CN102311502B - Fusion protein used for inhibiting regeneration or growth of blood vessel and medical treatment application thereof - Google Patents

Abstract

The invention relates to a fusion protein used for inhibiting regeneration or growth of blood vessel, and a medicinal application or pharmaceutical preparation thereof. The fusion protein is capable of inhibiting PDGF (platelet-derived growth factor) and VEGF (vascular endothelial growth factor) at the same time, and effectively treating the different diseases caused by the regeneration and growth of blood vessel, such as tumor, eye disease and the like.

Description

The fusion rotein of a kind of angiogenesis inhibiting or growth and medical use thereof

Technical field

The present invention relates to genetically engineered and protein engineering field, specifically, relate to the fusion rotein of a kind of effectively angiogenesis inhibiting or growth, with and pharmaceutical use or pharmaceutical preparation.

Background technology

Under normal physiological conditions, the generation of blood vessel is one and is subject to the tight process of regulating of a plurality of links, and the normal function of repairing and maintain body is had to important effect.Yet, as inside tumor blood vessel Fast Growth, be one of clinical common phenomenon.A large amount of animal model and human clinical trials show, in the blocking-up tumour, the formation of new vessel can stop the growth of tumour and the death of triggering tumor cell effectively, thereby reaches the result for the treatment of to tumour.Therefore, angiogenesis inhibiting is one of impressive progress of current anti-cancer agent research, and the anti-neovascularization medicaments of macromole is as the listing approval of Avastin through U.S. FDA, also have simultaneously more medicine in different clinical before with the clinical study stage.In addition, for senile retinal vasculopathy (Age-related macular degeneration, referred to as AMD), the multiple diseases relevant to angiogenesis such as diabetic retinopathy, sacroiliitis, angiogenesis inhibiting treatment new drug also has extensive and important effect.

Angiogenesis is a complex process that has the various active biotic factor to be regulated and controled, thereby one of them key link is endothelial cell surface receptor to be combined and is activated by multiple somatomedin, then control the endotheliocyte activity through the signal transduction system of intracellular tyrosine phosphorylation, thereby impel angiogenesis.In multiple somatomedin, vascular endothelial growth factor (Vascular endothelial cell growth factor, referred to as VEGF) and Thr6 PDGF BB (platelet derived growth factor, referred to as PDGF) be to control the most important two class factors of angiogenesis, be induce and promote the vascularization effect the most by force, the most single-minded angiogenesis factor, overexpression all in nearly all human tumor is an important molecule target of anticancer research.

PDGF mainly by with pdgf receptor (PDGFR) combination, and then activated protein kinase signal transduction pathway and playing a role.PDGFR consists of α and two kinds of subunits of β, have 3 kinds of dimers (PDGFR-α α, α β, β β), wherein β β dimer acceptor (PDGFR-β) is the most important, its molecular weight is about 180～190 kd, belong to tyrosine kinase receptor (receptor tyrosine kinase, RTK) family.PDGFR plays an important role in tumour formation and development process.The overexpression of PDGFR-β or overactivity all can stimulate intratumoral vasculature to generate, and promote tumor growth.PDGFR-β is one of molecular marker of tumor vascular endothelial cell, high expression level in endothelial cells in tumor neogenetic blood vessels, and closely related with growth, the Metastasis and prognosis of some tumour.Therefore PDGFR-β is the target of a comparatively desirable neoplasm targeted therapy.

VEGF has multiple acceptor on Surface of Vascular Endothelial Cells, be called not only Flt-1 comprising VEGFR-1() and VEGFR-2(but be called KDR or Flk-1), their extracellular part forms by seven immunoglobulin-like zones (D1-D7) that can combine with VEGF, intracellular portion includes the Tyrosylprotein kinase group, after acceptor is activated by VEGF, intracellular Tyrosylprotein kinase group generation phosphorylation, and cause a series of signal transmission, finally cause angiogenesis.Because the VEGF signal transmits the importance to angiogenesis, thereby blocking VEGF or vegf receptor reach angiogenesis inhibiting has important antitumous effect, also other are comprised that the disease relevant to angiogenesis such as retinal vasculopathy has important therapeutic action simultaneously.Unique cancer therapy drug for angiogenesis of being ratified by U.S. FDA (Avastin) is exactly the monoclonal antibody of specific binding VEGF-A at present, and its mechanism is exactly by reach the purpose of blocking VEGF and its receptors bind in conjunction with VEGF.The VEGF blocker of another kind of possibility better effects if is the extracellular fragment of vegf receptor, and it has the natural high specific for VEGF.

At present a large amount of research has confirmed that the generation of blood vessel is the complex process that is subject to the multiplefactor regulation and control, and PDGF and VEGF control the most important two class factors of angiogenesis.But current medicine, especially macromole antibody and fusion proteins medicine, all for one of them as the treatment target spot, consider that angiogenesis is the process of a complexity, in order only to improve at present the defect for single target treatment medicine, the invention provides one for most important two fusion roteins that target spot suppresses of angiogenesis simultaneously, greatly improving on bioactive basis, guarantee its in vitro with animal in can be more effectively in conjunction with or neutralize VEGF and PDGF, blocking-up angiogenesis and growth, thus reach better result for the treatment of.

summary of the invention

One of the object of the invention is to provide a kind of fusion rotein through optimizing and comprising VEGF and pdgf receptor extracellular fragment and human normal immunoglobulin Fc, it all has good stability and biological activity in vivo and in vitro, and blocking VEGF and the transmission of PDGF signal simultaneously, thereby the effect of angiogenesis inhibiting and growth.

To achieve these goals, the invention provides following technical scheme:

One aspect of the present invention provides a kind of fusion rotein, this fusion rotein is to consist of the different fragments of pdgf receptor and vegf receptor and human normal immunoglobulin Fc, pdgf receptor fragment wherein, can also comprise one or more optimization peptide junction fragments between vegf receptor fragment or Fc, this peptide junction fragment is selected from following group:

A. (Gly Gly Gly Gly Ser) _n, n can be 1,2,3,4,5;

B. (Gly Gly Gly) _n, n can be 1,2,3,4,5;

Wherein said pdgf receptor fragment is selected from following group:

A. the immunoglobulin-like zone, extracellular 1,2,3 or 4 of PDGF α acceptor, its aminoacid sequence is as described in SEQ ID NO.1 in sequence table; Or

B. the immunoglobulin-like zone, extracellular 1,2,3 or 4 of PDGF beta receptor, its aminoacid sequence is as described in SEQ ID NO.2 in sequence table;

Described vegf receptor fragment is selected from following group:

A. the 2nd immunoglobulin-like zone, the extracellular of VEGF-1 acceptor, its aminoacid sequence is as described in SEQ ID NO.3 in sequence table;

B. the 3rd immunoglobulin-like zone, the extracellular of VEGF-2 acceptor, its aminoacid sequence is as described in SEQ ID NO.4 in sequence table;

C. the 4th immunoglobulin-like zone, the extracellular of VEGF-1 acceptor, its aminoacid sequence is as described in SEQ ID NO.5 in sequence table.

The present invention also further provides the fusion rotein with following structure:

a. KH-001：α RD d1 － α RD d2 －α RD d3 － α RD d4 － FLT-1 d2 － KDR d3 －Fc;

b. KH-002：β RD d1 － β RD d2 － β RD d3 － β RD d4 －FLT-1 d2 －KDR d3－Fc;

c. KH-003：α RD d2 －α RD d3－ FLT-1 d2 － KDR d3 －FLT-1 d4－Fc;

d. KH-004： β RD d2 － β RD d3－FLT-1 d2 －KDR d3－FLT-1 d4－Fc;

e. KH-005：α RD d2 －α RD d3－ FLT-1 d2 － KDR d3－Fc;

f. KH-006： β RD d2 － β RD d3－FLT-1 d2 －KDR d3－Fc;

g. KH-007：α RD d2 －α RD d3－GS－ FLT-1 d2 － KDR d3 －GS－Fc;

h. KH-008： β RD d2 － β RD d3－GS－FLT-1 d2 －KDR d3－GS－Fc;

i. KH-009：α RD d2 －α RD d3－ FLT-1 d2 － KDR d3 －GS－Fc;

j. KH-010： β RD d2 － β RD d3－FLT-1 d2 －KDR d3－GS－Fc;

k. KH-011：α RD d2 －α RD d3－GS－ FLT-1 d2 － KDR d3－Fc;

l. KH-012： β RD d2 － β RD d3－GS－FLT-1 d2 －KDR d3－Fc;

Wherein,

The aminoacid sequence of α RD d1, α RD d2, α RD d3, α RD d4 is as described in SEQ ID NO.1 in sequence table;

The aminoacid sequence of β RD d1, β RD d2, β RD d3, β RD d4 is as described in SEQ ID NO.2 in sequence table;

The aminoacid sequence of FLT-1 d2 is as described in SEQ ID NO.3 in sequence table;

The aminoacid sequence of KDR d3 is as described in SEQ ID NO.10 in sequence table;

The aminoacid sequence of FLT-1 d4 is as described in SEQ ID NO.11 in sequence table;

The aminoacid sequence of Fc is as described in SEQ ID NO.12 in sequence table;

The aminoacid sequence of GS is (Gly Gly Gly Gly Ser) _n, n can be 1,2,3,4,5.

Wherein, more preferably

The coding DNA of KH-001 is as described in SEQ ID NO.13 in sequence table;

The coding DNA of KH-002 is as described in SEQ ID NO.14 in sequence table;

The coding DNA of KH-003 is as described in SEQ ID NO.15 in sequence table;

The coding DNA of KH-004 is as described in SEQ ID NO.16 in sequence table;

The coding DNA of KH-005 is as described in SEQ ID NO.17 in sequence table;

The coding DNA of KH-006 is as described in SEQ ID NO.18 in sequence table;

The coding DNA of KH-007 is as described in SEQ ID NO.19 in sequence table;

The coding DNA of KH-008 is as described in SEQ ID NO.20 in sequence table;

The coding DNA of KH-009 is as described in SEQ ID NO.21 in sequence table;

The coding DNA of KH-010 is as described in SEQ ID NO.22 in sequence table;

The coding DNA of KH-011 is as described in SEQ ID NO.23 in sequence table;

The coding DNA 2 of KH-01 is as described in SEQ ID NO.24 in sequence table.

The present invention also provides the carrier of above-mentioned fusion rotein, and its carrier is preferably plasmid, virus or DNA fragmentation.The present invention also provides the cell of above-mentioned fusion rotein carrier, is preferably protokaryon or eukaryotic cell.

The pharmaceutical composition that the present invention also provides above-mentioned fusion rotein and pharmaceutically acceptable carrier or vehicle to form; Wherein dosage form is preferably injection, injection freeze-dried powder or gel for eye use.

Application in the medicine of the disease that the present invention provides again above-mentioned fusion rotein to be caused by angiogenesis or growth in the preparation treatment; The wherein said disease caused by angiogenesis or growth is preferably tumour or ocular angiogenesis disease, and described ocular angiogenesis disease is the age related maculopathy more preferably.

Main points of the present invention are in prior art to suppress neovascularization medicaments and only by suppressing VEGF, control angiogenesis, but the defect that the blood vessel that can not make to have generated disappears, designed and built the fusion rotein of a series of pairs of target spots, also can insert in vegf receptor by adding peptide linkage section (peptide linker) simultaneously, between the extracellular fragment or Fc of pdgf receptor, make the extracellular fragment of vegf receptor, there is sufficiently high structural elasticity and plasticity-between the extracellular fragment of pdgf receptor or Fc, thereby greatly increased the stability of fusion rotein, the more important thing is, significantly improved the avidity of being combined with multiple VEGF and PDGF.This optimization fusion albumen that comprises the peptide linkage section, compare with the fusion rotein that does not comprise this peptide linkage section, has higher biological activity and longer serum half-life, thus more effectively neutralize VEGF and PDGF, angiogenesis inhibiting and tumor development.

PDGF is the somatomedin of a dimer class, and its acceptor is divided into two kinds of α and β.The zone that all comprises 5 immunoglobulin-likes in two kinds of recipient cell outer segments, wherein D2 and D3 mainly participate in the combination to PDGF, D4 mainly participate in interaction between acceptor-acceptor (Olli et al. Biochemistry 2000,39,2370-2375).Our result of study shows, the multiple pdgf receptor fusion rotein that does not comprise D2 and D3 has lost most PDGF avidity, the multiple pdgf receptor fusion rotein that comprises D2 and D3 has been preserved the avidity to PDGF, therefore, the present invention is in conjunction with the α of PDGF and beta receptor structural domain 2 and 3 one or more combinations.

The protein molecular the present invention relates at least has two independent functional domains, the acceptor zone of being combined with VEGF and PDGF.US610071 discloses the fusion rotein of independent VEGF fragment or Fc and has lost most of activity in conjunction with VEGF.In failed D2-Fc fusion rotein, only have a linkage section that comprises two amino acid (FE) at this between D2 fragment and Fc, this may be exactly its failed reason.VEGF, PDGF and Fc three each and every one independently have the zone of difference in functionality, all must form the activated three-D space structure of each self stabilization, particularly after two Fc zone dimerizations, two somatomedin calmodulin binding domain CaMs must keep its structural stability and biological activity, thereby guarantee its avidity to VEGF and PDGF.And at this in failed D2-Fc fusion rotein, the structure space that two amino acid between D2 and Fc probably are not enough to provide enough meets the needs of D2 and Fc rock steady structure, make D2 or Fc or the two all can not form stable structure, finally greatly affect the avidity of D2-Fc fusion rotein to VEGF.The optimization peptide linkage section that the present invention provides a series of whippy structures, to connect two (or three) relatively independent functional areas in albumen, makes it enough spaces and forms stable structure, thus the avidity and the biological activity that have guaranteed.

The PDGF that the present invention describes, the optimization fusion albumen of vegf receptor extracellular fragment and Fc be by conventional or by the biology field researchist familiar gene recombination technology built, concrete experimental procedure as<<molecular cloning the third edition (Joseph Sambrook, Science Press).

As shown in Figure 1, its coding DNA can obtain by conventional gene recombination technology albumen primary structure involved in the present invention.After the DNA sequence dna of required coding pdgf receptor, vegf receptor and Fc fragment obtains in the GenBank of NCBI (National Center for Biotechnology Information), the DNA sequence dna of the above-mentioned optimization fusion albumen of coding is cloned into respectively in carrier after PCR is synthetic, and used carrier can be plasmid, virus or the DNA fragmentation that molecular biology is commonly used.Add the protein excretion signal sequence before the end of DNA sequence dna of the above-mentioned optimization fusion albumen of coding, secrete out from cell to guarantee protein.The carrier sequence comprises promotor, protein translation initial sum termination signal and polyadenylic acid (PolyA) sequence for driving genetic expression.Antibiotic resistance genes is arranged in carrier, be beneficial to carrier at host cell, as bred in bacterium.In addition, also comprise the eukaryotic cell selected gene in carrier, for the selection of stable transfection host cell strain.

Do not have absolute boundary between aminoacid sequence due to each immunoglobulin-like zone in pdgf receptor and vegf receptor, so the length of the aminoacid sequence in each immunoglobulin-like zone can there is certain variation.So the aminoacid sequence of optimization fusion protein involved in the present invention also can have certain variation, they all belong to scope of the present invention.

Fc in above-mentioned optimization fusion albumen is from human normal immunoglobulin IgG1, can be also hypotype IgG2, IgG3, IgG4 or human normal immunoglobulin IgM and IgA, this immunoglobulin Fc segments can be Fc total length or part Fc sequence, as being selected from CH2 segment, CH3 segment or stranded regional fragment, they all belong to scope of the present invention.

The peptide linkage section purpose related in the present invention is to provide the independence in better elasticity and space, therefore its aminoacid sequence and length can allow certain variation, also can in the peptide chain library of a completely random, screen and obtain, they all belong to scope of the present invention.

After the plasmid construction that completes the DNA sequence dna that contains the above-mentioned optimization fusion albumen of coding, available this recombinant vectors transfection or transformed host cell, express corresponding fused protein.Can be used in the expression system of expressing these fusion roteins has multiplely, can be that eukaryotic cell can be also prokaryotic cell prokaryocyte, and they include, but is not limited to mammalian cell, bacterium, yeast, insect cell etc.Due to the aminoacid sequence of fused protein of the present invention comprises can glycosylated amino acid, therefore, mammalian cell is the optimizer system of expressing these protein.Can be used for the extensive mammalian cell of expressing of protein has multiple, such as 293 cells, Chinese hamster ovary celI, SP20 cell, NS0 cell, COS cell, bhk cell or PerC6 cell etc., therefore many other cells also can be used for these protein expressions and production, all are included in the row of the cell that the present invention can use.The recombinant plasmid that contains the above-mentioned optimization fusion albumen of encoding can enter host cell through transfection, and the method for transfectional cell has multiple, comprising but be not limited to: electricity turns, liposome transfection, calcium mediated method etc.

A kind of preferably expression method is, in the host cell of stable transfection, recombinant vectors is carried out to gene amplification, to improve the expression amount of corresponding recombination fusion protein, for example, after lacking the host cell of DHFR with the recombinant vectors stable transfection that contains Tetrahydrofolate dehydrogenase (DHFR), can in cell culture fluid, increase the concentration of methotrexate (MTX) with the number of copies of amplification recombinant vectors in host cell; Again for example to expressing the stable transfection host cell of glutamine synthetase (GS), utilize can the increase number of copies of recombinant vectors of the concentration that increases methionine sulfoxide (MSX) in nutrient solution.Other expression systems beyond mammalian cell, also can be for expressing these optimization fusion albumen such as bacterium, yeast or insect cell etc., and they are also included within the row of the cell that the present invention can use.The protein output of these expression systems is high than mammalian cell, and still, expressed potein deficiency glycosylation or formed sugar chain are different from mammalian cell.

After the optimization fusion protein expression, available enzyme linked immunosorbent adsorption test (ELISA) or additive method are measured the concentration of fused protein in cell culture fluid.For the albumen that comprises the Fc fragment, can purify with protein A-sepharose affinity chromatography.For albumen, can select according to the purification tag added in carrier the purification process of response.

Obtain corresponding optimization fusion protein from the recombinant chou nutrient solution after, can utilize the external combination experiment of PDGF and VEGF to detect and compare range protein avidity.The results show, only contain VEGF or pdgf receptor structural domain fusion rotein is compared with prior art is disclosed, and the constructed optimization fusion protein of the present invention possesses the avidity (see figure 2) of higher PDGF and VEGF greatly simultaneously.Albumen with respect to single target spot PDGF or VEGF, the constructed optimization fusion albumen of the present invention is to having better blocking effect, thereby angiogenesis inhibiting more effectively, the disease for the treatment of and angiogenesis, they include but not limited to various tumours, retinal vasculopathy AMD, diabetic retinopathy, sacroiliitis, anaemia or endometrial hyperplasia etc.The present invention also provides experimentation on animals to prove optimization fusion protein provided by the invention anti-angiogenic rebirth effect in vivo.Experimental results show that, in the mouse model of HCC Hep3B liver cancer and Lovo large bowel cancer, fusion rotein provided by the invention has all fully suppressed the growth of tumour, and successful is better than the fusion rotein of the independent target spot of prior art, therefore, the constructed fusion rotein of the present invention has efficient anti-cancer ability.At present, anti-VEGF mab treatment has become the therapeutic regimen of the wet AMD for the treatment of, but 1/3rd the eyesight of only having an appointment in the patient who receives treatment can improve.The topmost shortcoming of this kind for the treatment of plan remains the generation that can only suppress neovascularity, can not make existing blood-vascular system disease even disappear.Therefore, develop the result for the treatment of that the treatment plan that can make new vessel disappear can greatly promote medicine.. the fusion rotein that the present invention also provides just can, by suppressing the blood vessel peripheral cells, more surprisingly can make existing new vessel atrophy.In treatment AMD, the blood vessel peripheral cells can be impelled by secrete somatomedin (as VEGF) and other front somatomedin simultaneously the formation of new vessel.Therefore, only, by anti-VEGF treatment, be difficult to make the blood vessel formed to disappear.PDGF assembles and ripe cytokine as regulating peripheral cells, and the raising of its expression level can promote the generation of new vessel.Otherwise, by suppressing PDGF, can make peripheral cells come off, new vessel disappears.In addition, at laser induced choroidal neovascularization (choroidal neovascularization, referred to as CNV) in mouse model, the protein of the present invention's design, not only can suppress the generation of new vessel, and can make to treat previously generated new vessel atrophy, make hemorrhage area reducing, therefore, retinal vasculopathy is had to good medical prospect.

The present invention also provides the pharmaceutical composition that contains fusion rotein of the present invention and pharmaceutical carrier.This pharmaceutical composition can be made various forms of pharmaceutical preparations according to the technology of pharmaceutics routine techniques, preferably injection, most preferably freeze drying injection.

Pharmaceutical composition of the present invention, wherein also comprise any one or more other the medicine with synergistic angiogenesis inhibiting, described composition can be treated relevant diseases of angiogenesis together with the other treatment method, and described other treatment method is selected from chemotherapy, reflexotherapy, gene therapy.

Adopted the C end to merge the fusion rotein of people Fc albumen, its purpose is in order to extend the transformation period of this soluble fusion protein on the one hand, makes it be difficult for being degraded, and is can more easily by affinity chromatography, obtain target protein in the purifying in downstream on the other hand.

The accompanying drawing explanation

The structure of the various albumen of Fig. 1 forms.

The 1st immunoglobulin-like zone (being expressed as α RD d1) of PDGF α acceptor, the 2nd immunoglobulin-like zone (being expressed as α RD d2), the 3rd immunoglobulin-like zone (being expressed as α RD d3), the 4th immunoglobulin-like zone (being expressed as α RD d4); The 1st immunoglobulin-like zone (being expressed as β RD d1) of PDGF beta receptor, the 2nd immunoglobulin-like zone (being expressed as β RD d2), the 3rd immunoglobulin-like zone (being expressed as β RD d3), the 4th immunoglobulin-like zone (being expressed as β RD d4); The 2nd immunoglobulin-like zone (being expressed as FLT-1d2) of VEGFR-1, the 3rd immunoglobulin-like zone (being expressed as KDR d3) of VEGFR-2; Human normal immunoglobulin Fc zone (being expressed as Fc), optimize peptide linkage section (being expressed as G9, G12 and GS) for three kinds.

The various fusion roteins of Fig. 2-A. are in vitro respectively in conjunction with the avidity of PDGF.

The various fusion roteins of Fig. 2-B. are in vitro respectively in conjunction with the avidity of VEGF.

Fig. 3 fusion rotein suppresses the growth of HCC Hep3B liver cancer in Mice Body effectively.

Fig. 4 is that fusion rotein suppresses can suppress the generation of CNV in laser induced choroidal neovascularization CNV mouse model at the mouse intraocular.

Embodiment

Following examples are explained in detail optimization fusion albumen structure, test and application involved in the present invention.But content of the present invention and purposes are not restricted to the scope of example.

The DNA sequence dna of embodiment 1, clones coding optimization fusion albumen and structure recombinant vectors

The FP2 built with our company and FP3 (ZL200510073595.4) increase respectively FLT-1D2, KDRD3, FLT-1D4 and Fc, the structural domain of the immunoglobulin-like of coding PDGFR α and PDGFR β is from people's fetal liver cell, with different primers, utilize polymerase chain reaction (PCR) amplification to obtain the fragment needed again, finally corresponding sequence is merged, thereby build the DNA sequence dna of different fused proteins.The structure of 12 kinds of fusion roteins that this preferred embodiment is constructed is shown in accompanying drawing 1.

Collect the good extraction people fetal liver cell (from the USS cell bank) of growth shape body in the T-175 culturing bottle, be approximately 1 * 10 ⁷individual cell, application RNA extracts test kit (QIAGEN company) and extracts cell total rna, and becomes cDNA with the cDNA of Invitrogen company test kit reverse transcription, and-80 ℃ are frozen standby.FP2 and FP3 plasmid are cultivated according to cellar culture bacterium method, and mention test kit with plasmid and prepare plasmid, finally using plasmid and liver cDNA as template, adopt following special primer amplifying target genes fragment.

The KH-001 amplimer

P1

S: 5 ^’ CAGGATTCGCAAGGACACCATGGGGACTTC 3’

AS: 5 ^’ ACGAAAGGTCTACCTAACTTGAGTTAACAGTTC 3’

P2

S: 5 ^’ CTGTTAACTCAAGTTAGGTAGACCTTTCGTAGAG 3’

AS: 5 ^’ ATTCTGCAGTCATTTACCCGGAGACAGGGAG 3’。

The KH-002 amplimer

P3

S: 5 ^’ ATCGGATCCAAGGACACCATGCGGCTTCCGGG 3’

AS: 5 ^’ ACGAAAGGTCTACCTGACATTGATCTGTAGCTGGAAGG 3’

P4

S: 5 ^’ CCAGCTACAGATCAATGTCAGGTAGACCTTTCGTAGAGATG 3’。

The KH-003 amplimer

P5

S: 5 ^’ GTTAGATCTAGCTATGGGGACTTCCCATC 3’

AS: 5 ^’ CTACG AAAGGTCTACCTGGCCCGCACCTCTACAACAA 3’

P6

S: 5 ^’ TTTTGTTGTAGAGGTGCGGGCCAGGTACACCTTTCGTAG 3’。

The KH-004 amplimer

P7

S: 5 ^’ ATTGGATCCACCATGCGGCTTCCGGGTGCG 3’

AS: 5 ^’ CTACG AAAGGTCTACCTGTAGCCGCTCTCAACCACGGTG 3’

P8

S: 5 ^’ GGTTGAGAGCGGCTACAGGTAGACCTTTCGTAGAGATG 3’。

The KH-005 amplimer

The same KH-003 of PCR primer, take FP2 as template.

The KH-006 amplimer

The same KH-004 of PCR primer, take FP2 as template.

The KH-007 amplimer

P9

S: 5 ^’ CCAGATCCGCCACCTCCGGCCCGCACCTCTACAAC 3’

P10

S: 5 ^’ GTGGCGGATCTGGAGGTGGCGGATCTAGGTAGACCTTTCG3’

AS: 5 ^’ AGATCCGCCACCTCCTTTTCATGGACCCTGACAAATGT 3’

P11

S: 5 ^’ GGAGGTGGCGGATCTGGAGGTGGCGGATCTGACAAAACTCAC 3’。

The KH-008 amplimer

P9

S: 5 ^’ CCACCTCCAGATCCGCCACCTCCGTAGCCGCTCTCAACCA 3’。

KH-009

With P5, P6, P10AS and P11 coupling amplified production, finally with P5S and P2AS above three kinds of amplified productions, be spliced into KH-009.

KH-0010

With P7, P8, P10AS and P12 coupling amplified production, finally with P7S and P2AS above three kinds of amplified productions, be spliced into KH-0010.

KH-0011

With P5, P9, P10S and P12 coupling amplified production, finally with P5S and P2AS above three kinds of amplified productions, be spliced into KH-0011.

KH-0012

With P7S, P12 and P2AS coupling amplified production, finally with P7S and P2AS above three kinds of amplified productions, be spliced into KH-0012.

95 ℃ of sex change 3 minutes, anneal 56 ℃, 45 seconds, under 72 ℃ of extensions condition of 2 minutes, carry out pcr amplification, after 30 circulations, obtain PDGFR α and PDGFR β, FLT-1, the Fc section PCR product of KDR immunoglobulin like domain and human normal immunoglobulin 1, adopt TA Cloning test kit, the PCR product cloning is directed into to the pCR2.1 plasmid, and transforming intestinal bacteria, the white resistance bacterium colony that choosing on plate spends the night grows, join in the LB liquid nutrient medium amplification of spending the night.Qiagen(Mini) the enzyme evaluation of cutting and check order after plasmid extraction test kit extracting plasmid, the coding DNA of acquisition is without short in size and phase shift mutation.

Adopt splicing PCR(sewing PCR) method, the designed protein sequence according to Fig. 1, corresponding code cDNA is linked together, and add the EcoRI restriction enzyme site in primer, after the EcoRI enzyme is cut, with the QIAGENE enzyme, cut the test kit purifying DNA fragment and insert the pCDNA3.1 plasmid, transform intestinal bacteria with connecting product, the positive bacterium colony of the white that choosing on plate spends the night grows, join in the LB liquid nutrient medium overnight incubation.Qiagen(Mini) the enzyme evaluation of cutting and check order after plasmid extraction test kit extracting plasmid, the coding DNA of acquisition is without short in size and phase shift mutation.

KH-007 is similar to KH-001 to KH-012, but they are the optimization fusion albumen that has comprised respectively GS (or G9, G12 etc.) peptide linkage section before Fc.Their construction is to take the KH-001 plasmid as template, by splicing PCR(Bridge PCR) method construct obtain.

Embodiment 2, the fusion rotein stably express in Chinese hamster ovary celI

The mode that encoded K H-001 is turned to the restructuring high purity plasmid utilization electricity of KH-008 imports in Chinese hamster ovary celI (Invitrogen company), add G148 at the serum-free medium base after two days, after G148 antibody colony forms, adopt limiting dilution assay to clone cultivation, about 2 weeks rear picking monoclonal cells also proceed to enlarged culturing in culture dish.

The purifying of embodiment 3 fusion roteins

Collect the cell culture fluid containing fusion rotein, centrifugal taking-up cell debris, take the method for staphylococcal protein A,SPA affinity chromatography to carry out purifying.Albumin A-Sepharose chromatography column is washed with after balance with the PBS damping fluid, nutrient solution loading ultra-fine filter concentrated with the speed of 2 ml/min, with the PBS damping fluid wash until unconjugated albumen entirely by wash-out (being monitored with A280), then use citric acid (pH=3) the elution of bound albumen of 100mM, neutralized with abundant 2M Tris at once.

The external combination experiment of embodiment 4 fusion roteins

The present invention utilizes VEGF and the PDGF detection kit (R&amp of high specific; D Systems company) by detect free VEGF and PDGF determine each fusion rotein and avidity.In experiment, the people VEGF by the KH-001 of different concns (0 to 1000 pM) to KH-012 fusion rotein respectively with 10 pM ₁₆₅with PDGF(Sigma company) at room temperature mix mutually, after overnight incubation, by detection kit, detect not by the free PDGF of fusion rotein combination and VEGF concentration.Fc and KH-001 are 6.4pM, 6.3pM, 6.2pM, 5.6pM, 5.4pM, 4.9pM, 4.4pM, 3.8pM, 2.7pM, 1.4pM, 1.3pM, 1.2pM, 0.8 pM with the half-inhibition concentration (IC50) that PDGF ties mutually respectively to 12 fusion roteins of KH012, concrete outcome shows as Fig. 2 A, all fusion roteins are all keeping the fine avidity to PDGF, and the fusion rotein KH-007 that wherein comprises the peptide linkage section has shown more excellent avidity to KH-012; Fc and KH-001 are 6.2pM, 5.4pM, 4.8pM, 4.4pM, 3.3pM, 2.4pM, 1.5pM, 1.2pM, 1.1pM, 0.8pM, 0.7pM, 0.6pM, 0.5 pM with the half-inhibition concentration (IC50) that VEGF ties mutually respectively to 12 fusion roteins of KH012, concrete outcome as shown in Figure 2 B, all fusion roteins are all keeping the fine avidity to VEGF, and the fusion rotein KH-007 that wherein comprises the peptide linkage section has shown more excellent avidity to KH-012.This experiment further illustrates the fusion rotein that contains two target spots to have efficiently, single-minded with can be in conjunction with the characteristics of two target molecules.

Embodiment 5 preparations are containing the injection of fusion rotein

The injection of optimization fusion albumen can be prepared from by multiple formulations, usually the concentration of this fusion rotein be 0.1 mg/ml to 100 mg/ml, other composition includes but not limited to various carrier proteinss, buffer reagent, electrolyte ion and sustained release dosage.Wherein a kind of preferably formula is: the optimization fusion albumen of 20 mg/ml, 5 mM Phosphate, 5 mM Citrate, 100 mM NaCl, 0.1% Tween 20,20% Sucrose, pH 6.0, make according to the conventional preparation method of injection.

The restraining effect of embodiment 6 fusion roteins growth in nude mice to the Lovo colorectal cancer cells

Lovo colorectal cancer cells (source ATCC) cellar culture is in 37 ^oc, after stand density reaches necessary requirement, with 5 X 10 ⁶lovo colorectal cancer cells/every quantity back subcutaneous injection BalB/C nude mice, become knurl after tail vein injection carry various fusion roteins, consumption is 2 mg/kg, twice until the 7th week weekly, the human normal immunoglobulin Fc of control group injection same dose.The volume of tumour is measured weekly once, and experimental result as shown in Figure 3.The Fc control group does not have antitumous effect, KH-002, and KH-004, KH-006 and KH-008 have shown good anticancer effect, KH-008 has shown optimum anticancer effect, has suppressed the growth of tumour cell in Mice Body fully.

The restraining effect of embodiment 7 fusion roteins to the mouse choroidal neovascularization (CNV) of induced with laser

Adopt red ion laser (energy is 120-150mw, spot diameter 70-100 μ m, 0.1 second time) to select retina rear class section, avoid the retina great vessels, at 9,12,3 and 6 bearing points, each swashs and penetrates one, breaks up the bruch film, induces CNV to form.The bubble that the bruch film rupture produces is an important symbol of bringing out choroidal neovascularization (CNV), and 4 some positions all have Bubble formation just can enter the anthology experiment.The right eye of mouse is by intravitreal 500ug fusion rotein, and left eye is not accepted any processing as a control group.After two weeks, mouse is condemned to death also as document (Mori et al, Investigative Ophthalomology & Visual Science, 2002,43 (6): 1994-2000) described method detects the degree of choroidal neovascularization, and result is as shown in Fig. 4, and fusion rotein can suppress the generation of laser induced CNV.

SEQUENCE LISTING

<110 > Kanghong Biotech Co., Ltd., Chengdu

<120 > fusion rotein of a kind of angiogenesis inhibiting or growth and medical use thereof

<130> CN1706867A

<160> 18

<170> PatentIn version 3.3

<210> 1

<211> 390

<212> PRT

<213> PDGFR α d1-d4

<400> 1

Gln Leu Ser Leu Pro Ser Ile Leu Pro Asn Glu Asn Glu Lys Val Val

1 5 10 15

Gln Leu Asn Ser Ser Phe Ser Leu Arg Cys Phe Gly Glu Ser Glu Val

20 25 30

Ser Trp Gln Tyr Pro Met Ser Glu Glu Glu Ser Ser Asp Val Glu Ile

35 40 45

Arg Asn Glu Glu Asn Asn Ser Gly Leu Phe Val Thr Val Leu Glu Val

50 55 60

Ser Ser Ala Ser Ala Ala His Thr Gly Leu Tyr Thr Cys Tyr Tyr Asn

65 70 75 80

His Thr Gln Thr Glu Glu Asn Glu Leu Glu Gly Arg His Ile Tyr Ile

85 90 95

Tyr Val Pro Asp Pro Asp Val Ala Phe Val Pro Leu Gly Met Thr Asp

100 105 110

Tyr Leu Val Ile Val Glu Asp Asp Asp Ser Ala Ile Ile Pro Cys Arg

115 120 125

Thr Thr Asp Pro Glu Thr Pro Val Thr Leu His Asn Ser Glu Gly Val

130 135 140

Val Pro Ala Ser Tyr Asp Ser Arg Gln Gly Phe Asn Gly Thr Phe Thr

145 150 155 160

Val Gly Pro Tyr Ile Cys Glu Ala Thr Val Lys Gly Lys Lys Phe Gln

165 170 175

Thr Ile Pro Phe Asn Val Tyr Ala Leu Lys Ala Thr Ser Glu Leu Asp

180 185 190

Leu Glu Met Glu Ala Leu Lys Thr Val Tyr Lys Ser Gly Glu Thr Ile

195 200 205

Val Val Thr Cys Ala Val Phe Asn Asn Glu Val Val Asp Leu Gln Trp

210 215 220

Thr Tyr Pro Gly Glu Val Lys Gly Lys Gly Ile Thr Met Leu Glu Glu

225 230 235 240

Ile Lys Val Pro Ser Ile Lys Leu Val Tyr Thr Leu Thr Val Pro Glu

245 250 255

Ala Thr Val Lys Asp Ser Gly Asp Tyr Glu Cys Ala Ala Arg Gln Ala

260 265 270

Thr Arg Glu Val Lys Glu Met Lys Lys Val Thr Ile Ser Val His Glu

275 280 285

Lys Gly Phe Ile Glu Ile Lys Pro Thr Phe Ser Gln Leu Glu Ala Val

290 295 300

Asn Leu His Glu Val Lys His Phe Val Val Glu Val Arg Ala Tyr Pro

305 310 315 320

Pro Pro Arg Ile Ser Trp Leu Lys Asn Asn Leu Thr Leu Ile Glu Asn

325 330 335

Leu Thr Glu Ile Thr Thr Asp Val Glu Lys Ile Gln Glu Ile Arg Tyr

340 345 350

Arg Ser Lys Leu Lys Leu Ile Arg Ala Lys Glu Glu Asp Ser Gly His

355 360 365

Tyr Thr Ile Val Ala Gln Asn Glu Asp Ala Val Lys Ser Tyr Thr Phe

370 375 380

Glu Leu Leu Thr Gln Val

385 390

<210> 2

<211> 386

<212> PRT

<213> PDGFR β d1-d4

<400> 2

Ser Gln Gly Leu Val Val Thr Pro Pro Gly Pro Glu Leu Val Leu Asn

1 5 10 15

Val Ser Ser Thr Phe Val Leu Thr Cys Ser Gly Ser Ala Pro Val Val

20 25 30

Trp Glu Arg Met Ser Gln Glu Pro Pro Gln Glu Met Ala Lys Ala Gln

35 40 45

Asp Gly Thr Phe Ser Ser Val Leu Thr Leu Thr Asn Leu Thr Gly Leu

50 55 60

Asp Thr Gly Glu Tyr Phe Cys Thr His Asn Asp Ser Arg Gly Leu Glu

65 70 75 80

Thr Asp Glu Arg Lys Arg Leu Tyr Ile Phe Val Pro Asp Pro Thr Val

85 90 95

Gly Phe Leu Pro Asn Asp Ala Glu Glu Leu Phe Ile Phe Leu Thr Glu

100 105 110

Ile Thr Glu Ile Thr Ile Pro Cys Arg Val Thr Asp Pro Gln Leu Val

115 120 125

Val Thr Leu His Glu Lys Lys Gly Asp Val Ala Leu Pro Val Pro Tyr

130 135 140

Asp His Gln Arg Gly Phe Ser Gly Ile Phe Glu Asp Arg Ser Tyr Ile

145 150 155 160

Cys Lys Thr Thr Ile Gly Asp Arg Glu Val Asp Ser Asp Ala Tyr Tyr

165 170 175

Val Tyr Arg Leu Gln Val Ser Ser Ile Asn Val Ser Val Asn Ala Val

180 185 190

Gln Thr Val Val Arg Gln Gly Glu Asn Ile Thr Leu Met Cys Ile Val

195 200 205

Ile Gly Asn Glu Val Val Asn Phe Glu Trp Thr Tyr Pro Arg Lys Glu

210 215 220

Ser Gly Arg Leu Val Glu Pro Val Thr Asp Phe Leu Leu Asp Met Pro

225 230 235 240

Tyr His Ile Arg Ser Ile Leu His Ile Pro Ser Ala Glu Leu Glu Asp

245 250 255

Ser Gly Thr Tyr Thr Cys Asn Val Thr Glu Ser Val Asn Asp His Gln

260 265 270

Asp Glu Lys Ala Ile Asn Ile Thr Val Val Glu Ser Gly Tyr Val Arg

275 280 285

Leu Leu Gly Glu Val Gly Thr Leu Gln Phe Ala Glu Leu His Arg Ser

290 295 300

Arg Thr Leu Gln Val Val Phe Glu Ala Tyr Pro Pro Pro Thr Val Leu

305 310 315 320

Trp Phe Lys Asp Asn Arg Thr Leu Gly Asp Ser Ser Ala Gly Glu Ile

325 330 335

Ala Leu Ser Thr Arg Asn Val Ser Glu Thr Arg Tyr Val Ser Glu Leu

340 345 350

Thr Leu Val Arg Val Lys Val Ala Glu Ala Gly His Tyr Thr Met Arg

355 360 365

Ala Phe His Glu Asp Ala Glu Val Gln Leu Ser Phe Gln Leu Gln Ile

370 375 380

Asn Val

385

<210> 3

<211> 93

<212> PRT

<213> FLT-1 d2

<400> 3

Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu Ile Ile His Met Thr

1 5 10 15

Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val Thr Ser Pro Asn Ile

20 25 30

Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr Leu Ile Pro Asp Gly

35 40 45

Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe Ile Ile Ser Asn Ala

50 55 60

Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr Val Asn Gly

65 70 75 80

His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr

85 90

<210> 4

<211> 102

<212> PRT

<213> KDR d3

<400> 4

Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly Glu Lys

1 5 10 15

Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile Asp

20 25 30

Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu Val

35 40 45

Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe Leu

50 55 60

Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu Tyr

65 70 75 80

Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr Phe

85 90 95

Val Arg Val His Glu Lys

100

<210> 5

<211> 87

<212> PRT

<213> FLT d4

<400> 5

Thr Val Lys His Arg Lys Gln Gln Val Leu Glu Thr Val Ala Gly Lys

1 5 10 15

Arg Ser Tyr Arg Leu Ser Met Lys Val Lys Ala Phe Pro Ser Pro Glu

20 25 30

Val Val Trp Leu Lys Asp Gly Leu Pro Ala Thr Glu Lys Ser Ala Arg

35 40 45

Tyr Leu Thr Arg Gly Tyr Ser Leu Ile Ile Lys Asp Val Thr Glu Glu

50 55 60

Asp Ala Gly Asn Tyr Thr Ile Leu Leu Ser Ile Lys Gln Ser Asn Val

65 70 75 80

Phe Lys Asn Leu Thr Ala Thr

85

<210> 6

<211> 227

<212> PRT

<213> Fc

<400> 6

Asp Lys Thr His Thr Cys Pro Leu Cys Pro Ala Pro Glu Leu Leu Gly

1 5 10 15

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met

20 25 30

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His

35 40 45

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val

50 55 60

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr

65 70 75 80

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly

85 90 95

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile

100 105 110

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val

115 120 125

Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser

130 135 140

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu

145 150 155 160

Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Ala Thr Pro Pro

165 170 175

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val

180 185 190

Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met

195 200 205

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser

210 215 220

Pro Gly Lys

225

<210> 7

<211> 818

<212> PRT

<213> KH-001

<400> 7

Gln Leu Ser Leu Pro Ser Ile Leu Pro Asn Glu Asn Glu Lys Val Val

1 5 10 15

Gln Leu Asn Ser Ser Phe Ser Leu Arg Cys Phe Gly Glu Ser Glu Val

20 25 30

Ser Trp Gln Tyr Pro Met Ser Glu Glu Glu Ser Ser Asp Val Glu Ile

35 40 45

Arg Asn Glu Glu Asn Asn Ser Gly Leu Phe Val Thr Val Leu Glu Val

50 55 60

Ser Ser Ala Ser Ala Ala His Thr Gly Leu Tyr Thr Cys Tyr Tyr Asn

65 70 75 80

His Thr Gln Thr Glu Glu Asn Glu Leu Glu Gly Arg His Ile Tyr Ile

85 90 95

Tyr Val Pro Asp Pro Asp Val Ala Phe Val Pro Leu Gly Met Thr Asp

100 105 110

Tyr Leu Val Ile Val Glu Asp Asp Asp Ser Ala Ile Ile Pro Cys Arg

115 120 125

Thr Thr Asp Pro Glu Thr Pro Val Thr Leu His Asn Ser Glu Gly Val

130 135 140

Val Pro Ala Ser Tyr Asp Ser Arg Gln Gly Phe Asn Gly Thr Phe Thr

145 150 155 160

Val Gly Pro Tyr Ile Cys Glu Ala Thr Val Lys Gly Lys Lys Phe Gln

165 170 175

Thr Ile Pro Phe Asn Val Tyr Ala Leu Lys Ala Thr Ser Glu Leu Asp

180 185 190

Leu Glu Met Glu Ala Leu Lys Thr Val Tyr Lys Ser Gly Glu Thr Ile

195 200 205

Val Val Thr Cys Ala Val Phe Asn Asn Glu Val Val Asp Leu Gln Trp

210 215 220

Thr Tyr Pro Gly Glu Val Lys Gly Lys Gly Ile Thr Met Leu Glu Glu

225 230 235 240

Ile Lys Val Pro Ser Ile Lys Leu Val Tyr Thr Leu Thr Val Pro Glu

245 250 255

Ala Thr Val Lys Asp Ser Gly Asp Tyr Glu Cys Ala Ala Arg Gln Ala

260 265 270

Thr Arg Glu Val Lys Glu Met Lys Lys Val Thr Ile Ser Val His Glu

275 280 285

Lys Gly Phe Ile Glu Ile Lys Pro Thr Phe Ser Gln Leu Glu Ala Val

290 295 300

Asn Leu His Glu Val Lys His Phe Val Val Glu Val Arg Ala Tyr Pro

305 310 315 320

Pro Pro Arg Ile Ser Trp Leu Lys Asn Asn Leu Thr Leu Ile Glu Asn

325 330 335

Leu Thr Glu Ile Thr Thr Asp Val Glu Lys Ile Gln Glu Ile Arg Tyr

340 345 350

Arg Ser Lys Leu Lys Leu Ile Arg Ala Lys Glu Glu Asp Ser Gly His

355 360 365

Tyr Thr Ile Val Ala Gln Asn Glu Asp Ala Val Lys Ser Tyr Thr Phe

370 375 380

Glu Leu Leu Thr Gln Val Pro Gly Pro Pro Phe Val Glu Met Tyr Ser

385 390 395 400

Glu Ile Pro Glu Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile

405 410 415

Pro Cys Arg Val Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe

420 425 430

Pro Leu Asp Thr Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser

435 440 445

Arg Lys Gly Phe Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu

450 455 460

Leu Thr Cys Glu Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr

465 470 475 480

Leu Thr His Arg Gln Thr Val Val Leu Ser Pro Ser His Gly Ile Glu

485 490 495

Leu Ser Val Gly Glu Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu

500 505 510

Leu Asn Val Gly Ile Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His

515 520 525

Gln His Lys Lys Leu Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser

530 535 540

Glu Met Lys Lys Phe Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg

545 550 555 560

Ser Asp Gln Gly Leu Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr

565 570 575

Lys Lys Asn Ser Thr Phe Val Arg Val His Glu Lys Pro Gly Pro Asp

580 585 590

Lys Thr His Thr Cys Pro Leu Cys Pro Ala Pro Glu Leu Leu Gly Gly

595 600 605

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile

610 615 620

Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu

625 630 635 640

Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His

645 650 655

Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg

660 665 670

Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys

675 680 685

Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu

690 695 700

Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr

705 710 715 720

Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu

725 730 735

Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp

740 745 750

Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Ala Thr Pro Pro Val

755 760 765

Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

770 775 780

Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His

785 790 795 800

Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro

805 810 815

Gly Lys

<210> 8

<211> 814

<212> PRT

<213> KH-002

<400> 8

Ser Gln Gly Leu Val Val Thr Pro Pro Gly Pro Glu Leu Val Leu Asn

1 5 10 15

Val Ser Ser Thr Phe Val Leu Thr Cys Ser Gly Ser Ala Pro Val Val

20 25 30

Trp Glu Arg Met Ser Gln Glu Pro Pro Gln Glu Met Ala Lys Ala Gln

35 40 45

Asp Gly Thr Phe Ser Ser Val Leu Thr Leu Thr Asn Leu Thr Gly Leu

50 55 60

Asp Thr Gly Glu Tyr Phe Cys Thr His Asn Asp Ser Arg Gly Leu Glu

65 70 75 80

Thr Asp Glu Arg Lys Arg Leu Tyr Ile Phe Val Pro Asp Pro Thr Val

85 90 95

Gly Phe Leu Pro Asn Asp Ala Glu Glu Leu Phe Ile Phe Leu Thr Glu

100 105 110

Ile Thr Glu Ile Thr Ile Pro Cys Arg Val Thr Asp Pro Gln Leu Val

115 120 125

Val Thr Leu His Glu Lys Lys Gly Asp Val Ala Leu Pro Val Pro Tyr

130 135 140

Asp His Gln Arg Gly Phe Ser Gly Ile Phe Glu Asp Arg Ser Tyr Ile

145 150 155 160

Cys Lys Thr Thr Ile Gly Asp Arg Glu Val Asp Ser Asp Ala Tyr Tyr

165 170 175

Val Tyr Arg Leu Gln Val Ser Ser Ile Asn Val Ser Val Asn Ala Val

180 185 190

Gln Thr Val Val Arg Gln Gly Glu Asn Ile Thr Leu Met Cys Ile Val

195 200 205

Ile Gly Asn Glu Val Val Asn Phe Glu Trp Thr Tyr Pro Arg Lys Glu

210 215 220

Ser Gly Arg Leu Val Glu Pro Val Thr Asp Phe Leu Leu Asp Met Pro

225 230 235 240

Tyr His Ile Arg Ser Ile Leu His Ile Pro Ser Ala Glu Leu Glu Asp

245 250 255

Ser Gly Thr Tyr Thr Cys Asn Val Thr Glu Ser Val Asn Asp His Gln

260 265 270

Asp Glu Lys Ala Ile Asn Ile Thr Val Val Glu Ser Gly Tyr Val Arg

275 280 285

Leu Leu Gly Glu Val Gly Thr Leu Gln Phe Ala Glu Leu His Arg Ser

290 295 300

Arg Thr Leu Gln Val Val Phe Glu Ala Tyr Pro Pro Pro Thr Val Leu

305 310 315 320

Trp Phe Lys Asp Asn Arg Thr Leu Gly Asp Ser Ser Ala Gly Glu Ile

325 330 335

Ala Leu Ser Thr Arg Asn Val Ser Glu Thr Arg Tyr Val Ser Glu Leu

340 345 350

Thr Leu Val Arg Val Lys Val Ala Glu Ala Gly His Tyr Thr Met Arg

355 360 365

Ala Phe His Glu Asp Ala Glu Val Gln Leu Ser Phe Gln Leu Gln Ile

370 375 380

Asn Val Pro Gly Pro Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu

385 390 395 400

Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val

405 410 415

Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr

420 425 430

Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe

435 440 445

Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu

450 455 460

Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg

465 470 475 480

Gln Thr Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly

485 490 495

Glu Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly

500 505 510

Ile Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys

515 520 525

Leu Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys

530 535 540

Phe Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly

545 550 555 560

Leu Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser

565 570 575

Thr Phe Val Arg Val His Glu Lys Pro Gly Pro Asp Lys Thr His Thr

580 585 590

Cys Pro Leu Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe

595 600 605

Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro

610 615 620

Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val

625 630 635 640

Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr

645 650 655

Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val

660 665 670

Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys

675 680 685

Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser

690 695 700

Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro

705 710 715 720

Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val

725 730 735

Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly

740 745 750

Gln Pro Glu Asn Asn Tyr Lys Ala Thr Pro Pro Val Leu Asp Ser Asp

755 760 765

Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp

770 775 780

Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His

785 790 795 800

Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

805 810

<210> 9

<211> 755

<212> PRT

<213> KH-003

<400> 9

Tyr Asn His Thr Gln Thr Glu Glu Asn Glu Leu Glu Gly Arg His Ile

1 5 10 15

Tyr Ile Tyr Val Pro Asp Pro Asp Val Ala Phe Val Pro Leu Gly Met

20 25 30

Thr Asp Tyr Leu Val Ile Val Glu Asp Asp Asp Ser Ala Ile Ile Pro

35 40 45

Cys Arg Thr Thr Asp Pro Glu Thr Pro Val Thr Leu His Asn Ser Glu

50 55 60

Gly Val Val Pro Ala Ser Tyr Asp Ser Arg Gln Gly Phe Asn Gly Thr

65 70 75 80

Phe Thr Val Gly Pro Tyr Ile Cys Glu Ala Thr Val Lys Gly Lys Lys

85 90 95

Phe Gln Thr Ile Pro Phe Asn Val Tyr Ala Leu Lys Ala Thr Ser Glu

100 105 110

Leu Asp Leu Glu Met Glu Ala Leu Lys Thr Val Tyr Lys Ser Gly Glu

115 120 125

Thr Ile Val Val Thr Cys Ala Val Phe Asn Asn Glu Val Val Asp Leu

130 135 140

Gln Trp Thr Tyr Pro Gly Glu Val Lys Gly Lys Gly Ile Thr Met Leu

145 150 155 160

Glu Glu Ile Lys Val Pro Ser Ile Lys Leu Val Tyr Thr Leu Thr Val

165 170 175

Pro Glu Ala Thr Val Lys Asp Ser Gly Asp Tyr Glu Cys Ala Ala Arg

180 185 190

Gln Ala Thr Arg Glu Val Lys Glu Met Lys Lys Val Thr Ile Ser Val

195 200 205

His Glu Lys Gly Phe Ile Glu Ile Lys Pro Thr Phe Ser Gln Leu Glu

210 215 220

Ala Val Asn Leu His Glu Val Lys His Phe Val Val Glu Val Arg Ala

225 230 235 240

Pro Gly Pro Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu Ile Ile

245 250 255

His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val Thr Ser

260 265 270

Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr Leu Ile

275 280 285

Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe Ile Ile

290 295 300

Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr

305 310 315 320

Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr

325 330 335

Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly Glu Lys

340 345 350

Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile Asp

355 360 365

Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu Val

370 375 380

Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe Leu

385 390 395 400

Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu Tyr

405 410 415

Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr Phe

420 425 430

Val Arg Val His Glu Lys Thr Val Lys His Arg Lys Gln Gln Val Leu

435 440 445

Glu Thr Val Ala Gly Lys Arg Ser Tyr Arg Leu Ser Met Lys Val Lys

450 455 460

Ala Phe Pro Ser Pro Glu Val Val Trp Leu Lys Asp Gly Leu Pro Ala

465 470 475 480

Thr Glu Lys Ser Ala Arg Tyr Leu Thr Arg Gly Tyr Ser Leu Ile Ile

485 490 495

Lys Asp Val Thr Glu Glu Asp Ala Gly Asn Tyr Thr Ile Leu Leu Ser

500 505 510

Ile Lys Gln Ser Asn Val Phe Lys Asn Leu Thr Ala Thr Pro Gly Pro

515 520 525

Asp Lys Thr His Thr Cys Pro Leu Cys Pro Ala Pro Glu Leu Leu Gly

530 535 540

Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met

545 550 555 560

Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His

565 570 575

Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val

580 585 590

His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr

595 600 605

Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly

610 615 620

Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile

625 630 635 640

Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val

645 650 655

Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser

660 665 670

Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu

675 680 685

Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Ala Thr Pro Pro

690 695 700

Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val

705 710 715 720

Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met

725 730 735

His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser

740 745 750

Pro Gly Lys

755

<210> 10

<211> 758

<212> PRT

<213> KH-004

<400> 10

His Asn Asp Ser Arg Gly Leu Glu Thr Asp Glu Arg Lys Arg Leu Tyr

1 5 10 15

Ile Phe Val Pro Asp Pro Thr Val Gly Phe Leu Pro Asn Asp Ala Glu

20 25 30

Glu Leu Phe Ile Phe Leu Thr Glu Ile Thr Glu Ile Thr Ile Pro Cys

35 40 45

Arg Val Thr Asp Pro Gln Leu Val Val Thr Leu His Glu Lys Lys Gly

50 55 60

Asp Val Ala Leu Pro Val Pro Tyr Asp His Gln Arg Gly Phe Ser Gly

65 70 75 80

Ile Phe Glu Asp Arg Ser Tyr Ile Cys Lys Thr Thr Ile Gly Asp Arg

85 90 95

Glu Val Asp Ser Asp Ala Tyr Tyr Val Tyr Arg Leu Gln Val Ser Ser

100 105 110

Ile Asn Val Ser Val Asn Ala Val Gln Thr Val Val Arg Gln Gly Glu

115 120 125

Asn Ile Thr Leu Met Cys Ile Val Ile Gly Asn Glu Val Val Asn Phe

130 135 140

Glu Trp Thr Tyr Pro Arg Lys Glu Ser Gly Arg Leu Val Glu Pro Val

145 150 155 160

Thr Asp Phe Leu Leu Asp Met Pro Tyr His Ile Arg Ser Ile Leu His

165 170 175

Ile Pro Ser Ala Glu Leu Glu Asp Ser Gly Thr Tyr Thr Cys Asn Val

180 185 190

Thr Glu Ser Val Asn Asp His Gln Asp Glu Lys Ala Ile Asn Ile Thr

195 200 205

Val Val Glu Ser Gly Tyr Val Arg Leu Leu Gly Glu Val Gly Thr Leu

210 215 220

Gln Phe Ala Glu Leu His Arg Ser Arg Thr Leu Gln Val Val Phe Glu

225 230 235 240

Pro Gly Pro Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu Ile Ile

245 250 255

His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val Thr Ser

260 265 270

Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr Leu Ile

275 280 285

Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe Ile Ile

290 295 300

Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr

305 310 315 320

Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr

325 330 335

Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly Glu Lys

340 345 350

Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile Asp

355 360 365

Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu Val

370 375 380

Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe Leu

385 390 395 400

Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu Tyr

405 410 415

Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr Phe

420 425 430

Val Arg Val His Glu Lys Thr Val Lys His Arg Lys Gln Gln Val Leu

435 440 445

Glu Thr Val Ala Gly Lys Arg Ser Tyr Arg Leu Ser Met Lys Val Lys

450 455 460

Ala Phe Pro Ser Pro Glu Val Val Trp Leu Lys Asp Gly Leu Pro Ala

465 470 475 480

Thr Glu Lys Ser Ala Arg Tyr Leu Thr Arg Gly Tyr Ser Leu Ile Ile

485 490 495

Lys Asp Val Thr Glu Glu Asp Ala Gly Asn Tyr Thr Ile Leu Leu Ser

500 505 510

Ile Lys Gln Ser Asn Val Phe Lys Asn Leu Thr Ala Thr Pro Gly Pro

515 520 525

Pro Gly Pro Asp Lys Thr His Thr Cys Pro Leu Cys Pro Ala Pro Glu

530 535 540

Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

545 550 555 560

Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp

565 570 575

Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly

580 585 590

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn

595 600 605

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

610 615 620

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro

625 630 635 640

Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

645 650 655

Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn

660 665 670

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

675 680 685

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Ala

690 695 700

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

705 710 715 720

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

725 730 735

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

740 745 750

Ser Leu Ser Pro Gly Lys

755

<210> 11

<211> 668

<212> PRT

<213> KH-005

<400> 11

Tyr Asn His Thr Gln Thr Glu Glu Asn Glu Leu Glu Gly Arg His Ile

1 5 10 15

Tyr Ile Tyr Val Pro Asp Pro Asp Val Ala Phe Val Pro Leu Gly Met

20 25 30

Thr Asp Tyr Leu Val Ile Val Glu Asp Asp Asp Ser Ala Ile Ile Pro

35 40 45

Cys Arg Thr Thr Asp Pro Glu Thr Pro Val Thr Leu His Asn Ser Glu

50 55 60

Gly Val Val Pro Ala Ser Tyr Asp Ser Arg Gln Gly Phe Asn Gly Thr

65 70 75 80

Phe Thr Val Gly Pro Tyr Ile Cys Glu Ala Thr Val Lys Gly Lys Lys

85 90 95

Phe Gln Thr Ile Pro Phe Asn Val Tyr Ala Leu Lys Ala Thr Ser Glu

100 105 110

Leu Asp Leu Glu Met Glu Ala Leu Lys Thr Val Tyr Lys Ser Gly Glu

115 120 125

Thr Ile Val Val Thr Cys Ala Val Phe Asn Asn Glu Val Val Asp Leu

130 135 140

Gln Trp Thr Tyr Pro Gly Glu Val Lys Gly Lys Gly Ile Thr Met Leu

145 150 155 160

Glu Glu Ile Lys Val Pro Ser Ile Lys Leu Val Tyr Thr Leu Thr Val

165 170 175

Pro Glu Ala Thr Val Lys Asp Ser Gly Asp Tyr Glu Cys Ala Ala Arg

180 185 190

Gln Ala Thr Arg Glu Val Lys Glu Met Lys Lys Val Thr Ile Ser Val

195 200 205

His Glu Lys Gly Phe Ile Glu Ile Lys Pro Thr Phe Ser Gln Leu Glu

210 215 220

Ala Val Asn Leu His Glu Val Lys His Phe Val Val Glu Val Arg Ala

225 230 235 240

Pro Gly Pro Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu Ile Ile

245 250 255

His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val Thr Ser

260 265 270

Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr Leu Ile

275 280 285

Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe Ile Ile

290 295 300

Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr

305 310 315 320

Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr

325 330 335

Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly Glu Lys

340 345 350

Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile Asp

355 360 365

Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu Val

370 375 380

Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe Leu

385 390 395 400

Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu Tyr

405 410 415

Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr Phe

420 425 430

Val Arg Val His Glu Lys Pro Gly Pro Asp Lys Thr His Thr Cys Pro

435 440 445

Leu Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe

450 455 460

Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val

465 470 475 480

Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe

485 490 495

Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro

500 505 510

Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr

515 520 525

Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val

530 535 540

Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala

545 550 555 560

Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg

565 570 575

Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly

580 585 590

Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro

595 600 605

Glu Asn Asn Tyr Lys Ala Thr Pro Pro Val Leu Asp Ser Asp Gly Ser

610 615 620

Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln

625 630 635 640

Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His

645 650 655

Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

660 665

<210> 12

<211> 668

<212> PRT

<213> KH-006

<400> 12

His Asn Asp Ser Arg Gly Leu Glu Thr Asp Glu Arg Lys Arg Leu Tyr

1 5 10 15

Ile Phe Val Pro Asp Pro Thr Val Gly Phe Leu Pro Asn Asp Ala Glu

20 25 30

Glu Leu Phe Ile Phe Leu Thr Glu Ile Thr Glu Ile Thr Ile Pro Cys

35 40 45

Arg Val Thr Asp Pro Gln Leu Val Val Thr Leu His Glu Lys Lys Gly

50 55 60

Asp Val Ala Leu Pro Val Pro Tyr Asp His Gln Arg Gly Phe Ser Gly

65 70 75 80

Ile Phe Glu Asp Arg Ser Tyr Ile Cys Lys Thr Thr Ile Gly Asp Arg

85 90 95

Glu Val Asp Ser Asp Ala Tyr Tyr Val Tyr Arg Leu Gln Val Ser Ser

100 105 110

Ile Asn Val Ser Val Asn Ala Val Gln Thr Val Val Arg Gln Gly Glu

115 120 125

Asn Ile Thr Leu Met Cys Ile Val Ile Gly Asn Glu Val Val Asn Phe

130 135 140

Glu Trp Thr Tyr Pro Arg Lys Glu Ser Gly Arg Leu Val Glu Pro Val

145 150 155 160

Thr Asp Phe Leu Leu Asp Met Pro Tyr His Ile Arg Ser Ile Leu His

165 170 175

Ile Pro Ser Ala Glu Leu Glu Asp Ser Gly Thr Tyr Thr Cys Asn Val

180 185 190

Thr Glu Ser Val Asn Asp His Gln Asp Glu Lys Ala Ile Asn Ile Thr

195 200 205

Val Val Glu Ser Gly Tyr Val Arg Leu Leu Gly Glu Val Gly Thr Leu

210 215 220

Gln Phe Ala Glu Leu His Arg Ser Arg Thr Leu Gln Val Val Phe Glu

225 230 235 240

Pro Gly Pro Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu Ile Ile

245 250 255

His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val Thr Ser

260 265 270

Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr Leu Ile

275 280 285

Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe Ile Ile

290 295 300

Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr

305 310 315 320

Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr

325 330 335

Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly Glu Lys

340 345 350

Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile Asp

355 360 365

Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu Val

370 375 380

Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe Leu

385 390 395 400

Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu Tyr

405 410 415

Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr Phe

420 425 430

Val Arg Val His Glu Lys Pro Gly Pro Asp Lys Thr His Thr Cys Pro

435 440 445

Leu Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe

450 455 460

Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val

465 470 475 480

Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe

485 490 495

Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro

500 505 510

Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr

515 520 525

Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val

530 535 540

Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala

545 550 555 560

Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg

565 570 575

Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly

580 585 590

Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro

595 600 605

Glu Asn Asn Tyr Lys Ala Thr Pro Pro Val Leu Asp Ser Asp Gly Ser

610 615 620

Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln

625 630 635 640

Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His

645 650 655

Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

660 665

<210> 13

<211> 672

<212> PRT

<213> KH-007

<400> 13

His Asn Asp Ser Arg Gly Leu Glu Thr Asp Glu Arg Lys Arg Leu Tyr

1 5 10 15

Ile Phe Val Pro Asp Pro Thr Val Gly Phe Leu Pro Asn Asp Ala Glu

20 25 30

Glu Leu Phe Ile Phe Leu Thr Glu Ile Thr Glu Ile Thr Ile Pro Cys

35 40 45

Arg Val Thr Asp Pro Gln Leu Val Val Thr Leu His Glu Lys Lys Gly

50 55 60

Asp Val Ala Leu Pro Val Pro Tyr Asp His Gln Arg Gly Phe Ser Gly

65 70 75 80

Ile Phe Glu Asp Arg Ser Tyr Ile Cys Lys Thr Thr Ile Gly Asp Arg

85 90 95

Glu Val Asp Ser Asp Ala Tyr Tyr Val Tyr Arg Leu Gln Val Ser Ser

100 105 110

Ile Asn Val Ser Val Asn Ala Val Gln Thr Val Val Arg Gln Gly Glu

115 120 125

Asn Ile Thr Leu Met Cys Ile Val Ile Gly Asn Glu Val Val Asn Phe

130 135 140

Glu Trp Thr Tyr Pro Arg Lys Glu Ser Gly Arg Leu Val Glu Pro Val

145 150 155 160

Thr Asp Phe Leu Leu Asp Met Pro Tyr His Ile Arg Ser Ile Leu His

165 170 175

Ile Pro Ser Ala Glu Leu Glu Asp Ser Gly Thr Tyr Thr Cys Asn Val

180 185 190

Thr Glu Ser Val Asn Asp His Gln Asp Glu Lys Ala Ile Asn Ile Thr

195 200 205

Val Val Glu Ser Gly Tyr Val Arg Leu Leu Gly Glu Val Gly Thr Leu

210 215 220

Gln Phe Ala Glu Leu His Arg Ser Arg Thr Leu Gln Val Val Phe Glu

225 230 235 240

Gly Gly Gly Gly Ser Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu

245 250 255

Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val

260 265 270

Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr

275 280 285

Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe

290 295 300

Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu

305 310 315 320

Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg

325 330 335

Gln Thr Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly

340 345 350

Glu Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly

355 360 365

Ile Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys

370 375 380

Leu Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys

385 390 395 400

Phe Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly

405 410 415

Leu Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser

420 425 430

Thr Phe Val Arg Val His Glu Lys Gly Gly Gly Gly Ser Asp Lys Thr

435 440 445

His Thr Cys Pro Leu Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser

450 455 460

Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg

465 470 475 480

Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro

485 490 495

Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala

500 505 510

Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val

515 520 525

Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr

530 535 540

Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr

545 550 555 560

Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu

565 570 575

Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys

580 585 590

Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser

595 600 605

Asn Gly Gln Pro Glu Asn Asn Tyr Lys Ala Thr Pro Pro Val Leu Asp

610 615 620

Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser

625 630 635 640

Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala

645 650 655

Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

660 665 670

<210> 14

<211> 672

<212> PRT

<213> KH-008

<400> 14

Tyr Asn His Thr Gln Thr Glu Glu Asn Glu Leu Glu Gly Arg His Ile

1 5 10 15

Tyr Ile Tyr Val Pro Asp Pro Asp Val Ala Phe Val Pro Leu Gly Met

20 25 30

Thr Asp Tyr Leu Val Ile Val Glu Asp Asp Asp Ser Ala Ile Ile Pro

35 40 45

Cys Arg Thr Thr Asp Pro Glu Thr Pro Val Thr Leu His Asn Ser Glu

50 55 60

Gly Val Val Pro Ala Ser Tyr Asp Ser Arg Gln Gly Phe Asn Gly Thr

65 70 75 80

Phe Thr Val Gly Pro Tyr Ile Cys Glu Ala Thr Val Lys Gly Lys Lys

85 90 95

Phe Gln Thr Ile Pro Phe Asn Val Tyr Ala Leu Lys Ala Thr Ser Glu

100 105 110

Leu Asp Leu Glu Met Glu Ala Leu Lys Thr Val Tyr Lys Ser Gly Glu

115 120 125

Thr Ile Val Val Thr Cys Ala Val Phe Asn Asn Glu Val Val Asp Leu

130 135 140

Gln Trp Thr Tyr Pro Gly Glu Val Lys Gly Lys Gly Ile Thr Met Leu

145 150 155 160

Glu Glu Ile Lys Val Pro Ser Ile Lys Leu Val Tyr Thr Leu Thr Val

165 170 175

Pro Glu Ala Thr Val Lys Asp Ser Gly Asp Tyr Glu Cys Ala Ala Arg

180 185 190

Gln Ala Thr Arg Glu Val Lys Glu Met Lys Lys Val Thr Ile Ser Val

195 200 205

His Glu Lys Gly Phe Ile Glu Ile Lys Pro Thr Phe Ser Gln Leu Glu

210 215 220

Ala Val Asn Leu His Glu Val Lys His Phe Val Val Glu Val Arg Ala

225 230 235 240

Gly Gly Gly Gly Ser Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu

245 250 255

Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val

260 265 270

Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr

275 280 285

Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe

290 295 300

Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu

305 310 315 320

Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg

325 330 335

Gln Thr Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly

340 345 350

Glu Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly

355 360 365

Ile Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys

370 375 380

Leu Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys

385 390 395 400

Phe Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly

405 410 415

Leu Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser

420 425 430

Thr Phe Val Arg Val His Glu Lys Gly Gly Gly Gly Ser Asp Lys Thr

435 440 445

His Thr Cys Pro Leu Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser

450 455 460

Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg

465 470 475 480

Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro

485 490 495

Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala

500 505 510

Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val

515 520 525

Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr

530 535 540

Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr

545 550 555 560

Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu

565 570 575

Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys

580 585 590

Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser

595 600 605

Asn Gly Gln Pro Glu Asn Asn Tyr Lys Ala Thr Pro Pro Val Leu Asp

610 615 620

Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser

625 630 635 640

Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala

645 650 655

Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

660 665 670

<210> 15

<211> 670

<212> PRT

<213> KH-009

<400> 15

His Asn Asp Ser Arg Gly Leu Glu Thr Asp Glu Arg Lys Arg Leu Tyr

1 5 10 15

Ile Phe Val Pro Asp Pro Thr Val Gly Phe Leu Pro Asn Asp Ala Glu

20 25 30

Glu Leu Phe Ile Phe Leu Thr Glu Ile Thr Glu Ile Thr Ile Pro Cys

35 40 45

Arg Val Thr Asp Pro Gln Leu Val Val Thr Leu His Glu Lys Lys Gly

50 55 60

Asp Val Ala Leu Pro Val Pro Tyr Asp His Gln Arg Gly Phe Ser Gly

65 70 75 80

Ile Phe Glu Asp Arg Ser Tyr Ile Cys Lys Thr Thr Ile Gly Asp Arg

85 90 95

Glu Val Asp Ser Asp Ala Tyr Tyr Val Tyr Arg Leu Gln Val Ser Ser

100 105 110

Ile Asn Val Ser Val Asn Ala Val Gln Thr Val Val Arg Gln Gly Glu

115 120 125

Asn Ile Thr Leu Met Cys Ile Val Ile Gly Asn Glu Val Val Asn Phe

130 135 140

Glu Trp Thr Tyr Pro Arg Lys Glu Ser Gly Arg Leu Val Glu Pro Val

145 150 155 160

Thr Asp Phe Leu Leu Asp Met Pro Tyr His Ile Arg Ser Ile Leu His

165 170 175

Ile Pro Ser Ala Glu Leu Glu Asp Ser Gly Thr Tyr Thr Cys Asn Val

180 185 190

Thr Glu Ser Val Asn Asp His Gln Asp Glu Lys Ala Ile Asn Ile Thr

195 200 205

Val Val Glu Ser Gly Tyr Val Arg Leu Leu Gly Glu Val Gly Thr Leu

210 215 220

Gln Phe Ala Glu Leu His Arg Ser Arg Thr Leu Gln Val Val Phe Glu

225 230 235 240

Pro Gly Pro Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu Ile Ile

245 250 255

His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val Thr Ser

260 265 270

Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr Leu Ile

275 280 285

Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe Ile Ile

290 295 300

Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr

305 310 315 320

Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr

325 330 335

Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly Glu Lys

340 345 350

Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile Asp

355 360 365

Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu Val

370 375 380

Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe Leu

385 390 395 400

Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu Tyr

405 410 415

Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr Phe

420 425 430

Val Arg Val His Glu Lys Gly Gly Gly Gly Ser Asp Lys Thr His Thr

435 440 445

Cys Pro Leu Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe

450 455 460

Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro

465 470 475 480

Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val

485 490 495

Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr

500 505 510

Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val

515 520 525

Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys

530 535 540

Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser

545 550 555 560

Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro

565 570 575

Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val

580 585 590

Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly

595 600 605

Gln Pro Glu Asn Asn Tyr Lys Ala Thr Pro Pro Val Leu Asp Ser Asp

610 615 620

Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp

625 630 635 640

Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His

645 650 655

Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

660 665 670

<210> 16

<211> 670

<212> PRT

<213> KH-010

<400> 16

Tyr Asn His Thr Gln Thr Glu Glu Asn Glu Leu Glu Gly Arg His Ile

1 5 10 15

Tyr Ile Tyr Val Pro Asp Pro Asp Val Ala Phe Val Pro Leu Gly Met

20 25 30

Thr Asp Tyr Leu Val Ile Val Glu Asp Asp Asp Ser Ala Ile Ile Pro

35 40 45

Cys Arg Thr Thr Asp Pro Glu Thr Pro Val Thr Leu His Asn Ser Glu

50 55 60

Gly Val Val Pro Ala Ser Tyr Asp Ser Arg Gln Gly Phe Asn Gly Thr

65 70 75 80

Phe Thr Val Gly Pro Tyr Ile Cys Glu Ala Thr Val Lys Gly Lys Lys

85 90 95

Phe Gln Thr Ile Pro Phe Asn Val Tyr Ala Leu Lys Ala Thr Ser Glu

100 105 110

Leu Asp Leu Glu Met Glu Ala Leu Lys Thr Val Tyr Lys Ser Gly Glu

115 120 125

Thr Ile Val Val Thr Cys Ala Val Phe Asn Asn Glu Val Val Asp Leu

130 135 140

Gln Trp Thr Tyr Pro Gly Glu Val Lys Gly Lys Gly Ile Thr Met Leu

145 150 155 160

Glu Glu Ile Lys Val Pro Ser Ile Lys Leu Val Tyr Thr Leu Thr Val

165 170 175

Pro Glu Ala Thr Val Lys Asp Ser Gly Asp Tyr Glu Cys Ala Ala Arg

180 185 190

Gln Ala Thr Arg Glu Val Lys Glu Met Lys Lys Val Thr Ile Ser Val

195 200 205

His Glu Lys Gly Phe Ile Glu Ile Lys Pro Thr Phe Ser Gln Leu Glu

210 215 220

Ala Val Asn Leu His Glu Val Lys His Phe Val Val Glu Val Arg Ala

225 230 235 240

Pro Gly Pro Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu Ile Ile

245 250 255

His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val Thr Ser

260 265 270

Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr Leu Ile

275 280 285

Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe Ile Ile

290 295 300

Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu Ala Thr

305 310 315 320

Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg Gln Thr

325 330 335

Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly Glu Lys

340 345 350

Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly Ile Asp

355 360 365

Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys Leu Val

370 375 380

Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys Phe Leu

385 390 395 400

Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly Leu Tyr

405 410 415

Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser Thr Phe

420 425 430

Val Arg Val His Glu Lys Gly Gly Gly Gly Ser Asp Lys Thr His Thr

435 440 445

Cys Pro Leu Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe

450 455 460

Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro

465 470 475 480

Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val

485 490 495

Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr

500 505 510

Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val

515 520 525

Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys

530 535 540

Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser

545 550 555 560

Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro

565 570 575

Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val

580 585 590

Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly

595 600 605

Gln Pro Glu Asn Asn Tyr Lys Ala Thr Pro Pro Val Leu Asp Ser Asp

610 615 620

Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp

625 630 635 640

Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His

645 650 655

Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

660 665 670

<210> 17

<211> 670

<212> PRT

<213> KH-011

<400> 17

His Asn Asp Ser Arg Gly Leu Glu Thr Asp Glu Arg Lys Arg Leu Tyr

1 5 10 15

Ile Phe Val Pro Asp Pro Thr Val Gly Phe Leu Pro Asn Asp Ala Glu

20 25 30

Glu Leu Phe Ile Phe Leu Thr Glu Ile Thr Glu Ile Thr Ile Pro Cys

35 40 45

Arg Val Thr Asp Pro Gln Leu Val Val Thr Leu His Glu Lys Lys Gly

50 55 60

Asp Val Ala Leu Pro Val Pro Tyr Asp His Gln Arg Gly Phe Ser Gly

65 70 75 80

Ile Phe Glu Asp Arg Ser Tyr Ile Cys Lys Thr Thr Ile Gly Asp Arg

85 90 95

Glu Val Asp Ser Asp Ala Tyr Tyr Val Tyr Arg Leu Gln Val Ser Ser

100 105 110

Ile Asn Val Ser Val Asn Ala Val Gln Thr Val Val Arg Gln Gly Glu

115 120 125

Asn Ile Thr Leu Met Cys Ile Val Ile Gly Asn Glu Val Val Asn Phe

130 135 140

Glu Trp Thr Tyr Pro Arg Lys Glu Ser Gly Arg Leu Val Glu Pro Val

145 150 155 160

Thr Asp Phe Leu Leu Asp Met Pro Tyr His Ile Arg Ser Ile Leu His

165 170 175

Ile Pro Ser Ala Glu Leu Glu Asp Ser Gly Thr Tyr Thr Cys Asn Val

180 185 190

Thr Glu Ser Val Asn Asp His Gln Asp Glu Lys Ala Ile Asn Ile Thr

195 200 205

Val Val Glu Ser Gly Tyr Val Arg Leu Leu Gly Glu Val Gly Thr Leu

210 215 220

Gln Phe Ala Glu Leu His Arg Ser Arg Thr Leu Gln Val Val Phe Glu

225 230 235 240

Gly Gly Gly Gly Ser Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu

245 250 255

Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val

260 265 270

Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr

275 280 285

Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe

290 295 300

Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu

305 310 315 320

Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg

325 330 335

Gln Thr Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly

340 345 350

Glu Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly

355 360 365

Ile Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys

370 375 380

Leu Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys

385 390 395 400

Phe Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly

405 410 415

Leu Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser

420 425 430

Thr Phe Val Arg Val His Glu Lys Pro Gly Pro Asp Lys Thr His Thr

435 440 445

Cys Pro Leu Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe

450 455 460

Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro

465 470 475 480

Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val

485 490 495

Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr

500 505 510

Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val

515 520 525

Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys

530 535 540

Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser

545 550 555 560

Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro

565 570 575

Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val

580 585 590

Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly

595 600 605

Gln Pro Glu Asn Asn Tyr Lys Ala Thr Pro Pro Val Leu Asp Ser Asp

610 615 620

Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp

625 630 635 640

Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His

645 650 655

Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

660 665 670

<210> 18

<211> 670

<212> PRT

<213> KH-012

<400> 18

Tyr Asn His Thr Gln Thr Glu Glu Asn Glu Leu Glu Gly Arg His Ile

1 5 10 15

Tyr Ile Tyr Val Pro Asp Pro Asp Val Ala Phe Val Pro Leu Gly Met

20 25 30

Thr Asp Tyr Leu Val Ile Val Glu Asp Asp Asp Ser Ala Ile Ile Pro

35 40 45

Cys Arg Thr Thr Asp Pro Glu Thr Pro Val Thr Leu His Asn Ser Glu

50 55 60

Gly Val Val Pro Ala Ser Tyr Asp Ser Arg Gln Gly Phe Asn Gly Thr

65 70 75 80

Phe Thr Val Gly Pro Tyr Ile Cys Glu Ala Thr Val Lys Gly Lys Lys

85 90 95

Phe Gln Thr Ile Pro Phe Asn Val Tyr Ala Leu Lys Ala Thr Ser Glu

100 105 110

Leu Asp Leu Glu Met Glu Ala Leu Lys Thr Val Tyr Lys Ser Gly Glu

115 120 125

Thr Ile Val Val Thr Cys Ala Val Phe Asn Asn Glu Val Val Asp Leu

130 135 140

Gln Trp Thr Tyr Pro Gly Glu Val Lys Gly Lys Gly Ile Thr Met Leu

145 150 155 160

Glu Glu Ile Lys Val Pro Ser Ile Lys Leu Val Tyr Thr Leu Thr Val

165 170 175

Pro Glu Ala Thr Val Lys Asp Ser Gly Asp Tyr Glu Cys Ala Ala Arg

180 185 190

Gln Ala Thr Arg Glu Val Lys Glu Met Lys Lys Val Thr Ile Ser Val

195 200 205

His Glu Lys Gly Phe Ile Glu Ile Lys Pro Thr Phe Ser Gln Leu Glu

210 215 220

Ala Val Asn Leu His Glu Val Lys His Phe Val Val Glu Val Arg Ala

225 230 235 240

Gly Gly Gly Gly Ser Pro Phe Val Glu Met Tyr Ser Glu Ile Pro Glu

245 250 255

Ile Ile His Met Thr Glu Gly Arg Glu Leu Val Ile Pro Cys Arg Val

260 265 270

Thr Ser Pro Asn Ile Thr Val Thr Leu Lys Lys Phe Pro Leu Asp Thr

275 280 285

Leu Ile Pro Asp Gly Lys Arg Ile Ile Trp Asp Ser Arg Lys Gly Phe

290 295 300

Ile Ile Ser Asn Ala Thr Tyr Lys Glu Ile Gly Leu Leu Thr Cys Glu

305 310 315 320

Ala Thr Val Asn Gly His Leu Tyr Lys Thr Asn Tyr Leu Thr His Arg

325 330 335

Gln Thr Val Val Leu Ser Pro Ser His Gly Ile Glu Leu Ser Val Gly

340 345 350

Glu Lys Leu Val Leu Asn Cys Thr Ala Arg Thr Glu Leu Asn Val Gly

355 360 365

Ile Asp Phe Asn Trp Glu Tyr Pro Ser Ser Lys His Gln His Lys Lys

370 375 380

Leu Val Asn Arg Asp Leu Lys Thr Gln Ser Gly Ser Glu Met Lys Lys

385 390 395 400

Phe Leu Ser Thr Leu Thr Ile Asp Gly Val Thr Arg Ser Asp Gln Gly

405 410 415

Leu Tyr Thr Cys Ala Ala Ser Ser Gly Leu Met Thr Lys Lys Asn Ser

420 425 430

Thr Phe Val Arg Val His Glu Lys Pro Gly Pro Asp Lys Thr His Thr

435 440 445

Cys Pro Leu Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe

450 455 460

Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro

465 470 475 480

Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val

485 490 495

Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr

500 505 510

Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val

515 520 525

Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys

530 535 540

Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser

545 550 555 560

Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro

565 570 575

Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val

580 585 590

Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly

595 600 605

Gln Pro Glu Asn Asn Tyr Lys Ala Thr Pro Pro Val Leu Asp Ser Asp

610 615 620

Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp

625 630 635 640

Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His

645 650 655

Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

660 665 670

Claims (6)

1. a fusion rotein, is characterized in that, different fragments and the human normal immunoglobulin Fc of pdgf receptor and vegf receptor, consists of, and its concrete structure is as follows:

The aminoacid sequence of KH-001 is as described in SEQ ID NO.7 in sequence table;

The aminoacid sequence of KH-002 is as described in SEQ ID NO.8 in sequence table;

The aminoacid sequence of KH-003 is as described in SEQ ID NO.9 in sequence table;

The aminoacid sequence of KH-004 is as described in SEQ ID NO.10 in sequence table;

The aminoacid sequence of KH-005 is as described in SEQ ID NO.11 in sequence table;

The aminoacid sequence of KH-006 is as described in SEQ ID NO.12 in sequence table;

The aminoacid sequence of KH-007 is as described in SEQ ID NO.13 in sequence table;

The aminoacid sequence of KH-008 is as described in SEQ ID NO.14 in sequence table;

The aminoacid sequence of KH-009 is as described in SEQ ID NO.15 in sequence table;

The aminoacid sequence of KH-010 is as described in SEQ ID NO.16 in sequence table;

The aminoacid sequence of KH-011 is as described in SEQ ID NO.17 in sequence table;

The aminoacid sequence of KH-012 is as described in SEQ ID NO.18 in sequence table.

2. a pharmaceutical composition, is characterized in that being comprised of fusion rotein described in claim 1 and pharmaceutically acceptable carrier or vehicle.

3. pharmaceutical composition according to claim 2, the dosage form that it is characterized in that described pharmaceutical composition is injection, injection freeze-dried powder or gel for eye use.

4. fusion rotein according to claim 1, is characterized in that the application of described fusion rotein in preparing the medicine for the treatment of the disease caused by angiogenesis or growth.

5. fusion rotein according to claim 4, is characterized in that the disease that described angiogenesis or growth cause is the disease that tumour or ocular angiogenesis cause.

6. fusion rotein according to claim 5, is characterized in that the disease that described ocular angiogenesis causes is the disease that choroidal neovascularization causes.

Images