CN102234683B - Liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation - Google Patents

Liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation Download PDF

Info

Publication number
CN102234683B
CN102234683B CN 201010160753 CN201010160753A CN102234683B CN 102234683 B CN102234683 B CN 102234683B CN 201010160753 CN201010160753 CN 201010160753 CN 201010160753 A CN201010160753 A CN 201010160753A CN 102234683 B CN102234683 B CN 102234683B
Authority
CN
China
Prior art keywords
seq
sequence
dna
artificial sequence
exon
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN 201010160753
Other languages
Chinese (zh)
Other versions
CN102234683A (en
Inventor
许嘉森
李国强
余刚
秦会娟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Surexam Bio Tech Co Ltd
Original Assignee
Guangzhou Surexam Bio Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Surexam Bio Tech Co Ltd filed Critical Guangzhou Surexam Bio Tech Co Ltd
Priority to CN 201010160753 priority Critical patent/CN102234683B/en
Priority to PCT/CN2011/073210 priority patent/WO2011131145A1/en
Publication of CN102234683A publication Critical patent/CN102234683A/en
Application granted granted Critical
Publication of CN102234683B publication Critical patent/CN102234683B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation. The liquid phase chip mainly comprises a wild-type and mutant-type allele specific primer extension (ASPE) primer pair designed for mutational sites of an EGFR gene respectively, microspheres which are respectively coated with specific anti-tag sequences and have different colors of codes and amplification primers for respectively amplifying the target sequences with the corresponding mutational sites of the Exon 19, Exon 20 and/or Exon 21, wherein each ASPE primer comprises the tag sequences at the 5' terminal and the specific primers aiming at the mutational sites of the target gene at the 3' terminal; and the anti-tag sequences can correspondingly complement and form pair with the tag sequences selected in (A). The liquid phase chip has the following advantages: the coincidence rate of the detection method provided by the invention and a sequencing method is as high as 100%; the prepared liquid phase chip has very good signal to noise ratio; and cross reactions do not exist between the designed probes and the anti-tag sequences.

Description

A kind of EGFR gene mutation detection liquid-phase chip
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete relate to a kind of EGFR gene mutation detection liquid-phase chip.
Technical background
EGF-R ELISA (epidermal growth factor receptor, EGFR) be a kind of multi-functional glycoprotein that is distributed widely on each cell membranes in tissue of human body, having tyrosine kinase activity, is one of four members of ErbB family, therefore has another name called HER1 or ErbB1.EGFR is activated the back by part and starts the intracellular signal conduction, through the cascade reaction of adaptin, enzyme in the tenuigenin, regulates transcribing of transcription factor activated gene, instructs cell migration, sticks, propagation, differentiation and apoptosis.Studies show that, have high expression level or the unconventionality expression of EGFR in many noumenal tumours, this is for being the oncotherapy of target with EGFR and providing theoretical basis and experimental basis at the signal transduction therapeutic intervention of EGFR signal transduction pathway.
At present, the molecular targeted agents of developing at EGFR mainly contains two classes: 1) small molecules tyrosine kinase inhibitor (TKI), replace Buddhist nun (Erlotinib) as Gefitinib (Gefitinib) and sieve in distress, and suppress EGFR intracellular region tyrosine kinase activity; 2) monoclonal antibody (MAb) as west appropriate former times (Cetuximab) and handkerchief Buddhist nun monoclonal antibody (Panitumumab), is combined with the EGFR extracellular region, and blocking-up depends on the EGFR activation of part.Said medicine is by the intracellular signaling pathway of different approaches blocking-up EGFR mediation, thus inhibition tumor growth, transfer and vasculogenesis, and promote to improve chemicotherapy susceptibility by apoptosis of tumor cells.
Studies show that Gefitinib etc. are at the molecular targeted agents of EGFR, the situation significant correlation of its curative effect and EGFR transgenation.The EGFR transgenation of Fa Xianing up to now is positioned at exons 1 9～21 more than 90%.These sudden changes can be divided into 3 types:
1) exons 19 base deletions
Exons 19 sudden changes mainly are the base deletion sudden changes of the 746th～752 bit codon, cause amino acid in the EGFR albumen (ELREATS) sequence to be lost, this disappearance has changed acceptor ATP in conjunction with capsule (ATP-binding pocket, ABP) angle, thus cancer cells significantly strengthened to the susceptibility of Gefitinib.Studies show that the incidence of exons 19 transgenations is the highest, account for more than 50% of EGFR transgenation sum.According to incompletely statistics, exons 19 transgenations of having found both at home and abroad at present have 22 kinds of different types at least.
Exons 19 sudden change mainly contains following disappearance type, and its concrete sequence is as described in showing, and wherein, with respect to wild-type, the sequence of mutant disappearance is with "-" number expression:
Genotype The disappearance type Sequence (5 '-3 ')
Wild-type Wild-type GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTCGAT
M1 del E746-A750 (1) GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAA---------------AACATCTCCGAAAGCCAACAAGGAAATCCTCGAT
M2 del E746-A750 (2) GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAG---------------ACATCTCCGAAAGCCAACAAGGAAATCCTCGAT
M3 del L747-E749ins P GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAA--------C-CAACATCTCCGAAAGCCAACAAGGAAATCCTCGAT
M4 del L747-A750ins P GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAA-----------C-CATCTCCGAAAGCCAACAAGGAAATCCTCGAT
M5 del L747-T751 GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAA---------------TCTCCGAAAGCCAACAAGGAAATCCTCGAT
M6 del L747-T75lins A GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGG---------------CATCTCCGAAAGCCAACAAGGAAATCCTCGAT
M7 del L747-S752 GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAA-------------CATCTCCGAAAGCCAACAAGGAAATCCTCGAT
M8 del L747-S752ins V (2) GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGG-TT-----------------CCGAAAGCCAACAAGGAAATCCTCGAT
M9 del L747-S752ins D GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGA-------------------TCCGAAAGCCAACAAGGAAATCCTCGAT
M10 del L747-S752ins Q (2) GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAA-----------------CA-GAAAGCCAACAAGGAAATCCTCGAT
M11 del L747-S752ins S GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAAT---------------CGAAAGCCAACAAGGAAATCCTCGAT
M12 delE749-S752ins D(GAT) GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAATTAAGAGA---------TCCGAAAGCCAACAAGGAAATCCTCGAT
M13 delE746-T75lin GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAG---------
sT(ACC) -----ACC-TCTCCGAAAGCCAACAAGGAAATCCTCGAT
M14 delE746-P753ins VS(GTC TCG) GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGG-----------------TCT-CGAAAGCCAACAAGGAAATCCTCGAT
M15 delE746-T751in sY(TAT) TATCCCAGAAGGTGAGAAAGATAAAATTCCCGTCGCTATCAAGG-TAT-----------CATCTCCGAAAGCCAACAAGAAT
M16 - GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAA----------CA--ATCTCCGAAAGCCAACAAGGAAATCCTCGAT
M17 delE746-T751in sA(GCT) GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGG-CT--------------TCTCCGAAAGCCAACAAGGAAATCCTCGAT
M18 delE746-A750in sAP(GCC CCA) ATCCCAGAAGGTGAGAAAGATAAAATTCCCGTCGCTATCAAGG-CCC--------CAACATCTCCGAAAGCCAACAAGGAA
M19 del L747-T751ins V GGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGG--------------T-ATCTCCGAAAGCCAACAAGGAAATCCTCGAT
2) mutation type of extron 20
The sudden change of extron 20 mainly is that the C-T conversion appears in the 790th bit codon, causes that the Threonine in this site in the EGFR albumen is replaced (T790M) by methionine(Met).This sudden change is detected in recidivist after the pharmacological agent, and sudden change makes cancer cells produce resistance to Gefitinib and Tarceva.In addition, the sudden change that occurs in extron 20 also has base to insert, generally appear at the 770-775 bit codon, there are 8 kinds of different inserted modes in (mainly in CCCCC sequence both sides) between GAC AAC CCC CAC GTG TGC sequence, the fragment of inserting is 3～9 bases, but the practical application meaning of this class insertion sudden change it be not immediately clear.
3) point mutation of exon 21
The point mutation of exon 21 mainly is that the T-G conversion appears in the 858th bit codon, causes that the leucine in this site in the EGFR albumen changes arginine (L858R) into.This sudden change is positioned near the DFG sequence.Its effect is that the stability of A-loop is improved, and cancer cells obviously strengthens the susceptibility of Gefitinib and Tarceva.
At present, the EGFR detection in Gene Mutation technology of having set up mainly is PCR-sequencing and real-time fluorescence quantitative PCR detection technique.The PCR-sequencing has the advantage that can determine mutational range and type, it is present widely used detection method, but the sensitivity of sequencing has only 20%-25%, can not satisfy the needs of practical application far away, especially for the tumour somatic mutation of heterogeneity, muting sensitivity will cause a large amount of omissions.Simultaneously, sequencing detects complicated operation, poor in timeliness, and for requiring high-timeliness and highly sensitive practical application to detect, the limitation of sequencing highlights already.And the real-time fluorescence quantitative PCR detection technique, its detection efficiency height, ageing strong, but its false positive rate under being in is not also denounced by practical application.Problem based on above-mentioned detection technique existence, (application number: 200810027613.9) detection method is simple to operate for " detection probes of EGFR gene mutation site, liquid-phase chip and the detection method thereof " of applicant's success in early stage exploitation, cut enrichment by enzyme and got rid of the interference that a large amount of wild-type sequences cause, specificity is good as a result, highly sensitive, accuracy reaches more than 99%, but this method relates to two-wheeled PCR operation, more easily pollute, and hybridization detects the step probe comparatively near (having only the mutational site difference), is not easy to the parallel detection of several genes mutational site.
Summary of the invention
One of purpose of the present invention provides the EGFR gene mutation detection liquid-phase chip.This liquid-phase chip can be used for detecting normal genotype and 19 kinds of main deletion mutantion type: M1～M19 thereof of EGFR gene extron 19, the normal genotype of extron 20 and mutant T790M, and the normal genotype of exon 21 and mutant L858R.
The technical scheme that realizes above-mentioned purpose is as follows:
A kind of EGFR gene mutation detection liquid-phase chip mainly includes:
(A) the ASPE primer of the wild-type that designs respectively at the mutational site of EGFR gene and mutant is right: every kind of ASPE primer is made up of at the Auele Specific Primer in goal gene mutational site tag sequence and the 3 ' end of 5 ' end, and described tag sequence is selected from the sequence among SEQID NO.1～SEQ ID NO.24; Described Auele Specific Primer is: at the Auele Specific Primer of Exon 19 mutants, this Auele Specific Primer derives among SEQ NO.26～SEQ ID NO.44 more than one base sequence respectively, or derive from more than one base sequence among SEQNO.73～SEQ ID NO.96 (reverse complementary sequence of SEQ NO.26～SEQ ID NO.44), 3 ' of every species-specific primer is brought in and is come from 1～6 adjacent base of corresponding disappearance zone 3 ' end, and can identify corresponding mutation type specifically, with the Auele Specific Primer at Exon 19 wild-types, this Auele Specific Primer derives from the base sequence in SEQ NO.25 or its reverse complementary sequence, and its 3 ' end contains distinctive disappearance base in the disappearance zone of the mutant that every kind of need detect, and the Auele Specific Primer of itself and all mutants is different; And/or at Exon20, derive from the base sequence in SEQ NO.45～SEQNO.46 or its reverse complementary sequence; And/or at Exon 21, derive from the base sequence in SEQ NO.47～SEQ NO.48 or its complementary sequence; Be the mutational site at a base in last 3 bit bases of 3 ' end of the Auele Specific Primer of Exon 20 and Exon 21; The Tm value of above-mentioned all Auele Specific Primers is between 52～58 ℃;
(B) be coated with microballoon special anti-tag sequence, that have the different colours coding respectively, described anti-tag sequence is selected from the sequence among SEQID NO.121～SEQ ID NO.144, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C) for the amplimer that amplifies the target sequence in the corresponding mutational site with Exon 19, Exon20 and/or Exon21 respectively.
Preferably, described amplimer is: at SEQ NO.145～146 of Exon 19; At Exon 20, when Auele Specific Primer derives from SEQ NO.45～SEQ NO.46, amplimer is SEQ NO.147～148, when Auele Specific Primer derives from the reverse complementary sequence of SEQNO.45～SEQ NO.46, amplimer is SEQ NO.149～150; At Exon 21, when Auele Specific Primer derives from SEQ NO.47～SEQ NO.48, amplimer is SEQ NO.151～152, when Auele Specific Primer derives from the reverse complementary sequence of SEQ NO.47～SEQ NO.48, amplimer is SEQ NO.153～154.
Preferably, the Auele Specific Primer at Exon 19 is: more than one in more than one in SEQ NO.50～68 and SEQ NO.49 or SEQNO.98～116 and SEQ NO.97.Auele Specific Primer at Exon 20 is: SEQ NO.69～70 or SEQNO.117～118.Auele Specific Primer at Exon21 is: SEQ NO.71～72 or SEQ NO.119～120.
Major advantage of the present invention is:
1. the identical rate of detection method provided by the present invention and sequencing is up to 100%.Prepared EGFR gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and does not have cross reaction basically between designed probe and the anti-tag sequence.
2. the Auele Specific Primer of the present invention's design has extraordinary specificity, can accurately distinguish various mutation types.Each specific specificity ASPE primer can carry out hybridization under the reaction conditions of homogeneous, and does not have non-specific binding substantially between the various primer, probe.
3. detection method step of the present invention is simple, can can finish the amplification of the target sequence in a plurality of sites by a step multiplex PCR, many uncertain factors of existing in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can improve the detection accuracy rate greatly, embodied qualitative, quantitative analysis feature of accurate while.
4. detected result of the present invention is reliable and stable, and being used in combination of multiple ASPE Auele Specific Primer makes liquid-phase chip and detection method form an intact system of detection effect.
Embodiment
Embodiment 1EGFR gene mutation detection liquid-phase chip mainly includes:
One, ASPE primer
Normal genotype and 19 kinds of main deletion mutantion type: M1～M19 thereof at EGFR gene extron 19; the normal genotype of extron 20 and mutant T790M; and the normal genotype of exon 21 and mutant L858R, design specific primer sequence respectively.
The ASPE primer design main points of EGFR detection in Gene Mutation are:
The ASPE primer is made up of " Tag+ specific primer sequence ".Wherein, 5 ' end is the Tag sequence designed according to the EGFR detection in Gene Mutation, cross reaction does not take place in the secondary structure that designed Tag sequence can avoid the ASPE primer to form in reaction system to greatest extent, and Tag sequence and Tag sequence between Tag sequence and the specific primer sequence.Tag sequence and specific primer sequence form complete ASPE primer, and make all ASPE primers can be in the reaction system of a homogeneous synchronous reaction (being the buffer environment of same reaction, same temperature of reaction etc.), finish parallel detection.Designed Tag sequence is concrete as table 1.3 ' end is the specific primer sequence designed according to the EGFR detection in Gene Mutation, and the Tm value of described Auele Specific Primer is between 52～58 ℃; Auele Specific Primer at Exon 19 mutants, derive from the base sequence in SEQ NO.26～44 or its reverse complementary sequence respectively, 3 ' of every species-specific primer is brought in and is come from 1～6 base adjacent with this mutation type disappearance zone 3 ' end (according to the Tm value of setting between 52～58 ℃, determined general base number, be that Auele Specific Primer has been contained the base that lacks regional two ends), and can identify corresponding mutation type specifically at the Auele Specific Primer of Exon 19 wild-types, this Auele Specific Primer derives from the base sequence in SEQ NO.25 or its reverse complementary sequence, and its 3 ' end contains distinctive disappearance base in the disappearance zone of the mutant that all (every kinds) need to detect, for example, SEQ NO.49 in the table 3, contained between the distinctive base wild-type of 19 kinds of sudden changes that needs detect and the various mutant Auele Specific Primer different, the sequence that can extend various types specifically.At the specific primer sequence of Exon 20 or Exon 21 various mutants, a base in last 3 bit bases of its 3 ' end is the mutational site; Last 3 bases of the specific primer sequence 3 ' end of described Exon 20 or Exon 21 wild-types should comprise Codon790 or Codon858 site respectively.The account form of described Tm value is Tm=(G+C) * 4+ (A+T) * 2-4.
Table 1 Tag sequence
SEQ NO. Tag sequence (5 '-3 ')
1 CTTCTCATTAACTTACTTCATAAT
2 TCAATTACTTCACTTTAATCCTTT
3 CTTTTCATCAATAATCTTACCTTT
4 AAACAAACTTCACATCTCAATAAT
5 TCATTTCAATCAATCATCAACAAT
6 TCAATCATCTTTATACTTCACAAT
7 TTACTCAAAATCTACACTTTTTCA
8 CTTTTTCAATCACTTTCAATTCAT
9 CAATATCATCATCTTTATCATTAC
10 AATCTACAAATCCAATAATCTCAT
11 ATCAAATCTCATCAATTCAACAAT
12 TTCATAACTACAATACATCATCAT
13 AAACTAACATCAATACTTACATCA
14 TCAAAATCTCAAATACTCAAATCA
15 CTACTAATTCATTAACATTACTAC
16 AATCCTTTTTACTCAATTCAATCA
17 CTACAAACAAACAAACATTATCAA
18 TAACATTACAACTATACTATCTAC
19 TATATACACTTCTCAATAACTAAC
20 CTTTTCATCTTTTCATCTTTCAAT
21 TCAATTACCTTTTCAATACAATAC
22 TCATTTACCAATCTTTCTTTATAC
23 TAATTATACATCTCATCTTCTACA
24 CTTTTCAATTACTTCAAATCTTCA
Show the source sequence that comes of 2EGFR detection in Gene Mutation Auele Specific Primer
(Exon19 is deletion mutantion, and Exon20,21 is point mutation, wherein, is the point mutation base in the)
SEQ NO. Type Auele Specific Primer come source sequence (5 '-3 ')
25 19-w (wild-type) GTTAAAATTCCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCT CCGAAAGCCAACAAGGAAATCCTCGAT
26 19M1 (mutant) GTTAAAATTCCCGTCGCTATCAAAACATCTCCGAAAGCCAACAAG GAAATCCTCGAT
27 19M2 (mutant) GTTAAAATTCCCGTCGCTATCAAGACATCTCCGAAAGCCAACAAG GAAATCCTCGAT
28 19M3 (mutant) GTTAAAATTCCCGTCGCTATCAAGGAACCAACATCTCCGAAAGCC AACAAGGAAATCCTCGAT
29 19M4 (mutant) GTTAAAATTCCCGTCGCTATCAAGGAACCATCTCCGAAAGCCAAC AAGGAAATCCTCGAT
30 19M5 (mutant) GTTAAAATTCCCGTCGCTATCAAGGAATCTCCGAAAGCCAACAAG GAAATCCTCGAT
31 19M6 (mutant) GTTAAAATTCCCGTCGCTATCAAGGCATCTCCGAAAGCCAACAAG GAAATCCTCGAT
32 19M7 (mutant) GTTAAAATTCCCGTCGCTATCAAGGAACATCTCCGAAAGCCAACA AGGAAATCCTCGAT
33 19M8 (mutant) GTTAAAATTCCCGTCGCTATCAAGGTTCCGAAAGCCAACAAGGAA ATCCTCGAT
34 19M9 (mutant) GTTAAAATTCCCGTCGCTATCAAGGATCCGAAAGCCAACAAGGAA ATCCTCGAT
35 19M10 (mutant) GTTAAAATTCCCGTCGCTATCAAGGAACAGAAAGCCAACAAGGA AATCCTCGAT
36 19M11 (mutant) GTTAAAATTCCCGTCGCTATCAAGGAATCGAAAGCCAACAAGGAA ATCCTCGAT
37 19M12 (mutant) GTTAAAATTCCCGTCGCTATCAAGGAATTAAGAGATCCGAAAGCC AACAAGGAAATCCTCGAT
38 19M13 (mutant) GTTAAAATTCCCGTCGCTATCAAGACCTCTCCGAAAGCCAACAAG GAAATCCTCGAT
39 19M14 (mutant) GTTAAAATTCCCGTCGCTATCAAGGTCTCGAAAGCCAACAAGGAA ATCCTCGAT
40 19M15 (mutant) GATAAAATTCCCGTCGCTATCAAGGTATCATCTCCGAAAGCCAAC AAGAAT
41 19M16 (mutant) GTTAAAATTCCCGTCGCTATCAAGGAACAATCTCCGAAAGCCAAC AAGGAAATCCTCGAT
42 19M17 (mutant) GTTAAAATTCCCGTCGCTATCAAGGCTTCTCCGAAAGCCAACAAG
Figure GSA00000109799300091
According to the key points in design of specific primer sequence in the above-mentioned ASPE primer, design obtains a series of specific primer sequence, wherein exemplifies part wild-type and mutant Auele Specific Primer, as table 3:
Table 3EGFR detection in Gene Mutation specific primer sequence one
Figure GSA00000109799300092
Figure GSA00000109799300101
Figure GSA00000109799300111
It is as shown in the table, detects the specific primer sequence of Exon19 deletion mutantion, and 3 ' of every species-specific primer is brought in and come from 1～6 base adjacent with this mutation type disappearance zone 3 ' end, and this base is represented with italic, and the point that Exon20 and Exon21 undergo mutation is used Mark.
Same, the reverse complementary sequence that comes source sequence of Auele Specific Primer also can be used for the Auele Specific Primer of design ASPE in the table 2, the alternative scope of concrete sequence such as table 4:
Table 4EGFR detection in Gene Mutation Auele Specific Primer come source sequence two
Figure GSA00000109799300123
Figure GSA00000109799300131
Figure GSA00000109799300141
Same, according to the key points in design of specific primer sequence in the above-mentioned ASPE primer, obtain a series of specific primer sequence by the source sequences Design of specific primer sequence in the table 4, wherein exemplify part wild-type and mutant Auele Specific Primer, as table 5:
Two of table 5EGFR detection in Gene Mutation specific primer sequence
Figure GSA00000109799300142
All ASPE primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with the stock solution of 100pmol/mL respectively with 10mmol/LTris Buffer.
Two, the microballoon of anti-tag sequence bag quilt
According to designed ASPE specific primer sequence, select the tag sequence, reduce between the anti-tag sequence of each microballoon to greatest extent and secondary structure that tag and ASPE specific primer sequence may form, corresponding anti-tag sequence is as shown in table 6 on 24 kinds of microballoons numberings of selection and the microballoon.
Corresponding anti-tag sequence on table 6 microballoon numbering and the microballoon
SEQ NO. The anti-tag sequence (5 '-3 ') of correspondence on the microballoon The microballoon numbering
121 ATTATGAAGTAAGTTAATGAGAAG 47
122 AAAGGATTAAAGTGAAGTAATTGA 33
123 AAAGGTAAGATTATTGATGAAAAG 65
124 ATTATTGAGATGTGAAGTTTGTTT 48
125 ATTGTTGATGATTGATTGAAATGA 51
126 ATTGTGAAGTATAAAGATGATTGA 52
127 TGAAAAAGTGTAGATTTTGAGTAA 26
128 ATGAATTGAAAGTGATTGAAAAAG 54
129 GTAATGATAAAGATGATGATATTG 57
130 ATGAGATTATTGGATTTGTAGATT 60
131 ATTGTTGAATTGATGAGATTTGAT 73
132 ATGATGATGTATTGTAGTTATGAA 79
133 TGATGTAAGTATTGATGTTAGTTT 87
134 TGATTTGAGTATTTGAGATTTTGA 18
135 GTAGTAATGTTAATGAATTAGTAG 58
136 TGATTGAATTGAGTAAAAAGGATT 22
137 TTGATAATGTTTGTTTGTTTGTAG 28
138 GTAGATAGTATAGTTGTAATGTTA 66
139 AAAGGTAAGATTATTGATGAAAAG 55
140 ATTGAAAGATGAAAAGATGAAAAG 37
141 GTATTGTATTGAAAAGGTAATTGA 24
142 GTATAAAGAAAGATTGGTAAATGA 44
143 TGTAGAAGATGAGATGTATAATTA 53
144 TGAAGATTTGAAGTAATTGAAAAG 25
24 kinds of microballoons selecting are available from U.S. Luminex company, with anti-tag sequence bag by on microballoon.Be connected with the spacerarm sequence of 5-10 T between anti-tag sequence and the microballoon, namely add the spacerarm sequence of the preceding paragraph 5-10 T before each anti-tag sequence, the anti-tag sequence is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.With synthetic anti-tag sequence sterilization ddH 2O is made into the stock solution of 100nmol/ml.Described spacerarm is for being used for anti-tag and microsphere surface is spaced apart or anti-tag is placed the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficient of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n 〉=3) are as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T.
The process of microballoon bag quilt is as follows:
Get 5 * 10 respectively 6The carboxylated microballoon of individual above-mentioned numbering (available from Luminex company) is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl)-N-ethylcarbodiimide) (available from the Pierce Chemical company) working fluid of preparation 10ng/ml.Add the EDC working fluid of 2.5ul in the microballoon suspension, constant temperature was hatched 30 minutes, added the EDC working fluid of 2.5ul again, and constant temperature was hatched 30 minutes again.After reaction finished, the Tween-20 washing with 0.02% was once washed once with 0.1% SDS liquid again.The microballoon that is coated with the anti-tag sequence after the washing is resuspended in the Tris-EDTA solution [10mmol/L Tris (pH8.0), 1mmol/LEDTA] of 100ul, and 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence with detection site
Detect normal genotype and 19 kinds of main deletion mutantion type: M1～M19 thereof of EGFR gene Exon19, the normal genotype of Exon20 and mutant T790M, and the normal genotype of Exon21 and mutant L858R.Utilize Primer5.0 design three pairs of primers (seeing Table 7), amplify the target sequence with detection site.
Detect Exon20 and Exon21 mutational site, when its specific primer sequence derives from SEQ.NO45～48, use SEQ ID NO.147～148 and SEQ ID NO.151～152 amplifications to contain the target site sequence; When its specific primer sequence derives from SEQ ID NO.93～96, use SEQ ID NO.149～150 and SEQ ID NO.153～154 amplifications to contain the target site sequence.Detecting the Exon19 mutational site all uses SEQ ID NO.145～146 amplifications to contain the target site sequence.Designed amplimer has improved detection efficiency greatly to finishing multi-PRC reaction synchronously under same pcr amplification condition.
Table 7 amplifies the primer of the target sequence of EGFR gene mutation site
Figure GSA00000109799300191
All primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with the stock solution of 100pmol/mL respectively with 10mmol/L Tris Buffer.
Embodiment 2 uses the EGFR gene mutation detection liquid-phase chip to the detection of sample
The prescription of described various solution is as follows:
MES damping fluid (pH5.0) prescription (250ml) of 50mM:
Reagent The source Final concentration The consumption of every 250ml
MES(2[N-Morpholino] ethanesulfonic acid) Sigma M-2933 0.05M 2.44g
5M NaOH Fisher SS256-500 --- 5
2 * Tm hybridization buffer
Reagent The source Final concentration The consumption of every 250ml
1MTris-HCl，pH8.0 SigmaT3038 0.2M 50ml
5M NaCl Sigma S5150 0.4M 20ml
Triton X-100 Sigma T8787 0.16％ 0.4ml
Be stored in 4 ℃ after the filtration.
The ExoSAP-IT test kit is available from U.S. USB company.
Biotin labeled dCTP is available from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
With reference to " molecular cloning " methods involving about DNA extraction, obtain DNA to be detected.
Two, the pcr amplification of testing sample
Utilize Primer5.0 design primer, divide two pipes to carry out multiplex PCR, one step amplified 3 target sequences that contain detection site, when the amplimer of Exon19, Exon20 and Exon21 was respectively SEQ ID NO.145-146, SEQ ID NO.147-148 and SEQ ID NO.151-152, the product size was respectively 117bp, 141bp, 131bp; When the amplimer of Exon19, Exon20 and Exon21 was respectively SEQ ID NO.145-146, SEQ ID NO.149-150 and SEQ ID NO.153-154, the product size was respectively 117bp, 168bp, 156bp.Primer sequence is seen shown in the above-mentioned table 7.
At first prepare the multiple PCR primer working fluid: respectively get the primer stock solution 100ul of SEQ NO.145-154 respectively in the 1.5ml Eppendorf tube, mix and be the multiple PCR primer working fluid.The PCR reaction system is as follows:
10 * damping fluid (contains Mg 2+) 5ul
DNTP (each 2.5mmol/L) 4ul
Taq enzyme (5U/ul) 0.5ul
Multiple PCR primer working fluid (each 16.7pmol/mL) 6ul
Template DNA (10ng/ul) 1ul
ddH 2O 33.5ul
Be total to 50ul
The pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 20s, 56 ℃ of 30s, 72 ℃ of 30s, 30 circulations; 72 ℃ of 10min; 4 ℃ of preservations are standby.
Three, the enzyme of PCR product is cut processing
Detailed step is as follows:
1. get the reacted product of 7.5ul PCR, add 3ul ExoSAP-IT enzyme;
2.37 ℃ hatch 15min.Hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after the processing is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE Auele Specific Primer of above-mentioned design to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on the reacted product band.
The ASPE primer working fluid that mixes of preparation at first: get Exon19, Exon20 and the corresponding wild-type of Exon21 and mutant ASPE primer (specifically as shown in table 8) stock solution 10ul respectively in 2 different 1.5ml Eppendorf tubes, add 10mmol/LTris Buffer and mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Detection to Exon19, Exon20 and Exon21 mutant, wherein Group1, Group3 and Group 5 carry out the ASPE primer extension reaction in same pipe, it extends template is the PCR product that contains target site, and the amplimer of this PCR product is respectively SEQ ID NO.145-146, SEQ ID NO.147-148 and SEQ ID NO.151-152; Similarly, Group2, Group 4 and Group6 carry out the ASPE primer extension reaction in same pipe, it extends template is the PCR product that contains target site, and the amplimer of this PCR product is respectively SEQ ID NO.145-146, SEQ ID NO.149-150 and SEQ IDNO.153-154.
The design one of table 8EGFR gene mutation detection liquid-phase chip preparation
Figure GSA00000109799300211
Figure GSA00000109799300221
Figure GSA00000109799300231
10 * damping fluid 2ul
MgCl 2(50mmol/L) 0.5ul
Biotin-dCTP(400umol/L) 0.25ul
DATP, dGTP, dTTP mixed solution (each 100umol/L) 1ul
Tsp enzyme (5U/ul) 0.25ul
ASPE primer working fluid (each 500nmol/L) 1ul that mixes
Enzyme is cut the pcr amplification product 5ul of processing
ddH 2O 10.ul
Be total to 20ul
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 52 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ of preservations are standby.
Five, hybridization
1. according to the ASPE primer of design, (microballoon concentration is 2.5 * 10 to select corresponding 24 kinds of optimum microballoons 5Individual/ml).Every kind of microballoon has the different colours coding respectively;
2. get the microballoon of every kind of numbering of 1ul respectively in the Eppendorf tube of 1.5ml;
3. microballoon is in 〉=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, the vortex mixing;
5. get the above-mentioned microballoon suspension of 25ul in the corresponding hole of 96 hole filter plates, control wells adds the ddH of 25ul 2O;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH 2O complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after the hybridization is in 〉=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;
10. microballoon is in 〉=centrifugal the 2-5min of 3000g;
11 are resuspended in microballoon in 1 * Tm hybridization buffer of 75ul, and adding 15ul concentration is Streptavidin-phycoerythrin (SA-PE) of 10ug/ml;
12.37 ℃ hatch 15min, on the Luminex instrument, detect.
Six, the result detects and data analysis
The reaction after product detects by Luminex serial analysis instrument.Be the cut-off value with fluorescent value (MFI) greater than 100, the MFI value that detects when mutant judges that there is this mutation type in this sample, otherwise judges that this sample is corresponding wild-type that detected result is shown in table 9, table 10, table 11 and table 12 greater than 100 the time.
Use present method to detect the EGFR transgenation of great amount of samples, compare with the liquid-phase chip result with the sequencing detection, calculate the identical rate of method detected result provided by the present invention.Present method detects 20 increments EGFR genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.As seen EGFR gene mutation detection liquid-phase chip provided by the present invention can detect the mutation type of EGFR gene exactly, and the result is reliable and stable.
At the detection of the designed 2 group-specific primers sequences that derive from SEQ.NO25-48 and reverse complementary sequence SEQ NO.73-96 thereof respectively in identical mutation site to sample, the detection effect of all agreeing.The different liquid-phase chips that design respectively according to the main points of above-mentioned ASPE design of primers, for example, other specific sequence that exemplifies in table 3 and the table 5, its corresponding specific primer sequence difference, and detected result unanimity.The concrete detection data of other analogues are omitted.
Figure GSA00000109799300261
Table 11 pattern detection result three (MFI)
Figure GSA00000109799300271
The interpretation of result of table 12 sample EGFR detection in Gene Mutation
Figure GSA00000109799300281
The liquid-phase chip of the ASPE primer that embodiment 3 is different is to the detection of EGFR transgenation
One, the design (selection of Tag sequence and Anti-Tag sequence) of liquid-phase chip preparation
Detection liquid-phase chip with 19M1 mutational site in the EGFR gene extron 19 is example, at the wild-type (19-w) of exons 19 and the specific primer sequence of 19M1 mutant design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end then is selected from 2 among the SEQ ID NO.1-SEQ ID NO.24, accordingly, bag is by anti-tag sequence selection SEQ ID NO.121-SEQ ID NO.144 on microballoon and corresponding tag sequence complementary pairing.Specific design is shown in following table (table 13).Synthetic, the anti-tag sequence bag of ASPE primer is described like embodiment 1 and embodiment 2 by microballoon, amplimer, detection method.
The design of table 13 liquid-phase chip preparation
Figure GSA00000109799300291
Two, sample detection
Adopt the liquid-phase chip of above-mentioned design preparation, by embodiment 2 described testing processes and method sample 21-40 is detected, detected result is as follows:
Table 14 pattern detection result (MFI) and gene mutation analysis
Figure GSA00000109799300292
34 2683 61 2296 61 2533 54
35 2233 63 2357 53 2065 61
36 2673 65 2270 52 1742 55
37 2237 56 2062 62 3016 57
38 2402 51 2940 57 2046 51
39 2260 53 3071 52 2206 58
40 2351 63 2598 64 1921 58
The interpretation of result of table 15 sample EGFR detection in Gene Mutation
40 Wild-type Wild-type Wild-type Wild-type
Other is at the liquid-phase chip in different mutational sites, and the ASPE primer uses above-mentioned designed different Tag sequence, and its result is still reliable and stable, and concrete data are omitted.
The selection of embodiment 4 exons 1s, 9 deletion mutantion gene test wild-types and mutant specific primer sequence
One, the design (selection of wild-type and mutant specific primer sequence) of liquid-phase chip preparation
Key points in design according to EGFR gene Exon19 deletion mutantion Auele Specific Primer, be that 3 ' of specific primer sequence is brought in and come from 1～6 base adjacent with deletion mutantion zone 3 ' end and can identify corresponding mutation type specifically, the specific primer sequence of design 19-w, 19M1 and 19M2, shown in table 16.
Detection liquid-phase chip with the Exon19 deletion mutantion of EGFR gene is example respectively, wild-type and two kinds of mutants of 19M1,19M2 at Exon19, design the specific primer sequence of the ASPE primer 3 ' end of wild-type and mutant respectively, specific design is shown in following table (table 17).Synthetic, the anti-tag sequence bag of ASPE primer is described like embodiment 1 and embodiment 2 by microballoon, amplimer, detection method.
The Exon19 genetically deficient mutation detection specific primer of table 16EGFR
SEQ NO. Type Specific primer sequence (5 '-3 ') The Tm value (℃)
155 19-w TCAAGGAATTAAGAGAAGCAAC 56
156 19M1 TTCCCGTCGCTATCAAAACAT 56
157 19M2 CCCGTCGCTATCAAGACATC 58
The design three of table 17 liquid-phase chip preparation
Figure GSA00000109799300311
19M2-2 SEQ ID NO.157 SEQ ID NO.3 SEQ ID NO.123
Two, sample detection
Adopt the liquid-phase chip of above-mentioned design preparation, by embodiment 2 described testing processes and method sample 41-60 is detected, detected result is as follows:
Table 18 pattern detection result (MFI) and gene mutation analysis
Figure GSA00000109799300321
The interpretation of result of table 20 sample EGFR detection in Gene Mutation
Figure GSA00000109799300322
41 Wild-type Wild-type Wild-type
42 Wild-type Wild-type Wild-type
43 Wild-type Wild-type Wild-type
44 Wild-type Wild-type Wild-type
45 The 19M1 sudden change The 19M1 sudden change The 19M1 sudden change
46 Wild-type Wild-type Wild-type
47 Wild-type Wild-type Wild-type
48 Wild-type Wild-type Wild-type
49 Wild-type Wild-type Wild-type
50 Wild-type Wild-type Wild-type
51 Wild-type Wild-type Wild-type
52 Wild-type Wild-type Wild-type
53 Wild-type Wild-type Wild-type
54 Wild-type Wild-type Wild-type
55 The 19M2 sudden change The 19M2 sudden change The 19M2 sudden change
56 Wild-type Wild-type Wild-type
57 Wild-type Wild-type Wild-type
58 Wild-type Wild-type Wild-type
59 Wild-type Wild-type Wild-type
60 Wild-type Wild-type Wild-type
At the detection of the designed 2 group-specific primers sequences that derive from SEQ.NO49-51 and SEQ NO.155-157 respectively of the same deletion mutantion of the Exon19 of EGFR to sample, the detection effect of all agreeing.Main points according to above-mentioned ASPE design of primers, be that 3 ' of specific primer sequence is brought in and come from 1～6 bit base adjacent with deletion mutantion zone 3 ' end, She Ji different liquid-phase chips respectively, its specific primer sequence difference, and the detected result unanimity, but bring in (Group1) when coming from 1～3 base adjacent with deletion mutantion zone 3 ' end when 3 ' of specific primer sequence, the signal to noise ratio of detected result is better, and its specificity and sensitivity are corresponding higher.The concrete detection data of other analogues are omitted.
More than be at the specifying of possible embodiments of the present invention, but this embodiment is not in order to limiting claim of the present invention, does not allly break away from equivalence of the present invention and implement or change, all should be contained in the claim of the present invention.
Sequence table
＜110〉Guangzhou Yishan Biotechnology Co., Ltd.
＜120〉a kind of EGFR gene mutation detection liquid-phase chip
<160>154
<170>PatentIn version 3.1
<210>1
<211>24
<212>DNA
＜213〉artificial sequence
<400>1
cttctcatta acttacttca taat 24
<210>2
<211>24
<212>DNA
＜213〉artificial sequence
<400>2
tcaattactt cactttaatc cttt 24
<210>3
<211>24
<212>DNA
＜213〉artificial sequence
<400>3
cttttcatca ataatcttac cttt 24
<210>4
<211>24
<212>DNA
＜213〉artificial sequence
<400>4
aaacaaactt cacatctcaa taat 24
<210>5
<211>24
<212>DNA
＜213〉artificial sequence
<400>5
tcatttcaat caatcatcaa caat 24
<210>6
<211>24
<212>DNA
＜213〉artificial sequence
<400>6
tcaatcatct ttatacttca caat 24
<210>7
<211>24
<212>DNA
＜213〉artificial sequence
<400>7
ttactcaaaa tctacacttt ttca 24
<210>8
<211>24
<212>DNA
＜213〉artificial sequence
<400>8
ctttttcaat cactttcaat tcat 24
<210>9
<211>24
<212>DNA
＜213〉artificial sequence
<400>9
caatatcatc atctttatca ttac 24
<210>10
<211>24
<212>DNA
＜213〉artificial sequence
<400>10
aatctacaaa tccaataatc tcat 24
<210>11
<211>24
<212>DNA
＜213〉artificial sequence
<400>11
atcaaatctc atcaattcaa caat 24
<210>12
<211>24
<212>DNA
＜213〉artificial sequence
<400>12
ttcataacta caatacatca tcat 24
<210>13
<211>24
<212>DNA
＜213〉artificial sequence
<400>13
aaactaacat caatacttac atca 24
<210>14
<211>24
<212>DNA
＜213〉artificial sequence
<400>14
tcaaaatctc aaatactcaa atca 24
<210>15
<211>24
<212>DNA
＜213〉artificial sequence
<400>15
ctactaattc attaacatta ctac 24
<210>16
<211>24
<212>DNA
＜213〉artificial sequence
<400>16
aatccttttt actcaattca atca 24
<210>17
<211>24
<212>DNA
＜213〉artificial sequence
<400>17
ctacaaacaa acaaacatta tcaa 24
<210>18
<211>24
<212>DNA
＜213〉artificial sequence
<400>18
taacattaca actatactat ctac 24
<210>19
<211>24
<212>DNA
＜213〉artificial sequence
<400>19
tatatacact tctcaataac taac 24
<210>20
<211>24
<212>DNA
＜213〉artificial sequence
<400>20
cttttcatct tttcatcttt caat 24
<210>21
<211>24
<212>DNA
＜213〉artificial sequence
<400>21
tcaattacct tttcaataca atac 24
<210>22
<211>24
<212>DNA
＜213〉artificial sequence
<400>22
tcatttacca atctttcttt atac 24
<210>23
<211>24
<212>DNA
＜213〉artificial sequence
<400>23
taattataca tctcatcttc taca 24
<210>24
<211>24
<212>DNA
＜213〉artificial sequence
<400>24
cttttcaatt acttcaaatc ttca 24
<210>25
<211>72
<212>DNA
＜213〉artificial sequence
<400>25
gttaaaattc ccgtcgctat caaggaatta agagaagcaa 40
catctccgaa agccaacaag gaaatcctcg at 72
<210>26
<211>57
<212>DNA
＜213〉artificial sequence
<400>26
gttaaaattc ccgtcgctat caaaacatct ccgaaagcca 40
acaaggaaat cctcgat 57
<210>27
<211>57
<212>DNA
＜213〉artificial sequence
<400>27
gttaaaattc ccgtcgctat caagacatct ccgaaagcca 40
acaaggaaat cctcgat 57
<210>28
<211>63
<212>DNA
＜213〉artificial sequence
<400>28
gttaaaattc ccgtcgctat caaggaacca acatctccga 40
aagccaacaa ggaaatcctc gat 63
<210>29
<211>60
<212>DNA
＜213〉artificial sequence
<400>29
gttaaaattc ccgtcgctat caaggaacca tctccgaaag 40
ccaacaagga aatcctcgat 60
<210>30
<211>57
<212>DNA
＜213〉artificial sequence
<400>30
gttaaaattc ccgtcgctat caaggaatct ccgaaagcca 40
acaaggaaat cctcgat 57
<210>31
<211>57
<212>DNA
＜213〉artificial sequence
<400>31
gttaaaattc ccgtcgctat caaggcatct ccgaaagcca 40
acaaggaaat cctcgat 57
<210>32
<211>59
<212>DNA
＜213〉artificial sequence
<400>32
gttaaaattc ccgtcgctat caaggaacat ctccgaaagc 40
caacaaggaa atcctcgat 59
<210>33
<211>54
<212>DNA
＜213〉artificial sequence
<400>33
gttaaaattc ccgtcgctat caaggttccg aaagccaaca 40
aggaaatcct cgat 54
<210>34
<211>54
<212>DNA
＜213〉artificial sequence
<400>34
gttaaaattc ccgtcgctat caaggatccg aaagccaaca 40
aggaaatcct cgat 54
<210>35
<211>54
<212>DNA
＜213〉artificial sequence
<400>35
gttaaaattc ccgtcgctat caaggaacag aaagccaaca 40
aggaaatcct cgat 54
<210>36
<211>54
<212>DNA
＜213〉artificial sequence
<400>36
gttaaaattc ccgtcgctat caaggaatcg aaagccaaca 40
aggaaatcct cgat 54
<210>37
<211>63
<212>DNA
＜213〉artificial sequence
<400>37
gttaaaattc ccgtcgctat caaggaatta agagatccga 40
aagccaacaa ggaaatcctc gat 63
<210>38
<211>57
<212>DNA
＜213〉artificial sequence
<400>38
gttaaaattc ccgtcgctat caagacctct ccgaaagcca 40
acaaggaaat cctcgat 57
<210>39
<211>54
<212>DNA
＜213〉artificial sequence
<400>39
gttaaaattc ccgtcgctat caaggtctcg aaagccaaca 40
aggaaatcct cgat 54
<210>40
<211>51
<212>DNA
＜213〉artificial sequence
<400>40
gataaaattc ccgtcgctat caaggtatca tctccgaaag 40
ccaacaagaa t 51
<210>41
<211>60
<212>DNA
＜213〉artificial sequence
<400>41
gttaaaattc ccgtcgctat caaggaacaa tctccgaaag 40
ccaacaagga aatcctcgat 60
<210>42
<211>57
<212>DNA
＜213〉artificial sequence
<400>42
gttaaaattc ccgtcgctat caaggcttct ccgaaagcca 40
acaaggaaat cctcgat 57
<210>43
<211>54
<212>DNA
＜213〉artificial sequence
<400>43
gataaaattc ccgtcgctat caaggcccca acatctccga 40
aagccaacaa ggaa 54
<210>44
<211>57
<212>DNA
＜213〉artificial sequence
<400>44
gttaaaattc ccgtcgctat caaggtatct ccgaaagcca 40
acaaggaaat cctcgat 57
<210>45
<211>41
<212>DNA
＜213〉artificial sequence
<400>45
ctccaccgtg cagctcatca cgcagctcat gcccttcggc t 41
<210>46
<211>41
<212>DNA
＜213〉artificial sequence
<400>46
ctccaccgtg cagctcatca tgcagctcat gcccttcggc t 41
<210>47
<211>42
<212>DNA
＜213〉artificial sequence
<400>47
gtcaagatca cagattttgg gctggccaaa ctgctgggtg cg 42
<210>48
<211>42
<212>DNA
＜213〉artificial sequence
<400>48
gtcaagatca cagattttgg gcgggccaaa ctgctgggtg cg 42
<210>49
<211>22
<212>DNA
＜213〉artificial sequence
<400>49
ctatcaagga attaagagaa gc 22
<210>50
<211>21
<212>DNA
＜213〉artificial sequence
<400>50
aattcccgtc gctatcaaaa c 21
<210>51
<211>20
<212>DNA
＜213〉artificial sequence
<400>51
ttcccgtcgc tatcaagaca 20
<210>52
<211>20
<212>DNA
＜213〉artificial sequence
<400>52
cgtcgctatc aaggaaccaa 20
<210>53
<211>20
<212>DNA
＜213〉artificial sequence
<400>53
cgtcgctatc aaggaaccat 20
<210>54
<211>19
<212>DNA
＜213〉artificial sequence
<400>54
cgtcgctatc aaggaatct 19
<210>55
<211>19
<212>DNA
＜213〉artificial sequence
<400>55
cccgtcgcta tcaaggcat 19
<210>56
<211>19
<212>DNA
＜213〉artificial sequence
<400>56
ccgtcgctat caaggaaca 19
<210>57
<211>19
<212>DNA
＜213〉artificial sequence
<400>57
cccgtcgcta tcaaggttc 19
<210>58
<211>19
<212>DNA
＜213〉artificial sequence
<400>58
ccgtcgctat caaggatcc 19
<210>59
<211>19
<212>DNA
＜213〉artificial sequence
<400>59
cgtcgctatc aaggaacag 19
<210>60
<211>19
<212>DNA
＜213〉artificial sequence
<400>60
cgtcgctatc aaggaatcg 19
<210>61
<211>22
<212>DNA
＜213〉artificial sequence
<400>61
ctatcaagga attaagagat cc 22
<210>62
<211>19
<212>DNA
＜213〉artificial sequence
<400>62
tcccgtcgct atcaagacc 19
<210>63
<211>19
<212>DNA
＜213〉artificial sequence
<400>63
cccgtcgcta tcaaggtct 19
<210>64
<211>20
<212>DNA
＜213〉artificial sequence
<400>64
ccgtcgctat caaggtatca 20
<210>65
<211>20
<212>DNA
＜213〉artificial sequence
<400>65
ccgtcgctat caaggaacaa 20
<210>66
<211>19
<212>DNA
＜213〉artificial sequence
<400>66
cccgtcgcta tcaaggctt 19
<210>67
<211>19
<212>DNA
＜213〉artificial sequence
<400>67
tcgctatcaa ggccccaac 19
<210>68
<211>19
<212>DNA
＜213〉artificial sequence
<400>68
cgtcgctatc aaggtatct 19
<210>69
<211>18
<212>DNA
＜213〉artificial sequence
<400>69
caccgtgcag ctcatcac 18
<210>70
<211>19
<212>DNA
＜213〉artificial sequence
<400>70
ccaccgtgca gctcatcat 19
<210>71
<211>21
<212>DNA
＜213〉artificial sequence
<400>71
caagatcaca gattttgggc t 21
<210>72
<211>20
<212>DNA
＜213〉artificial sequence
<400>72
aagatcacag attttgggcg 20
<210>73
<211>72
<212>DNA
＜213〉artificial sequence
<400>73
atcgaggatt tccttgttgg ctttcggaga tgttgcttct 40
cttaattcct tgatagcgac gggaatttta ac 72
<210>74
<211>57
<212>DNA
＜213〉artificial sequence
<400>74
atcgaggatt tccttgttgg ctttcggaga tgttttgata 40
gcgacgggaa ttttaac 57
<210>75
<211>57
<212>DNA
＜213〉artificial sequence
<400>75
atcgaggatt tccttgttgg ctttcggaga tgtcttgata 40
gcgacgggaa ttttaac 57
<210>76
<211>63
<212>DNA
＜213〉artificial sequence
<400>76
atcgaggatt tccttgttgg ctttcggaga tgttggttcc 40
ttgatagcga cgggaatttt aac 63
<210>77
<211>60
<212>DNA
＜213〉artificial sequence
<400>77
atcgaggatt tccttgttgg ctttcggaga tggttccttg 40
atagcgacgg gaattttaac 60
<210>78
<211>57
<212>DNA
＜213〉artificial sequence
<400>78
atcgaggatt tccttgttgg ctttcggaga ttccttgata 40
gcgacgggaa ttttaac 57
<210>79
<211>57
<212>DNA
＜213〉artificial sequence
<400>79
atcgaggatt tccttgttgg ctttcggaga tgccttgata 40
gcgacgggaa ttttaac 57
<210>80
<211>59
<212>DNA
＜213〉artificial sequence
<400>80
atcgaggatt tccttgttgg ctttcggaga tgttccttga 40
tagcgacggg aattttaac 59
<210>81
<211>54
<212>DNA
＜213〉artificial sequence
<400>81
atcgaggatt tccttgttgg ctttcggaac cttgatagcg 40
acgggaattt taac 54
<210>82
<211>54
<212>DNA
＜213〉artificial sequence
<400>82
atcgaggatt tccttgttgg ctttcggatc cttgatagcg 40
acgggaattt taac 54
<210>83
<211>54
<212>DNA
＜213〉artificial sequence
<400>83
atcgaggatt tccttgttgg ctttctgttc cttgatagcg 40
acgggaattt taac 54
<210>84
<211>54
<212>DNA
＜213〉artificial sequence
<400>84
atcgaggatt tccttgttgg ctttcgattc cttgatagcg 40
acgggaattt taac 54
<210>85
<211>63
<212>DNA
＜213〉artificial sequence
<400>85
atcgaggatt tccttgttgg ctttcggatc tcttaattcc 40
ttgatagcga cgggaatttt aac 63
<210>86
<211>57
<212>DNA
＜213〉artificial sequence
<400>86
atcgaggatt tccttgttgg ctttcggaga ggtcttgata 40
gcgacgggaa ttttaac 57
<210>87
<211>54
<212>DNA
＜213〉artificial sequence
<400>87
atcgaggatt tccttgttgg ctttcgagac cttgatagcg 40
acgggaattt taac 54
<210>88
<211>51
<212>DNA
＜213〉artificial sequence
<400>88
attcttgttg gctttcggag atgatacctt gatagcgacg 40
ggaattttat c 51
<210>89
<211>60
<212>DNA
＜213〉artificial sequence
<400>89
atcgaggatt tccttgttgg ctttcggaga ttgttccttg 40
atagcgacgg gaattttaac 60
<210>90
<211>57
<212>DNA
＜213〉artificial sequence
<400>90
atcgaggatt tccttgttgg ctttcggaga agccttgata 40
gcgacgggaa ttttaac 57
<210>91
<211>54
<212>DNA
＜213〉artificial sequence
<400>91
ttccttgttg gctttcggag atgttggggc cttgatagcg 40
acgggaattt tatc 54
<210>92
<211>57
<212>DNA
＜213〉artificial sequence
<400>92
atcgaggatt tccttgttgg ctttcggaga taccttgata 40
gcgacgggaa ttttaac 57
<210>93
<211>41
<212>DNA
＜213〉artificial sequence
<400>93
agccgaaggg catgagctgc gtgatgagct gcacggtgga g 41
<210>94
<211>41
<212>DNA
＜213〉artificial sequence
<400>94
agccgaaggg catgagctgc atgatgagct gcacggtgga g 41
<210>95
<211>42
<212>DNA
＜213〉artificial sequence
<400>95
cgcacccagc agtttggcca gcccaaaatc tgtgatcttg ac 42
<210>96
<211>42
<212>DNA
＜213〉artificial sequence
<400>96
cgcacccagc agtttggccc gcccaaaatc tgtgatcttg ac 42
<210>97
<211>21
<212>DNA
＜213〉artificial sequence
<400>97
tcggagatgt tgcttctctt a 21
<210>98
<211>21
<212>DNA
＜213〉artificial sequence
<400>98
ttggctttcg gagatgtttt g 21
<210>99
<211>20
<212>DNA
＜213〉artificial sequence
<400>99
ttggctttcg gagatgtctt 20
<210>100
<211>20
<212>DNA
＜213〉artificial sequence
<400>100
gctttcggag atgttggttc 20
<210>101
<211>20
<212>DNA
＜213〉artificial sequence
<400>101
tgttggcttt cggagatggt 20
<210>102
<211>20
<212>DNA
＜213〉artificial sequence
<400>102
ttgttggctt tcggagattc 20
<210>103
<211>20
<212>DNA
＜213〉artificial sequence
<400>103
ttgttggctt tcggagatgc 20
<210>104
<211>20
<212>DNA
＜213〉artificial sequence
<400>104
gttggctttc ggagatgttc 20
<210>105
<211>20
<212>DNA
＜213〉artificial sequence
<400>105
tccttgttgg ctttcggaac 20
<210>106
<211>19
<212>DNA
＜213〉artificial sequence
<400>106
ccttgttggc tttcggatc 19
<210>107
<211>21
<212>DNA
＜213〉artificial sequence
<400>107
gatttccttg ttggctttct g 21
<210>108
<211>21
<212>DNA
＜213〉artificial sequence
<400>108
atttccttgt tggctttcga t 21
<210>109
<211>20
<212>DNA
＜213〉artificial sequence
<400>109
cttgttggct ttcggatctc 20
<210>110
<211>20
<212>DNA
＜213〉artificial sequence
<400>110
ttgttggctt tcggagaggt 20
<210>111
<211>19
<212>DNA
＜213〉artificial sequence
<400>111
cttgttggct ttcgagacc 19
<210>112
<211>20
<212>DNA
＜213〉artificial sequence
<400>112
gttggctttc ggagatgata 20
<210>113
<211>20
<212>DNA
＜213〉artificial sequence
<400>113
ttgttggctt tcggagattg 20
<210>114
<211>20
<212>DNA
＜213〉artificial sequence
<400>114
ttgttggctt tcggagaagc 20
<210>115
<211>20
<212>DNA
＜213〉artificial sequence
<400>115
ttggctttcg gagatgttgg 20
<210>116
<211>20
<212>DNA
＜213〉artificial sequence
<400>116
tgttggcttt cggagatacc 20
<210>117
<211>18
<212>DNA
＜213〉artificial sequence
<400>117
cgaagggcat gagctgcg 18
<210>118
<211>18
<212>DNA
＜213〉artificial sequence
<400>118
cgaagggcat gagctgca 18
<210>119
<211>18
<212>DNA
＜213〉artificial sequence
<400>119
cacccagcag tttggcca 18
<210>120
<211>18
<212>DNA
＜213〉artificial sequence
<400>120
cacccagcag tttggccc 18
<210>121
<211>24
<212>DNA
＜213〉artificial sequence
<400>121
attatgaagt aagttaatga gaag 24
<210>122
<211>24
<212>DNA
＜213〉artificial sequence
<400>122
aaaggattaa agtgaagtaa ttga 24
<210>123
<211>24
<212>DNA
＜213〉artificial sequence
<400>123
aaaggtaaga ttattgatga aaag 24
<210>124
<211>24
<212>DNA
＜213〉artificial sequence
<400>124
attattgaga tgtgaagttt gttt 24
<210>125
<211>24
<212>DNA
＜213〉artificial sequence
<400>125
attgttgatg attgattgaa atga 24
<210>126
<211>24
<212>DNA
＜213〉artificial sequence
<400>126
attgtgaagt ataaagatga ttga 24
<210>127
<211>24
<212>DNA
＜213〉artificial sequence
<400>127
tgaaaaagtg tagattttga gtaa 24
<210>128
<211>24
<212>DNA
＜213〉artificial sequence
<400>128
atgaattgaa agtgattgaa aaag 24
<210>129
<211>24
<212>DNA
＜213〉artificial sequence
<400>129
gtaatgataa agatgatgat attg 24
<210>130
<211>24
<212>DNA
＜213〉artificial sequence
<400>130
atgagattat tggatttgta gatt 24
<210>131
<211>24
<212>DNA
＜213〉artificial sequence
<400>131
attgttgaat tgatgagatt tgat 24
<210>132
<211>24
<212>DNA
＜213〉artificial sequence
<400>132
atgatgatgt attgtagtta tgaa 24
<210>133
<211>24
<212>DNA
＜213〉artificial sequence
<400>133
tgatgtaagt attgatgtta gttt 24
<210>134
<211>24
<212>DNA
＜213〉artificial sequence
<400>134
tgatttgagt atttgagatt ttga 24
<210>135
<211>24
<212>DNA
＜213〉artificial sequence
<400>135
gtagtaatgt taatgaatta gtag 24
<210>136
<211>24
<212>DNA
＜213〉artificial sequence
<400>136
tgattgaatt gagtaaaaag gatt 24
<210>137
<211>24
<212>DNA
＜213〉artificial sequence
<400>137
ttgataatgt ttgtttgttt gtag 24
<210>138
<211>24
<212>DNA
＜213〉artificial sequence
<400>138
gtagatagta tagttgtaat gtta 24
<210>139
<211>24
<212>DNA
＜213〉artificial sequence
<400>139
aaaggtaaga ttattgatga aaag 24
<210>140
<211>24
<212>DNA
＜213〉artificial sequence
<400>140
attgaaagat gaaaagatga aaag 24
<210>141
<211>24
<212>DNA
＜213〉artificial sequence
<400>141
gtattgtatt gaaaaggtaa ttga 24
<210>142
<211>24
<212>DNA
＜213〉artificial sequence
<400>142
gtataaagaa agattggtaa atga 24
<210>143
<211>24
<212>DNA
＜213〉artificial sequence
<400>143
tgtagaagat gagatgtata atta 24
<210>144
<211>24
<212>DNA
＜213〉artificial sequence
<400>144
tgaagatttg aagtaattga aaag 24
<210>145
<211>23
<212>DNA
＜213〉artificial sequence
<400>145
ccagaaggtg agaaagttaa aat 23
<210>146
<211>20
<212>DNA
＜213〉artificial sequence
<400>146
acccccacac agcaaagcag 20
<210>147
<211>20
<212>DNA
＜213〉artificial sequence
<400>147
atctgcctca cctccaccgt 20
<210>148
<211>21
<212>DNA
＜213〉artificial sequence
<400>148
cctgattacc tttgcgatct g 21
<210>149
<211>20
<212>DNA
＜213〉artificial sequence
<400>149
tccaggaagc ctacgtgatg 20
<210>150
<211>20
<212>DNA
＜213〉artificial sequence
<400>150
tgagcaggta ctgggagcca 20
<210>151
<211>21
<212>DNA
＜213〉artificial sequence
<400>151
accgcagcat gtcaagatca c 21
<210>152
<211>21
<212>DNA
＜213〉artificial sequence
<400>152
ccctggtgtc aggaaaatgc t 21
<210>153
<211>20
<212>DNA
＜213〉artificial sequence
<400>153
cagccaggaa cgtactggtg 20
<210>154
<211>21
<212>DNA
＜213〉artificial sequence
<400>154
ccctggtgtc aggaaaatgc t 21

Claims (1)

1. an EGFR gene mutation detection liquid-phase chip is characterized in that, mainly includes:
(A) wild-type that designs respectively at the mutational site of EGFR gene and the ASPE primer of mutant: every kind of ASPE primer is made up of at the Auele Specific Primer in goal gene mutational site tag sequence and the 3 ' end of 5 ' end, and described tag sequence is selected from the sequence among SEQ ID NO.1～SEQ ID NO.24; Described Auele Specific Primer is: at more than one and the SEQ ID NO.97 in SEQ ID NO.98～116 in more than one and SEQ ID NO.49 in SEQ ID NO.50～68 in the sequence table of Exon 19 or the sequence table; And/or at SEQ ID NO.117～118 in SEQ ID NO.69～70 or the sequence table in the sequence table of Exon 20; And/or at SEQ ID NO.119～120 in SEQ ID NO.71～72 or the sequence table in the sequence table of Exon 21;
(B) be coated with microballoon special anti-tag sequence, that have the different colours coding respectively, described anti-tag sequence is selected from the sequence among SEQ ID NO.121～SEQ ID NO.144, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C) be used for amplifying respectively have Exon 19, the amplimer of the target sequence in the corresponding mutational site of Exon 20 and/or Exon 21, described amplimer is: at SEQ ID NO.145～146 of Exon 19; At Exon 20, when Auele Specific Primer derives from SEQ ID NO.45～SEQ ID NO.46, amplimer is SEQ ID NO.147～148, when Auele Specific Primer derives from the reverse complementary sequence of SEQ ID NO.45～SEQ ID NO.46, amplimer is SEQ ID NO.149～150; At Exon 21, when Auele Specific Primer derives from SEQ ID NO.47～SEQ ID NO.48, amplimer is SEQ ID NO.151～152, when Auele Specific Primer derives from the reverse complementary sequence of SEQ ID NO.47～SEQ ID NO.48, amplimer is SEQ ID NO.153～154.
CN 201010160753 2010-04-23 2010-04-23 Liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation Active CN102234683B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN 201010160753 CN102234683B (en) 2010-04-23 2010-04-23 Liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation
PCT/CN2011/073210 WO2011131145A1 (en) 2010-04-23 2011-04-23 Liquid chip for detecting egfr gene mutations

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 201010160753 CN102234683B (en) 2010-04-23 2010-04-23 Liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation

Publications (2)

Publication Number Publication Date
CN102234683A CN102234683A (en) 2011-11-09
CN102234683B true CN102234683B (en) 2013-07-17

Family

ID=44833725

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 201010160753 Active CN102234683B (en) 2010-04-23 2010-04-23 Liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation

Country Status (2)

Country Link
CN (1) CN102234683B (en)
WO (1) WO2011131145A1 (en)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102597271B (en) * 2009-10-30 2015-05-20 爱科来株式会社 Probe for detecting polymorphism in egfr genes, and usage therefor
WO2012065705A1 (en) * 2010-11-19 2012-05-24 Roche Diagnostics Gmbh Novel complex mutation in the epidermal growth factor receptor kinase domain
CN103184274A (en) * 2011-12-27 2013-07-03 上海复星医学科技发展有限公司 EGFR mutation detection kit based on LDR technology
CN103667270B (en) * 2012-09-18 2016-06-08 南京世和基因生物技术有限公司 For the DNA probe storehouse hybridized with EGFR gene and the method adopting its enrichment EGFR gene fragment
CN102912041B (en) * 2012-11-06 2014-10-01 厦门出入境检验检疫局检验检疫技术中心 Primers and liquid-phase chip for detecting five viruses of prawns and application thereof
CN107619864A (en) * 2017-07-14 2018-01-23 广州赛百纯生物科技有限公司 A kind of liquid-phase chip for detecting Human epidermal growth factor receptor gene mutation
CN107937525B (en) * 2017-12-08 2020-10-30 益善生物技术股份有限公司 NRAS mutation detection kit and extension primer based on liquid chip method
CN108504725A (en) * 2018-06-12 2018-09-07 上海浦美生物医药科技有限公司 A kind of primer and probe for detecting EGFR TKI sensitizing mutations

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101041850A (en) * 2006-03-20 2007-09-26 吕成伟 T790M mutation quick-detection method and reagent case for human epidermal growth factor acceptor(EGFR) gene extron 20
CN101445829A (en) * 2008-04-23 2009-06-03 广州益善生物技术有限公司 Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites
CN101624626A (en) * 2009-08-11 2010-01-13 广州益善生物技术有限公司 Specific primer for detecting fluorouracil medicament healing effect related gene mutation, liquid phase chip thereof and method thereof
CN101633963A (en) * 2009-08-11 2010-01-27 广州益善生物技术有限公司 Hepatitis B virus YMDD motif mutation detection specific primer and liquid phase chip and method thereof

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7226737B2 (en) * 2001-01-25 2007-06-05 Luminex Molecular Diagnostics, Inc. Polynucleotides for use as tags and tag complements, manufacture and use thereof
BRPI0508286B8 (en) * 2004-03-31 2021-05-25 Dana Farber Cancer Inst Inc method to determine the likelihood of efficacy of an egfr tyrosine kinase inhibitor to treat cancer, use of an egfr tyrosine kinase inhibitor, probe, kit, and, primer pair
WO2006070667A1 (en) * 2004-12-28 2006-07-06 Takara Bio Inc. Method of detecting mutation in egfr gene and detection kit
CA2597673C (en) * 2005-02-11 2014-07-08 Harold Varmus Methods and compositions for detecting a drug resistant egfr mutant
GB2424886A (en) * 2005-04-04 2006-10-11 Dxs Ltd Polynucleotide primers against epidermal growth factor receptor and method of detecting gene mutations
ES2398709T5 (en) * 2005-06-28 2017-04-18 Genentech, Inc. Mutations in EGFR and KRAS to predict a patient's response to treatment with EGFR inhibitors
JP2007202546A (en) * 2006-02-03 2007-08-16 Hiroaki Onishi Pcr primer for detecting mutation of epithelial growth factor receptor gene
JP2007215413A (en) * 2006-02-14 2007-08-30 Toyobo Co Ltd Method for detecting deletion
JP2010029146A (en) * 2008-07-30 2010-02-12 Hitachi Ltd Method for analysis of base sequence
CN101463390B (en) * 2008-12-31 2011-09-14 广州益善生物技术有限公司 EGFR gene extron 20 mutational detecting probe, liquid phase chip and detecting method thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101041850A (en) * 2006-03-20 2007-09-26 吕成伟 T790M mutation quick-detection method and reagent case for human epidermal growth factor acceptor(EGFR) gene extron 20
CN101445829A (en) * 2008-04-23 2009-06-03 广州益善生物技术有限公司 Detection probe, liquid phase chip and detection method thereof for EGFR gene mutation sites
CN101624626A (en) * 2009-08-11 2010-01-13 广州益善生物技术有限公司 Specific primer for detecting fluorouracil medicament healing effect related gene mutation, liquid phase chip thereof and method thereof
CN101633963A (en) * 2009-08-11 2010-01-27 广州益善生物技术有限公司 Hepatitis B virus YMDD motif mutation detection specific primer and liquid phase chip and method thereof

Also Published As

Publication number Publication date
CN102234683A (en) 2011-11-09
WO2011131145A1 (en) 2011-10-27

Similar Documents

Publication Publication Date Title
CN102234683B (en) Liquid phase chip for detecting EGFR (epidermal growth factor receptor) gene mutation
CN101984070B (en) c-KIT gene mutation detection liquid-phase chip
CN101824467B (en) CYP2D6 gene mutation detection liquid-phase chip and detection method
CN102234685B (en) Liquid phase chip for detecting PIK3CA (phosphoinositide-3-kinase, catalytic, alpha) gene mutation
CN101671740A (en) Method for detecting gene polymorphism of UGT1A1 and liquid phase chip
CN102234686B (en) Liquid chip for detecting KRAS gene mutation
CN102234684B (en) Specific primer and liquid phase chip for BRAF genetic mutation detection
CN103571923A (en) Detection probes and detection liquid phase chip for BIM gene deletion mutation
CN102021238B (en) ADRB1 (adrenergic, beta-1) gene SNP (Single Nucleotide Polymorphism) detection specificity primer and liquid phase chip
CN102994617A (en) HRAS gene mutation detection specificity primer and liquid chip thereof
CN102021240B (en) Liquid phase chip for detecting mutation of GSTM1(glutathione S transferase mu), GSTT1 (glutathione S transferase theta) and GSTP1 (glutathione S transferase pi) genes
CN104846108A (en) Primer, kit as well as PCR method for detecting of D816V mutation site of C-KIT gene
CN109504769B (en) Specific primer, liquid phase chip kit and method for detecting HER2 gene mutation
CN102021236B (en) AGT1R (Angiotensin Type 1 Receptor) gene SNP (Single Nucleotide Polymorphism) detection liquid phase chip and specific primer
CN102533951B (en) BRAP and PSMA6 gene SNP detection specific primer and liquid phase chip
CN102021237B (en) Liquid phase chip and specificity primer for SNP detection of CYP4F2 and EPHX1 genes
CN103031367A (en) VHL (Von Hippel Lindau) genetic mutation detection specific primer and liquid phase chip
CN102010898B (en) EPHX1 (Microsomal epoxide hydrolase, mEH, EPHX1) gene detection specific primer and liquid phase chip
CN102010900B (en) Liquid chip and specific primer for detecting SNP of GPIIIa gene and liquid chip and specific primer for detecting SNP of GPIIIa and COX-1 genes
CN102031286A (en) Chromosome 9p21 section and KIF6 gene SNP (single nucleotide polymorphism) detection liquid phase chip and specific primer
CN101824476B (en) OPRM1 (Opiate Receptor Mu 1) gene SNP (Single Nucleotide Polymorphism) detection specific primer, liquid-phase chip and detection method
CN102994620B (en) AKT1 gene mutation detection specificity primer and liquid chip thereof
CN102559850B (en) ApoA5 genic mutation detection specific primer and liquid phase chip
CN102277413A (en) Specific primer and liquid-phase chip for SNP detection of COX-1 genes
CN102559852B (en) Specific primes and liquid phase chip for AGT (angiotensinogen) and ACE (angiotensin-converting enzyme) gene polymorphism detection

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C56 Change in the name or address of the patentee

Owner name: SUREXAM BIOTECHNOLOGY CO., LTD.

Free format text: FORMER NAME: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD.

CP01 Change in the name or title of a patent holder

Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Patentee after: Surexam Biological Technology Co., Ltd.

Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Patentee before: Guangzhou Yishan Biotechnology Co., Ltd.