy derived from the species with the host compatibility for expressing the selective marker can selecting phenotype with control sequence and the cell of giving transfection.Known in the art and commercially available many suitable carriers are as pSUPER and pSUPERIOR

Within the scope of the present invention, suitable pharmaceutical composition comprises those compositions being suitable for oral, rectum, nose, locally (comprise through containing clothes and sublingual), peritonaeum and parenteral (comprising intramuscular, subcutaneous or intravenously) and giving, or by sucking or be blown into those compositions given.Can local or general give.Give preferably by oral or intravenous route.Described preparation can be packaged as separate dosage units.

Pharmaceutical composition of the present invention comprises any pharmaceutical dosage forms that this area is determined; such as capsule, micro-capsule, cachet, pill, tablet, powder, pilule (pellet), many granular preparations (such as pearl, particle or crystal), aerosol, sprays, foam, solution, dispersion agent, tincture, syrup, elixir, suspension, water-in-oil emulsion are as ointment, and water external emulsion is as emulsion, lotion and face cream.

Above-mentioned (" having justice " and " antisense ") nucleic acid molecule can be formulated as pharmaceutical composition (Gennaro by the use acceptable composition of pharmacology and the preparation method set up; A.L.and Gennaro; A.R. (2000) Remington:The Science and Practice of Pharmacy; 20th Ed.; LippincottWilliams & Wilkins; Philadelphia, PA; Crowder, T.M.et al. (2003) A Guide toPharmaceutical Particulate Science.Interpharm/CRC, Boca Raton, FL; Niazi, S.K. (2004) Handbook of Pharmaceutical Manufacturing Formulations, CRCPress, Boca Raton, FL).

In order to pharmaceutical compositions, the inorganic of pharmaceutical inert or organic excipients (i.e. carrier) can be used.In order to preparation example is as pill, tablet, capsule or particle, such as lactose, talcum, stearic acid and salt thereof, fat, wax, solid or liquid polyol, natural oil or winterized stearin can be used.For the production of solution, suspension, milk sap, aerosol mixture or before the use reprovision be that the appropriate excipients of the powder of solution or aerosol mixture comprises water, alcohol, glycerine, polyvalent alcohol and suitable mixture thereof and vegetables oil.

Described pharmaceutical composition also can contain additive, as filling agent, bonding agent, moistening agent, glidant, stablizer, sanitas, emulsifying agent, and other solvent or solubilizing agent or realize the material of storage effect.The latter can be regarded as and nucleic acid molecule can be mixed in slowly-releasing or sustained release or targeted delivery system as in liposome, nano particle and micro-capsule.

In order to the great majority tissue in target body, need clinical feasible nothing wound strategy so that this pharmaceutical composition is as defined herein oriented to cell.In the past, certain methods by the siRNA of Rational Dosage is entered in mouse and primate bodies to have obtained great treatment benefit through intravenous injection, and without obvious limiting toxicity.

A kind of method comprises passerby's chain of miRNA (miRNA* chain) and cholesterol or derivatives thereof/conjugate covalent coupling to promote by time at the absorption (Soutschek of the cell surface LDL receptors of expressing, J.et al. (2004) Nature 432,173-178).Or the oligonucleotide (LNA-antimiR) that the locked nucleic acid of unconjugated PBS-preparation is modified may be used for general conveying (Elmen, J.et al. (2008) Nature 452,896-899).The method of another kind of conveying miRNA comprises use polyoxyethylene glycol makes miRNA capsulation become specific liposome to reduce the absorption of scavenger cell and to strengthen cycling time.MiRNA is delivered to liver and (and does not arrive other organ (see such as Zimmermann by these specific nucleic acid particle (stable nucleic acid-lipid particle or SNALP) effectively; T.S.et al. (2006) Nature 441,111-114)).In recent years, describe the agent delivery (Akinc of novel lipid sample delivery of molecules (synthesizing based on alkyl acrylate or alkyl-acrylamide and primary amine or the puting together addition of secondary amine) as RNAi therapeutical agent that a class is called lipoids (lipidoid), A.et al. (2008) Nat.Biotechnol.26,561-569).

Further cell-specific target strategy comprises and being mixed with a kind of fusion rotein by miRNA, this fusion rotein is made up of the targeting antibodies fragment be connected with protamine, described protamine makes DNA nucleation in sperm and by the basic protein (Song of charge bonded miRNA, E.et al. (2005) Nat.Biotechnol.23,709-717).Be developed recently multiple amendment and change that above-mentioned basic carrying method is carried out.These technology are known in the art, and summary is at such as de Fougerolles, A.et al. (2007) Nat.Rev.Drug Discov.6,443-453; In Kim, D.H.and Rossi, J.J. (2007) Nat.Genet.8,173-184.

The present invention is further described by accompanying drawing and following embodiment, and described drawings and Examples, just in order to the object of illustration special embodiment of the present invention, should not be construed as the meaning limiting the scope of the invention by any way.

Embodiment

embodiment 1: patient data

In discovery research, patients with lung cancer frozen tissue sample 125 example of filing during have collected Zhong Shan hospital 2007-2009.All patients have informed consent to participation scientific research.Collecting of tissue sample comments on council's approval according to agreement by upper marine mountain hospital associate.After being more than organized in operation in vitro, immediately with OCT embedding, using liquid nitrogen frozen section, and be stored in-80 ° of C with stand-by.Adjoin morphologic healthy tissues (distance cancerous tissue at least 10cm) from identical patients with lung cancer.These samples comprise 36 routine gland cancer lung cancer, 30 routine prognosis of squamous cell lung cancer and 16 routine small cell lung cancers and the corresponding healthy tissuess of 44 examples.

In checking research, have collected the cancerous lung tissue fixing paraffin embedding (FFPE) from 215 examples of filing during upper marine mountain hospital 2004-2008 through formalin.These FFPE tissue comprises 54 routine gland cancer lung cancer, 50 routine prognosis of squamous cell lung cancer and 56 routine small cell lung cancers and the corresponding healthy tissuess of 55 examples.Table-7 is referred at the foundation characteristic of the tumor specimen found and in checking research.

table 7: finding the characteristic of tissue sample in research and checking research

Tissue sample	Discovery group	Checking group
			Normal lung tissue	44	55
Lung cancer
			Gland cancer	36	54
Squama cancer	30	50
			Small cell lung cancer	16	56
Sum	126	215

Patient data (age, sex, image data, methods for the treatment of, other medical conditions, family history etc.) from hospital database for mating collected different samples.Pathology follow (such as by h and E (H & E) dye the histologic analysis carried out) is for the consistent classification of the morbid state (such as Normal group, gland cancer lung cancer, prognosis of squamous cell lung cancer or small cell lung cancer) and guarantee sample of clearly determining given sample.

embodiment 2: sample preparation

In discovery research, detection wind lidar is optionally carried out with specific isolation tumor cell group (about 200000 cells) to each cancer sample.In brief, transparent transfer film is applied to the surface of tissue slice or sample.Under the microscope, observe the thin tissue section be placed on slide glass, and identification of cell group is to be separated.When the cell selected is positioned at the center of field of view, activate the integrated microscope optics of near-infrared laser diode.Pulse laser beam activates the spot (spot) on transfer film, makes the cytogamy of this film and selection below.Then the transfer film with the cell of combination is peeled off from described thin tissue section and (summarize see such as Emmert-Buck, M.R.et al. (1996) .Science 274,998-1001; Espina, V.et al. (2007) Expert Rev.Mol.Diagn.7,647-657).Substantially prepare freezing microtome section as manufacturers instructions and use laser capture microscope (ArcturusVeritasTM Laser Capture Microdissection Instrument (Molecular Devices, Inc., Sunnyvale, CA, USA) carry out catching step.

In order to help the transformation from investigative research to clinical implementation, FFPE surgical tissue is for verifying research.Once FFPE tissue is selected to research and analyse, HE cuts into slices the ratio that will be prepared for checking in each sample shared by tumor section.If tumor group is woven with the neoplastic cell more than 75%, it will be considered to be suitable for analyzing and need not doing further tumour cell purifying again.If histology display tumour has the neoplastic cell lower than 75%, and so it will be selected and mark for doing micro-dissections.Except tumoral lesion, control tissue should apart from cancerous tissue at least 10cm.

Use mirVana ^tMmiRNA separating kit (Ambion, Inc., Austin, TX, USA) is separated total serum IgE according to manufacturers instructions.NanoDrop 1000 Spectrophotometer (NanoDropTechnologies, Waltham, MA) measures total rna concentration.The quality monitoring of RNA has then been come by 2100Bioanalyzer by RNA 6000Pico LabChip kit.

embodiment 3: microarray data

In discovery research, Agilent miRNA microarray platform (Agilent Technologies, Santa Clara, CA, USA) is used optionally to carry out qualitative analysis to the miRNA that (difference) in specific sample is expressed according to manufacturers instructions.This chip array takes from Sanger v.10.1 database, comprises the probe of 723 mankind miRNA.The total serum IgE (100ng) obtained in the lung tissue sample that 126 LCM cut, after Cy3 mark, and obtains signal through XDR Scan (PMT100, PMT5) scanning.The working method of mark and hybridization is all with reference to Agilent chip specification sheets.By the raw data normalization method of applying Quantile method and use GeneSpring GX10 software known in the art (Agilent Technologies, Santa Clara, CA, USA) will obtain for monochromatic (CY3) hybridization.

Independent experiment is carried out for each measurement, the mean value of each respective data that the miRNA expression level representative determined obtains.

Non-paired t-test after fisher test (F-test) for the identification of candidate miRNA marker optimum in gland cancer lung cancer, prognosis of squamous cell lung cancer or small cell lung cancer.MedCalc software is used to perform specificity and the susceptibility that Receiver operating curve (receive operating characteristic curve, ROC) analyzes the candidate miRNA to determine the biomarker as diagnostic value.95% credibility interval is used to determine significance.

Organize about the freezing excision in first aspect the array analysis design mothod data of 7 main candidate miRNA of intermediate energy region point gland cancer lung cancer and normal lung tissue to refer to and show-8.

table 8: the candidate miRNA biomarker that gland cancer lung cancer and normal lung tissue can be distinguished in excision frozen tissue

Organize intermediate energy region to divide the array analysis design mothod data of 7 main candidate miRNA of prognosis of squamous cell lung cancer and normal lung tissue to refer to about the freezing excision in second aspect and show-9.

table 9: the candidate miRNA biomarker that lung squamous cancer and normal lung tissue can be distinguished in excision frozen tissue

Organize intermediate energy region to divide the array analysis design mothod data of 7 main candidate miRNA of small cell lung cancer and normal lung tissue to refer to about the freezing excision in the third aspect and show-10.

table 10: the candidate miRNA biomarker that small cell lung cancer and normal lung tissue can be distinguished in excision frozen tissue

Divide the array analysis design mothod data of 7 main candidate miRNA of prognosis of squamous cell lung cancer and gland cancer lung cancer to refer to about the freezing operation resection organization intermediate energy region in fourth aspect and show-11.

table 11: the candidate miRNA biomarker that lung squamous cancer and gland cancer lung cancer can be distinguished in excision frozen tissue

Divide the array analysis design mothod data of 7 main candidate miRNA of small cell lung cancer and gland cancer lung cancer to refer to about the freezing operation resection organization intermediate energy region in the 5th and show-12.

table 12: the candidate miRNA biomarker that small cell lung cancer and gland cancer lung cancer can be distinguished in excision frozen tissue

Divide the array analysis design mothod data of 7 main candidate miRNA of small cell lung cancer and prognosis of squamous cell lung cancer to refer to about the freezing operation resection organization intermediate energy region in the 6th and show-13.

table 13: the candidate miRNA biomarker that small cell lung cancer and lung squamous cancer can be distinguished in excision frozen tissue

embodiment 4: the checking of microarray data in paraffin-embedded surgical tissue

For the miRNA expression data that checking obtains, use the real-time quantitative RT-PCR set up according to manufacturers instructions, it adopts TaqMan microRNA assay method (Applied Biosystems, Foster City, CA, USA).Hsa-miR-205 (SEQID NO:1) is demonstrated successively in 215 routine paraffin-embedded excision tissues, hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3), the expression (table 1) of hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5) hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).That carries out is used as standardized quality monitoring to the detection that tiny RNA U47 expresses simultaneously.Each experiment in triplicate.

Briefly, instruct according to Applied Biosystem, adopt Taqman microRNA RT test kit to carry out reverse transcription mensuration.The total serum IgE of 100ng is comprised 1X RT Buffer, 1X RT primer, in 15 microlitre RT mixed solutions of 1nM dNTP, 4U RNase inhibitor and 50U MultiScribe reversed transcriptive enzyme, carry out reverse transcription.Then these RT mixed solutions are placed on the upper reaction of PCR instrument (Thermal cycleralpha engine, Bio-rad), steering routine is as follows: 16 ° of C, 30 minutes; 42 ° of C, 30 minutes; 85 ° of C, 5 minutes.And adopt TaqMan Universal PCRMaster Mix test kit and Taqman microRNA to measure the mensuration that test kit carries out quantitative PCR according to the guidance of Applied Biosystem.

The RT product of 2 microlitres increases in 1X TaqMan Universal PCR Master Mix, NoAmpErase UNG, 1X TaqMan MicroRNA Assay mix.Roch LightCycling 480 instrument carries out real-time fluorescence quantitative PCR, and steering routine is as follows: 96 ° of C, 5 minutes initial heats; Then 40 or 50 circulations under 95 ° of C, 15 seconds; 60 ° of C, 60 seconds.Cp value is calculated through secondary derivatization method by LC480 software and obtains.The Cp value of last according to standard sample carries out absolute quantitation to miRNA.

Non-paired t-test after fisher test (F-test) for the identification of the differential expression of miRNA.MedCalc software is used to perform specificity and the susceptibility that Receiver operating curve (receive operatingcharacteristic curve, ROC) analyzes the candidate miRNA to determine the biomarker as diagnostic value.95% credibility interval is used to determine significance.

Organize about the paraffin-embedded excision in first aspect the experimental data of the candidate miRNA of 4 empirical tests of intermediate energy region point gland cancer lung cancer and lung healthy tissues to refer to and show-14.Wherein preferred hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4) and hsa-miR-34a (SEQ ID NO:6) mark with runic.

table 14: the checking miRNA biomarker that lung squamous cancer and normal lung tissue can be distinguished in excision paraffin organization

Organize intermediate energy region to divide the experimental data of the candidate miRNA of 4 empirical tests of prognosis of squamous cell lung cancer and lung healthy tissues to refer to about the paraffin-embedded excision in second aspect and show-15.Preferred hsa-miR-205 (SEQ ID NO:1), hsa-miR-25 (SEQ ID NO:2) and hsa-miR-29a (SEQ ID NO:3) mark with runic.

table 15: the checking miRNA biomarker that small cell lung cancer and normal lung tissue can be distinguished in excision paraffin organization

Organize intermediate energy region to divide the experimental data of the candidate miRNA of 5 empirical tests of small cell lung cancer and lung healthy tissues to refer to about the paraffin-embedded excision in the third aspect and show-16.Preferred hsa-miR-29a (SEQ ID NO:3) and hsa-miR-375 (SEQ ID NO:7) marks with runic.

table 16: the checking miRNA biomarker that small cell lung cancer and normal lung tissue can be distinguished in excision paraffin organization

Organize intermediate energy region to divide the experimental data of the candidate miRNA of 4 empirical tests of prognosis of squamous cell lung cancer and gland cancer lung cancer to refer to about the paraffin-embedded excision in fourth aspect and show-17.Preferred hsa-miR-205 (SEQ ID NO:1), hsa-miR-25 (SEQ ID NO:2) and hsa-miR-375 (SEQ ID NO:7) mark with runic.

table 17: the checking miRNA biomarker that lung squamous cancer and gland cancer lung cancer can be distinguished in excision paraffin organization

Organize intermediate energy region to divide the experimental data of the candidate miRNA of 5 empirical tests of small cell lung cancer and gland cancer lung cancer to refer to about the paraffin-embedded excision in the 5th and show-18.Preferred hsa-miR-205 (SEQ ID NO:1), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7) mark with runic.

table 18: the checking miRNA biomarker that small cell lung cancer and gland cancer lung cancer can be distinguished in excision paraffin organization

Organize intermediate energy region to divide the experimental data of the candidate miRNA of 5 empirical tests of small cell lung cancer and prognosis of squamous cell lung cancer to refer to about the paraffin-embedded excision in the 6th and show-19.Preferred hsa-miR-205 (SEQ ID NO:1), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7) mark with runic.

table 19: the checking miRNA biomarker that small cell lung cancer and lung squamous cancer can be distinguished in excision paraffin organization

The result obtained confirms that the high specific that miRNA expresses in lung cancer regulates.Therefore, the corresponding Asia collection of miRNA as herein described represents unique miRNA expression characteristic, for the expression pattern analysis of lung cancer, it not only makes it possible to differentiate carcinogenesis state (cancerogenous state) itself, and makes it possible to distinguish dissimilar lung tumor.

embodiment 5: the method quantizing miRNA biomarker

(Agilent Technologies is measured by using TaqMan microRNA, Santa Clara, CA, USA) real-time quantitative RT-PCR, optionally quantitative analysis is carried out to the miRNA marker that (difference) in specific sample is expressed according to manufacturers instructions.

Particularly preferably, the quantitative of described miRNA biomarker realizes (Fig. 1) by situ hybridization.Described method is as follows:

A () collects examination of living tissue or the surgical tissue of patient;

B () prepares tissue slice on slide glass;

D () under the microscope or carry out quantitatively by digital pathology answer method to the expression of miRNA;

E () determines multiple nucleic acids developed by molecule level in one or more described target cells, often kind of nucleic acid molecule is all encoded miRNA sequence;

G respective expression level that () is obtained in step (e) and (f) by contrast, one or more nucleic acid molecule of differential expression in target cell and compared with control cells are identified from described multiple nucleic acids molecule, the nucleic acid molecule of one or more differential expressions wherein said represents expression of nucleic acid feature as defined herein together, and it is the indication that there is gland cancer lung cancer, prognosis of squamous cell lung cancer or small cell lung cancer.

For the expression level that the described labeled nucleic acid molecule thing of standard code miRNA sequence obtains, the expression of nucleic acid molecule of described coding hsa-miR-24 (SEQ ID NO:8) may preferably, and it is stably express in colorectal carcinoma.And for the negative control of expression level that the described labeled nucleic acid molecule thing of coding miRNA sequence obtains, the expression of nucleic acid molecule of described coding hsa-122 (SEQ ID NO:9) may preferably, and it does not express in colorectal carcinoma.

Probe for hybridizing is that hybridization is comprising of target miRNA of 30 residues by comprehensive infinite sequence (GGGGGTCCTATATGGCTCCACTTCTCCCCC).Described residue sequence runic marks.Probe is marked on a fluorescent group at 5 ' end.Single or multiple probe and independent fluorescence dye can parallel blot.Provide in table-20 for the probe sequence of in situ hybridization in the present invention.

Described residue 5 ' hairpin structure (GGGGG-CCCCC to) is in order to the hybridization that is stabilized between probe and target miRNA and improve hybrid specificities.In position in hybridization, same principle can be used for designing the probe of other miRNA markers.

table 20: in situ hybridization probe

Illustrate in this article the present invention of describing can suitably do not exist herein special disclose any element, restriction condition under carry out.Therefore, such as term " comprises ", " comprising " " to contain " etc. and should have broad sense and unrestricted.In addition; the term applied herein and express for describing the present invention and unrestricted meaning; and do not use these terms and express and get rid of any characteristic sum shown in it and describe or the meaning of Equivalent of its part, but should recognize can carry out various amendment in the scope of the invention of request protection.Therefore, although should understand the special announcement carried out the present invention by embodiment and optional feature, those skilled in the art can modify to the present invention and change, and this amendment and change are thought within the scope of the invention.

Extensively and briefly describe the present invention herein.The upper set of each narrower subordinate concept and Asia fallen within the scope of upper description also constitutes a part of the present invention.This comprises uses conditioned disjunction from the negative restriction of any theme of upper middle removing to upper description of the present invention, and no matter whether removed theme is quoted from this article especially.

Other embodiment is in following right.In addition, when feature of the present invention or all respects Ma Kushi prescription formula describe, those skilled in the art can recognize that the present invention is also described with each member any of Ma Kushi group or member's subgroup mode.

Claims

1. for the identification of the diagnostic kit of molecule marker of one or more target mammalian cell showing lung cancer, described test kit comprises multiple nucleic acids molecule, often kind of nucleic acid molecule is all encoded microrna sequences, one or more differential expressions in described target cell and in one or more compared with control cells of wherein said multiple nucleic acids molecule, and the nucleic acid molecule of one or more differential expressions wherein said represents expression of nucleic acid biomarker together, described expression of nucleic acid biomarker is lung cancer, and/or the indication that different subtype lung cancer exists, wherein different lung cancer is by gland cancer lung cancer, prognosis of squamous cell lung cancer or small cell lung cancer formed,

When described lung cancer is gland cancer lung cancer, wherein said expression of nucleic acid biomarker comprises any one or the multiple nucleic acids combination of coding hsa-miR-34a/hsa-miR-27a and hsa-miR-34a/hsa-miR-29a;

When described lung cancer is prognosis of squamous cell lung cancer, wherein said expression of nucleic acid biomarker comprises any one or the multiple nucleic acids combination of coding hsa-miR-205/hsa-miR-29a, hsa-miR-25/hsa-miR-29a, hsa-miR-205/hsa-miR-375, hsa-miR-25/hsa-miR-375;

When described lung cancer is small cell lung cancer, wherein said expression of nucleic acid biomarker comprises any one or the multiple nucleic acids combination of coding hsa-miR-25/hsa-miR-27a, hsa-miR-375/hsa-miR-27a, hsa-miR-25/hsa-miR-29a and hsa-miR-375/hsa-miR-29a.

2. the test kit of claim 1, wherein said lung cancer is gland cancer lung cancer.

3. the test kit of claim 2, wherein said expression of nucleic acid biomarker comprises at least four kinds of nucleic acid molecule.

4. the test kit of claim 2, wherein in one or more target cells described compared with in one or more normal control cells described, the expression of hsa-miR-34a is raised, and the expression of any one or the multiple nucleic acids molecule of hsa-miR-27a and hsa-miR-29a that encode is lowered.

5. the test kit of claim 2, wherein said expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-29a, hsa-miR-27a and hsa-miR-34a.

6. the test kit of claim 1, wherein said lung cancer is prognosis of squamous cell lung cancer.

7. the test kit of claim 6, wherein said expression of nucleic acid biomarker comprises at least four kinds of nucleic acid molecule.

8. the test kit of claim 6, wherein in one or more target cells described compared with in one or more normal control cells described, the expression of hsa-miR-205 and hsa-miR-25 is raised, and the expression of any one or the multiple nucleic acids molecule of hsa-miR-29a and hsa-miR-375 that encode is lowered.

9. the test kit of claim 6, wherein said expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-205, hsa-miR-25 and hsa-miR-29a.

10. the test kit of claim 1, wherein said lung cancer is small cell lung cancer.

The test kit of 11. claims 10, wherein said expression of nucleic acid biomarker comprises at least five kinds of nucleic acid molecule.

The test kit of 12. claims 10, wherein in one or more target cells described compared with in one or more normal control cells described, the expression of hsa-miR-25 and hsa-miR-375 is raised, and the expression of any one or the multiple nucleic acids molecule of encode hsa-miR-27a, hsa-miR-29a is lowered.

The test kit of 13. claims 10, wherein said expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-29a and hsa-miR-375.

The test kit of 14. any one of claim 1-13, is further used for prognosis of squamous cell lung cancer and gland cancer lung cancer to differentiate.

The test kit of 15. claims 14, wherein said expression of nucleic acid biomarker comprises at least four kinds of nucleic acid molecule.

The test kit of 16. claims 14, wherein said expression of nucleic acid biomarker comprises the nucleic acid molecule of at least one coding microrna sequences, and its expression is raised in one or more target cells compared with in one or more compared with control cells; And comprising the nucleic acid molecule of at least one coding microrna sequences, its expression is lowered in one or more target cells compared with in one or more compared with control cells.

The test kit of 17. claims 14, wherein said expression of nucleic acid biomarker comprises any one or the multiple nucleic acids molecule of coding hsa-miR-205, hsa-miR-25, hsa-miR-27a and hsa-miR-375.

The test kit of 18. claims 17, wherein in one or more target cells described compared with in one or more compared with control cells described, the expression of hsa-miR-205, hsa-miR-25 and hsa-miR-27a is raised, and the expression of a kind of nucleic acid molecule of the hsa-miR-375 that encodes is lowered.

The test kit of 19. claims 17, wherein said expression of nucleic acid biomarker comprises any one or the multiple nucleic acids combination of coding hsa-miR-205/hsa-miR-375 and hsa-miR-25/hsa-miR-375.

The test kit of 20. claims 17, wherein said expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-205, hsa-miR-25 and hsa-miR-375.

The test kit of 21. any one of claim 1-13, is further used for small cell lung cancer and gland cancer lung cancer to differentiate.

The test kit of 22. claims 21, wherein said expression of nucleic acid biomarker comprises at least six kinds of nucleic acid molecule.

The test kit of 23. claims 21, wherein said expression of nucleic acid biomarker comprises the nucleic acid molecule of at least one coding microrna sequences, and its expression is raised in one or more target cells compared with in one or more compared with control cells; And comprising the nucleic acid molecule of at least one coding microrna sequences, its expression is lowered in one or more target cells compared with in one or more compared with control cells.

The test kit of 24. claims 21, wherein said expression of nucleic acid biomarker comprises any one or the multiple nucleic acids molecule of coding hsa-miR-25, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.

The test kit of 25. claims 24, wherein in one or more target cells described compared with in one or more compared with control cells described, the expression of hsa-miR-25 and hsa-miR-375 is raised, and the expression of any one or the multiple nucleic acids molecule of encode hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-34a is lowered.

The test kit of 26. claims 21, wherein said expression of nucleic acid biomarker comprises any one or the multiple nucleic acids combination of coding hsa-miR-25/hsa-miR-27a, hsa-miR-375/hsa-miR-27a, hsa-miR-25/hsa-miR-29a and hsa-miR-375/hsa-miR-29a.

The test kit of 27. claims 21, wherein said expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-25, hsa-miR-34a and hsa-miR-375.

The test kit of 28. any one of claim 1-13, is further used for small cell lung cancer and prognosis of squamous cell lung cancer to differentiate.

The test kit of 29. claims 28, wherein said expression of nucleic acid biomarker comprises at least six kinds of nucleic acid molecule.

The test kit of 30. claims 28, wherein said expression of nucleic acid biomarker comprises the nucleic acid molecule of at least one coding microrna sequences, and its expression is raised in one or more target cells compared with in one or more compared with control cells; And comprising the nucleic acid molecule of at least one coding microrna sequences, its expression is lowered in one or more target cells compared with in one or more compared with control cells.

The test kit of 31. claims 28, wherein said expression of nucleic acid biomarker comprises any one or the multiple nucleic acids molecule of coding hsa-miR-205, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.

The test kit of 32. claims 31, wherein in one or more target cells described compared with in one or more compared with control cells, the expression of hsa-miR-375 is raised, and the expression of any one or the multiple nucleic acids molecule of encode hsa-miR-205, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-34a is lowered.

The test kit of 33. claims 31, wherein said expression of nucleic acid biomarker comprises any one or the multiple nucleic acids combination of coding hsa-miR-375/hsa-miR-27a and hsa-miR-375/hsa-miR-29a.

The test kit of 34. claims 31, wherein said expression of nucleic acid biomarker comprises a kind of Nucleic acid combinations of coding hsa-miR-29b and hsa-miR-375.

35. for the pharmaceutical composition preventing and/or treating lung cancer in one or more target mammalian cell, described composition comprises one or more nucleic acid molecule, often kind of equal encoding sequence of nucleic acid molecule, described sequence with as any one of 1-34 define as described in it is expressed coded by the nucleic acid molecule that raises in one or more target cells microrna sequences complementary at least partly, and/or described sequence correspond to as any one of claim 1-34 define as described in the microrna sequences of its expression coded by the nucleic acid molecule lowered in one or more target cells.

The pharmaceutical composition of 36. claims 35 is preparing the purposes prevented and/or treated in the medicine of lung cancer.