CN102690826B - shRNA for specifically reducing human Aurora-A gene expression and application thereof - Google Patents
shRNA for specifically reducing human Aurora-A gene expression and application thereof Download PDFInfo
- Publication number
- CN102690826B CN102690826B CN201210115006.4A CN201210115006A CN102690826B CN 102690826 B CN102690826 B CN 102690826B CN 201210115006 A CN201210115006 A CN 201210115006A CN 102690826 B CN102690826 B CN 102690826B
- Authority
- CN
- China
- Prior art keywords
- shrna
- aurora
- seqidno
- seq
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to the field of molecular genetics and biomedicines, in particular to a shRNA for specifically reducing human Aurora-A gene expression and application of the shRNA. The invention provides hairpin interference RNA (ribonucleic acid) for specifically reducing human Aurora-A gene expression, shown by SEQIDNO. 1; an aimed target sequence is the 995th-1015th bit of human Aurora-AmRNA, shown by SEQIDNO. 2; the shRNA can be sheared in vivo or in vitro to form siRNA shown by SEQIDNO. 4 and SEQIDNO. 5; the invention further provides a DNA (deoxyribonucleic acid) oligonucleotide chain for coading the shRNA, shown by SEQIDNO. 3, and a plasmid including the DNA oligonucleotide chain shown by SEQIDNO. 3. According to the invention, after medicines of Aurora-A-shRNA interference carriers transfect human esophageal cancer cells EC9706, an mRNA transcriptional level and a protein expression level of Aurora-A genes in cells are significantly reduced so as to significantly reduce invasiveness of esophageal cancer cells and prompt apoptosis of esophageal cancer cells irradiated and induced by UV (ultra violet), thereby overcoming the defect that the siRNA chemically synthetized in vitro has short acting time, and providing a new way for developing novel antitumor drugs.
Description
Technical field
The present invention relates to molecular genetics and biological medicine technology field, be specially shRNA and application thereof that a species specificity reduces people Aurora-A genetic expression.
Background technology
RNA perturbation technique (RNAi) refers to that double-stranded RNA brings out specifically with its homologous sequence mRNA molecule and is degraded, causes the phenomenon of corresponding gene expression inhibiting.In the synthetic or cell of artificial chemistry, transcribe little double-stranded RNA (the small interfering RNA of generation, siRNA) enter after cell, energy and with it the target gene mRNA combination of complementation, degrade mRNA thereby mediate specific nickase, reaches the object that reduces destination gene expression.
At present, although the siRNA of external chemosynthesis can cause expression of target gene, reduce, its effect is relatively of short duration.For gene is carried out to long-acting inhibition, many Mammals plasmid expression vectors have been used as research tool, instruct synthetic siRNA in cell.These carriers comprise dependenc RNA polymerase-III U6 or H1 promotor, by a clear and definite transcripting start point and a transcription termination signal (T5) being comprised of continuous 5 thymus pyrimidines.Wherein, to derive from a segment length of target gene mRNA be the unique sequences of 19～21 bases to a pair of specific oligonucleotide.When by forward and the annealing of reverse DNA oligonucleotide, and while being cloned between two restriction endonuclease sites of carrier, forward DNA oligonucleotide will correctly be positioned the downstream of U6 promotor.The transcription product of recombinant vectors is hair clip type RNA(small hairpin RNA, shRNA) can self fold pairing formation stem length is stem ring (Stem-loop) structure of 19～21 bases, and the precursor of this loop-stem structure is cut very soon the siRNA that is formed with function in cell.The shRNA of this vector expression has the advantages that through shearing the siRNA forming expression amount is stable, the time length is long, thereby can cause the long-acting inhibition that target gene is expressed.
Aurora-A is the mitotic serine/threonine kinase of a kind of participation, its biological action is mainly by regulating the function of centrosome and microtubule, guarantee the correct separation of centrosome and complete division [the Bischoff JR of endochylema, Plowman GD. The Aurora/Ipl1p kinase family:regulators of chromosome segregation and cytokinesis. Trends Cell Biol, 1999,9 (11): 454-459.].In recent years, why Aurora-A receives much attention, and is because it is close with being related of many tumours, is a kind of potential oncogene.For example, at mammary cancer [Zhou H, Kuang J, Zhong L, et al. Tumour amplified kinase STK15/BTAK induces centrosome amplification, aneuploidy and transformation. Nat Genet, 1998, 20 (2): 189-193.], liver cancer [Jeng YM, Peng SY, Lin CY, et al. Overexpression and amplification of Aurora-A in hepatocellular carcinoma. Clin Cancer Res, 2004, 10 (6): 2065-2071.], colorectal carcinoma [Bischoff JR, Anderson L, Zhu Y, et al. A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectal cancers. EMBO J, 1998, 17 (11): 3052-3065.], bladder cancer [Sen S, Zhou H, Zhang RD, et al. Amplification/overexpression of a mitotic kinase gene in human bladder cancer. J Natl Cancer Inst, 2002, 94 (17): 1320-1329.] and the esophageal carcinoma [Tong T, Zhong Y, Kong J, et al. Overexpression of Aurora-A contributes to malignant development of human esophageal squamous cell carcinoma. Clin Cancer Res, 2004, 10 (21): 7304-7310. Tanaka E, Hashimoto Y, Ito T, et al. The clinical significance of Aurora-A/STK15/BTAK expression in human esophageal squamous cell carcinoma. Clin Cancer Res, 2005, 11 (5): 1827-1834.] etc. in tumour, all finding that there is crossing of Aurora-A expresses.Aurora-A abnormal expression is not only closely related with the generation of tumour, and also has dependency significantly with invasion and attack and the transfer of tumour.For example, in bladder cancer, liver cancer [Jeng YM, Peng SY, Lin CY, et al. Overexpression and amplification of Aurora-A in hepatocellular carcinoma. Clin Cancer Res, 2004, 10 (6): 2065-2071. Sen S, Zhou H, Zhang RD, et al. Amplification/overexpression of a mitotic kinase gene in human bladder cancer. J Natl Cancer Inst, 2002, 94 (17): 1320-1329.] in, the expression level of Aurora-A with organize classification, invasion and attack and the rate of transform are proportionate, and relevant to patient's prognosis, in esophageal squamous cell carcinoma, histological grade and the Invasion Potential of Aurora-A expression level and tumour are proportionate, and relevant to distant place nodus lymphoideus transferring rate, but also can be used as an individual index [Tong T who judges patient's prognosis, Zhong Y, Kong J, et al. Overexpression of Aurora-A contributes to malignant development of human esophageal squamous cell carcinoma. Clin Cancer Res, 2004, 10 (21): 7304-7310. Tanaka E, Hashimoto Y, Ito T, et al. The clinical significance of Aurora-A/STK15/BTAK expression in human esophageal squamous cell carcinoma. Clin Cancer Res, 2005, 11 (5): 1827-1834.].Explanation thus, Aurora-A plays vital effect in the developing of tumour.Therefore, Aurora-A gene likely becomes one of Effective target site for the treatment of tumor development.
As everyone knows, the sickness rate of China's esophageal carcinoma ranks first in the world at present, and especially take the some areas in Hebei, Henan and Shanxi of Taihang Mountain periphery is district occurred frequently.Although excision and postoperative chemicotherapy make patient's survival rate obtain larger raising, overall prognosis is still pessimistic, and the major cause that causes patient death is recurrence and the transfer of tumour.Therefore, the newtype drug of the development treatment esophageal carcinoma has important economic worth and social benefit, and adopts RNA perturbation technique likely to become one of effective way of the treatment esophageal carcinoma.
Summary of the invention
The object of the present invention is to provide a species specificity to reduce shRNA and the application thereof of people Aurora-A genetic expression.
The present invention adopts following technical scheme to realize: a species specificity reduces the shRNA of people Aurora-A genetic expression, and its base sequence is as shown in SEQ ID NO.1,
5’-GCACCACUUGGAACAGUUUAUUUCAAGAGAAUAAACUGUUCCAAGUGGUGC-3’。
This shRNA can be applicable to treat in the medicine of the esophageal carcinoma.
The invention provides a kind of hair clip type RNA interfering (Aurora-A-shRNA) that can specificity reduces people Aurora-A genetic expression, as shown in SEQ ID NO.1, for 995th～1015 of target sequence behaviour Aurora-A mRNA, as shown in SEQ ID NO.2, this shRNA in vivo or the external siRNA forming containing as shown in SEQ ID NO.4 and SEQ ID NO.5 that shears; The present invention also provides the DNA oligonucleotide chain of this shRNA that encodes, as shown in SEQ ID NO.3, and the plasmid that comprises the DNA oligonucleotide chain as shown in SEQ ID NO.3, utilize this plasmid can be directly in vivo or external generation Aurora-A-shRNA.And the present invention has also proved that utilization is containing after the medicine transient transfection human esophagus cancer EC9706 cell of Aurora-A-shRNA interference carrier, in cell, the mRNA transcriptional level of Aurora-A gene obviously reduces, protein expression level obviously reduces, the invasive ability of esophageal cancer cell is significantly reduced, and can promote the esophageal cancer cell apoptosis of UV radiation-induced.
In a word, the present invention utilizes RNA perturbation technique, successfully obtains the shRNA for people Aurora-A gene; Take this sequence can stablize lasting inhibition Aurora-A mRNA and protein expression level as basic carrier for expression of eukaryon in cell, has overcome of short duration shortcoming siRNA action time of external chemosynthesis; Take the esophageal cancer cell apoptosis that this sequence can effectively suppress the invasion and attack of esophageal cancer cell and promote UV radiation-induced as basic carrier for expression of eukaryon in cell, therefore, for the exploitation of new type antineoplastic medicine provides new way.
Accompanying drawing explanation
Fig. 1 is the characteristic pattern of rna interference vector of the present invention;
Fig. 2 observes EC9706 cytological map (* 100) under simple microscope after transfection;
Fig. 3 is fluorescence Microscopic observation EC9706 cell Green fluorescent protein expression figure (* 100) after transfection;
Fig. 4 is the RT-PCR result figure of Aurora-A mrna expression in EC9706 cell after transfection;
Fig. 5 is the Western blot result figure of Aurora-A protein expression in EC9706 cell after transfection;
Fig. 6 is control group Transwell Matrigel result figure (* 100) after transfection;
Fig. 7 is experimental group Transwell Matrigel result figure (* 100) after transfection;
Fig. 8 is Transwell Matrigel result statistical graph after transfection;
Fig. 9 is the cellular control unit DAPI colored graph (* 200) of UV radiation-induced after transfection;
Figure 10 is the experimental group cell DAPI colored graph (* 200) of UV radiation-induced after transfection.
Embodiment
Following examples are only not used in and limit the scope of the invention for the present invention is described, the experimental technique of unreceipted actual conditions in the following example, conventionally according to normal condition or the condition of advising according to production firm.
Embodiment 1:
Can reduce the design of the shRNA of people Aurora-A genetic expression
According to the mRNA base sequence of people Aurora-A gene in ncbi database (GeneBank numbers NM_003600.2), the siRNA tool software providing on Internet by siDirect company (siDirect version 2.0) is selected target sequence, 995th～1015 of target sequence behaviour Aurora-A mRNA, as shown in SEQ ID NO.2, i.e. 5 '-GCACCACUUGGAACAGUUUAU-3 '
According to the corresponding shRNA sequence of target sequence design, be:
SEQ ID NO.1：5’-GCACCACUUGGAACAGUUUAUUUCAAGAGAAUAAACUGUUCCAAGUGGUGC-3’
The DNA sequence dna of coding shRNA is:
SEQ ID NO.3：5’-GCACCACTTGGAACAGTTTATTTCAAGAGAATAAACTGTTCCAAGTGGTGC-3’
This shRNA sequence is in vivo or external siRNA positive-sense strand and the antisense strand forming containing as shown in SEQ ID NO.4 and SEQ ID NO.5 of shearing:
SEQ ID NO.4: positive-sense strand is 5 '-GCACCACUUGGAACAGUUUAU-3 ',
SEQ ID NO.5: antisense strand is 5 '-AUAAACUGUUCCAAGUGGUGC-3 '.
Embodiment 2:
Can reduce the structure of the shRNA interference carrier of people Aurora-A genetic expression
According to above sequence, by Shanghai Ji Ma company limited, by chemical synthesis, synthesize the DNA shown in SEQ ID NO:3, and at two ends, add the restriction enzyme site of BamH I and Bbs I.DNA oligonucleotide is dissolved in the water of sterilizing, nuclease free, final concentration is 3mg/mL.Annealing reaction is by the annealing buffer of the forward of each 1mL and reverse DNA oligonucleotide and 48ml (10mM Tris, pH 7.5-8.0,50mM NaCl, 1mM EDTA) mix, at 90 ℃ of incubation 4min, 70 ℃ of incubation 10min, slowly oligonucleotide to 10 of cooling annealing ℃.Annealing product is carried out to double digestion with empty pGPU6/GFP/Neo plasmid (Shanghai Ji Ma company limited provides), adopt DNA purification kit purifying enzyme to cut product, respectively get T4 DNA ligases connections for 2 μ L.The pGPU6/GFP/Neo carrier of restructuring is transformed to the agarose plate that contains penbritin, picking positive colony, determines in recombinant plasmid, whether to insert correct sequence by order-checking.
As shown in Figure 1, wherein shDNA represents code book invention sequence shRNA(SEQ ID NO.1 to plasmid feature) DNA sequence dna (SEQ ID NO.3).Order-checking confirms that insertion sequence is entirely true.
Embodiment 3:
Preparation containing people Aurora-A-shRNA interference carrier medicine
8 μ g plasmids are diluted in to 500 μ L without in substratum, mix gently.Get Lipofectamine 2 000 (liposome mediated-method) 8 μ L and be diluted in 500 μ L serum free mediums, mix incubated at room 5min.The liposome of dilution is mixed to incubated at room 20min with the plasmid DNA of dilution.
Embodiment 4:
Utilize the medicine transient transfection human esophagus cancer EC9706 cell containing people Aurora-A-shRNA interference carrier
Get the cell that growth conditions is good, in transfection, the day before yesterday cell is inoculated in culture dish, during transfection, cell density reaches 70% left and right.The prepared medicine of embodiment 3 is added in culture dish, add serum free medium to 2mL, mix gently.After 6h, add the RPMI 1640 substratum 2mL containing 20%, after 24h, discard former substratum, change RPMI 1640 substratum containing 10%.After 48h, collecting cell is identified.
Embodiment 5:
The expression of micro-Microscopic observation EC9706 cell Green fluorescin after transfection
On carrier, with GFP gene, expressing green fluorescent protein, is beneficial to the transfection efficiency of observing containing the medicine of recombinant vectors.Result demonstration, along with the prolongation of transfection time, green fluorescence increases enhancing gradually.Under the same visual field white light (Fig. 2) and fluoroscope, the expression of (Fig. 3) paired observation cell Green fluorescin, draws as calculated when 48h, and the transfection efficiency that contains the medicine of people Aurora-A-shRNA interference carrier is about 50-60%.
Embodiment 6:
After transfection, semi-quantitative RT-PCR detects the interference effect to Aurora-A mrna expression
After transfection 48h, with Trizol reagent extracting cell total rna, get RNA 7.5 μ g, random hexamers (500 μ g/mL) 2 μ L, 10mM dNTP mix 1 μ l, adds DEPC water to 10 μ L, mixes rear 65 ℃ of effect 5min; Be placed in 3-5min on ice, add 10 * RT buffer, 2 μ l, 25 mmol/L MgCl
24 μ l, 0.1mol/L DTT 2 μ l, mix rear 25 ℃ of effect 2min; In every pipe, add SuperscriptII
tMreversed transcriptive enzyme 1 μ l, mixes, and 25 ℃ act on 10min successively, 42 ℃ of effect 90min, and 70 ℃ of effect 15min, reverse transcription becomes cDNA.Take cDNA as template again, PCR amplification Aurora-A gene, upstream primer is: 5 '-AATGATTGAAGGTCGGATGC-3 '; Downstream primer is: 5 '-TTCTCTGAGCATTGGCCTCT-3 '.Take house-keeping gene GAPDH as internal reference, and upstream primer is: 5 '-GCTGAGAACGGGAAGCTTGT-3 '; Downstream: 5 '-GCCAGGGGTGCTAAGCAGTT-3 '.Primer is synthetic by the precious biotech firm in Dalian.PCR reaction system is as follows:
| Component | Volume (μ L) |
| 10×PCR Buffer | 2.5 |
| MgCl 2 | 1 |
| dNTP (5 mmol/L) | 2 |
| Taq archaeal dna polymerase | 0.25 |
| CDNA template | 1 |
| Goal gene up/down trip primer (10 mmol/L) | 2 |
| GAPDH primer | 1 |
| Deionized water | 15.25 |
| Cumulative volume | 25 |
Reaction conditions is: 94 ℃ of 30 s, 58 ℃ of 30 s, 72 ℃ of 30 s, totally 30 circulations.Result demonstration, with the comparison of negative plasmid transfection group, the mRNA transcriptional level that contains Aurora-A gene in the drug treating cell of people Aurora-A-shRNA interference carrier obviously reduces (see figure 4).
Embodiment 7:
After transfection, Western blot method detects the interference effect to Aurora-A protein expression
Collecting cell after transfection 48h, get 50 μ g total protein of cell, after 10% SDS-PAGE, be transferred to nitrocellulose filter, the anti-Aurora-A monoclonal antibody of the rabbit of take (1:1000 dilution) is primary antibodie, and the sheep anti-mouse igg of HRP mark is two anti-, through hatch wash film after ECL develop, detect the expression level of Aurora-A albumen in cell, take β-actin as internal reference.Result demonstration, with the comparison of negative plasmid transfection group, the expression level that contains Aurora-A albumen in the drug treating cell of people Aurora-A-shRNA interference carrier obviously reduces (see figure 5).
Embodiment 8:
After transfection, Transwell Matrigel detects the impact on cell invasion ability
Dilution Matrigel to 250 μ g/mL, the poly-carbon ester film in 8 μ m holes is two-sided through coated each 30min of extracellular matrix Matrigel, take out air-dry standby.30 μ L RPMI 1640 substratum are added in to chamber under Boyden cell, and the poly-carbon ester film in 8 μ m holes that Matrigel has been coated with is laid on above lower chamber, then adds one deck rubber pad, and installs groove on Boyden cell.Get the cell dissociation that growth conditions is good, by 50 μ L 2 * 10
4individual cell seeding is chamber under each Boyden cell, in 37 ℃ of 5%CO
2in incubator, cultivate.After 24h, carefully take off film, scrape off the cell that migration does not occur on upper strata.Methyl alcohol with 75% is the cell 15min on film fixedly.After 0.5% Viola crystallina (methyl alcohol preparation) dyeing 20min, distilled water cleans.The cell count of the poly-carbon ester film lower surface of counting, carries out statistical analysis under the microscope, takes pictures simultaneously.Result shows, containing the drug treating cell of people Aurora-A-shRNA interference carrier, through the cell count of film, is 56 ± 12(Fig. 7), control group is 520 ± 32(Fig. 6 through the cell count of film).Result shows, compares with compared with control cells, containing the vitro invasion ability of the drug treating cell of people Aurora-A-shRNA interference carrier, obviously weaken, and Epidemiological Analysis by statistics, difference has significance (see figure 8).
Embodiment 9:
After transfection, DAPI staining detects the impact of UV irradiation on apoptosis ability
UV after transfection 48h (30J/m2,254 nm ultraviolet lamps) irradiating cell, cleans cell with PBS after 12h, cold methanol fixed cell 30min.PBS rinses cell, 0.1 μ g/mL DAPI(4', 6'-diamidino-2-phenylindole hydrochloride, 4,6-diamidine-2-phenylindone) transfect cell core, incubated at room 15min.PBS rinses cell, sucks excess liq, mounting with filter paper.Result shows, compare with compared with control cells (Fig. 9), containing the cell after the drug treating of people Aurora-A-shRNA interference carrier, after UV irradiates, there is nucleus chromatin condensation in a lot of cells, edge forms crescent, and nuclear membrane collapse and cytolysis form the apoptotic body of cohesion, presents the feature (see figure 10) of typical apoptosis.Prompting can promote the esophageal cancer cell apoptosis of UV radiation-induced containing the medicine of people Aurora-A-shRNA interference carrier.
sequence table
<110> Mountain Western Medicine S University
<120> mono-species specificity reduces shRNA and the application thereof of people Aurora-A genetic expression
<160>5
<170> PaUentIn Version 3.5
<210> 1
<211> 51
<212> RNA
<213> artificial sequence
<223> is according to the shRNA sequence of Aurora-A gene siRNA design
<400> 1
gcaccacuug gaacaguuua uuucaagaga auaaacuguu ccaaguggug c
<210> 2
<211> 21
<212> RNA
<213> people (Homo sapiens)
<223> Aurora-A target-gene sequence
<400> 2
gcaccacttg gaacagttta t
<210> 3
<211> 51
<212> DNA
<213> artificial sequence
The DNA sequence dna of <223> coding Aurora-A gene shRNA
<400> 3
gcaccacttg gaacagttta tttcaagaga ataaactgtt ccaagtggtg c
<210> 4
<211> 21
<212> RNA
<213> people (Homo sapiens)
<223> shRNA shears product siRNA positive-sense strand
<400> 4
gcaccacuug gaacaguuua u
<210> 5
<211> 21
<212> RNA
<213> people (Homo sapiens)
<223> shRNA shears product siRNA antisense strand
<400> 5
auaaacuguu ccaaguggug c
Claims (6)
1. a species specificity reduces the shRNA of people Aurora-A genetic expression, it is characterized in that, its base sequence is as shown in SEQ ID NO.1,
5’- GCACCACUUGGAACAGUUUAUUUCAAGAGAAUAAACUGUUCCAAGUGGUGC-3’。
2. a species specificity according to claim 1 reduces the shRNA of people Aurora-A genetic expression, it is characterized in that its for 995th～1015 of target sequence behaviour Aurora-A mRNA, as shown in SEQ ID NO.2,
5’- GCACCACUUGGAACAGUUUAU-3’。
3. a species specificity according to claim 1 reduces the shRNA of people Aurora-A genetic expression, it is characterized in that this shRNA transcribes generation by the DNA oligonucleotide chain as shown in SEQ ID NO.3,
5’- GCACCACTTGGAACAGTTTATTTCAAGAGAATAAACTGTTCCAAGTGGTGC-3’。
4. a species specificity according to claim 1 reduces the shRNA of people Aurora-A genetic expression, it is characterized in that this shRNA transcribes generation by the plasmid that comprises the DNA oligonucleotide chain as shown in SEQ ID NO.3.
5. a species specificity according to claim 1 reduces the shRNA of people Aurora-A genetic expression, it is characterized in that this shRNA can shear siRNA positive-sense strand and the antisense strand forming containing as shown in SEQ ID NO.4 and SEQ ID NO.5,
SEQ ID NO.4: positive-sense strand is 5 '-GCACCACUUGGAACAGUUUAU-3 ',
SEQ ID NO.5: antisense strand is 5 '-AUAAACUGUUCCAAGUGGUGC-3 '.
6. the application of the shRNA of a specificity reduction people Aurora-A as claimed in claim 1 genetic expression in preparation treatment esophageal carcinoma medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210115006.4A CN102690826B (en) | 2012-04-19 | 2012-04-19 | shRNA for specifically reducing human Aurora-A gene expression and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210115006.4A CN102690826B (en) | 2012-04-19 | 2012-04-19 | shRNA for specifically reducing human Aurora-A gene expression and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102690826A CN102690826A (en) | 2012-09-26 |
| CN102690826B true CN102690826B (en) | 2014-03-05 |
Family
ID=46856563
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210115006.4A Expired - Fee Related CN102690826B (en) | 2012-04-19 | 2012-04-19 | shRNA for specifically reducing human Aurora-A gene expression and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102690826B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103343125A (en) * | 2013-06-18 | 2013-10-09 | 山西医科大学 | shRNA for inhibiting colon cancer cell PRPS2 expression, construction method of vector of shRNA, and use of shRNA |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006006948A2 (en) * | 2002-11-14 | 2006-01-19 | Dharmacon, Inc. | METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY |
| EP2037919A2 (en) * | 2006-06-30 | 2009-03-25 | Schering Corporation | Method of using substituted piperidines that increase p53 activity |
| CN101595107A (en) * | 2006-06-30 | 2009-12-02 | 先灵公司 | Can improve that P53 is active substituted piperidine and uses thereof |
| US20110033461A1 (en) * | 2008-03-12 | 2011-02-10 | Vladimir Ratushny | Combination Therapy for the Treatment of Cancer |
| EP2169077A1 (en) * | 2008-09-19 | 2010-03-31 | Vereniging voor christelijk hoger onderwijs, wetenschappelijk onderzoek en patiëntenzorg | Methods and compositions for diagnosing an adenocarcinoma |
| WO2010034670A2 (en) * | 2008-09-26 | 2010-04-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Host cell kinases as targets for antiviral therapies against hcv infection |
| AU2011237669B2 (en) * | 2010-04-06 | 2016-09-08 | Caris Life Sciences Switzerland Holdings Gmbh | Circulating biomarkers for disease |
-
2012
- 2012-04-19 CN CN201210115006.4A patent/CN102690826B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| A framework for identification of actionable cancer genome dependencies in small cell lung cancer.;Martin L.et al.;《PNAS》;20121016;第109卷(第42期);附件第3页最后一段至第4页第一段 * |
| Martin L.et al..A framework for identification of actionable cancer genome dependencies in small cell lung cancer..《PNAS》.2012,第109卷(第42期), |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102690826A (en) | 2012-09-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | MiR-155-5p accelerates the metastasis of cervical cancer cell via targeting TP53INP1 | |
| Ji et al. | PRR11 is a novel gene implicated in cell cycle progression and lung cancer | |
| Wang et al. | NIRF is frequently upregulated in colorectal cancer and its oncogenicity can be suppressed by let-7a microRNA | |
| Wang et al. | Prognostic and biological significance of microRNA-127 expression in human breast cancer | |
| Li et al. | Suppression of CX43 expression by miR-20a in the progression of human prostate cancer | |
| Han et al. | MiR-101 inhibits the proliferation and metastasis of lung cancer by targeting zinc finger E-box binding homeobox 1 | |
| Zhang et al. | MicroRNA‐146a targets PRKCE to modulate papillary thyroid tumor development | |
| Han et al. | ROBO3 promotes growth and metastasis of pancreatic carcinoma | |
| Gong et al. | LncRNA HAND2‐AS1 represses cervical cancer progression by interaction with transcription factor E2F4 at the promoter of C16orf74 | |
| Wu et al. | Long non‐coding RNA SNHG6 promotes cell proliferation and migration through sponging miR‐4465 in ovarian clear cell carcinoma | |
| Yang et al. | Circular RNA circRGNEF promotes bladder cancer progression via miR-548/KIF2C axis regulation | |
| Wang et al. | Expression and prognostic impact of PRL‐3 in lymph node metastasis of gastric cancer: its molecular mechanism was investigated using artificial microRNA interference | |
| Zhou et al. | MicroRNA-134 inhibits tumor stem cell migration and invasion in oral squamous cell carcinomas via downregulation of PI3K-Akt signaling pathway by inhibiting LAMC2 expression | |
| Hu et al. | LncRNA TDRG1 promotes the metastasis of NSCLC cell through regulating miR‐873‐5p/ZEB1 axis | |
| Wang et al. | Fibulin-4 is associated with prognosis of endometrial cancer patients and inhibits cancer cell invasion and metastasis via Wnt/β-catenin signaling pathway | |
| Zhao et al. | EGF promotes HIF-1α expression in colorectal cancer cells and tumor metastasis by regulating phosphorylation of STAT3. | |
| Guo et al. | Silencing the YB‐1 gene inhibits cell migration in gastric cancer in vitro | |
| Taddei et al. | Stromal‐induced downregulation of miR‐1247 promotes prostate cancer malignancy | |
| Zhang et al. | AGO2 involves the malignant phenotypes and FAK/PI3K/AKT signaling pathway in hypopharyngeal-derived FaDu cells | |
| Wan et al. | SNHG3 promotes migration, invasion, and epithelial-mesenchymal transition of breast cancer cells through the miR-186-5p/ZEB1 axis | |
| Meng et al. | Human bone marrow mesenchymal stem cell‐derived extracellular vesicles impede the progression of cervical cancer via the miR‐144‐3p/CEP55 pathway | |
| Wu et al. | LncRNA SLCO4A1-AS1 modulates colon cancer stem cell properties by binding to miR-150-3p and positively regulating SLCO4A1 | |
| Xu et al. | Mesenchymal stem cell-derived exosomes carrying microRNA-150 suppresses the proliferation and migration of osteosarcoma cells via targeting IGF2BP1 | |
| Wang et al. | Circular RNA ITCH attenuates the progression of nasopharyngeal carcinoma by inducing PTEN upregulation via miR‐214 | |
| Yu et al. | Retracted: Long noncoding RNA LINC00052 inhibits colorectal cancer metastasis by sponging microRNA‐574‐5p to modulate CALCOCO1 expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140305 Termination date: 20180419 |