CN102296059A - Method for parallel assembly of multiple DNA fragments - Google Patents

Abstract

The invention relates to a method for parallel assembly of multiple DNA fragments. The method comprises that an annular or linear unit vector is putted into an annular host or a linear host to form a gene vector and the recombined DNA genetic materials are obtained through annular or linear vector recovery. The method is characterized in that the method can realize parallel simultaneous operation on multiple DNA fragments, and thus improving efficiency of DNA assembly which aims at forming a novel DNA structure, preventing DNA pollution and disproportionation and guaranteeing quality of recombined DNA to realize a design purpose. Time spent on assembly of multiple DNA fragments is approximately proportional to log (N). Assembly processes are carried out in a cell or outside the cell and thus multiple DNA fragments can be spliced into a novel structure in any order. The method is suitable for being utilized in gene recombination which aims at forming a novel organism and belongs to the genetic engineering field.

Description

The method of the parallel assembling of a kind of multistage DNA

Technical field

What the present invention relates to is the field of genetic engineering gene recombination technology, the method for the parallel assembling of specifically a kind of multistage DNA.

Background technology

The at present human life form that is touched all needs whole features of complete cellularstructure competence exertion organism.In the middle of cell, DNA is main genetic material, and DNA transcribes and forms RNA, and the RNA translation obtains protein, and RNA and protein are realized biological function in biomass cells.Therefore to the transformation of this confrontation DNA of the transformation of biology.Transformation ability to DNA has determined human transformation even has created biological ability.

After 2005, the synthetic biology correlation technique need develop and suitable development and the needs of extensive genome packing technique to adapt to genetically engineered, metabolic engineering.

" recombinant DNA technology " (recombinant DNA technology) invented in 1973, still generally used so far.But the dependence owing to restriction enzyme causes this technology to have following defective:

1, restriction endonuclease recognition sequence commonly used is generally the 4-8 base pair, is generally 6 base pairs, just contains a restriction endonuclease sites in the middle of the n DNA of average every 4096bp length.The DNA of long segment often contains multiple restriction endonuclease sites and is difficult to operation.

2, restriction endonuclease sites needs manipulation in vitro, and the lengthy motion picture segment DNA is difficult to carry out manipulation in vitro.

3, when needs avoid restricted in during restriction enzyme site, be difficult to parallelization and operate.

For the shortcoming that overcomes " recombinant DNA technology " solves multistage DNA packing problem, have following method to be suggested in recent years:

One, based on the method for restriction endonuclease

A) BioBrick system

The IGEM of MIT tissue is advocated by synthetic gene and is evaded some restriction endonuclease sites that the script in the middle of the n DNA has, thereby utilizes isocaudarner to carry out the parallelization assembling.Has following structure in the middle of the DNA of the BioBrick of a standard of BioBrick agreement regulation successively: EcoRI site, XbaI site, dna fragmentation, SpeI site, PstI site.Wherein do not contain EcoRI, XbaI, SpeI, PstI site in the middle of the synthetic dna fragmentation.XbaI is the isocaudarner that has identical sticky end after enzyme is cut with SpeI, but they obtain non-palindromic sequence after connecting, restriction enzyme site disappears, thereby the product that makes assembling still has the structure in turn in EcoRI site, XbaI site, dna fragmentation, SpeI site, PstI site, can be used for further assembling.The shortcoming of this method: 1, the cost of synthetic DNA is than higher.2, can not avoid large fragment DNA to be difficult to carry out the problem of manipulation in vitro.

B) based on producing the not multistage DNA connection method of the restriction enzyme of specific sticking end.

Contain not particular sequence in the recognition sequence of minority restriction enzyme, for example the recognition site of SfiI is: GGCCNNNN^NGGCC, wherein N can be any base pair of ATGC.This enzyme cutting produces the sticking arbitrarily terminal of three base NNN.Utilize different sticking terminal couplings can connect multistage DNA simultaneously.The shortcoming of this method: 1, can not avoid the problem that contains the type restriction enzyme site in the native sequences.2, the disposable segments that assembles generally should not surpass 10 sections, otherwise joint efficiency is very low.3, be difficult to carry out manipulation in vitro for big fragment.

Two, reorganization package technique

A) based on the selection markers exchange process of subtilis homologous recombination.

This method uses the central a kind of homologous recombination of subtilis.Each fragment to be assembled need be reserved homology arm, and is connected in the middle of the domino carrier.The Domino carrier has two kinds of different antibiotic forms.In regrouping process, carrier need be cut into linearity earlier and connect into multistage multiple linear structure external.When containing a kind of carrier of resistance in the middle of the genome, then next assembling fragment will be placed in the carrier that contains another resistance; This carrier carries the assembling fragment and genome is recombinated, and replaces original carrier and resistance in the genome, thereby realizes assembling one by one fragment.The fragment that assembles can be taken out in the middle of subtilis by homologous recombination once more, and is used for recombinating next time.The shortcoming of this method:, the mistake reorganization can occur when in the middle of heavily waiting to assemble fragment, tumor-necrosis factor glycoproteins being arranged 1, owing to utilize homologous recombination fully.2, this method recombination efficiency is not high, the actual employing of few people.

B) locus specificity reorganization construction from part

United States Patent (USP) " recombination method assembling large fragment DNA " (Recombination assembly of large DNA fragments, US7267984) the central system of describing an annular genome and circular plasmids.Comprise 3 sites in the middle of its genome, be respectively applied for reorganization and insert, cut out carrier, reclaim carrier.The shortcoming of this method: 1, be a der group assembling system, can not parallelization.

Three, vitro recombination method

A) vitro recombination method

The principle of this method is a vitro recombination: obtaining the DNA that terminal strand stretches out by methods such as incomplete PCR or T4 archaeal dna polymerase or the decomposition of λ excision enzyme, the single stranded DNA that utilizes the base pairing principle to make then to stretch out is according to the pairing combination.At first, make PCR fragment end to be assembled have specific recombinant fragment, be generally 30bp by PCR primer or the design of gene synthetic; Handle these PCR fragments with the T4 archaeal dna polymerase then, obtain end and possess the product that the strand end stretches out, utilize the vitro recombination method to assemble these DNA then.The shortcoming of this method: 1,, introduce sudden change easily owing to relate to the PCR process.2 and be not suitable for the assembling long segment.

B) improved vitro recombination method

Improved vitro recombination method is consistent with SLIC on principle.This method has following improvement than the SLIC method: 1, increased the length of recombinant fragment, used the homology end of 80 bases to recombinate usually, can use the homology end that reaches the 200-250 base under a few cases; 2, in the middle of reaction system, increased archaeal dna polymerase and ligase enzyme, made product after the complementary reorganization of strand can mend flat and be connected to double-stranded global DNA.When 3, needing, in the middle of reaction system, can introduce T5 exo excision enzyme to cut away the terminal one section non-coupling single stranded DNA of single stranded DNA.The shortcoming of this method: 1, owing to the increase of reorganization desired length, for natural fragment, one time PCR is difficult to obtain the above recombinant fragment of 80 bases, so this method is mainly used in full chemosynthesis genome.And full chemosynthesis genome cost is too high, causes range of application that considerable restraint is arranged.2, need in the assembling process to use than the carrier of high copy number do in the middle of clone, in the middle of E. coli, should not assemble fragment above 50Kbp.

Correlation technique:

The U.S. Pat 5888732 of Invitrogen has been protected following content: if a plasmid may be split into and is two portions; wherein Yi Bufen two ends are two Attachment recombination sites of not recombinating mutually, and then this plasmid and recombining reaction thereof belong to the protection domain of US5888732.

Lambda red reorganization and cutting out: an other class recombining reaction of finding in the intestinal bacteria Lambda Red phage is by Lambda Red Alpha, Beta, Exo and colibacillary RecA enzyme catalysis.This reaction can catalysis PCR or enzyme flat end or the sticking terminal linear DNA of cutting generation recombinate with genome or plasmid.When utilizing the playback restriction endonuclease to cut karyomit(e) in Bacillus coli cells, Lambda Red reorganization can be induced and be cut out dna fragmentation.Lambda Red reorganization is by WO 1999029837 patent protections such as grade.

Shape material grain N15 phage and similar phage can be present in the middle of the host bacteria with linear.Its two ends are hair fastener shape telomeres of sealing.Deliver very early based on the plasmid of N15 phage, according to the regulation of general patent law, this linear phage and plasmid itself can not be subjected to patent protection.U.S. Pat 20090263873 in application is applied for the cloning vector of protection based on this plasmid at present.Linear unit carrier among the present invention and recovery carrier have used shape material grain.

The glm gene group: most of prokaryotic micro-organisms all has annular karyomit(e), and minority is natural to have linear karyomit(e).There is one in the karyomit(e) such as agrobacterium tumefaciens (Agrobacterium tumefaciens) for linear.The Telomerase recognition site of N15 phage is incorporated into the correct position of escherichia coli chromosome, and expresses Telomerase, can make colibacillary linearization of karyomit(e).This result is open, this content of no patent protection.

Summary of the invention

In order to overcome the existing existing defective of DNA package technique, the present invention proposes the method for the parallel assembling of a kind of multistage DNA.This method is carried out the gene butt joint by utilizing the unit carrier to insert the host, and then reclaims carrier, solves the technical problem of multistage DNA assembling.

The scheme that technical solution scheme of the present invention is adopted is:

Treat the assembling fragment and clone, met the unit carrier of " macroelement carrier " structure;

Select a series of differences that contain according to " the assembling function " of unit carrier and wait to assemble segmental macroelement carrier, form " can assemble formation ";

To " assembling formation and " carry out " the parallel assembling of formation ";

Concrete steps:

(1) at first, according to assembling implementer's needs, " fragment to be assembled " is cloned into " dummy cell carrier " central form " unit carrier "; Get to contain and remain to be assembled segmental " unit carrier " and other " macroelement carrier " formation at least a " formation just begins to assemble "; Then, " formation just begins to assemble " carried out " the parallel assembling of formation ", the unit amount vector equals 1 in " can assemble formation " of forming; 1 carrier of gained in the last formation comprises the institute that needs design sequence to arrange according to the assembling implementer and remains to be assembled segmental assembling product;

And,

(2) assembling is if take place in cell, and then required recombinase is expressed by " helper plasmid "; Assembling is if take place in the extracellular, and then required recombinase directly adds with the albumen form;

And,

(3) when " the parallel assembling of formation " the auxiliary of " helper plasmid ", " assembling host ", " recovery carrier " when needing, arranged in the assembling process;

Described " macroelement carrier " comprises " unit carrier " and " assembling host ";

The constitutional features of described " unit carrier " is as follows: " unit carrier " structure has following 2 kinds of possibilities:

(1) a kind of is to contain substance structure site " unit carrier ", comprises successively by the sequence order: left arm, left reactive end, fragment to be assembled, right reactive end, right arm, topology reconstruction site, connect left arm;

Perhaps,

(2) another kind is to contain dual structure site unit carrier, comprises successively by the sequence order: fixed arm, reclaim reconstruct site, left arm, left reactive end, fragment to be assembled, right reactive end, right arm, topology reconstruction site, connect the aforementioned fixation arm;

Described " fragment to be assembled " forms " the unit carrier " that contains " fragment to be assembled " in the middle of being connected to " dummy cell carrier ";

Described " assembling host " is that " fragment to be assembled " length is 0 " unit carrier ", has following constitutional features: fixed arm, reclaim reconstruct site, left arm, left reactive end and right reactive end and one, right arm, topology reconstruction site are arranged at least, connect the aforementioned fixation arm;

Described " macroelement carrier " has following feature:

(1) difference of " assembling function " type of " macroelement carrier " is left reactive end, right reactive end, topology reconstruction site, reclaims the difference in reconstruct site;

And,

(2) " macroelement carrier " has at least 1 type " assembling function ";

And,

(3) reactive end of " the macroelement carrier " of different types " assembling function " and the selection in reconstruct site will be satisfied: " the macroelement carrier " of any " assembling function ", and exist " the macroelement carrier " of a kind of " assembling function " " to match each other " at least with it;

And,

(4) all kinds of " the assembling function " of " macroelement carrier " will satisfy: for any amount fragment to be assembled, have a kind of " can assemble formation " at least;

The constitutional features of described " recovery carrier " is as follows:

(1) " recovery carrier " has and reclaims reconstruct site, left reactive end, right reactive end, topology reconstruction site, connects in the middle of 4 recombination sites of aforementioned fixation arm at least wherein 2;

And,

(2) " the macroelement carrier " of " recovery carrier " and " coupling " to carry out the purpose product of " carrier displacement " still be " macroelement carrier ";

Described " fragment to be assembled " is the fragment that the assembling implementer need assemble; The dna sequence dna of " fragment to be assembled ", allowing is the reorganization that does not participate in reactive end, topology reconstruction site, recovery reconstruct site arbitrarily, and does not participate in the dna sequence dna of the screening of replicon and selection markers;

It is described that to wait to assemble segmental " left reactive end " and " right reactive end " be to have the dna sequence dna that the reorganization ability takes place; And in " assembling reaction ", same unit carries intravital left reactive end and right reactive end does not have mutual reorganization ability; And, in " assembling reaction ", from disappearing after the left reactive end of " the macroelement carrier " of different " assembling functions " and the reorganization of right reactive end or becoming the active dna sequence dna of under this recombinase, not recombinating; And " left reactive end " and " right reactive end " comes from the dummy cell carrier or comes from fragment to be assembled;

Described " topology reconstruction site " is the sequence-specific recombination site, or Telomerase site, or 2 telomeres that disconnect mutually, and in same " assembling reaction ", have the reorganization of generation ability, and in same " assembling reaction ", do not have with identical carrier in reactive end or reclaim the ability of reconstruct site reorganization; And when the topology reconstruction site was 2 telomeres that disconnect mutually, the vector dna molecule that contains the topology reconstruction site was linear on topological framework;

Described " reclaiming the reconstruct site " is to have the dna sequence dna that the reorganization ability takes place in " assembling reaction ", and in same " assembling reaction ", do not have with identical carrier in the ability of any reactive end reorganization, and do not have in same " assembling reaction " with identical carrier in the ability of topology reconstruction site reorganization;

Described " fixed arm ", " left arm ", " right arm " are not have with reactive end, topology reconstruction site arbitrarily in " assembling reaction ", reclaim the dna sequence dna of reconstruct site reorganization ability, comprising at least one replicon and at least one selection markers;

Described " displacement arm " is the dna sequence dna that does not participate in the reorganization in reactive end, topology reconstruction site, recovery reconstruct site arbitrarily;

Described " recovery carrier " has following 3 features with " the site coupling " of " macroelement carrier ":

(1) in " recovery carrier " recombination site of comprising with the recovery reconstruct site of " macroelement carrier ", left reactive end, right reactive end, topology reconstruction site recombination site in the middle of at least 2 have the abilities that reorganization takes place;

And,

(2) " recovery carrier " meets the constitutional features of " macroelement carrier " with " macroelement carrier " generation " carrier displacement " purpose product afterwards, and has the screening feature before the reaction of being different from;

" carrier displacement " definition of described " recovery carrier " and " macroelement carrier " comprises following 2 reactions:

(1) " recovery carrier " and " macroelement carrier " reclaim and have wherein 2 in the middle of reconstruct site, left reactive end, right reactive end, 4 recombination sites in topology reconstruction site at least and recombinate;

After the purpose product of described " carrier displacement " is " carrier displacement " reaction, obtain " fragment to be assembled " and the carrier that meet " macroelement carrier " feature of reactant central " macroelement carrier ";

" the matching each other " of described " macroelement carrier " is defined as satisfies following three conditions simultaneously:

(1) satisfies the reactive end coupling: 2 unit carriers, perhaps wherein 2 unit carriers are through " carrier displacement " afterwards at the most, the right reactive end of one of them unit carrier has the ability of recombinating with the left reactive end of another unit carrier, and perhaps the left reactive end of one of them unit carrier has the ability of recombinating with the right reactive end of another unit carrier; Above-mentioned two kinds of situations do not take place under the same enzyme catalysis simultaneously; This reorganization is defined as " reorganization of reactive end coupling ";

And,

(2) satisfy reconstruct site coupling: 2 unit carriers itself, perhaps wherein both unit carriers are through " carrier displacement " afterwards at the most, under the same enzyme catalysis, the topology reconstruction site of one of them unit carrier and another unit carrier has the reorganization ability, perhaps the topology reconstruction site of one of them unit carrier and another unit carrier is the telomere form of disconnection simultaneously, and perhaps the recovery reconstruct site of one of them unit carrier and another unit carrier has the reorganization ability; Above-mentioned three kinds of situations do not take place under the same enzyme catalysis simultaneously; This reorganization is defined as " the coupling reorganization of reconstruct site ";

And,

(3) satisfy the screening characteristic matching: 2 the unit carriers itself that match each other, perhaps wherein both unit carriers are through " carrier displacement " afterwards at the most, each step recombinant products of assembling between the unit carrier is all had any different in the screening changing features of crossing reacting precursor;

Described " matching unit carrier to " is defined as 2 " macroelement carriers " of satisfied " matching each other " relation;

Described " assembling reaction " is the recombining reaction that takes place between 2 " the macroelement carriers " of " matching each other ", and its feature is as follows:

(1) under the situation that " matching each other " needs, carries out required " carrier displacement " with " recovery carrier " earlier, " reorganization of reactive end coupling " and " the coupling reorganization of reconstruct site " 2 reorganization take place then;

And,

(2) " assembling reaction " product is to contain the institute that is comprised in its 2 " macroelement carrier " precursors in the middle of the recombining reaction product to remain to be assembled segmental carrier;

According to the structure of described unit carrier, the product of " assembling reaction " satisfies the definition of unit carrier, still is called " unit carrier ", has the ability that continues to take place with " the macroelement carrier " of coupling the assembling reaction;

Described " can assemble formation " is the formation that is made of " macroelement carrier "; And satisfy: " macroelement carrier " quantity is 2N or 2N+1 in formation, and N is a nonnegative integer, can pick out " the matching unit carrier to " that be no more than N not shared mutually " macroelement carrier " in the formation, this is no more than these " matching unit carriers to " in " macroelement carrier " the alternative former formation that obtains after N's " matching unit carrier to " generations " assembling reaction ", the formation that obtains still meets the condition of " can assemble formation ";

Described " formation just begins to assemble " is one " can assemble formation ", is made of the unit carrier that contains " fragment to be assembled " and " assembling host "; And the quantity of " unit carrier " that contains " fragment to be assembled " in the formation is consistent with the number of fragments of required assembling, and each " unit carrier " contains a fragment to be assembled; And, contained the waiting of unit carrier in the formation assemble segmental order with the assembling implementer the purpose assembling sequence consistent;

Described " the parallel assembling of formation " is defined as following process: according to aforementioned definitions, in " macroelement carrier " quantity is N " the matching unit carrier to " of sharing unit carrier not mutually that be no more than that exists in " can assemble formation " of 2N or 2N+1 (N is a nonnegative integer), make this be no more than N " matching unit carrier to " parallel simultaneously carrying out " assembling reaction ", and with " assembling reaction " product of each " matching unit carrier to " or " host's intermediate " alternative former " matching unit carrier to ";

The macroelement carrier:

(1) all kinds of " the assembling function " of described " macroelement carrier " further satisfies: for " fragment to be assembled " of any amount, have a kind of " coupling assembling formation " at least;

And,

(2), make described " formation just begins to assemble " satisfy the requirement of " coupling assembling formation " by selecting " the macroelement carrier " of " coupling ";

And,

(3) " formation just begins to assemble " of satisfying " coupling assembling formation " requirement carried out " assembling of formation PARALLEL MATCHING ";

Described " coupling assembling formation " is " can assemble formation " of satisfying following 2 conditions:

(1) " macroelement carrier " quantity is 2N or 2N+1 in formation, and N is nonnegative integer, then has " the matching unit carrier to " of N not shared mutually " macroelement carrier " in the formation;

And,

(2) substitute these " matching unit carriers to " in former formation with " the macroelement carrier " that obtain after aforementioned N " matching unit carrier to " generations " assembling reaction ", the formation that obtains still meets the condition of " coupling is assembled formation ";

Described " assembling of formation PARALLEL MATCHING " is defined as following process: according to aforementioned definitions, in " macroelement carrier " quantity is 2N or 2N+1, and N is N not shared mutually " macroelement carrier " existing in the nonnegative integer " coupling assembling formation " " matching unit carrier to ", make this N " matching unit carrier to " parallel simultaneously carrying out " assembling reaction ", and with " assembling reaction " product of each " matching unit carrier to " alternative former " matching unit carrier to ";

First kind of selection markers:

(1) selection markers has at least a kind, and one of the left arm of every kind " unit carrier " or right arm have selection markers;

And,

(2) " assemble reaction " when taking place, in the cell at " assembling host " place, " unit carrier " do not have replication; And " assembling host " is karyomit(e); And, reclaim carrier and when specific helper plasmid exists, have the ability of in the assembling host, duplicating;

And,

(3) wherein after a group of " unit carrier " and " assembling host " generations " reorganization of reactive end coupling ", " the coupling reorganization of reconstruct site ", the selection markers of utilization " unit carrier " screens the intermediate product that intermediate screens the selection markers that contains the unit carrier; After another group wherein of " reactive end coupling reorganization ", " the coupling reorganization of reconstruct site " takes place in intermediate product again, utilize " unit carrier " with selection markers lose screening " assembling is reacted " product;

And,

(4) screening of " carrier displacement " purpose product: after one of them of 2 reorganization of " macroelement carrier " and " recovery carrier " generation " carrier displacement " reaction, utilize the selection markers of " recovery carrier " to screen intermediate; Wherein another of 2 reorganization of " carrier displacement " reaction takes place in intermediate again, utilizes " recovery carrier " reproducible screening " carrier displacement " product under particular copy albumen;

And,

(5) " helper plasmid " is the temperature sensitivity carrier; And, before each step reorganization, helper plasmid is transformed into host cell; And, do not have at " helper plasmid " in each step reorganization back under the temperature of replication and cultivate, helper plasmid is removed from host cell;

Second kind of selection markers:

(1) selection markers has at least 2 kinds, and the left arm or the right arm of " the unit carrier " of every kind " assembling function " have a kind of selection markers, and the selection markers that two arms are had is different; And " assembling reaction " when taking place, in the host cell at " assembling host " place, " unit carrier " do not have replication; And " assembling host " is karyomit(e), and the assembling host of at least 2 kinds of differences " assembling function " is arranged, and every kind contains a kind of different selection markers; And " recovery carrier " has the ability of duplicating containing its " helper plasmid " that duplicates required replication protein in host cell when existing;

(2) after " unit carrier " and " macroelement carrier " generation " assembling reaction ", utilize " macroelement carrier " with the selection markers of quilt " unit carrier " of selection markers replace and screen " assembling reaction " product;

(3) after one of them of 2 reorganization of " macroelement carrier " and " recovery carrier " generation " carrier displacement " reaction, utilize " recovery carrier " and " macroelement carrier " 2 selection markers to screen " carrier displacement " product;

The third selection markers:

(1) selection markers has at least 3 kinds, and the left arm and the right arm of every kind " unit carrier " have a kind of selection markers, and the selection markers that two arms are had is different;

And,

(2) " assembling and react " 2 reorganization that comprised carries out simultaneously; And, the purpose product of " assembling reaction " contains the selection markers combination that is different from its 2 " unit carrier " precursors, makes this product have the operability that screens from the mixing species of recombinant products, by product and the unit carrier that do not react by this selection markers combination;

And,

(3) assembling process does not need " recovery carrier " and " assembling host ";

And,

(4) " helper plasmid " expresses 22 recombinases that reaction is required that " assembling reaction " comprises simultaneously;

Reactive end, recovery reconstruct site, topology reconstruction site:

Described reactive end, reclaim the reconstruct site, the topology reconstruction site is frt, loxP, the recombination site attB of Lambda phage, attB1, attB2, attB3, attB4, attB5, attP, attP1, attP2 attP3, attP4, attP5, attL, attL1, attL2, attL3, attL4, attL5, attR, attR1, attR2, attR3, attR4, attR5, the recombination site attB of HK022 phage, attP, attL, attR, the recombination site attB of phi80 phage, attP, attL, attR, the recombination site attB of P21 phage, attP, attL, attR, the recombination site attB of P22 phage, attP, attL, attR; Described reactive end is the required homologous sequence of lambda red reorganization;

The Telomerase recognition site:

Telomerase recognition site or telomere are the recognition site or the telomere of procaryotic Telomerase, comprise the Telomerase recognition site of Enterobacteria phage N15, Vibrio phage VP882, Klebsiella phage phiKO2, Yersinia phage PY54 etc.; Telomere also is the chromosomal telomere of eukaryote;

Unit carrier, assembling host, recovery carrier:

Described unit carrier, assembling host, reclaim carrier and be prokaryotic organism or Eukaryotic plasmid, also be prokaryotic organism or Eukaryotic genome;

Unit carrier, the conversion site of reclaiming carrier:

Described unit carrier, reclaim to contain to engage in the middle of the carrier and transform the site, and the assembling host microorganism does not need the outer molecule manipulation of host cell when possessing the conversion capability of joint; Described unit carrier, reclaim not contain to engage in the middle of the carrier and transform the site, or and host microorganism when not possessing the conversion capability of joint, need the outer molecule manipulation of host cell;

The recombination site recombinase:

When using the recombinase of recombination site in the extracellular, the corresponding Cre recombinase of loxP, the corresponding FLP recombinase of frt, the BP of Lambda phage recombinate corresponding Lambda Int and IHF, the BP of Lambda phage the corresponding Lambda Int that recombinates, Xis and IHF, the BP of=HK022 phage recombinate corresponding HK022 Int and IHF, the BP of HK022 phage the corresponding HK022 Int that recombinates, Xis and IHF, the BP of phi80 phage recombinate corresponding phi80 Int and IHF, the BP of phi80 phage the corresponding phi80 Int that recombinates, Xis and IHF, the BP of P21 phage recombinate corresponding P21 Int and IHF, the BP of P21 phage the corresponding P21 Int that recombinates, Xis and IHF, the BP of P22 phage recombinate corresponding P22 Int and IHF, the BP of P22 phage the corresponding P22 Int that recombinates, Xis and IHF, the recombining reaction in the assembling process has the ability of carrying out in the extracellular;

Wherein:

One-sided telomere after two linear carriers are recombinated exchanges, and is considered as in the telomere site once reorganization having taken place, because this process is equivalent to twice reorganization of annular carrier; For example linear carrier A and B telomere are labeled as T, about two telomeres use L and Zone R branch respectively, in carrier, recombinate between X and the Y, as follows:

T ^L _A-X _A-Y _A-?T ^R _A?+?T ^L _B-X _B-Y _B-?T ^R _B?è?T ^L _A-X _A-Y _B-?T ^R _B?+?T ^L _B-X _B-Y _A-?T ^R _A

After the reorganization, the X-Y of each carrier combination exchanges, and simultaneously terminal telomere combination also exchanges.

Positively effect: the present invention selects to utilize annular or linear unit carrier to be presented to annular host or linear host, forms genophore, again by reclaiming annular or linear carrier, the DNA genetic material after obtaining recombinating.Be characterized in, can realize the parallel operation simultaneously of multistage DNA, form the efficient of new dna structure thereby improve the DNA assembling, and prevent that DNA from polluting and disproportionation, guarantee the quality of assembling back DNA, make it to reach purpose of design.Suit to obtain to use in the new organism in the field of genetic engineering gene recombination.

Description of drawings

Fig. 1 is the general flow chart of assembling.

Fig. 2 is the parallel assembling of formation synoptic diagram.

Fig. 3 is first kind of topoisomerase site reorganization synoptic diagram.

Fig. 4 is second kind of topoisomerase site reorganization synoptic diagram.

Fig. 5 is the third topoisomerase site reorganization synoptic diagram.

Among the figure, 1.DNA, 2. macroelement carrier, 3. reactive end, 4. topology reconstruction site.

Embodiment

According to shown in Figure 1, after DNA1 assembles through walking abreast, become the DNA of setting structure.

According to shown in Figure 2, wherein the top is the preceding formation of assembling, and the below is the formation after the assembling.When formation walks abreast assembling, mate two macroelement carriers 2 " assembling reaction " takes place, the product carrier that obtains has the fragment to be assembled that comes from two reactants, and the position of replacement reactant in formation, forms new formation.This process constantly repeats, and the macroelement amount vector is 1 in formation.

According to shown in Figure 3,4 is the topology reconstruction site, is divided into left and right sides reactive end 3, and DNA-1 and DNA-2 represent fragment to be assembled, and four-headed arrow has marked two corresponding sites that the assembling reaction takes place, and the rounded nose of linear carrier end is represented telomere.Assembling reaction when left side expression utilizes linear carrier telomere site as the topology reconstruction site among the figure can see that product has obtained respectively from the telomere of two reaction carriers, and therefore reorganization has taken place to be considered as telomere.Middle portion represents not utilize the situation of linear carrier telomere as the topology reconstruction site among the figure, and this moment, telomere did not exchange, and two recombining reactions that arrow marks have only taken place.The right side is the assembling reaction of circular plasmids among the figure, and two reorganization that arrow marks have taken place.It with " reclaim reconstruct site " reaction that the assembling reaction of " site coupling reorganization " then is equivalent to the reaction in topology reconstruction site among this figure is changed to recovery reconstruct site.

Structure to " macroelement carrier " system in the description of the invention is described with the relation of different " assembling functions ".According to organization definition and mutual relationship, can obtain the feasible specific form of macroelement carrier and recovery carrier.Below provided the concrete unit carrier system at single selection markers, two selection markers, three screening Mk system, the typical refinement scheme with general proxy meaning of assembling process, the system of more selection markers has similar feature.

A) the annular element carrier is assembled mutually:

(1) design of the mutual package system of annular dummy cell carrier:

Topology reconstruction site-carrier framework-selection markers AS-left side reactive end AL-waits to assemble fragment cloning site-right reactive end BR-selection markers BS-(and connects beginning);

Topology reconstruction site-carrier framework-selection markers AS-left side reactive end AL-waits to assemble fragment cloning site-right reactive end CR-selection markers CS-(and connects beginning);

Topology reconstruction site-carrier framework-selection markers BS-left side reactive end BL-waits to assemble fragment cloning site-right reactive end AR-selection markers AS-(and connects beginning);

Topology reconstruction site-carrier framework-selection markers BS-left side reactive end BL-waits to assemble fragment cloning site-right reactive end CR-selection markers CS-(and connects beginning);

Topology reconstruction site-carrier framework-selection markers CS-left side reactive end CL-waits to assemble fragment cloning site-right reactive end AR-selection markers AS-(and connects beginning);

Topology reconstruction site-carrier framework-selection markers CS-left side reactive end CL-waits to assemble fragment cloning site-right reactive end BR-selection markers BS-(and connects beginning);

Wherein replicon can place forearm or postbrachium.

(2) assembling of the mutual package system of annular element carrier:

1. original material:

Each dna fragmentation can all make up the unit carrier of 6 inferior versions.For both assemblings of definite sequence, only using wherein, 3 inferior versions get final product but usually.Might as well get following 8 formations " formation just begins to assemble ", and satisfy " coupling assembling formation " requirement:

A1B:frt-OriS-OriT-AS-AL-DNA1-BR-BS-(connecing beginning);

B2C:frt-OriS-OriT-BS-BL-DNA2-CR-CS-(connecing beginning);

C3A:frt-OriS-OriT-CS-CL-DNA3-AR-AS-(connecing beginning);

A4B:frt-OriS-OriT-AS-AL-DNA4-BR-BS-(connecing beginning);

B5C:frt-OriS-OriT-BS-BL-DNA5-CR-CS-(connecing beginning);

C6A:frt-OriS-OriT-CS-CL-DNA6-AR-AS-(connecing beginning);

A7B:frt-OriS-OriT-AS-AL-DNA7-BR-BS-(connecing beginning);

B8C:frt-OriS-OriT-BS-BL-DNA8-CR-CS-(connecing beginning);

Wherein left reactive end is AL, BL, CL; Right reactive end is AR, BR, CR; The topology reconstruction site is frt.

2. first round assembling:

A1B and B2C reaction:

Before the reaction:

A1B:frt-OriS-OriT-AS-AL-DNA1-BR-BS-(connecing beginning);

B2C:frt-OriS-OriT-BS-BL-DNA2-CR-CS-(connecing beginning);

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, BR and BL reaction, frt and frt reaction simultaneously obtains by selection markers AS and CS screening:

A12C:frt-OriS-OriT-AS-AL-DNA1-BB-DNA2-CR-CS-(connecing beginning);

C3A and A4B reaction:

Before the reaction:

C3A:frt-OriS-OriT-CS-CL-DNA3-AR-AS-(connecing beginning);

A4B:frt-OriS-OriT-AS-AL-DNA4-BR-BS-(connecing beginning);

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, AR and AL reaction, frt and frt reaction simultaneously obtains by selection markers CS and BS screening:

C34B:frt-OriS-OriT-CS-CL-DNA3-AB-DNA4-BR-BS-(connecing beginning);

B5C and C6A reaction:

Before the reaction:

B5C:frt-OriS-OriT-BS-BL-DNA5-CR-CS-(connecing beginning);

C6A:frt-OriS-OriT-CS-CL-DNA6-AR-AS-(connecing beginning);

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, CR and CL reaction, frt and frt reaction simultaneously obtains by selection markers BS and AS screening:

B56A:frt-OriS-OriT-BS-BL-DNA5-CB-DNA6-AR-AS-(connecing beginning);

A7B and B8C reaction:

Before the reaction:

A7B:frt-OriS-OriT-AS-AL-DNA7-BR-BS-(connecing beginning);

B8C:frt-OriS-OriT-BS-BL-DNA8-CR-CS-(connecing beginning);

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, BR and BL reaction, frt and frt reaction simultaneously obtains by selection markers AS and CS screening:

A78C:frt-OriS-OriT-AS-AL-DNA7-BB-DNA8-CR-CS-(connecing beginning);

3. second take turns assembling:

A12C and C34B reaction:

Before the reaction:

A12C:frt-OriS-OriT-AS-AL-DNA1-BB-DNA2-CR-CS-(connecing beginning);

C34B:frt-OriS-OriT-CS-CL-DNA3-AB-DNA4-BR-BS-(connecing beginning);

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, CR and CL reaction, frt and frt reaction simultaneously obtains by selection markers AS and BS screening:

A1234B:frt-OriS-OriT-AS-AL-DNA1-BB-DNA2-CB-DNA3-AB-DNA4-BR-BS-(connecing beginning);

B56A and A78C reaction:

Before the reaction:

B56A:frt-OriS-OriT-BS-BL-DNA5-CB-DNA6-AR-AS-(connecing beginning);

A78C:frt-OriS-OriT-AS-AL-DNA7-BB-DNA8-CR-CS-(connecing beginning);

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, AR and AL reaction, frt and frt reaction simultaneously obtains by selection markers BS and CS screening:

B5678C:frt-OriS-OriT-BS-BL-DNA5-CB-DNA6-AB-DNA7-BB-DNA8-CR-CS-(connecing beginning);

4. third round assembling:

A1234B and B5678C reaction:

Before the reaction:

A1234B:frt-OriS-OriT-AS-AL-DNA1-BB-DNA2-CB-DNA3-AB-DNA4-BR-BS-(connecing beginning)

B5678C:frt-OriS-OriT-BS-BL-DNA5-CB-DNA6-AB-DNA7-BB-DNA8-CR-CS-(connecing beginning);

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, BR and BL reaction, frt and frt reaction simultaneously obtains by selection markers AS and CS screening:

A12345678C:frt-OriS-OriT-AS-AL-DNA1-BB-DNA2-CB-DNA3-AB-D NA4-BB-DNA5-CB-DNA6-AB-DNA7-BB-DNA8-CR-CS-(connecing beginning);

B) the mutual package system of linear unit carrier:

(1) design of the mutual package system of linear unit carrier:

Telomere-carrier framework-selection markers AS-left side reactive end AL-waits to assemble the right reactive end BR-of fragment DNA-selection markers BS-telomere;

Telomere-carrier framework-selection markers AS-left side reactive end AL-waits to assemble fragment cloning site-right reactive end CR-selection markers CS-telomere;

Telomere-carrier framework-selection markers BS-left side reactive end BL-waits to assemble fragment cloning site-right reactive end AR-selection markers AS-telomere;

Telomere-carrier framework-selection markers BS-left side reactive end BL-waits to assemble fragment cloning site-right reactive end CR-selection markers CS-telomere;

Telomere-carrier framework-selection markers CS-left side reactive end CL-waits to assemble fragment cloning site-right reactive end AR-selection markers AS-telomere;

Telomere-carrier framework-selection markers CS-left side reactive end CL-waits to assemble fragment cloning site-right reactive end BR-selection markers BS-telomere;

(2) assembling of the mutual package system of linear unit carrier:

1. original material:

Each dna fragmentation all makes up the unit carrier of 6 inferior versions.For both assemblings of definite sequence, only using wherein, 3 inferior versions get final product but usually.Might as well get following 8 formations " formation just begins to assemble ", and satisfy " coupling assembling formation " requirement:

A1B: telomere-OriL-OriT-AS-AL-DNA1-BR-BS-telomere;

B2C: telomere-OriL-OriT-BS-BL-DNA2-CR-CS-telomere;

C3A: telomere-OriL-OriT-CS-CL-DNA3-AR-AS-telomere;

A4B: telomere-OriL-OriT-AS-AL-DNA4-BR-BS-telomere;

B5C: telomere-OriL-OriT-BS-BL-DNA5-CR-CS-telomere;

C6A: telomere-OriL-OriT-CS-CL-DNA6-AR-AS-telomere;

A7B: telomere-OriL-OriT-AS-AL-DNA7-BR-BS-telomere;

B8C: telomere-OriL-OriT-BS-BL-DNA8-CR-CS-telomere;

Wherein left reactive end is AL, BL, CL; Right reactive end is AR, BR, CR; The topology reconstruction site is frt.

2. first round assembling:

A1B and B2C reaction:

Before the reaction:

A1B: telomere-OriL-OriT-AS-AL-DNA1-BR-BS-telomere;

B2C: telomere-OriL-OriT-BS-BL-DNA2-CR-CS-telomere;

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, BR and BL reaction, frt and frt reaction simultaneously obtains by selection markers AS and CS screening:

A12C: telomere-OriL-OriT-AS-AL-DNA1-BB-DNA2-CR-CS-telomere;

C3A and A4B reaction:

Before the reaction:

C3A: telomere-OriL-OriT-CS-CL-DNA3-AR-AS-telomere;

A4B: telomere-OriL-OriT-AS-AL-DNA4-BR-BS-telomere;

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, AR and AL reaction, frt and frt reaction simultaneously obtains by selection markers CS and BS screening:

C34B: telomere-OriL-OriT-CS-CL-DNA3-AB-DNA4-BR-BS-telomere;

B5C and C6A reaction:

Before the reaction:

B5C: telomere-OriL-OriT-BS-BL-DNA5-CR-CS-telomere;

C6A: telomere-OriL-OriT-CS-CL-DNA6-AR-AS-telomere;

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, CR and CL reaction, frt and frt reaction simultaneously obtains by selection markers BS and AS screening:

B56A: telomere-OriL-OriT-BS-BL-DNA5-CB-DNA6-AR-AS-telomere;

A7B and B8C reaction:

Before the reaction:

A7B: telomere-OriL-OriT-AS-AL-DNA7-BR-BS-telomere;

B8C: telomere-OriL-OriT-BS-BL-DNA8-CR-CS-telomere;

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, BR and BL reaction, frt and frt reaction simultaneously obtains by selection markers AS and CS screening:

A78C: telomere-OriL-OriT-AS-AL-DNA7-BB-DNA8-CR-CS-telomere;

3. second take turns assembling:

A12C and C34B reaction:

Before the reaction:

A12C: telomere-OriL-OriT-AS-AL-DNA1-BB-DNA2-CR-CS-telomere;

C34B: telomere-OriL-OriT-CS-CL-DNA3-AB-DNA4-BR-BS-telomere;

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, CR and CL reaction, frt and frt reaction simultaneously obtains by selection markers AS and BS screening:

A1234B: telomere-OriL-OriT-AS-AL-DNA1-BB-DNA2-CB-DNA3-AB-DNA4-BR-BS-telomere;

B56A and A78C reaction:

Before the reaction:

B56A: telomere-OriL-OriT-BS-BL-DNA5-CB-DNA6-AR-AS-telomere;

A78C: telomere-OriL-OriT-AS-AL-DNA7-BB-DNA8-CR-CS-telomere;

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, AR and AL reaction, frt and frt reaction simultaneously obtains by selection markers BS and CS screening:

B5678C: telomere-OriL-OriT-BS-BL-DNA5-CB-DNA6-AB-DNA7-BB-DNA8-CR-CS-telomere;

4. third round assembling:

A1234B and B5678C reaction:

Before the reaction:

A1234B: telomere-OriL-OriT-AS-AL-DNA1-BB-DNA2-CB-DNA3-AB-DNA4-BR-BS-telomere;

B5678C: telomere-OriL-OriT-BS-BL-DNA5-CB-DNA6-AB-DNA7-BB-DNA8-CR-CS-telomere;

Engage conversion one of them carrier is transferred in the middle of the host of another carrier, BR and BL reaction, frt and frt reaction simultaneously obtains by selection markers AS and CS screening:

A12345678C: telomere-OriL-OriT-AS-AL-DNA1-BB-DNA2-CB-DNA3-AB-DNA4-BB-DNA5-CB-DNA6-AB-DNA7-BB-DNA8-CR-CS-telomere;

C) host of annular element carrier shifts and reclaims assembling:

(1) design of unit carrier:

The annular element carrier comprises at least two carriers, is used alternatingly in assembling process.

The annular element carrier according to the structure that the DNA base puts in order is:

Annular element carrier A: topology reconstruction site IR, carrier framework, left reactive end AR, wait to assemble segmental cloning site, right reactive end BL.

Annular element carrier B: topology reconstruction site IP, carrier framework, left reactive end BR, wait to assemble segmental cloning site, right reactive end AL.

Carrier framework comprises replicon, screening-gene.Can comprise in conjunction with conversion site or other and not participate in the sequence of recombining reaction.Its distributing order does not influence function.The unit carrier is reproducible not in the middle of the assembling host.

Wherein AL and AR reorganization obtains AB and AP, and BL and BR reorganization obtain BB and BP.

(2) design of recombinant host:

The annular recombinant host: when beginning assembling from the annular element carrier A, in the middle of the annular recombinant host in order base contain following site successively: reclaim that carrier inserts site EL, cuts out site AL, assembling site IL.

When beginning assembling from the annular element carrier B, in the middle of the annular recombinant host in order base contain following site successively: reclaim that carrier inserts site EL, cuts out site BL, assembling site IB.

(3) design of recovery carrier:

Annular reclaims carrier: contain AL in the middle of the assembling host before reclaiming, then Dui Ying recovery carrier has following structure: reclaim carrier insertion site ER-and assemble site IR-carrier framework-cut out site BR.

Contain BL in the middle of the assembling host before reclaiming, then Dui Ying recovery carrier has following structure: reclaim carrier insertion site ER-and assemble site IP-carrier framework-cut out site AR carrier framework and comprise replicon, screening-gene.Can comprise in conjunction with conversion site or other and not participate in the sequence of recombining reaction.Its distributing order does not influence function usually.The unit carrier is reproducible not in the middle of the assembling host.

(4) host of annular element carrier shifts the recovery assembling process:

1. original material:

It is as follows to treat that earlier assembled dna obtains " just beginning to assemble formation " in the middle of being cloned into the unit carrier:

Assembling host: karyomit(e)-EL-AL-IL-karyomit(e).Wherein reclaiming the reconstruct site is EL; Right reactive end is AL; The topology reconstruction site is IL.

C2R:IR-carrier framework-AR-DNA2-BL-connects beginning.Wherein left reactive end is AR; Right reactive end is BL; The topology reconstruction site is IR.

C1P:IP-carrier framework-BR-DNA1-AL-connects beginning.Wherein left reactive end is BR; Right reactive end is AL; The topology reconstruction site is IP.

Reclaim carrier B: ER-IR-carrier framework-BR-connects beginning.Wherein reclaiming the reconstruct site is ER; The topology reconstruction site is IR.

2. assembling process:

Assembling host original state:

Assembling host: karyomit(e)-EL-AL-IL-karyomit(e); Assembling C2R, IL and IR reorganization:

Assembling host: karyomit(e)-EL-AL-IP-carrier framework-AR-DNA2-BL-IB-karyomit(e); Cut out carrier framework, AL and AR reorganization:

The assembling host is karyomit(e)-EL-AB-DNA2-BL-IB-karyomit(e); Assembling C1P, IB and IP reorganization:

Assembling host dyeing-EL-AB-DNA2-BL-IR-carrier framework-BR-DNA1-AL-IL-karyomit(e) cuts out carrier framework, BL and BR reorganization:

Assembling host: karyomit(e)-EL-AB-DNA2-BB-DNA1-AL-IL-karyomit(e); Use the recovery carrier to make it become the plasmid form, EL and ER reorganization:

Assembling host: karyomit(e)-EP-IR-carrier framework-BR-DNA2-BB-DNA1-AL-IL-karyomit(e); To assemble fragment and cut out recovery, IR and IL reorganization:

Assembling host: karyomit(e)-EP-IB-karyomit(e).

The carrier that reclaims: IP-carrier framework-BR-EB-AB-DNA2-BB-DNA1-AL-connects beginning

" IP-carrier framework-BR-...-AL-connects beginning " is consistent with the unit carrier for the structure that the carrier that is recovered to has, and can be used for further assembling.

4. parallel assembling:

If there is the N segment DNA to wait to assemble, earlier with dna clone to the unit carrier, the every 2-3 section of dna single unit's carrier that will the relation of joining by the front and back of design be divided into one group, every group with assembling in turn and reclaiming, these groups can be operated simultaneously, the realization parallelization.In next round, the every 2-3 section of carrier of recovery that will the relation of joining by the front and back of design is divided into one group, and every group with assembling in turn and reclaiming, and these groups can be operated simultaneously, the realization parallelization.Repeat above process, all install to together according to the der group of design up to all DNA that need assemble.

D) host of linear unit carrier shifts and reclaims assembling:

(1) design of unit carrier: utilize linear unit carrier.Linear unit carrier comprises at least two carriers, is used alternatingly in assembling process.Linear unit carrier can have linear and annular, and when reorganization took place reality, substrate was linear.

Linear unit carrier according to the structure that the DNA base puts in order is: the linear form of linear unit carrier A: carrier left arm, left reactive end AR, wait to assemble segmental cloning site, right reactive end BL, selection markers AS, carrier right arm.

The linear form of linear unit carrier B: carrier left arm, left reactive end BR, wait to assemble segmental cloning site, afterreaction end AL, selection markers BS, carrier right arm.

The carrier left arm comprises: telomere, replication origin.The unit carrier is reproducible not in the middle of the assembling host.

The carrier right arm comprises: telomere.

The ring form of linear unit carrier A: Telomerase recognition site, carrier framework, left reactive end AR, wait to assemble segmental cloning site, right reactive end BL, selection markers AS.

The ring form of linear unit carrier B: Telomerase recognition site, carrier framework, left reactive end BR, wait to assemble segmental cloning site, right reactive end AL, selection markers BS.

Carrier framework comprises replicon, screening-gene.Can comprise in conjunction with conversion site or other and not participate in the sequence of recombining reaction.Its distributing order does not influence function usually.The unit carrier is reproducible not in the middle of the assembling host.

For linear carrier, telomere is the topology reconstruction site.

Linear recombinant host: when beginning assembling from linear unit carrier A, linear recombinant host from the inboard to the telomere, have following site successively near the telomere end: reclaim site EL, insert site AR.

When beginning assembling from linear unit carrier B, linear recombinant host from the inboard to the telomere, have following site successively near the telomere end: reclaim site EL, insert site BR.

Linear recovery carrier: when the assembling host was contained AL before reclaiming, then Dui Ying recovery carrier had following structure: telomere, replicon, AR, recovery carrier insert site ER, selection markers AS, telomere.

When the assembling host was contained BL before reclaiming, then Dui Ying recovery carrier had following structure: telomere, replicon, BR, recovery carrier insert site ER, selection markers BS, telomere.

(4) host of linear unit carrier shifts the recovery assembling process:

1. original material:

Assembling host: karyomit(e)-EL-AL-BS-telomere; Wherein reclaiming the reconstruct site is EL; Right reactive end is AL; The topology reconstruction site is a telomere.

L2A: telomere-replication origin-AR-DNA2-BL-AS-telomere; Wherein left reactive end is AR; Right reactive end is BL; The topology reconstruction site is a telomere.

L1B: telomere-replication origin-BR-DNA1-AL-BS-telomere; Wherein left reactive end is BR; Right reactive end is AL; The topology reconstruction site is a telomere.

Reclaim carrier B: telomere-replication origin-BR-ER-BS-replication initiator protein gene-telomere.Wherein reclaiming the reconstruct site is ER; The topology reconstruction site is a telomere.

2. order assembling:

Assembling host original state:

Assembling host: karyomit(e)-EL-AL-BS-telomere; Assembling L2A, IL and IR reorganization.Screen with AS

Assembling host: karyomit(e)-EL-AB-DNA2-BL-AS-telomere; Assembling L1B, IL and IR reorganization, screen with BS:

Assembling host: karyomit(e)-EL-AB-DNA2-BB-DNA1-AL-BS-telomere; Reclaim the exchange of carrier B and genome, EL and ER reorganization:

Assembling host: karyomit(e)-EP-AS-replication initiator protein gene-telomere;

Reclaim carrier: telomere-replication origin-BR-EB-AB-DNA2-BB-DNA1-AL-BS-telomere:

The structure that the carrier that is recovered to has " telomere-replication origin-BR-...-AL-BS-telomere " is consistent with the unit carrier, can be used for further assembling.

4. parallel assembling:

If there is the N segment DNA to wait to assemble, earlier with dna clone to the unit carrier, the every 2-3 section of dna single unit's carrier that will the relation of joining by the front and back of design be divided into one group, every group with assembling in turn and reclaiming, these groups can be operated simultaneously, the realization parallelization.In next round, the every 2-3 section of carrier of recovery that will the relation of joining by the front and back of design is divided into one group, and every group with assembling in turn and reclaiming, and these groups can be operated simultaneously, the realization parallelization.Repeat above process, all install to together according to the der group of design up to all DNA that need assemble.

Because the portion gene sequence length is bigger, with the replacement of quoting in the ncbi database.For example: in the nucleotide database of " [AY048744.1:240-23] " expression NCBI in the sequence of numbering AY048744.1 (because 240 greater than 23, so be reverse complementary sequence) 23 bases to the reverse complementary sequence of 240 bases.(because 23 less than 240, be the forward sequence) 23 bases are to 240 base sequences in the nucleotide database of " [AY048744.1:23-240] " expression NCBI in the numbering AY048744.1 sequence.

Gene synthesizes used carrier, and the synthetic gene is stored in the middle of this carrier:

PQLV: tab segments downstream TAGGAGAGACCGTGCAGGTACCCCGCGTTGTCTAGAAGCTTCCTATTGGGCTTGCT ATCCCTCCATAGCAGAAAGTCAAAAGCCTCCGACCGGAGGCTTTTGACTATTACTC AACAGGTTTTTCCATAGGCTCCGCCCCCCTGACG[EF196094.1:533-1581] [JF313343.1:1950-2222] AATACCGCGG[JF796098.1:1967-2136] C[JF796098.1:2138-2292] CGTGTTATCACTCATGGTTATGGCAGCACTA[JF796098.1:2324-2798] TACCGAAGAAAGGCCCACCCGTGAAGGTGAGCCAGTGAGTTGATTGCGTTCGCAGA ATTGGGAATCTGCAGGGTACCTGATCCTCTAGAGTCGACCTGCACAGGTCTCTAAG tab segments upstream.

Embodiment 1: utilize the assembling of circular groups assembling system luxA, luxB, luxC, luxD, luxE.

Original plasmid: pAH57 expresses Lambda Int Xis.PAH69 expresses HK022 Int.PAH129 expresses Phi80 Int Xis.PAH83 expresses HK022 Int Xis.PAH70 comprises HK022 attP.Derive from CGSC (http://cgsc.biology.yale.edu/).PCMR expresses HK022-Lambda Chemira Int Xis.PAH69Pir expresses HK022 Int and Pir gene.PCMRPir expresses HK022-Lambda Chemira Int Xis and Pir gene.PAH129E, the lambda C1 that destroys among the pAH129 with HindIII obtains.

Make up plasmid:

(1) make up helper plasmid:

Synthetic primer:

EVF:ACCTGACCGCTATCCCTGA

EVR:GCCCTTCAATCGCCAGA

IHF:TTGACTATTTTACCTCTGGCGG

IHR:TCCGACTTATGCCCGAGAAGACGTTG

IIF:CAACGTCTTCTCGGGCATAAGTCGGA

IIR:AATAACATGTAGCTTGGCATTGCTTATCAA

Synthetic gene:

p1pir:ACTAGTTTGAATTGGTCACGACTTTGCGAAGCAAAGTCTAGTGAGTATACTCAAGCATTGAGTGGATCGATGAGCTCAGGAGGTAATTATAATGCGTCTGAAAGTTATGATGGACGTTAACAAAAAAACCAAAATCCGTCACCGTAACGAACTGAACCACACCCTGGCGCAGCTGCCGCTGCCGGCGAAACGTGTTATGTACATGGCGCTGGCGCTGATCGACTCTAAAGAACCGCTGGAACGTGGTCGTGTTTTCAAAATCCGTGCGGAAGACCTGGCGGCGCTGGCGAAAATCACCCCGTCTCTGGCGTACCGTCAGCTGAAAGAAGGTGGTAAACTGCTGGGTGCGTCTAAAATCTCTCTGCGTGGTGACGACATCATCGCGCTGGCGAAAGAACTGAACCTGCTGTCTACCGCGAAAAACTCTTCTGAAGAACTGGACCTGAACATCATCGAATGGATCGCGTACTCTCCGGACGAAGGTTACCTGTCTCTGAAATTCACCCGTACCATCGAACCGTACATCTCTTCTCTGATCGGTAAAAAAAACAAATTCACCACCCAGCTGCTGACCGCGTCTCTGCGTCTGTCTTCTCAGTACTCTTCTTCTCTGTACCAGCTGATCCGTAAACACTACTCTAACTTCAAAAAAAAAAACTACTTCATCATCTCTGTTGACGAACTGAAAGAAGAACTGATCGCGTACACCTTCGACAAAGACGGTAACATCGAATACAAATACCCGGACTTCCCGATCTTCAAACGTGACGTTCTGAACAAAGCGATCGCGGAAATCAAAAAAAAAACCGAAATCTCTTTCGTTGGTTTCACCGTTCACGAAAAAGAAGGTCGTAAAATCTCTAAACTGAAATTTGAATTTGTGGTGGATGAAGATGAATTTTCTGGTGACAAAGACGACGAAGCGTTCTTCATGAACCTGTCTGAAGCGGACGCGGCGTTCCTGAAAGTTTTCAACGAAACCGTTCCGCCGAAAAAAGCGAAAGGTTAGGAGCTCTCTAGAAACAAGCTT

Experimental procedure:

Make up pAH129E: pAH129 is cut as enzyme with HindIII, reclaim enzyme with solution method and cut product, connect reclaiming product with the T4 dna ligase, be transformed in the competence that E. coli DH5 α makes, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, extracting plasmid from bacterium liquid carries out the PCR checking with primer EVF and EVR and screens that wherein can to produce 248bp segmental, and sequence verification, verify the correct pAH129E that is labeled as.

Prepare PCR: with pAH129E is that template is carried out PCR with primer EVF and EVR,

Prepare pAH83:

Make up pCMR: with pAH57 is that template is carried out PCR with primer I IF and IIR, and product is labeled as rI.With pAH83 is that template is carried out PCR with primer I HF and IHR, and product is labeled as rH.With rH and rI is that template is carried out PCR with primer I HF and IIR, with restriction restriction endonuclease EcoRI and PciI the PCR product is cut as enzyme, reclaims enzyme with solution method and cuts product, is labeled as cIH.With restriction restriction endonuclease NcoI and EcoRI pAH83 is cut as enzyme, and add the processing of CIAP dephosphorylation, reclaim enzyme with solution method and cut product, be labeled as cAH83.With the T4 dna ligase cAH83 is connected with cIH, be transformed in the competence that E. coli DH5 α makes connecting the product electricity, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pCMR that is labeled as.

Prepare cPir: with restriction restriction endonuclease EcoRI and HindIII p1pir is cut as enzyme, separate the fragment that enzyme is cut 1123bp in the product, be labeled as cPir with agarose gel electrophoresis.

Make up pCMRPir: with restriction restriction endonuclease EcoRI and HindIII pCMR is cut as enzyme, and add the processing of CIAP dephosphorylation, separate the fragment that enzyme is cut 4588bp in the product, be labeled as cCMR with agarose gel electrophoresis.With the T4 dna ligase cPir is connected with cCMR, be transformed in the competence that E. coli DH5 α makes connecting the product electricity, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pCMRPir that is labeled as.

Make up pAH69Pir: with restriction restriction endonuclease EcoRI and HindIII pAH69 is cut as enzyme, and add the processing of CIAP dephosphorylation, separate the fragment that enzyme is cut 4371bp in the product, be labeled as c69 with agarose gel electrophoresis.With the T4 dna ligase cPir is connected with c69, be transformed in the competence that E. coli DH5 α makes connecting the product electricity, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pAH69Pir that is labeled as.

(2) construction unit carrier:

Synthetic primer:

hkpF:GGTACCATAAATAGCCTGAAAGGCGCTGCTAATGCTCTGTCTCAGGTC

hkpR:GTCGACATAATTACACTTCGTGATGGGACAAAATTGAAATCG

aplF:GGTACCATAAATAGCCTGAAAGGCGAACACGTTTCAGTGAAACCATTTAAGAAAG

aplR:GTCGACATAATTACACTTCGTGGGTGAATCACGACAAAGCGTATCAAAAAC

vccF:GGTACCATAAATAGCCTGAAAGGCCCTGCCACTCATCGCAGTACTGTTG

vccR:GTCGACATAATTACACTTCGTGATTGGTAACTGTCAGACCAAGTTTACTCATATATAC

clnF:ATAAGGTACCAGTCGACGCCGTCGAGGCCGATGC

clnR:ATATTTACACTTCGTGGGCCATGCTGGCGTCCG

aprF:GGTACCATAAATAGCCTGAAAGGCACATTTTTGTTTTTGGGTACACA

aprR:GTCGACATAATTACACTTCGTGAATATTGAATCTCTATTCAGAACACTTT

KNF:ATAAGTCGACAAAGCCAGTCCGCAGAAACG

KNR:ATAAGAATTCCCCGCTCAGAAGAACTCGTC

PUCF:ATAACAATTGCTTCGCCCACCCCAAAAGGATCTAG

PUCR:AAAGTCGACAAGGAGGTACCACGGTTATCCACAGAATCAGGG

tesF:CCTTTTTACGGTTCCTGGC

tesR:TGTCCAGATAGCCCAGTAGC

Synthetic gene:

attRHK022:GGTACCATAAATAGCCTGAAAGGCTCAGGTCACTAATACTATCTAAGTAGTTGATTCATAGTGACTGGATATGTTGCGTTTTGTCGCATTATGTAGTCTATCATTTAACCACAGATTAGTGTAATGCGATGATTTTTAAGTGATTAATGTTATTTTGTCATCCTTTAGGTGAAAAAGGTTGAGTCGCAAAGCGGCACGAAGTGTAATTATGTCGAC

attL1:GGTACCATAAATAGCCTGAAAGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCACGAAGTGTAATTATGTCGAC

attR1:GGTACCATAAATAGCCTGAAAGGCACAAGTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGCACGAAGTGTAATTATGTCGAC

attR2:GGTACCATAAATAGCCTGAAAGGCACCACTTTGTACAAGAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGCACGAAGTGTAATTATGTCGAC

attL2:GGTACCATAAATAGCCTGAAAGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGCTGGGTCACGAAGTGTAATTATGTCGAC

phi80attR:ACATTTTTGTTTTTGGGTACACAAAAGTGTACACAAAGTTGCCCACTCAAAGCTACACGCAATGTAACACTAGTTCGCAGAGTGTTATGGTTTACATCCTTGAAAGCCTGCTGGATAAGGGTTTAGCGTAACAGAACGTTTTTACGCGGAATTGTTCGTAATATGCCAAATGACAATTTAAGAAAGTGTTCTGAATAGAGATTCAATATT

phi80attL:GAACACGTTTCAGTGAAACC[AY048738.1:572-358]

KanOri:GGTACCATAAATAGCCTGAAAGGC[AY048744.1:1271-110]CTCGAG[AY048744.1:2104-1666]CACGAAGTGTAATTATGTCGAC

Experimental procedure:

Make up pUCVHK022P: with pAH70 is that template is carried out PCR with primer hkpF and hkpR, with restriction restriction endonuclease KpnI and SalI the PCR product is cut as enzyme, reclaims enzyme with solution method and cuts product, is labeled as cHK022P.With the T4 dna ligase cUCV is connected with cHK022P, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCVHK022P that is labeled as.

Prepare cUCVHK022P: with restriction restriction endonuclease DraIII and SalI pUCVHK022P is cut as enzyme, separate enzyme with agarose gel electrophoresis and cut the dna fragmentation between 1000bp and 3600bp in the product, be labeled as cUCVHK022P.

Make up pUCVHK022P λ L1: with restriction restriction endonuclease BglI and SalI λ L1 is cut as enzyme, reclaim enzyme with solution method and cut product, be labeled as c λ L1.With the T4 dna ligase cUCVHK022P is connected with c λ L1, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCVHK022P λ L1 that is labeled as.

Prepare PCR: with pUCVHK022P λ L1 is that template is carried out PCR with primer tesF and tesR,

Make up pUCV: with pK18mobSacB is that template is carried out PCR with primer KNF and KNR, with restriction restriction endonuclease SalI and EcoRI the PCR product is cut as enzyme, reclaims enzyme with solution method and cuts product, is labeled as dKMS.With pUC18 is that template is carried out PCR with primer PUCF and PUCR, with restriction restriction endonuclease SalI and MfeI the PCR product is cut as enzyme, and is added the processing of CIAP dephosphorylation, reclaims enzyme with solution method and cuts product, is labeled as dUC.With the T4 dna ligase dUC is connected with dKMS, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCV that is labeled as.

Prepare cUCV: with restriction restriction endonuclease KpnI and SalI pUCV is cut as enzyme, separate the fragment that enzyme is cut 1921bp in the product, be labeled as cUCV with agarose gel electrophoresis.

Make up pUCV Φ 80L: with Φ 80L is that template is carried out PCR with primer aplF and aplR, with restriction restriction endonuclease KpnI and SalI the PCR product is cut as enzyme, reclaims enzyme with solution method and cuts product, is labeled as c Φ 80L.With the T4 dna ligase cUCV is connected with c Φ 80L, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCV Φ 80L that is labeled as.

Make up pUCV Φ 80LChlr: with restriction restriction endonuclease DraIII and SalI pUCV Φ 80L is cut as enzyme, and add the processing of CIAP dephosphorylation, reclaim enzyme with solution method and cut product, be labeled as cUCV Φ 80L.With pKD3 is that template is carried out PCR with primer vccF and vccR, with restriction restriction endonuclease BglI and SalI the PCR product is cut as enzyme, reclaims enzyme with solution method and cuts product, is labeled as cChlr.With the T4 dna ligase cChlr is connected with cUCV Φ 80L, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCV Φ 80LChlr that is labeled as.

Make up TARGET: with restriction restriction endonuclease BglI and DraIII the PCR product is cut as enzyme, reclaimed enzyme with solution method and cut product, be labeled as cHK022P λ L1BD.With restriction restriction endonuclease BglI and DraIII pUCV Φ 80LChlr is cut as enzyme, and adding CIAP dephosphorylation is handled, separate enzyme with agarose gel electrophoresis and cut the dna fragmentation between 1000bp and 1950bp in the product, with the T4 dna ligase separated product is connected with cHK022P λ L1BD, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains paraxin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains paraxin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct TARGET that is labeled as.

Prepare cKanOri: with restriction restriction endonuclease BglI and SalI KanOri is cut as enzyme, reclaim enzyme with solution method and cut product, be labeled as cKanOri.

Make up pUCV λ R2: with restriction restriction endonuclease KpnI and SalI λ R2 is cut as enzyme, reclaim enzyme with solution method and cut product, be labeled as c λ R2.With the T4 dna ligase cUCV is connected with c λ R2, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCV λ R2 that is labeled as.

Make up pUCV λ R2KanOri: with restriction restriction endonuclease DraIII and SalI pUCV λ R2 is cut as enzyme, and add the processing of CIAP dephosphorylation, reclaim enzyme with solution method and cut product, be labeled as cUCV λ R2.With the T4 dna ligase cUCV λ R2 is connected with cKanOri, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCV λ R2KanOri that is labeled as.

Prepare cUCV λ R2KanOri: with restriction restriction endonuclease DraIII and SalI pUCV λ R2KanOri is cut as enzyme, separate enzyme with agarose gel electrophoresis and cut the dna fragmentation between 1000bp and 4950bp in the product, be labeled as cUCV λ R2KanOri.

Make up pUCVPreUnitP: with restriction restriction endonuclease BglI and SalI the PCR product is cut as enzyme, reclaimed enzyme with solution method and cut product, be labeled as cHK022P λ L1BS.With the T4 dna ligase cHK022P λ L1BS is connected with cUCV λ R2KanOri, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCVPreUnitP that is labeled as.

Prepare cBGL: with pBHR68 is that template is carried out PCR with primer clnF and clnR, with restriction restriction endonuclease DraIII and KpnI the PCR product is cut as enzyme, separate enzyme with agarose gel electrophoresis and cut the dna fragmentation between 100bp and 1500bp in the product, be labeled as cBGL.

Make up pUCVUnitP: with restriction restriction endonuclease BglI and KpnI pUCVPreUnitP is cut as enzyme, separate enzyme with agarose gel electrophoresis and cut the dna fragmentation between 1000bp and 5100bp in the product, be labeled as cUCVPreUnitP.With the T4 dna ligase cBGL is connected with cUCVPreUnitP, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCVUnitP that is labeled as.

Make up pUnitP: SalI cuts as enzyme pUCVUnitP with the restriction restriction endonuclease, separate the fragment that enzyme is cut 2624bp in the product with agarose gel electrophoresis, with the T4 dna ligase separated product is connected, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUnitP that is labeled as.

Make up pUCV λ R1: with restriction restriction endonuclease KpnI and SalI λ R1 is cut as enzyme, reclaim enzyme with solution method and cut product, be labeled as c λ R1.With the T4 dna ligase cUCV is connected with c λ R1, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCV λ R1 that is labeled as.

Make up pUCV λ R1KanOri: with restriction restriction endonuclease DraIII and SalI pUCV λ R1 is cut as enzyme, separate enzyme with agarose gel electrophoresis and cut the dna fragmentation between 1000bp and 3000bp in the product, be labeled as cUCV λ R1.With the T4 dna ligase cUCV λ R1 is connected with cKanOri, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCV λ R1KanOri that is labeled as.

Prepare cUCV λ R1KanOri: with restriction restriction endonuclease DraIII and SalI pUCV λ R1KanOri is cut as enzyme, separate enzyme with agarose gel electrophoresis and cut the dna fragmentation between 1000bp and 4800bp in the product, be labeled as cUCV λ R1KanOri.

Make up pUCVHK022R: with restriction restriction endonuclease KpnI and SalI HK022R is cut as enzyme, reclaim enzyme with solution method and cut product, be labeled as cHK022R.With the T4 dna ligase cUCV is connected with cHK022R, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid, be labeled as pUCVHK022R.

Prepare cUCVHK022R: with restriction restriction endonuclease DraIII and SalI pUCVHK022R is cut as enzyme, reclaim enzyme with solution method and cut product, be labeled as cUCVHK022R.

Make up pUCVHK022R λ L2: with restriction restriction endonuclease BglI and SalI λ L2 is cut as enzyme, reclaim enzyme with solution method and cut product, be labeled as c λ L2.With the T4 dna ligase c λ L2 is connected with cUCVHK022R, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCVHK022R λ L2 that is labeled as.

Make up pUCVPreUnitR: with restriction restriction endonuclease BglI and SalI pUCVHK022R λ L2 is cut as enzyme, separate enzyme with agarose gel electrophoresis and cut the dna fragmentation between 100bp and 1500bp in the product, be labeled as cHK022R λ L2.With the T4 dna ligase cHK022R λ L2 is connected with cUCV λ R1KanOri, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCVPreUnitR that is labeled as.

Make up pUCVUnitR: with restriction restriction endonuclease BglI and KpnI pUCVPreUnitR is cut as enzyme, separate the fragment that enzyme is cut 3977bp in the product, be labeled as cUCVPreUnitR with agarose gel electrophoresis.With the T4 dna ligase cBGL is connected with cUCVPreUnitR, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCVUnitR that is labeled as.

Make up pUnitR: SalI cuts as enzyme pUCVUnitR with the restriction restriction endonuclease, separate the fragment that enzyme is cut 2527bp in the product with agarose gel electrophoresis, with the T4 dna ligase separated product is connected, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUnitR that is labeled as.

Prepare c Φ 80R: with Φ 80R is that template is carried out PCR with primer aprF and aprR, with restriction restriction endonuclease BglI and SalI the PCR product is cut as enzyme, reclaims enzyme with solution method and cuts product, is labeled as c Φ 80R.

Make up pUCVHK022P Φ 80R: cUCVHK022P is connected with c Φ 80R with the T4 dna ligase, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCVHK022P Φ 80R that is labeled as.

Make up pUCVUnitExP: with pUCVHK022P Φ 80R is that template is carried out PCR with primer tesF and tesR, with restriction restriction endonuclease BglI and SalI the PCR product is cut as enzyme, reclaims enzyme with solution method and cuts product, is labeled as cHK022P Φ 80R.With the T4 dna ligase cUCV λ R1KanOri is connected with cHK022P Φ 80R, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCVUnitExP that is labeled as.

Make up pUnitExP: pUCVUnitExP is cut as enzyme with restriction restriction endonuclease BglI and DraIII, separate the fragment that enzyme is cut 2252bp in the product with agarose gel electrophoresis, with the T4 dna ligase separated product is connected, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUnitExP that is labeled as.

Make up cUCVHK022R Φ 80R: cUCVHK022R is connected with c Φ 80R with the T4 dna ligase, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct cUCVHK022R Φ 80R that is labeled as.

Make up pUCVUnitExR: with cUCVHK022R Φ 80R is that template is carried out PCR with primer tesF and tesR, with restriction restriction endonuclease BglI and SalI the PCR product is cut as enzyme, reclaims enzyme with solution method and cuts product, is labeled as cHK022R Φ 80R.With the T4 dna ligase cHK022R Φ 80R is connected with cUCV λ R2KanOri, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUCVUnitExR that is labeled as.

Make up pUnitExR: pUCVUnitExR is cut as enzyme with restriction restriction endonuclease BglI and DraIII, separate the fragment that enzyme is cut 2155bp in the product with agarose gel electrophoresis, with the T4 dna ligase separated product is connected, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUnitExR that is labeled as.

(3) make up the unit carrier that has promotor and hairpin structure:

Gene is synthetic:

T7HP:TAGACAACGCGGGGTACCTGCACGGTCACTGCGTGCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTATTGCTCAGCGGTGGCAGCAGCCAACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCTCAGCCACGTAGGCATAAGCCTTCGAGGCCGTTATCATCCAAAATACGGTACGGAGACGTCAACAATATCTCTATTGAACTGCAGTCTCGAGATAAGTCGACTCTCCCTATAGTGAGTCGTATTACACCGAGTGCCTGTGCAGGTCGACTCTAGAGGATCAGGTACCCTGCAGATTCCCAATTCTGCGAACGCAATCAA

Experimental procedure:

Prepare cT7HP: DraIII cuts as enzyme T7HP with the restriction restriction endonuclease, separates the fragment that enzyme is cut 248bp in the product with agarose gel electrophoresis, is labeled as cT7HP.

Make up pUnitRHP: BglI cuts as enzyme pUnitR with the restriction restriction endonuclease, and adds the processing of CIAP dephosphorylation, reclaims enzyme with solution method and cuts product, is labeled as cUnitR.With the T4 dna ligase cT7HP is connected with cUnitR, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUnitRHP that is labeled as.

Make up pUnitPHP: BglI cuts as enzyme pUnitP with the restriction restriction endonuclease, and adds the processing of CIAP dephosphorylation, reclaims enzyme with solution method and cuts product, is labeled as cUnitP.With the T4 dna ligase cUnitP is connected with cT7HP, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUnitPHP that is labeled as.

(4) assembling host:

Primer is synthetic:

delF:ACGCGCATGATAGCCTCATCAATAATAAGGCTTTATGCTGTGTAGGCTGGAGCTGCTTC

delR:TCATCGCAGTACTGTTGTATTCATTAAGCATCTGCCGACCTGTCAAACATGAGAATTAA

VRSF:GGTGAATCACGACAAAGCGTATC

VRSR:AAGTTGTCGCATTATTCGCCTG

VRTF:GAAACCAGGGCACACCAACG

K2:CGGTGCCCTGAATGAACTGC

VRTF2:AGGTTATCAGCCGAAAATGCCG

VRSR2:TGCCTGAGTGTTGTCTTTTTCCA

Experimental procedure:

Make up E. coli TOP10 TARGET: the pAH69 electricity is transformed in the competence that E. coli TOP10 makes, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, the TARGET electricity is transformed in the competence that bacterium liquid makes, converted product is resuspended in the LB substratum, cultivated 30 minutes at 30 ℃, cultivated 30 minutes at 42 ℃, cultivated 30 minutes at 30 ℃, induce bacterium liquid to carry out HK022 BP reorganization, recombinant products is coated on the LB agar plate that contains paraxin, be cultured to visible mono-clonal at 37 ℃, with primer VRSF and primer VRSR the clone who grows is carried out bacterium colony PCR, screening wherein produces the clone of 970bp product, is labeled as E. coli TOP10 TARGET.

Make up E. coli TARKan: E. coli TOP10 TARGET is inoculated in the LB liquid nutrient medium that contains paraxin, be cultured to bacterium liquid muddiness at 37 ℃, pKD46 is transformed in the change commentaries on classics competence that bacterium liquid makes, converted product is coated on the LB agar plate that contains paraxin and penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains paraxin and penbritin, be cultured to bacterium liquid muddiness at 30 ℃, with pKD13 is that template is carried out PCR with primer delF and delR, PCR product electricity is transformed in the competence that bacterium liquid makes, converted product is resuspended in the LB substratum, cultivated 1 hour at 37 ℃, induce the clone who grows to carry out λ Red reorganization, recombinant products is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal, the clone who grows is carried out bacterium colony PCR with primer VRTF and primer K2 at 37 ℃, screening wherein produces the clone of 1190bp product, is labeled as E. coli TARKan.

Make up HOST: E. coli TARKan is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, the pCP20 electricity is transformed in the competence that bacterium liquid makes, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, getting bacterium liquid coats on the LB agar plate, cultivated 1 hour at 42 ℃, induce the clone who grows to carry out the frt reorganization, recombinant products is coated on the LB agar plate, be cultured to visible mono-clonal, the clone who grows is carried out bacterium colony PCR with primer VRTF2 and primer VRSR2 at 42 ℃, screening wherein produces the clone of 863bp product, is labeled as HOST.

(5) unit carrier:

Primer is synthetic:

luxCF:CCAGATCACCGAGTGAGGCTAATATGACTAAAAAAATTTCATTCA

luxCR:CCAGATCACCGTGTGTTACGGGACAAATACAAGGAACTT

luxAF:CCAGATCACCGAGTGAGGGCTCTCTATGAAATTTGGAA

luxAR:CCAGATCACCGTGTGCTATAATAGCGAACGTTGTTTTTCTTT

luxBF:CCAGATCACCGAGTGAGGAAAAAGAAATGAAATTTGGATT

luxBR:CCAGATCACCGTGTGCTACATGTGGTACTTTTTAATATTATCATT

luxEF:CCAGATCACCGAGTGAGGACAGGTATGACTTCATATGTTGATAAACA

luxER:CCAGATCACCGTGTGTCAACTATTAAATGCTTGGTTTAAGC

luxDF:CCAAATCACCGAGTGAGATAAGTTCCTTGTATTTGTCCCG

luxDR:CCAGATCACCGTGTGTTAAGACAGCGAAATCGCTTG

Gene is synthetic:

luxA:[BX571866.1:27616-28695]

luxD:[BX571866.1:26476-27439]

luxC:[BX571866.1:25061-26503]

luxB:[BX571866.1:28713-29687]

luxE:[BX571866.1:29749-30861]

Experimental procedure:

Prepare cUnitRHP: BglI cuts as enzyme pUnitRHP with the restriction restriction endonuclease, and adds the processing of CIAP dephosphorylation, reclaims enzyme with solution method and cuts product, is labeled as cUnitRHP.

Prepare cUnitPHP: BglI cuts as enzyme pUnitPHP with the restriction restriction endonuclease, and adds the processing of CIAP dephosphorylation, reclaims enzyme with solution method and cuts product, is labeled as cUnitPHP.

Make up pUnitRHPluxA: with luxA is that template is carried out PCR with primer luxAF and luxAR, DraIII cuts as enzyme the PCR product with the restriction restriction endonuclease, reclaim enzyme with solution method and cut product, with the T4 dna ligase cUnitRHP is connected with separated product, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pUnitRHPluxA that is labeled as.

Make up pUnitPHPluxD: pUnitRHPluxA is identical with making up, and wherein luxA, luxAF, luxAR, cUnitRHP replace with respectively: luxD, luxDF, luxDR, cUnitPHP.

Make up pUnitRHPluxC: pUnitRHPluxA is identical with making up, and wherein luxA, luxAF, luxAR, cUnitRHP replace with respectively: luxC, luxCF, luxCR, cUnitRHP.

Make up pUnitPHPluxB: pUnitRHPluxA is identical with making up, and wherein luxA, luxAF, luxAR, cUnitRHP replace with respectively: luxB, luxBF, luxBR, cUnitPHP.

Make up pUnitRHPluxE: pUnitRHPluxA is identical with making up, and wherein luxA, luxAF, luxAR, cUnitRHP replace with respectively: luxE, luxEF, luxER, cUnitRHP.

(6) assembling process:

Make up HOSTLuxAUnit: the pCMR electricity is transformed in the competence that HOST makes, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, the pUnitRHPluxA electricity is transformed in the competence that bacterium liquid makes, converted product is resuspended in the LB substratum, cultivated 30 minutes at 30 ℃, cultivated 30 minutes at 42 ℃, cultivated 30 minutes at 30 ℃, induce bacterium liquid to carry out HK022 LR reorganization, recombinant products is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, is cultured to bacterium liquid muddiness at 37 ℃, is labeled as HOSTLuxAUnit.

Make up HOSTLuxA: the pAH57 electricity is transformed in the competence that HOSTLuxAUnit makes, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, getting bacterium liquid coats on the LB agar plate, cultivated 1 hour at 42 ℃, induce the clone who grows to carry out λ LR reorganization, recombinant products is coated on the LB agar plate, be cultured to visible mono-clonal at 42 ℃, the clone on the picking flat board is inoculated in the LB liquid nutrient medium, be cultured to bacterium liquid muddiness at 42 ℃, be labeled as HOSTLuxA.

Make up HOSTLuxALuxBUnit: HOSTLuxAUnit is identical with making up, and wherein pCMR, HOST, pUnitRHPluxA, HK022 LR reorganization replace with respectively: pAH69, HOSTLuxA, pUnitPHPluxB, HK022 BP reorganization.

Make up HOSTLuxALuxB: HOSTLuxA is identical with making up, and wherein HOSTLuxAUnit replaces with: HOSTLuxALuxBUnit.

Make up HOSTLuxALuxBLuxEUnit: HOSTLuxAUnit is identical with making up, and wherein pCMR, HOST, pUnitRHPluxA, HK022 LR reorganization replace with respectively: pCMR, HOSTLuxALuxB, pUnitRHPluxE, HK022 LR reorganization.

Make up HOSTLuxALuxBLuxE: HOSTLuxA is identical with making up, and wherein HOSTLuxAUnit replaces with: HOSTLuxALuxBLuxEUnit.

Make up HOSTLuxALuxBLuxEExP: the pAH129E electricity is transformed in the competence that HOSTLuxALuxBLuxE makes, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, the pUnitExP electricity is transformed in the competence that bacterium liquid makes, converted product is resuspended in the LB substratum, cultivated 30 minutes at 30 ℃, cultivated 30 minutes at 42 ℃, cultivated 30 minutes at 30 ℃, induce bacterium liquid to carry out φ 80 LR reorganization, recombinant products is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, is cultured to bacterium liquid muddiness at 37 ℃, is labeled as HOSTLuxALuxBLuxEExP.

Make up pUnitLuxALuxBLuxE: the pAH69Pir electricity is transformed in the competence that HOSTLuxALuxBLuxEExP makes, induce converted product to carry out HK022 BP reorganization, recombinant products is coated on the LB agar plate that contains penbritin and kantlex, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin and kantlex, be cultured to bacterium liquid muddiness at 30 ℃, from bacterium liquid, extract plasmid, fragment with 6246bp in the agarose gel electrophoresis separation quality grain is labeled as pUnitLuxALuxBLuxE.

Make up HOSTLuxCUnit: HOSTLuxAUnit is identical with making up, and wherein pCMR, HOST, pUnitRHPluxA, HK022 LR reorganization replace with respectively: pCMR, HOST, pUnitRHPluxC, HK022 LR reorganization.

Make up HOSTLuxC: HOSTLuxA is identical with making up, and wherein HOSTLuxAUnit replaces with: HOSTLuxCUnit.

Make up HOSTLuxCLuxDUnit: HOSTLuxAUnit is identical with making up, and wherein pCMR, HOST, pUnitRHPluxA, HK022 LR reorganization replace with respectively: pAH69, HOSTLuxC, pUnitPHPluxD, HK022 BP reorganization.

Make up pUnitLuxCLuxD: HOSTLuxA is identical with making up, and wherein HOSTLuxAUnit replaces with: HOSTLuxCLuxDUnit.

Make up HOSTLuxCLuxDExR: HOSTLuxALuxBLuxEExP is identical with making up, and wherein HOSTLuxALuxBLuxE, pUnitExP replace with respectively: pUnitLuxCLuxD, pUnitExR.

Prepare pUnitLuxCLuxD: pUnitLuxALuxBLuxE is identical with making up, and wherein pAH69Pir, HOSTLuxALuxBLuxEExP replace with respectively: pCMRPir, HOSTLuxCLuxDExR.

Make up HOSTLuxALuxBLuxELuxCLuxDUnit: HOSTLuxAUnit is identical with making up, and wherein pCMR, HOST, pUnitRHPluxA, HK022 LR reorganization replace with respectively: pAH69, HOSTLuxALuxBLuxE, pUnitLuxCLuxD, HK022 BP reorganization.

Make up HOSTLuxALuxBLuxELuxCLuxD: HOSTLuxA is identical with making up, and wherein HOSTLuxAUnit replaces with: HOSTLuxALuxBLuxELuxCLuxDUnit.

HOSTLuxALuxBLuxELuxCLuxD is the product that 5 genomes are fitted together.

Embodiment 2: utilize linear package system assembling luxA, luxB, luxC, luxD, luxE.

(1) make up pLUHelp:

Gene is synthetic:

CrossInt:[AY048721.1:878-1258][AY048721.1:1259-1602][AY048715.1:1614-2236]TTGGCACTGGCTGATCAGCTAGCACATGT

Experimental procedure:

Make up pLUHelpH: with restriction restriction endonuclease NcoI and EcoRI pAH83 is cut as enzyme, separate the fragment that enzyme is cut 3822bp in the product with agarose gel electrophoresis, separated product is handled with alkali formula Phosphoric acid esterase, product is labeled as cAH83.With restriction restriction endonuclease EcoRI and PciI CrossInt is cut as enzyme, separate the fragment that enzyme is cut 1375bp in the product, be labeled as cCrossInt with agarose gel electrophoresis.With the T4 dna ligase cCrossInt is connected with cAH83, be transformed in the competence that E. coli DH5 α makes connecting the product electricity, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pLUHelpH that is labeled as.

Make up pLUHelp: HindIII cuts as enzyme pLUHelpH with the restriction restriction endonuclease, reclaim enzyme with solution method and cut product, with the T4 dna ligase separated product is connected, be transformed in the competence that E. coli DH5 α makes connecting the product electricity, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pLUHelp that is labeled as.

(2) unit carrier and assembling host insert the site:

Primer is synthetic:

CNF:AATAGTCGACCTTCGGAATAGGAACTTCATTTA

CNR:AATATCTAGAGCCTACCTGTGACGGAAGA

pUF:ATAAGGTACCGGATTGCGAGGCTTTGCC

pUR:TATAGTCGACGCAAGATCCGCAGTTCAACC

KNF:ATTAGTCGACGATCCCCTTATTAGAAGAACTCG

KNR:TTCATCTAGAAGAGCGCTTTTGAAGCTCA

ydeQF:TTATTCATAGATAAAAGTGACACCAATGA

ydeQR:GTCGATTCGATTTTCTTAGCCTT

Gene is synthetic:

CN(is connected among the pQLV): [JF748716.1:3633-3757] GGCCTCGACGGCCACGTTACTTAGTCATCGGCCTACGAGGCC[GU574773.1:14 25-1326] GGATCCGCAGCAGTAGAGCTCCTCGAGAGTGCAACGACTAGTCACATGGTG[AF06 4539.1:24474-25037] CACACGGTGGGTACC

KN(is connected among the pQLV): [JF748716.1:2177-2053] GGCCTCGACGGCC[CP000948.1:1675439-1675498] [AY048737.1:2029-1922] TGCACCGACCGTGAATTTAAGGCCTACGAGGCC[GU931384.1:750-849] GGATCCGCAGCAGTAGAGCTCCTCGAGAGTGCAACGACTAGTCACATGGTG[AF06 4539.1:24474-25037] CACACGGTGGGTACC[CP000948.1:1676351-1676410]

N15(is connected among the pQLV): GGATCC[FJ160465.1:3530-6278] CCATGGGGCGCGTACTGAGAGCTC

Par(is connected among the pQLV): CCATGG[FJ160465.1:8082-9448] GCTC

Experimental procedure:

Make up pN15Par: N15 is cut as enzyme with restriction restriction endonuclease NcoI and SacI, and adding CIAP dephosphorylation is handled, reclaim enzyme with solution method and cut product, with restriction restriction endonuclease NcoI and SacI par is cut as enzyme, separate the fragment that enzyme is cut 1375bp in the product with agarose gel electrophoresis, with the T4 dna ligase separated product is connected, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pN15Par that is labeled as.

Prepare cN15Par: with restriction restriction endonuclease BamHI and SacI pN15Par is cut as enzyme, separate the fragment that enzyme is cut 4130bp in the product, be labeled as cN15Par with agarose gel electrophoresis.

Prepare cR6K γ: with pKD13 is that template is carried out PCR with primer pUF and pUR, with restriction restriction endonuclease SalI and KpnI the PCR product is cut as enzyme, separates the fragment that enzyme is cut 427bp in the product with agarose gel electrophoresis, is labeled as cR6K γ.

Make up pN12C: with restriction restriction endonuclease SpeI and XhoI CN is cut as enzyme, separate the fragment that enzyme is cut 3308bp in the product, be labeled as cCN with agarose gel electrophoresis.With pKD3 is that template is carried out PCR with primer CNF and CNR, with restriction restriction endonuclease SalI and XbaI the PCR product is cut as enzyme, separates the fragment that enzyme is cut 905bp in the product with agarose gel electrophoresis, is labeled as cCHL.With the T4 dna ligase cCHL is connected with cCN, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pN12C that is labeled as.

Make up pR12C: with restriction restriction endonuclease SalI and KpnI pN12C is cut as enzyme, separate the fragment that enzyme is cut 1804bp in the product, be labeled as cN12C with agarose gel electrophoresis.With the T4 dna ligase cN12C is connected with cR6K γ, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains paraxin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains paraxin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pR12C that is labeled as.

Make up pLSU21C: pR12C is cut as enzyme with restriction restriction endonuclease BamHI and SacI, and adding CIAP dephosphorylation is handled, separate the fragment that enzyme is cut 2212bp in the product with agarose gel electrophoresis, with the T4 dna ligase separated product is connected with cN15Par, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains paraxin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains paraxin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pLSU21C that is labeled as.

Make up pN21K: with pKD13 is that template is carried out PCR with primer KNF and KNR, with restriction restriction endonuclease SalI and XbaI the PCR product is cut as enzyme, separates the fragment that enzyme is cut 1182bp in the product with agarose gel electrophoresis, is labeled as cKAN.With restriction restriction endonuclease SpeI and XhoI KN is cut as enzyme, separate the fragment that enzyme is cut 3540bp in the product, be labeled as cKN with agarose gel electrophoresis.With the T4 dna ligase cKN is connected with cKAN, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pN21K that is labeled as.

Make up pR21K: with SalI and KpnI pN21K is cut as enzyme, separate the fragment that enzyme is cut 2253bp in the product, be labeled as cN21K with agarose gel electrophoresis.With the T4 dna ligase cR6K γ is connected with cN21K, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pR21K that is labeled as.

Make up pLSU12K: pR21K is cut as enzyme with BamHI and SacI, and adding CIAP dephosphorylation is handled, separate the fragment that enzyme is cut 2661bp in the product with agarose gel electrophoresis, with the T4 dna ligase separated product is connected with cN15Par, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pLSU12K that is labeled as.

Make up E. coli MG1655 H2K: with pN21K is that template is carried out PCR with primer ydeQF and ydeQR, pKD46 is transformed in the change commentaries on classics competence that E. coli MG1655 makes, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, PCR product electricity is transformed in the competence that bacterium liquid makes, converted product is resuspended in the LB substratum, cultivated 1 hour at 37 ℃, induce the clone who grows to carry out λ Red reorganization, recombinant products is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, be labeled as E. coli MG1655 H2K.

(3) assembling host linearizing:

Primer is synthetic:

PG1F:CGTTCGCAGAATTGGGAATC

PG1R:GGGATAGCAAGCCCAATAGG

Gene is synthetic:

SopAB (being connected among the pQLV): CTCGAG[AF064539.1:22114-24973] AGCTT

TacTelN (being connected among the pQLV): ACTAGTGAAT[DQ997052.1:49-228] [AF064539.1:24981-26890]

Experimental procedure:

Make up pBSTacTelN: with TacTelN is that template is carried out PCR with primer PG1F and PG1R, with restriction restriction endonuclease SpeI and HindIII the PCR product is cut as enzyme, reclaims enzyme with solution method and cuts product, is labeled as cTacTelN.With restriction restriction endonuclease SpeI and HindIII pBluescript2KS (-) is cut as enzyme, and add the processing of CIAP dephosphorylation, separate the fragment that enzyme is cut 2929bp in the product, be labeled as cBS with agarose gel electrophoresis.With the T4 dna ligase cBS is connected with cTacTelN, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pBSTacTelN that is labeled as.

Make up pBSTacTelNSop: with restriction restriction endonuclease XhoI and HindIII pBSTacTelN is cut as enzyme, and add the processing of CIAP dephosphorylation, separate the fragment that enzyme is cut 5043bp in the product, be labeled as cBSTacTelN with agarose gel electrophoresis.With restriction restriction endonuclease XhoI and HindIII sopAB is cut as enzyme, separate the fragment that enzyme is cut 2869bp in the product, be labeled as cSop with agarose gel electrophoresis.With the T4 dna ligase cSop is connected with cBSTacTelN, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid, be labeled as pBSTacTelNSop.

Make up pAHTacTelNSop: with EcoRI and XhoI pBSTacTelNSop is cut as enzyme, separate the fragment that enzyme is cut 4998bp in the product, be labeled as cBSTacTelNSop with agarose gel electrophoresis.With SalI and EcoRI pAH153 is cut as enzyme, and add the processing of CIAP dephosphorylation, separate the fragment that enzyme is cut 2306bp in the product, be labeled as cAH153 with agarose gel electrophoresis.With the T4 dna ligase cAH153 is connected with cBSTacTelNSop, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains gentamicin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains gentamicin, be cultured to bacterium liquid muddiness at 37 ℃, extract plasmid, be labeled as pAHTacTelNSop.

Make up E. coli MG1655 H2KTS: the pAH123 electricity is transformed in the competence that E. coli MG1655 H2K makes, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, the pAHTacTelNSop electricity is transformed in the competence that bacterium liquid makes, converted product is resuspended in the LB substratum, cultivated 30 minutes at 30 ℃, cultivated 30 minutes at 42 ℃, cultivated 30 minutes at 30 ℃, induce bacterium liquid to carry out φ 80 BP reorganization, recombinant products is coated on the LB agar plate that contains gentamicin, be cultured to visible mono-clonal, be labeled as E. coli MG1655 H2KTS at 37 ℃.Under the TelN effect, E. coli MG1655 H2KTS forms telomere, is labeled as E. coli MG1655 H2KTSL.

(4) make up the recovery carrier:

Primer is synthetic:

pUEF:ATAAGAGCTCGGATTGCGAGGCTTTGCC

pUER:TATAACTAGTGCAAGATCCGCAGTTCAACC

KNF:ATTAGCGGCCGCGATCCCCTTATTAGAAGAACTCG

KNR:TTCAGGATCCAGAGCGCTTTTGAAGCTCA

CNF:AATAGCGGCCGCCTTCGGAATAGGAACTTCATTTA

CNR:AATAGGATCCGCCTACCTGTGACGGAAGA

Gene is synthetic:

Rep1 (being connected among the pQLV): [EF397941.1:3128-5246] TCCATAAGGACGTC

Rep2 (being connected among the pQLV): [EF583812.1:8100-6349] ACGTC

Rep3 (being connected among the pQLV): [EF397941.1:6985-7916] TGCTCGCAAAGTTGAAAAGACAACAATTGAAGTAGATCGTGACCTCGACTTGAACA TTGACATCCACGGAAATCCGCGTAGTAAAACT[EF397941.1:8005-8515] GACGTC

KE (being connected among the pQLV): GAGCTCATTAGCACGACCATGGTAGATTATGATTAATTAA[JF748716.1:3633-3757] CGCTTTGCGACTCAACCTTT[AY048737.1:1932-1784] GACGTCATCTTAGATACACTAGTAGATCTTATCGATGATCGCGGCCGCCACATGGT G

[AF064539.1:24474-25037]CACACGGTG

CE (being connected among the pQLV): GAGCTCATTAGCACGACCATGGTAGATTATGATTAATTAA[JF748716.1:2177-2053] CGCTTTGCGACTCAACCTTT[AY048737.1:1932-1784] GACGTCATCTTAGATACACTAGTAGATCTTATCGATGATCGCGGCCGCCACATGGT G[AF064539.1:24474-25037] CACACGGTG

Experimental procedure:

Prepare cR6K γ: with pKD13 is that template is carried out PCR with primer pUEF and pUER, with SpeI and SacI the PCR product is cut as enzyme, separates the fragment that enzyme is cut 427bp in the product with agarose gel electrophoresis, is labeled as cR6K γ.

Make up pCBREP12: with AatII and PciI rep2 is cut as enzyme, separate the fragment that enzyme is cut 1755bp in the product, be labeled as cREP2 with agarose gel electrophoresis.With AatII and PciI rep1 is cut as enzyme, and add the processing of CIAP dephosphorylation, reclaim enzyme with solution method and cut product, be labeled as cREP1.With the T4 dna ligase cREP1 is connected with cREP2, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pCBREP12 that is labeled as.

Make up pCBREP: with AatII and XhoI rep3 is cut as enzyme, separate the fragment that enzyme is cut 1535bp in the product, be labeled as cREP3 with agarose gel electrophoresis.With AatII and XhoI pCBREP12 is cut as enzyme, and add the processing of CIAP dephosphorylation, reclaim enzyme with solution method and cut product, be labeled as cREP12.With the T4 dna ligase cREP12 is connected with cREP3, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pCBREP that is labeled as.

Prepare cREP: with restriction restriction endonuclease AatII and XbaI pCBREP is cut as enzyme, separate the fragment that enzyme is cut 5392bp in the product, be labeled as cREP with agarose gel electrophoresis.

Make up pREPCE: with restriction restriction endonuclease AatII and SpeI CE is cut as enzyme, and add the processing of CIAP dephosphorylation, reclaim enzyme with solution method and cut product, be labeled as cCE.With the T4 dna ligase cCE is connected with cREP, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pREPCE that is labeled as.

Make up p15aEx1RC: with restriction restriction endonuclease BglII and NotI pREPCE is cut as enzyme, and add the processing of CIAP dephosphorylation, separate the fragment that enzyme is cut 8743bp in the product, be labeled as cREPCE with agarose gel electrophoresis.With pKD3 is that template is carried out PCR with primer CNF and CNR, with restriction restriction endonuclease BamHI and NotI the PCR product is cut as enzyme, separates the fragment that enzyme is cut 906bp in the product with agarose gel electrophoresis, is labeled as cCHL.With the T4 dna ligase cCHL is connected with cREPCE, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct p15aEx1RC that is labeled as.

Make up pLSEx1RC: with restriction restriction endonuclease XbaI and SacI p15aEx1RC is cut as enzyme, separate the fragment that enzyme is cut 7253bp in the product, be labeled as cEx1RC with agarose gel electrophoresis.With the T4 dna ligase cEx1RC is connected with cR6K γ, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains paraxin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains paraxin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pLSEx1RC that is labeled as.

Make up pREPKE: with restriction restriction endonuclease AatII and SpeI KE is cut as enzyme, and add the processing of CIAP dephosphorylation, reclaim enzyme with solution method and cut product, be labeled as cKE.With the T4 dna ligase cREP is connected with cKE, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pREPKE that is labeled as.

Make up p15aEx2RK: with restriction restriction endonuclease BglII and NotI pREPKE is cut as enzyme, and add the processing of CIAP dephosphorylation, separate the fragment that enzyme is cut 8743bp in the product, be labeled as cREPKE with agarose gel electrophoresis.With pKD13 is that template is carried out PCR with primer KNF and KNR, with restriction restriction endonuclease BamHI and NotI the PCR product is cut as enzyme, separates the fragment that enzyme is cut 1183bp in the product with agarose gel electrophoresis, is labeled as cKAN.With the T4 dna ligase cKAN is connected with cREPKE, be transformed in the change commentaries on classics competence that E. coli DH5 α makes connecting product, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct p15aEx2RK that is labeled as.

Make up pLSEx2RK: with restriction restriction endonuclease XbaI and SacI p15aEx2RK is cut as enzyme, separate the fragment that enzyme is cut 7530bp in the product, be labeled as cEx2RK with agarose gel electrophoresis.With the T4 dna ligase cEx2RK is connected with cR6K γ, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains kantlex, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pLSEx2RK that is labeled as.

(5) gene is connected to the unit carrier:

Consistent among primer luxCF, luxCR, luxAF, luxAR, luxBF, luxBR, luxEF, luxER, luxDF, luxDR, gene luxA, luxB, luxC, luxD, luxE and the embodiment 1 herein.

Experimental procedure:

Prepare cLSU21C: with SfiI pLSU21C is cut as enzyme, and add the processing of CIAP dephosphorylation, reclaim enzyme with solution method and cut product, be labeled as cLSU21C.

Prepare cLSU12K: SfiI cuts as enzyme pLSU12K with the restriction restriction endonuclease, and adds the processing of CIAP dephosphorylation, reclaims enzyme with solution method and cuts product, is labeled as cLSU12K.

Make up pLSU21CC: with luxC is that template is carried out PCR with primer luxCF and luxCR, DraIII cuts as enzyme the PCR product with the restriction restriction endonuclease, reclaim enzyme with solution method and cut product, with the T4 dna ligase cLSU21C is connected with separated product, be transformed in the change commentaries on classics competence that E. coli S17-1 Pir makes connecting product, converted product is coated on the LB agar plate that contains paraxin, be cultured to visible mono-clonal at 37 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains paraxin, be cultured to bacterium liquid muddiness at 37 ℃, from bacterium liquid, extract plasmid and sequence verification, verify the correct pLSU21CC that is labeled as.

Make up pLSU21CA: cLSU21C is identical with making up, and wherein luxC, luxCF, luxCR, cLSU21C replace with respectively: luxA, luxAF, luxAR, cLSU21C.

Make up pLSU21CE: cLSU21C is identical with making up, and wherein luxC, luxCF, luxCR, cLSU21C replace with respectively: luxE, luxEF, luxER, cLSU21C.

Make up pLSU12KB: cLSU21C is identical with making up, and wherein luxC, luxCF, luxCR, cLSU21C replace with respectively: luxB, luxBF, luxBR, cLSU12K.

Make up pLSU12KD: cLSU21C is identical with making up, and wherein luxC, luxCF, luxCR, cLSU21C replace with respectively: luxD, luxDF, luxDR, cLSU12K.

(6) assembling process:

Experimental procedure:

Make up E. coli MG1655 H2KTSLHost: the pLUHelp electricity is transformed in the competence that E. coli MG1655 H2KTSL makes, converted product is coated on the LB agar plate that contains penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin, be cultured to bacterium liquid muddiness at 30 ℃, be labeled as E. coli MG1655 H2KTSLHost.

Make up E. coli MG1655 H2KTSLluxA: the pLSU21CA electricity is transformed in the competence that E. coli MG1655 H2KTSLHost makes, induce converted product to form telomere, induce recombinant products to carry out λ LR reorganization, recombinant products is coated on the LB agar plate that contains paraxin and penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains paraxin and penbritin, be cultured to bacterium liquid muddiness at 30 ℃, be labeled as E. coli MG1655 H2KTSLluxA.

Make up E. coli MG1655 H2KTSLluxAB: the pLSU12KB electricity is transformed in the competence that E. coli MG1655 H2KTSLluxA makes, induce converted product to form telomere, induce recombinant products to carry out λ LR reorganization, recombinant products is coated on the LB agar plate that contains kantlex and penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex and penbritin, be cultured to bacterium liquid muddiness at 30 ℃, be labeled as E. coli MG1655 H2KTSLluxAB.

Make up E. coli MG1655 H2KTSLluxABE: the pLSU21CE electricity is transformed in the competence that E. coli MG1655 H2KTSLluxAB makes, induce converted product to form telomere, induce recombinant products to carry out λ LR reorganization, recombinant products is coated on the LB agar plate that contains paraxin and penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains paraxin and penbritin, be cultured to bacterium liquid muddiness at 30 ℃, be labeled as E. coli MG1655 H2KTSLluxABE.

Prepare pLSU21CABE: the pLSEx2RK electricity is transformed in the competence that E. coli MG1655 H2KTSLluxABE makes, induce converted product to form telomere, induce recombinant products to carry out HK022 LR reorganization, recombinant products coated contain kantlex, on the LB agar plate of penbritin and paraxin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in and contains kantlex, in the LB liquid nutrient medium of penbritin and paraxin, be cultured to bacterium liquid muddiness at 30 ℃, from bacterium liquid, extract plasmid, fragment with 9742bp in the agarose gel electrophoresis separation quality grain is labeled as pLSU21CABE.

Make up E. coli MG1655 H2KTSLluxC: the pLSU21CC electricity is transformed in the competence that E. coli MG1655 H2KTSLHost makes, induce converted product to form telomere, induce recombinant products to carry out λ LR reorganization, recombinant products is coated on the LB agar plate that contains paraxin and penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains paraxin and penbritin, be cultured to bacterium liquid muddiness at 30 ℃, be labeled as E. coli MG1655 H2KTSLluxC.

Make up E. coli MG1655 H2KTSLluxCD: the pLSU12KD electricity is transformed in the competence that E. coli MG1655 H2KTSLluxC makes, induce converted product to form telomere, induce recombinant products to carry out λ LR reorganization, recombinant products is coated on the LB agar plate that contains kantlex and penbritin, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains kantlex and penbritin, be cultured to bacterium liquid muddiness at 30 ℃, be labeled as E. coli MG1655 H2KTSLluxCD.

Prepare pLSU12KCD: the pLSEx1RC electricity is transformed in the competence that E. coli MG1655 H2KTSLluxCD makes, induce converted product to form telomere, induce recombinant products to carry out HK022 LR reorganization, recombinant products coated contain paraxin, on the LB agar plate of penbritin and kantlex, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in and contains paraxin, in the LB liquid nutrient medium of penbritin and kantlex, be cultured to bacterium liquid muddiness at 30 ℃, from bacterium liquid, extract plasmid, fragment with 9189bp in the agarose gel electrophoresis separation quality grain is labeled as pLSU12KCD.

Make up E. coli MG1655 H2KTSLluxABECD: the pLSU12KCD electricity is transformed in the competence that E. coli MG1655 H2KTSLluxABE makes, induce converted product to form telomere, induce recombinant products to carry out λ LR reorganization, recombinant products is coated on the LB agar plate that contains penbritin and kantlex, be cultured to visible mono-clonal at 30 ℃, clone on the picking flat board is inoculated in the LB liquid nutrient medium that contains penbritin and kantlex, be cultured to bacterium liquid muddiness at 30 ℃, be labeled as E. coli MG1655 H2KTSLluxABECD.

Embodiment 3: the no host of annular does not have recovery system assembling lux gene.

(1) make up pUC-Gate:

Synthetic primer:

PG1:CGTTCGCAGAATTGGGAATC

PG2:GGGATAGCAAGCCCAATAGG

M13F:TGTAAAACGACGGCCAGT

M13R:CAGGAAACAGCTATGACC

Synthetic gene:

Gate (being cloned among the pQLV): AAGCTTGCGGCCGCGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGG AACTTCTTAATTAACCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTG CGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTA TCGGTACCTTCGAGAGCTCCACCGAGTGACTAGTATGATGAATTCCACACGGTGGT CGACTACGTGCTAGCCTCGAGCAATTG

Experimental procedure: with GP1 and PG2 Gate is carried out PCR, the fragment that obtains with MfeI and HindIII enzyme in Fermentas T Buffer cut.Enzyme is cut product solution and is reclaimed.Be labeled as fragment cGate.In Fermentas R Buffer, the pUC18 carrier is carried out enzyme and cut, add FastAP dephosphorization acid simultaneously with EcoRI and HindIII.Enzyme is cut product solution and is reclaimed.Be labeled as fragment cUC.With T4 DNA ligase fragment cGate is connected with cUC.Connect product and be transformed in the middle of the DH5 α competence, be coated on after the conversion on the LB flat board of ammonia benzyl resistance.The clone who grows out is cooked bacterium colony PCR checking with M13F and M13R primer, and screening wherein has the clone of the PCR product of 300bp.The clone who obtains is cultivated and the extraction plasmid, and sequence verification does not have sudden change.This plasmid is designated as pUC-Gate.

(2) preparation resistance fragment:

Synthetic primer:

CRF:ATAACTCGAGACCACTTTGTACAAGAAAGCTGAAC

CRR:ATAAGCTAGCCTTCGGAATAGGAACTTCATTTAAAT

CLF :ATAAGGTACCGCCTACCTGTGACGGAAGATC

CLR:ATAAGAGCTCACCCAGCTTTCTTGTACAAAGTTG

GRF:ATAACTCGAGACAAGTTTGTACAAAAAAGCTGAACG

GRR:ATAAGCTAGCGAATTGTTAGGTGGCGGTACTTG

GLF:ATAAGGTACCGGAGACCCCACACTACCATCG

GLR:ATAAGAGCTCAGCCTGCTTTTTTGTACAAAGTTG

KRF:ATAACTCGAGAACCTTTTTCACCTAAAGGATGACA

KRR:ATAAGCTAGCGATCCCCTTATTAGAAGAACTCGTC

KLF:ATAAGGTACCAGAGCGCTTTTGAAGCTCACG

KLR:ATAAGAGCTCGGTGCACTTTAGGTGAATAAGTTGT

Synthetic gene:

C(is in the pQLV carrier): [JF748716.1:3757-3633] [GU589574.1:1023-129] [GU931384.1:849-750]

G(is in the pQLV carrier): [JF748716.1:2053-2177] [AY048737.1:3265-2481] [GU574773.1:1326-1425]

K(is in the pQLV carrier): AACCTTT[AY048737.1:2015-1927] [AY048744.1:1272-101] [AY048737.1:1932-1816] TAAAGTGCACC

PUC-Gate-Cut fragment: in Fermentas ScaI Buffer, pUC-Gate is carried out enzyme and cut processing, add FastAP simultaneously and carry out dephosphorization acid with SalI and NheI.The fragment that obtains reclaims with solution, is labeled as fragment pUC-Gate-Cut.

Fragment RC: with CRF and CRR C is carried out PCR, in Fermentas SdaI Buffer, the PCR product is carried out enzyme and cut with XhoI and NheI.Enzyme is cut product and is reclaimed with solution, is labeled as fragment RC.

Fragment CL: with CLF and CLR C is carried out PCR, in Fermentas BamHI Buffer, the PCR product is carried out enzyme and cut with SacI and KpnI.Enzyme is cut product and is reclaimed with solution, is labeled as fragment CL.

Fragment RG: with GRF and GRR C is carried out PCR, in Fermentas SdaI Buffer, the PCR product is carried out enzyme and cut with XhoI and NheI.Enzyme is cut product and is reclaimed with solution, is labeled as fragment RG.

Fragment GL: with GLF and GLR C is carried out PCR, in Fermentas BamHI Buffer, the PCR product is carried out enzyme and cut with SacI and KpnI.Enzyme is cut product and is reclaimed with solution, is labeled as fragment GL.

Fragment RK: with KRF and KRR C is carried out PCR, in Fermentas SdaI Buffer, the PCR product is carried out enzyme and cut with XhoI and NheI.Enzyme is cut product and is reclaimed with solution, is labeled as fragment RK.

Fragment KL: with KLF and KLR C is carried out PCR, in Fermentas BamHI Buffer, the PCR product is carried out enzyme and cut with SacI and KpnI.Enzyme is cut product and is reclaimed with solution, is labeled as fragment KL.

(3) make up plasmid pUC-C: fragment pUC-Gate-Cut is connected with RC with the T4 dna ligase.Connect product and be transformed in the middle of the DH5 α competence, be applied to the chlorampenicol resistant flat board after the conversion.Obtain the clone and use M13F and M13R primer sequence verification.Sequence correct for being labeled as plasmid pUC-C.

(4) make up plasmid pUC-G: fragment pUC-Gate-Cut is connected with RG with the T4 dna ligase.Connect product and be transformed in the middle of the DH5 α competence, be applied to the gentamicin resistant panel after the conversion.Obtain the clone and use M13F and M13R primer sequence verification.Sequence correct for being labeled as plasmid pUC-G.

(5) make up plasmid pUC-K: fragment pUC-Gate-Cut is connected with RC with the T4 dna ligase.Connect product and be transformed in the middle of the DH5 α competence, be applied to card after the conversion and receive the mycin resistant panel.Obtain the clone and use M13F and M13R primer sequence verification.Sequence correct for being labeled as plasmid pUC-K.

(6) make up plasmid pUC-GC: in Fermentas BamHI Buffer, pUC-C is carried out enzyme and cut, add the FastAP dephosphorylation simultaneously with SacI and KpnI.The fragment that obtains reclaims with solution.With the T4 dna ligase this fragment is connected with the GL fragment.Connect product and be transformed in the middle of the DH5 α competence, it is two anti-dull and stereotyped to be applied to gentamicin paraxin after the conversion.Obtain the clone and use M13F and M13R primer sequence verification.Sequence correct for being labeled as plasmid pUC-GC.

(7) make up plasmid pUC-KC: in Fermentas BamHI Buffer, pUC-C is carried out enzyme and cut, add the FastAP dephosphorylation simultaneously with SacI and KpnI.The fragment that obtains reclaims with solution.With the T4 dna ligase this fragment is connected with the KL fragment.Connect product and be transformed in the middle of the DH5 α competence, be applied to card after the conversion and receive the two anti-flat boards of mycin paraxin.Obtain the clone and use M13F and M13R primer sequence verification.Sequence correct for being labeled as plasmid pUC-KC.

(8) make up plasmid pUC-CG: in Fermentas BamHI Buffer, pUC-G is carried out enzyme and cut, add the FastAP dephosphorylation simultaneously with SacI and KpnI.The fragment that obtains reclaims with solution.With the T4 dna ligase this fragment is connected with the CL fragment.Connect product and be transformed in the middle of the DH5 α competence, it is two anti-dull and stereotyped to be applied to the paraxin gentamicin after the conversion.Obtain the clone and use M13F and M13R primer sequence verification.Sequence correct for being labeled as plasmid pUC-CG.

(9) make up plasmid pUC-KG: in Fermentas BamHI Buffer, pUC-G is carried out enzyme and cut, add the FastAP dephosphorylation simultaneously with SacI and KpnI.The fragment that obtains reclaims with solution.With the T4 dna ligase this fragment is connected with the KL fragment.Connect product and be transformed in the middle of the DH5 α competence, be applied to card after the conversion and receive the two anti-flat boards of mycin gentamicin.Obtain the clone and use M13F and M13R primer sequence verification.Sequence correct for being labeled as plasmid pUC-KG.

(10) make up plasmid pUC-CK: in Fermentas BamHI Buffer, pUC-K is carried out enzyme and cut, add the FastAP dephosphorylation simultaneously with SacI and KpnI.The fragment that obtains reclaims with solution.With the T4 dna ligase this fragment is connected with the CL fragment.Connect product and be transformed in the middle of the DH5 α competence, being applied to the paraxin card after the conversion, to receive mycin two anti-dull and stereotyped.Obtain the clone and use M13F and M13R primer sequence verification.Sequence correct for being labeled as plasmid pUC-CK.

(11) make up plasmid pUC-GK: in Fermentas BamHI Buffer, pUC-K is carried out enzyme and cut, add the FastAP dephosphorylation simultaneously with SacI and KpnI.The fragment that obtains reclaims with solution.With the T4 dna ligase this fragment is connected with the GL fragment.Connect product and be transformed in the middle of the DH5 α competence, being applied to the gentamicin card after the conversion, to receive mycin two anti-dull and stereotyped.Obtain the clone and use M13F and M13R primer sequence verification.Sequence correct for being labeled as plasmid pUC-GK.

(12) pUC-RFP fragment and OriS fragment: carrier J61031 is from iGEM (http://partsregistry.org/Part:BBa_J61031).With four enzymes of EcoRI SpeI XhoI NotI the J61031 plasmid being carried out enzyme in BamHI Buffer cuts.Glue reclaims wherein, and 4.1Kbp fragment (theoretical 4141bp) is the pUC-RFP fragment; Glue reclaims wherein, and 4.5Kbp fragment (theoretical 4548bp) is the OriS fragment.

(13) make up the no host of annular and do not have the unit of recovery empty carrier: pUC-GC, pUC-KC, pUC-CG, pUC-KG, pUC-CK, pUC-GK use EcoRI and SpeI double digestion respectively in Fermentas SdaI Buffer, add the FastAP dephosphorylation simultaneously.Obtain fragment and reclaim with solution respectively, be connected with the pUC-RFP fragment respectively.Connect product and be transformed into respectively in the middle of the DH5 α competence, transform back 6 kinds of separate application and arrive: AGC: penbritin+gentamicin+paraxin flat board; AKC: penbritin+card is received mycin+paraxin flat board; ACG: penbritin+paraxin+gentamicin flat board; AKG: penbritin+card is received mycin+gentamicin flat board; ACK: penbritin+paraxin+card is received the mycin flat board; AGK: penbritin+gentamicin+card is received the mycin flat board.More than six kinds of clones, 5 of pickings respectively, cultivate the back and extract plasmid, identify with EcoRI and SpeI double digestion.Get wherein correct each one.Enzyme is cut 6 correct carriers of checking in Fermentas O Buffer, carry out double digestion with XhoI and NotI respectively.Fragment solution respectively reclaims.The fragment that is recovered to is connected with the T4 dna ligase with the OriS fragment respectively.Connect product and be transformed into respectively in the middle of the DH5 α competence, transform back 6 kinds of separate application and arrive: AGC: penbritin+gentamicin+paraxin flat board; AKC: penbritin+card is received mycin+paraxin flat board; ACG: penbritin+paraxin+gentamicin flat board; AKG: penbritin+card is received mycin+gentamicin flat board; ACK: penbritin+paraxin+card is received the mycin flat board; AGK: penbritin+gentamicin+card is received the mycin flat board; Clone on six kinds of flat boards carries out two groups of PCR checkings with following primer: a) attR checking: FRVF: CCGCAAAAAAGGGAATAAGG and FRVR:TCAGGCATCGTGTGTAAGCA; B) attL checking: FLVF:TCGGTGTGCGGTTGTATGC and FLVR:GACGGTGCTCTGAAAGGTGA.Wherein: the fragment that contains the paraxin resistance PCR fragment of 1.3Kbp of should having an appointment.The fragment that contains the gentamicin resistance PCR fragment of 1.5Kbp of should having an appointment.Contain card and receive should the have an appointment PCR fragment of 1.8Kbp of the fragment of mycin resistance.Verify that six kinds of correct clones are respectively six kinds of unit carrier: FGC, FKC, FCG, FKG, FCK, FGK.

(14) synthetic FLP carrier (synthetic fragment is in the middle of pQLV), sequence is: CCATGGCATCACAGTATCGTGATGACAGAGGCAGGGAGTGGGACAAAATTGAAATC AAATAAGGATCCTACTAAGGAGGTTGTATGCCACAATTTGA[FJ797950.1:732 1-6482] G[FJ797950.1:6480-6064] TGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGC CGCTAGC

(15) make up helper plasmid pIXF: the pLUHelp in the embodiment 2 is carried out double digestion with NheI and NcoI in the middle of Fermentas Buffer Tango, add the FastAP dephosphorylation simultaneously.Enzyme is cut product and is reclaimed with solution.With primer PG1 and PG2 the FLP carrier is carried out PCR, the PCR product is carried out double digestion with NheI and NcoI in the middle of Fermentas Buffer Tango, enzyme is cut product and is reclaimed with solution.Two kinds of fragments that reclaim are connected with the T4 dna ligase, connect product and be transformed in the middle of the bacillus coli DH 5 alpha competence, be coated on the penbritin flat board after the conversion, 30 degrees centigrade of cultivations.Longer clone does bacterium colony PCR checking with primers F PF:CGCACGAAAAGCATCAGG and FPR:CGCAAAAACAACGAACCACA.Checking is got and wherein can be obtained the segmental clone of 1.7Kbp, extracts plasmid FPF and FPR primer sequence verification.Sequence verification is labeled as pIXFC1 for the correct plasmid that connects FLP.In Fermentas R Buffer pIXFC1 is cut with the HindIII enzyme, solution reclaims the back from connecting.Connect product and be transformed in the middle of the bacillus coli DH 5 alpha competence, be coated on the penbritin flat board after the conversion, 30 degrees centigrade of cultivations.Longer clone is cooked bacterium colony PCR checking with primer C1F:ACCTGACCGCTATCCCTGA and C1R:GCCCTTCAATCGCCAGA.Checking is got and wherein can be obtained the segmental clone of 250bp, and its plasmid is labeled as pIXF.

(16) make up host bacterium S17-1-IXF: pIXF is transformed in the middle of the E. coli S17-1, and 30 degrees centigrade at the penbritin plate screening.Obtain host bacterium S17-1-IXF.

(17) make up FG-luxA-C, FC-luxB-K, FK-luxC-G, FG-luxD-C, FC-luxE-K:

Synthetic primer:

GR:GGGCATACGGGAAGAAGTG

CF:TCAACAGGGACACCAGGATTT

CR:AGGGCGGGGCGTAAGG

KF:CGTTTCTGCGGACTGGC

KR:CGCCTTCTTGACGAGTTCTTC

GF:GCCCCCGATGGTAGTGTG

The endonuclease bamhi of luxA, luxB, luxC, luxD, luxE comes from the middle of the exemplifying embodiment 2.FGC, FCK, FKG are cut with the DraIII enzyme in the middle of Fermentas Buffer Tango respectively, add the FastAP dephosphorylation simultaneously.Reclaim the FGC fragment, be connected with luxA, luxD fragment respectively; Reclaim the FCK fragment, be connected with luxB, luxE fragment respectively; Reclaim the FKG fragment, be connected with the luxC fragment.Connect product and be transformed into respectively in the middle of the DH5 α competence, transform back 5 kinds of difference and be coated with as follows and screen: FGC+luxA: gentamicin+paraxin flat board; Primer screening GR+CF; FGC+luxD: gentamicin+paraxin flat board; Primer screening GR+CF; FCK+luxB: paraxin+card is received the mycin flat board; Primer screening CR+KF; FCK+luxE: paraxin+card is received the mycin flat board; Primer screening CR+KF; FKG+luxC: card is received mycin+gentamicin flat board; Primer screening KR+GF.Verify that correct plasmid is labeled as respectively: FG-luxA-C, FG-luxD-C, FC-luxB-K, FC-luxE-K, FK-luxC-G.These plasmids are transformed into respectively among the host bacterium S17-1IXF, obtain bacterium in 5: S17-1IXF (FG-luxA-C), S17-1IXF (FG-luxD-C), S17-1IXF (FC-luxB-K), S17-1IXF (FC-luxE-K), S17-1IXF (FK-luxC-G).

(18) parallel assembling:

A) first round:

With S17-1IXF (FG-luxA-C) and two kinds of each 2mL of bacterium liquid of S17-1IXF (FC-luxB-K), the heart of isolating respectively gets off, and is resuspended with 500 μ L antibiotic-free LB substratum; Repeat once.Two kinds of resuspended bacterium liquid are for the second time mixed, cultivated 4 hours at 30 degrees centigrade.After 4 hours, mixed bacteria liquid is rule on gentamicin+kantlex LB flat board.Be cultured to visible mono-clonal.The picking mono-clonal is the negative sieve of paraxin LB plate streaking, the clone that screening wherein can not be grown in paraxin.Be labeled as S17-1IXF (FG-luxAluxB-K).

With S17-1IXF (FK-luxC-G) and two kinds of each 2mL of bacterium liquid of S17-1IXF (FG-luxD-C), the heart of isolating respectively gets off, and is resuspended with 500 μ L antibiotic-free LB substratum; Repeat once.Two kinds of resuspended bacterium liquid are for the second time mixed, cultivated 4 hours at 30 degrees centigrade.After 4 hours, mixed bacteria liquid is rule on kantlex+paraxin LB flat board.Be cultured to visible mono-clonal.The picking mono-clonal is the negative sieve of gentamicin LB plate streaking, the clone that screening wherein can not be grown in gentamicin.Be labeled as S17-1IXF (FK-luxCluxD-C).

B) with S17-1IXF (FG-luxAluxB-K) and two kinds of each 2mL of bacterium liquid of S17-1IXF (FK-luxCluxD-C), the heart of isolating respectively gets off, and is resuspended with 500 μ L antibiotic-free LB substratum; Repeat once.Two kinds of resuspended bacterium liquid are for the second time mixed, cultivated 4 hours at 30 degrees centigrade.After 4 hours, mixed bacteria liquid is rule on gentamicin+paraxin LB flat board.Be cultured to visible mono-clonal.The picking mono-clonal is the negative sieve of kantlex LB plate streaking, the clone that screening wherein can not be grown in kantlex.Be labeled as S17-1IXF (FG-luxAluxBluxCluxD-C).

C) with S17-1IXF (FG-luxAluxBluxCluxD-C) and two kinds of each 2mL of bacterium liquid of S17-1IXF (FC-luxE-K), the heart of isolating respectively gets off, and is resuspended with 500 μ L antibiotic-free LB substratum; Repeat once.Two kinds of resuspended bacterium liquid are for the second time mixed, cultivated 4 hours at 30 degrees centigrade.After 4 hours, mixed bacteria liquid on receiving mycin LB flat board, gentamicin+card is rule.Be cultured to visible mono-clonal.The picking mono-clonal is the negative sieve of paraxin LB plate streaking, the clone that screening wherein can not be grown in paraxin.Be labeled as S17-1IXF (FG-luxAluxBluxCluxDluxE-K).

Embodiment 4 linear no hosts do not have recovery system.

(1) the synthetic SopAB(of full gene is connected among the pQLV), sequence is: GGATCC[AF064539.1:24970-22120] CTAGC

(2) the linear helper plasmid pIXSop of structure: the pIXFC1 among the embodiment 3 is cut with BamHI and NheI couple in Fermentas Tango Buffer, add the FastAP dephosphorylation simultaneously.Enzyme is cut product and is reclaimed with solution.Synthetic SopAB plasmid is cut with BamHI and NheI are two in Fermentas Tango Buffer, and glue reclaims the wherein fragment of about 2.9Kbp.Two fragments are connected with the T4 dna ligase, connect product and be transformed in the middle of the bacillus coli DH 5 alpha competence, be coated on the penbritin flat board after the conversion, 30 degrees centigrade of cultivations.6 longer clones of picking cultivate bacterium liquid and extract plasmid, and enzyme is cut the checking screening wherein with BamHI and the two plasmids that can produce about 5.1Kbp and 2.9Kbp of cutting of NheI.Correct plasmid is labeled as pIXSopC1.In Fermentas R Buffer pIXSopC1 is cut with the HindIII enzyme, solution reclaims the back from connecting.Connect product and be transformed in the middle of the bacillus coli DH 5 alpha competence, be coated on the penbritin flat board after the conversion, 30 degrees centigrade of cultivations.Longer clone verifies that with primer C1F:ACCTGACCGCTATCCCTGA and C1R:GCCCTTCAATCGCCAGA bacterium colony PCR screening is got and wherein can be obtained the segmental clone of about 250bp, and its plasmid is labeled as pIXSop.

(3) make up host bacterium S17-1-IXSop: pIXSop is transformed in the middle of the E. coli S17-1, and 30 degrees centigrade at the penbritin plate screening.Obtain host bacterium S17-1-IXSop.

(4) make up linear no host and do not have the unit of recovery carrier: pJAZZ-OC comes from Lucigen.In Fermentas ScaI Buffer, pJAZZ-OC is carried out double digestion with XbaI and PacI.Reclaim the wherein fragment of 10Kbp and 0.5Kbp.In Fermentas ScaI Buffer, respectively the pUC-GC among the embodiment 3, pUC-KC, pUC-CG, pUC-KG, pUC-CK, pUC-GK are carried out double digestion, reclaim the wherein fragment of 2.1Kbp, 2.5Kbp, 2.1Kbp, 2.3Kbp, 2.5Kbp, 2.3Kbp with glue respectively with NheI and PacI.The fragment that reclaims is cut two fragments that reclaim in the product respectively at the pJAZZ-OC enzyme and is connected.Connect product and be transformed into TSA competence central (from Lucigen) respectively, be coated on the following flat board and cultivate and screen: AGC: penbritin+gentamicin+paraxin flat board; AKC: penbritin+card is received mycin+paraxin flat board; ACG: penbritin+paraxin+gentamicin flat board; AKG: penbritin+card is received mycin+gentamicin flat board; ACK: penbritin+paraxin+card is received the mycin flat board; AGK: penbritin+gentamicin+card is received the mycin flat board.The picking clone that will grow respectively respectively, cultivate and extract plasmid, select wherein plasmid, and in the middle of Fermentas Buffer R, wherein can enzyme cut the plasmid that obtains three bar segment (wherein near 1Kbp) with XhoI and the screening of DraIII double digestion greater than 10Kbp.Six kinds of plasmids then picking out are labeled as respectively: LGC, LKC, LCG, LKG, LCK, LGK.

(5) endonuclease bamhi of structure LG-luxA-C, LC-luxB-K, LK-luxC-G, LG-luxD-C, LC-luxE-K:luxA, luxB, luxC, luxD, luxE comes from the middle of the embodiment 2.LGC, LCK, LKG are cut with the DraIII enzyme in the middle of Fermentas Buffer Tango respectively, add the FastAP dephosphorylation simultaneously.Reclaim the LGC fragment, be connected with luxA, luxD fragment respectively; Reclaim the LCK fragment, be connected with luxB, luxE fragment respectively; Reclaim the LKG fragment, be connected with the luxC fragment.Connect product and be transformed into respectively in the middle of the S17-1-IXSop competence, transform the back 30 degrees centigrade of cultivations, 5 kinds of conversion products are coated with as follows respectively and screen: LGC+luxA: gentamicin+paraxin flat board; Primer screening GR+CF; LGC+luxD: gentamicin+paraxin flat board; Primer screening GR+CF; LCK+luxB: paraxin+card is received the mycin flat board; Primer screening CR+KF; LCK+luxE: paraxin+card is received the mycin flat board; Primer screening CR+KF; LKG+luxC: card is received mycin+gentamicin flat board; Primer screening KR+GF.The screening usefulness primer sequence be with embodiment 3 in identical.Verify that correct plasmid is labeled as respectively: LG-luxA-C, LG-luxD-C, LC-luxB-K, LC-luxE-K, LK-luxC-G.The host bacterium that contains these plasmids is designated as: S17-1IXSop (FG-luxA-C), S17-1IXSop (FG-luxD-C), S17-1IXSop (FC-luxB-K), S17-1IXSop (FC-luxE-K), S17-1IXSop (FK-luxC-G).

(6) parallel assembling:

A) first round:

With S17-1IXSop (LG-luxA-C) and two kinds of each 2mL of bacterium liquid of S17-1IXSop (LC-luxB-K), the heart of isolating respectively gets off, and is resuspended with 500 μ L antibiotic-free LB substratum; Repeat once.Two kinds of resuspended bacterium liquid are for the second time mixed, cultivated 4 hours at 30 degrees centigrade.After 4 hours, mixed bacteria liquid is rule on gentamicin+kantlex LB flat board.Be cultured to visible mono-clonal.The picking mono-clonal is the negative sieve of paraxin LB plate streaking, the clone that screening wherein can not be grown in paraxin.Be labeled as S17-1IXSop (LG-luxAluxB-K).

With S17-1IXSop (LK-luxC-G) and two kinds of each 2mL of bacterium liquid of S17-1IXSop (LG-luxD-C), the heart of isolating respectively gets off, and is resuspended with 500 μ L antibiotic-free LB substratum; Repeat once.Two kinds of resuspended bacterium liquid are for the second time mixed, cultivated 4 hours at 30 degrees centigrade.After 4 hours, mixed bacteria liquid is rule on kantlex+paraxin LB flat board.Be cultured to visible mono-clonal.The picking mono-clonal is the negative sieve of gentamicin LB plate streaking, the clone that screening wherein can not be grown in gentamicin.Be labeled as S17-1IXSop (LK-luxCluxD-C).

B) with S17-1IXSop (LG-luxAluxB-K) and two kinds of each 2mL of bacterium liquid of S17-1IXSop (LK-luxCluxD-C), the heart of isolating respectively gets off, and is resuspended with 500 μ L antibiotic-free LB substratum; Repeat once.Two kinds of resuspended bacterium liquid are for the second time mixed, cultivated 4 hours at 30 degrees centigrade.After 4 hours, mixed bacteria liquid is rule on gentamicin+paraxin LB flat board.Be cultured to visible mono-clonal.The picking mono-clonal is the negative sieve of kantlex LB plate streaking, the clone that screening wherein can not be grown in kantlex.Be labeled as S17-1IXSop (LG-luxAluxBluxCluxD-C).

C) with S17-1IXSop (LG-luxAluxBluxCluxD-C) and two kinds of each 2mL of bacterium liquid of S17-1IXSop (LC-luxE-K), the heart of isolating respectively gets off, and is resuspended with 500 μ L antibiotic-free LB substratum; Repeat once.Two kinds of resuspended bacterium liquid are for the second time mixed, cultivated 4 hours at 30 degrees centigrade.After 4 hours, mixed bacteria liquid on receiving mycin LB flat board, gentamicin+card is rule.Be cultured to visible mono-clonal.The picking mono-clonal is the negative sieve of paraxin LB plate streaking, the clone that screening wherein can not be grown in paraxin.Be labeled as S17-1IXSop (LG-luxAluxBluxCluxDluxE-K).

The reaction of embodiment 5 vitro recombination realizes assembling.

Extract two kinds of plasmid: LK-luxC-G, LG-luxD-C among the embodiment 4.With volumetric molar concentrations such as two kinds of carriers are diluted to, respectively get 4 μ l, mix with the LR Clonase II Enzyme Mix of the Invitrogen of 2 μ l, 25 degrees centigrade of reactions 1 hour.Be transformed in the middle of the TSA competence, be coated on the LB flat board of kantlex and paraxin and cultivate.The clone who grows out gets the clone who wherein only contains kantlex and chlorampenicol resistant with the negative sieve of gentamicin.The clone who satisfies condition comprises plasmid LK-luxCluxD-C.This embodiment proves that assembling reorganization can carry out external.

The present invention is a kind of system and method for multi-disc segment DNA assembling.Relate to locus specificity reorganization, the lambda red reorganization of irreversible reaction, shape material grain and linear genome.

The locus specificity reorganization of irreversible reaction: with the recombining reaction in intestinal bacteria Lambda phage and the similar phage is under Int and IHF enzyme catalysis, attB+attP à attL+attR; Under Int, Xis and IHF enzyme catalysis: attL+attR à attB+attP.

Such recombination system can be incorporated into circular plasmids in the middle of the karyomit(e), and can reclaim from karyomit(e).The excision of the integration of annular element carrier and selection markers part in the middle of the present invention, annular assembling host, annular reclaim the integration of carrier and reclaim and all utilized this principle.

Characteristics of the present invention:

Annular element carrier among the present invention, annular assembling host carry out in turn, and assembling process has significantly distinguish at 3 with U.S. Pat 7267984:

1, US7267984 is the order assemble method, so US7267984 does not wrap the feature that the fragment guaranteeing to assemble can further be assembled.

2, US7267984 and also do not comprise the system that further standard carrier is simplified assembling process.

3, the order order of recombinating is in the regrouping process of US7267984: by two topology reconstruction sites reactions carrier is inserted earlier, and then cut out carrier framework by the reactive end reorganization DNA is joined; This patent is described process can directly make DNA join by two reactive end reactions earlier, and then cuts out carrier framework by the reaction of topology reconstruction site, also can pass through.

Claims (1)

1. the method for the parallel assembling of a multistage DNA is characterized in that:

Treat the assembling fragment and clone, met the unit carrier of " macroelement carrier " structure;

Select a series of differences that contain according to " the assembling function " of unit carrier and wait to assemble segmental macroelement carrier, form " can assemble formation ";

To " assembling formation and " carry out " the parallel assembling of formation ";

Concrete steps:

(1) at first, according to assembling implementer's needs, " fragment to be assembled " is cloned into " dummy cell carrier " central form " unit carrier "; Get to contain and remain to be assembled segmental " unit carrier " and other " macroelement carrier " formation at least a " formation just begins to assemble "; Then, " formation just begins to assemble " carried out " the parallel assembling of formation ", the unit amount vector equals 1 in " can assemble formation " of forming; 1 carrier of gained in the last formation comprises the institute that needs design sequence to arrange according to the assembling implementer and remains to be assembled segmental assembling product;

And,

(2) assembling is if take place in cell, and then required recombinase is expressed by " helper plasmid "; Assembling is if take place in the extracellular, and then required recombinase directly adds with the albumen form;

And,

(3) when " the parallel assembling of formation " the auxiliary of " helper plasmid ", " assembling host ", " recovery carrier " when needing, arranged in the assembling process;

Described " macroelement carrier " comprises " unit carrier " and " assembling host ";

The constitutional features of described " unit carrier " is as follows: " unit carrier " structure has following 2 kinds of possibilities:

(1) a kind of is to contain substance structure site " unit carrier ", comprises successively by the sequence order: left arm, left reactive end, fragment to be assembled, right reactive end, right arm, topology reconstruction site, connect left arm;

Perhaps,

(2) another kind is to contain dual structure site unit carrier, comprises successively by the sequence order: fixed arm, reclaim reconstruct site, left arm, left reactive end, fragment to be assembled, right reactive end, right arm, topology reconstruction site, connect the aforementioned fixation arm;

Described " fragment to be assembled " forms " the unit carrier " that contains " fragment to be assembled " in the middle of being connected to " dummy cell carrier ";

Described " assembling host " is that " fragment to be assembled " length is 0 " unit carrier ", has following constitutional features: fixed arm, reclaim reconstruct site, left arm, left reactive end and right reactive end and one, right arm, topology reconstruction site are arranged at least, connect the aforementioned fixation arm;

Described " macroelement carrier " has following feature:

(1) difference of " assembling function " type of " macroelement carrier " is left reactive end, right reactive end, topology reconstruction site, reclaims the difference in reconstruct site;

And,

(2) " macroelement carrier " has at least 1 type " assembling function ";

And,

(3) reactive end of " the macroelement carrier " of different types " assembling function " and the selection in reconstruct site will be satisfied: " the macroelement carrier " of any " assembling function ", and exist " the macroelement carrier " of a kind of " assembling function " " to match each other " at least with it;

And,

(4) all kinds of " the assembling function " of " macroelement carrier " will satisfy: for any amount fragment to be assembled, have a kind of " can assemble formation " at least;

The constitutional features of described " recovery carrier " is as follows:

(1) " recovery carrier " has and reclaims reconstruct site, left reactive end, right reactive end, topology reconstruction site, connects in the middle of 4 recombination sites of aforementioned fixation arm at least wherein 2;

And,

(2) " the macroelement carrier " of " recovery carrier " and " coupling " to carry out the purpose product of " carrier displacement " still be " macroelement carrier ";

Described " fragment to be assembled " is the fragment that the assembling implementer need assemble; The dna sequence dna of " fragment to be assembled ", allowing is the reorganization that does not participate in reactive end, topology reconstruction site, recovery reconstruct site arbitrarily, and does not participate in the dna sequence dna of the screening of replicon and selection markers;

It is described that to wait to assemble segmental " left reactive end " and " right reactive end " be to have the dna sequence dna that the reorganization ability takes place; And in " assembling reaction ", same unit carries intravital left reactive end and right reactive end does not have mutual reorganization ability; And, in " assembling reaction ", from disappearing after the left reactive end of " the macroelement carrier " of different " assembling functions " and the reorganization of right reactive end or becoming the active dna sequence dna of under this recombinase, not recombinating; And " left reactive end " and " right reactive end " comes from the dummy cell carrier or comes from fragment to be assembled;

Described " topology reconstruction site " is the sequence-specific recombination site, or Telomerase site, or 2 telomeres that disconnect mutually, and in same " assembling reaction ", have the reorganization of generation ability, and in same " assembling reaction ", do not have with identical carrier in reactive end or reclaim the ability of reconstruct site reorganization; And when the topology reconstruction site was 2 telomeres that disconnect mutually, the vector dna molecule that contains the topology reconstruction site was linear on topological framework;

Described " reclaiming the reconstruct site " is to have the dna sequence dna that the reorganization ability takes place in " assembling reaction ", and in same " assembling reaction ", do not have with identical carrier in the ability of any reactive end reorganization, and do not have in same " assembling reaction " with identical carrier in the ability of topology reconstruction site reorganization;

Described " fixed arm ", " left arm ", " right arm " are not have with reactive end, topology reconstruction site arbitrarily in " assembling reaction ", reclaim the dna sequence dna of reconstruct site reorganization ability, comprising at least one replicon and at least one selection markers;

Described " displacement arm " is the dna sequence dna that does not participate in the reorganization in reactive end, topology reconstruction site, recovery reconstruct site arbitrarily;

Described " recovery carrier " has following 3 features with " the site coupling " of " macroelement carrier ":

(1) in " recovery carrier " recombination site of comprising with the recovery reconstruct site of " macroelement carrier ", left reactive end, right reactive end, topology reconstruction site recombination site in the middle of at least 2 have the abilities that reorganization takes place;

And,

(2) " recovery carrier " meets the constitutional features of " macroelement carrier " with " macroelement carrier " generation " carrier displacement " purpose product afterwards, and has the screening feature before the reaction of being different from;

" carrier displacement " definition of described " recovery carrier " and " macroelement carrier " comprises following 2 reactions:

(1) " recovery carrier " and " macroelement carrier " reclaim and have wherein 2 in the middle of reconstruct site, left reactive end, right reactive end, 4 recombination sites in topology reconstruction site at least and recombinate;

After the purpose product of described " carrier displacement " is " carrier displacement " reaction, obtain " fragment to be assembled " and the carrier that meet " macroelement carrier " feature of reactant central " macroelement carrier ";

" the matching each other " of described " macroelement carrier " is defined as satisfies following three conditions simultaneously:

(1) satisfies the reactive end coupling: 2 unit carriers, perhaps wherein 2 unit carriers are through " carrier displacement " afterwards at the most, the right reactive end of one of them unit carrier has the ability of recombinating with the left reactive end of another unit carrier, and perhaps the left reactive end of one of them unit carrier has the ability of recombinating with the right reactive end of another unit carrier; Above-mentioned two kinds of situations do not take place under the same enzyme catalysis simultaneously; This reorganization is defined as " reorganization of reactive end coupling ";

And,

(2) satisfy reconstruct site coupling: 2 unit carriers itself, perhaps wherein both unit carriers are through " carrier displacement " afterwards at the most, under the same enzyme catalysis, the topology reconstruction site of one of them unit carrier and another unit carrier has the reorganization ability, perhaps the topology reconstruction site of one of them unit carrier and another unit carrier is the telomere form of disconnection simultaneously, and perhaps the recovery reconstruct site of one of them unit carrier and another unit carrier has the reorganization ability; Above-mentioned three kinds of situations do not take place under the same enzyme catalysis simultaneously; This reorganization is defined as " the coupling reorganization of reconstruct site ";

And,

(3) satisfy the screening characteristic matching: 2 the unit carriers itself that match each other, perhaps wherein both unit carriers are through " carrier displacement " afterwards at the most, each step recombinant products of assembling between the unit carrier is all had any different in the screening changing features of crossing reacting precursor;

Described " matching unit carrier to " is defined as 2 " macroelement carriers " of satisfied " matching each other " relation;

Described " assembling reaction " is the recombining reaction that takes place between 2 " the macroelement carriers " of " matching each other ", and its feature is as follows:

(1) under the situation that " matching each other " needs, carries out required " carrier displacement " with " recovery carrier " earlier, " reorganization of reactive end coupling " and " the coupling reorganization of reconstruct site " 2 reorganization take place then;

And,

(2) " assembling reaction " product is to contain the institute that is comprised in its 2 " macroelement carrier " precursors in the middle of the recombining reaction product to remain to be assembled segmental carrier;

According to the structure of described unit carrier, the product of " assembling reaction " satisfies the definition of unit carrier, still is called " unit carrier ", has the ability that continues to take place with " the macroelement carrier " of coupling the assembling reaction;

Described " can assemble formation " is the formation that is made of " macroelement carrier "; And satisfy: " macroelement carrier " quantity is 2N or 2N+1 in formation, and N is a nonnegative integer, can pick out " the matching unit carrier to " that be no more than N not shared mutually " macroelement carrier " in the formation, this is no more than these " matching unit carriers to " in " macroelement carrier " the alternative former formation that obtains after N's " matching unit carrier to " generations " assembling reaction ", the formation that obtains still meets the condition of " can assemble formation ";

Described " formation just begins to assemble " is one " can assemble formation ", is made of the unit carrier that contains " fragment to be assembled " and " assembling host "; And the quantity of " unit carrier " that contains " fragment to be assembled " in the formation is consistent with the number of fragments of required assembling, and each " unit carrier " contains a fragment to be assembled; And, contained the waiting of unit carrier in the formation assemble segmental order with the assembling implementer the purpose assembling sequence consistent;

Described " the parallel assembling of formation " is defined as following process: according to aforementioned definitions, in " macroelement carrier " quantity is N " the matching unit carrier to " of sharing unit carrier not mutually that be no more than that exists in " can assemble formation " of 2N or 2N+1 (N is a nonnegative integer), make this be no more than N " matching unit carrier to " parallel simultaneously carrying out " assembling reaction ", and with " assembling reaction " product of each " matching unit carrier to " or " host's intermediate " alternative former " matching unit carrier to ";

The macroelement carrier:

(1) all kinds of " the assembling function " of described " macroelement carrier " further satisfies: for " fragment to be assembled " of any amount, have a kind of " coupling assembling formation " at least;

And,

(2), make described " formation just begins to assemble " satisfy the requirement of " coupling assembling formation " by selecting " the macroelement carrier " of " coupling ";

And,

(3) " formation just begins to assemble " of satisfying " coupling assembling formation " requirement carried out " assembling of formation PARALLEL MATCHING ";

Described " coupling assembling formation " is " can assemble formation " of satisfying following 2 conditions:

(1) " macroelement carrier " quantity is 2N or 2N+1 in formation, and N is nonnegative integer, then has " the matching unit carrier to " of N not shared mutually " macroelement carrier " in the formation;

And,

(2) substitute these " matching unit carriers to " in former formation with " the macroelement carrier " that obtain after aforementioned N " matching unit carrier to " generations " assembling reaction ", the formation that obtains still meets the condition of " coupling is assembled formation ";

Described " assembling of formation PARALLEL MATCHING " is defined as following process: according to aforementioned definitions, in " macroelement carrier " quantity is 2N or 2N+1, and N is N not shared mutually " macroelement carrier " existing in the nonnegative integer " coupling assembling formation " " matching unit carrier to ", make this N " matching unit carrier to " parallel simultaneously carrying out " assembling reaction ", and with " assembling reaction " product of each " matching unit carrier to " alternative former " matching unit carrier to ";

First kind of selection markers:

(1) selection markers has at least a kind, and one of the left arm of every kind " unit carrier " or right arm have selection markers;

And,

(2) " assemble reaction " when taking place, in the cell at " assembling host " place, " unit carrier " do not have replication; And " assembling host " is karyomit(e); And, reclaim carrier and when specific helper plasmid exists, have the ability of in the assembling host, duplicating;

And,

(3) wherein after a group of " unit carrier " and " assembling host " generations " reorganization of reactive end coupling ", " the coupling reorganization of reconstruct site ", the selection markers of utilization " unit carrier " screens the intermediate product that intermediate screens the selection markers that contains the unit carrier; After another group wherein of " reactive end coupling reorganization ", " the coupling reorganization of reconstruct site " takes place in intermediate product again, utilize " unit carrier " with selection markers lose screening " assembling is reacted " product;

And,

(4) screening of " carrier displacement " purpose product: after one of them of 2 reorganization of " macroelement carrier " and " recovery carrier " generation " carrier displacement " reaction, utilize the selection markers of " recovery carrier " to screen intermediate; Wherein another of 2 reorganization of " carrier displacement " reaction takes place in intermediate again, utilizes " recovery carrier " reproducible screening " carrier displacement " product under particular copy albumen;

And,

(5) " helper plasmid " is the temperature sensitivity carrier; And, before each step reorganization, helper plasmid is transformed into host cell; And, do not have at " helper plasmid " in each step reorganization back under the temperature of replication and cultivate, helper plasmid is removed from host cell;

Second kind of selection markers:

(1) selection markers has at least 2 kinds, and the left arm or the right arm of " the unit carrier " of every kind " assembling function " have a kind of selection markers, and the selection markers that two arms are had is different; And " assembling reaction " when taking place, in the host cell at " assembling host " place, " unit carrier " do not have replication; And " assembling host " is karyomit(e), and the assembling host of at least 2 kinds of differences " assembling function " is arranged, and every kind contains a kind of different selection markers; And " recovery carrier " has the ability of duplicating containing its " helper plasmid " that duplicates required replication protein in host cell when existing;

(2) after " unit carrier " and " macroelement carrier " generation " assembling reaction ", utilize " macroelement carrier " with the selection markers of quilt " unit carrier " of selection markers replace and screen " assembling reaction " product;

(3) after one of them of 2 reorganization of " macroelement carrier " and " recovery carrier " generation " carrier displacement " reaction, utilize " recovery carrier " and " macroelement carrier " 2 selection markers to screen " carrier displacement " product;

The third selection markers:

(1) selection markers has at least 3 kinds, and the left arm and the right arm of every kind " unit carrier " have a kind of selection markers, and the selection markers that two arms are had is different;

And,

(2) " assembling and react " 2 reorganization that comprised carries out simultaneously; And, the purpose product of " assembling reaction " contains the selection markers combination that is different from its 2 " unit carrier " precursors, makes this product have the operability that screens from the mixing species of recombinant products, by product and the unit carrier that do not react by this selection markers combination;

And,

(3) assembling process does not need " recovery carrier " and " assembling host ";

And,

(4) " helper plasmid " expresses 22 recombinases that reaction is required that " assembling reaction " comprises simultaneously;

Reactive end, recovery reconstruct site, topology reconstruction site:

Described reactive end, reclaim the reconstruct site, the topology reconstruction site is frt, loxP, the recombination site attB of Lambda phage, attB1, attB2, attB3, attB4, attB5, attP, attP1, attP2 attP3, attP4, attP5, attL, attL1, attL2, attL3, attL4, attL5, attR, attR1, attR2, attR3, attR4, attR5, the recombination site attB of HK022 phage, attP, attL, attR, the recombination site attB of phi80 phage, attP, attL, attR, the recombination site attB of P21 phage, attP, attL, attR, the recombination site attB of P22 phage, attP, attL, attR; Described reactive end is the required homologous sequence of lambda red reorganization;

The Telomerase recognition site:

Telomerase recognition site or telomere are the recognition site or the telomere of procaryotic Telomerase, comprise the Telomerase recognition site of Enterobacteria phage N15, Vibrio phage VP882, Klebsiella phage phiKO2, Yersinia phage PY54 etc.; Telomere also is the chromosomal telomere of eukaryote;

Unit carrier, assembling host, recovery carrier:

Described unit carrier, assembling host, reclaim carrier and be prokaryotic organism or Eukaryotic plasmid, also be prokaryotic organism or Eukaryotic genome;

Unit carrier, the conversion site of reclaiming carrier:

Described unit carrier, reclaim to contain to engage in the middle of the carrier and transform the site, and the assembling host microorganism does not need the outer molecule manipulation of host cell when possessing the conversion capability of joint; Described unit carrier, reclaim not contain to engage in the middle of the carrier and transform the site, or and host microorganism when not possessing the conversion capability of joint, need the outer molecule manipulation of host cell;

The recombination site recombinase:

When using the recombinase of recombination site in the extracellular, the corresponding Cre recombinase of loxP, the corresponding FLP recombinase of frt, the BP of Lambda phage recombinate corresponding Lambda Int and IHF, the BP of Lambda phage the corresponding Lambda Int that recombinates, Xis and IHF, the BP of=HK022 phage recombinate corresponding HK022 Int and IHF, the BP of HK022 phage the corresponding HK022 Int that recombinates, Xis and IHF, the BP of phi80 phage recombinate corresponding phi80 Int and IHF, the BP of phi80 phage the corresponding phi80 Int that recombinates, Xis and IHF, the BP of P21 phage recombinate corresponding P21 Int and IHF, the BP of P21 phage the corresponding P21 Int that recombinates, Xis and IHF, the BP of P22 phage recombinate corresponding P22 Int and IHF, the BP of P22 phage the corresponding P22 Int that recombinates, Xis and IHF, the recombining reaction in the assembling process has the ability of carrying out in the extracellular;

Wherein:

One-sided telomere after two linear carriers are recombinated exchanges, and is considered as in the telomere site once reorganization having taken place, because this process is equivalent to twice reorganization of annular carrier; For example linear carrier A and B telomere are labeled as T, about two telomeres use L and Zone R branch respectively, in carrier, recombinate between X and the Y, as follows:

T ^L _A-X _A-Y _A-?T ^R _A?+?T ^L _B-X _B-Y _B-?T ^R _B?è?T ^L _A-X _A-Y _B-?T ^R _B?+?T ^L _B-X _B-Y _A-?T ^R _A

After the reorganization, the X-Y of each carrier combination exchanges, and simultaneously terminal telomere combination also exchanges.

Images