CN102206660A - Engineered protein TAT-VP28 against white spot syndrome virus of shrimp and its preparation and purpose - Google Patents
Engineered protein TAT-VP28 against white spot syndrome virus of shrimp and its preparation and purpose Download PDFInfo
- Publication number
- CN102206660A CN102206660A CN 201010572930 CN201010572930A CN102206660A CN 102206660 A CN102206660 A CN 102206660A CN 201010572930 CN201010572930 CN 201010572930 CN 201010572930 A CN201010572930 A CN 201010572930A CN 102206660 A CN102206660 A CN 102206660A
- Authority
- CN
- China
- Prior art keywords
- tat
- gene
- pet
- shrimp
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an engineered protein TAT-VP28 against white spot syndrome virus of shrimp and its preparation and purpose. The sequences of the engineered protein TAT-VP28 provided by the invention are nucleotide sequence as shown in SEQIDNO:1 and amino acid sequence as shown in SEQIDNO:2, and the bacterial strain is a recombinant gene engineering bacterial strain Escherichiacoli BL21(Pet-28a-TAT-VP28). WSSV is extracted from shrimp bodies and the VP28 gene is obtained through PCR; TAT-VP28 sequences are amplified by the PCR method and then the recombinant plasmid pET-28a(+)-TAT-VP28 is constructed, followed by the transformation of the recombinant plasmid pET-28a(+)-TAT-VP28 into the Escherichia coli BL21(DE3). The gene engineering fusion protein can be applied to preparing medicaments for treating or preventing the white spot syndrome virus of shrimp, has large expression amount and soluble performance, is easy for industrial production at low cost with good security, and has a better lasting protective effect of preventing the white spot syndrome of shrimp.
Description
Technical field
The present invention relates to the gene biological field of engineering technology.More specifically relate to a kind of recombination fusion protein TAT-VP28 subunit vaccine, the preparation method who also relates to a kind of bacillus coli gene engineering strain simultaneously is specifically related to make up and efficiently express the engineering strain of solvable a kind of nexin transduction domain polypeptide (TAT-PTD) and white spot syndrome virus (WSSV) (WSSV) envelope protein VP28 fusion rotein; Also relate to the purposes of fusion rotein in the medicine of anti-white spot syndrome virus (WSSV) that above-mentioned bacterial strains is expressed.
Background technology
Since the eighties in last century, world's shrimp culture industry high speed development, along with the destruction day by day of environment, the aggravation of disease problem has become the important factor that hinders the shrimp culture industry development.White spot syndrome virus (WSSV) (WSSV) is to one of maximum cause of disease of global shrimp culture industry harm.White spot syndrome virus (WSSV) (White Spot Syndrome Virus, WSSV) from 1992 first since Taiwan outburst, successively respectively in Japan, South East Asia, North America etc. country break out, shrimp culture industry has caused enormous economic loss in the world.Nineteen ninety-five, United Nations's grain and oil tissue (FAO), international veterinary drug office (OIE) and Asian-Pacific area aquaculture development network center (NACA) classify it as one of hydrocoles viral blight that needs report.The various countries experts and scholars further investigate white spot syndrome virus in recent years, have inquired into its morphological structure, genomic constitution, taxonomy, infection host and the albumen relevant with virus infection.For infecting, control WSSV provides the important theory foundation.
WSSV is a kind of circular double stranded DNA virus that cyst membrane is arranged, and its morphology is similar to baculovirus, is elongated rod shape, has double-deck cyst membrane.Complete virus particle mainly comprises cyst membrane, nucleocapsid and nucleoid three parts.WSSV has wider host range, and except can infecting crustaceans such as shrimp, crab class, copepods and part arthropods also can become this viral circulator and carrier.The primary structure albumen of WSSV has VP15, VP19, VP24, VP26, VP28, and these proteic reading frames of encoding are by definite to the mensuration of its n terminal amino acid sequence.VP19, VP28 are main envelope proteins.Proteic structural analysis can be found to VP28, has 5 potential N-glycosylation sites, 2 potential O-glycosylation sites and 9 possible phosphorylation sites in the proteic structure of VP28.Simultaneously, there is strong hydrophobic region at proteic N-end, and comprises a theoretic membrane spaning domain in this zone.Van Hulten utilizes the proteic antibody neutralization of VP28 to experimental results show that early process relevant (the van Hulten of this albumen with the WSSV infection for the first time, M.C.W., Witteveldt, J., Snippe, M., Vlak, J.M..White spot syndrome virus envelope protein VP28 is involved in the systemic infection of shrimp[J] .Virology, 2001b, 285:228-233.).On the research basis of van Hulten, Yi has further studied the concrete effect of VP28 albumen in the WSSV course of infection, proved that further VP28 albumen participates in the absorption and the invasion procedure (Yi of WSSV prawn cell, G., Wang, Z., Qi, Y., Yao, L., Qian, J., Hu, L..VP28 of white spot syndrome virus is involved in the attachment and penetration into shrimp cells[J] .J.Biochem.Mol.Biol, 2004,37:726-734.).Recent study is found to mainly contain PmRab7, HSP70 (heat shock cognate protein 70), STAT (signal transducer and activator of transcription) with the host cell surface albumen of VP28 protein-interacting.
The various countries scholar is devoted to the research to WSSV epidemiology and pathogenesis always in recent years, to seek measure and the method that control WSSV infects.The method of preventing and treating mainly contains and utilizes immunostimulant to strengthen the antiviral infection ability of prawn, utilizes the antibody neutralizing effect to block the infection of WSSV, utilizes vaccine to improve the ability of the anti-WSSV virus of prawn at present.Studies have shown that at present the immunostimulant that can strengthen the anti-WSSV infection ability of prawn mainly contain lipopolysaccharides (Lipopolysaccharides, LPS), dextran (Glucan).The inactivated vaccine of Zhu research can be induced the infection that produces immunne response and protect shrimp opposing WSSV in the shrimp body, inactivated vaccine is with divinyl imines (Binary ethylenimine, BEI) as inactivator, BEI is the envelope protein of WSSV (the Fei Zhu that can be kept perfectly during as inactivator, Huahua Du, Zhi-Guo Miao, Hai-Zhi Quan, Zi-Rong Xu.Protection of Procambarus clarkii against white spot syndrome virus using inactivated WSSV[J] .Fish ﹠amp; Shellfish Immunology.2009,26:685-690).Witteveldt utilizes prokaryotic expression carrier recombinant expressed VP28 fusion rotein in intestinal bacteria, the VP28 fusion rotein of purifying is arrived in the prawn body by intramuscular injection, after intramuscular injection, carried out the virus attack experiment in the 2nd day and the 25th day respectively, found that with control group and compare, there is higher relative survival rate (Jeroen Witteveldt in VP28 fusion rotein injection group, Just M.Vlak, Marielle C.W., van Hulten.Protection of Penaeus monodon against white spot syndrome virus using a WSSV subunit vaccine[J] .Fish ﹠amp; Shellfish Immunology.2004,16:571-579).Du utilizes insect cell expression system to come the VP28 albumen of express recombinant, and recombinant protein is in intramuscular injection enters huge legendary turtle shrimp body.And the injection back was carried out the virus attack experiment on the 10th day; the recombinant protein that found that insect cell expression is compared with control group; the huge legendary turtle shrimp there is better protecting effect (Huahua Du; Zirong Xu; Xiaofeng Wu; Weifen Li, Wei Dai. Increased resistance to white spot syndrome virus in Procambarus clarkii by injection of envelope pr
Protein transduction domains (protein transduction domain, PTD) or claim that (cell penetrating peptides, CPPs) be one is that the various materials of effective transportation of carrier enter cell and nuclear system with the peptide to cell-penetrating peptide.The material that carries by PTD has full length protein, DNA, chemicals, oligonucleotide, 40nm magnetic bead and 200nm liposome etc.The protein transduction domains that research now at most, range of application is the widest derive from human immunodeficiency virus type 1 (HIV-1) activating transcription factor (Trans-activating transcriptional activator, Tat).There are 3 functional domains in the Tat albumen, are respectively: be positioned at the acidic region of N-end, mainly play the function of trans-activation; DNA land between the 22-37 amino acids, halfcystine is rich in this zone; Basic region between the 47-60 amino acids is main nexin transduction domain, participates in the proteic cell internalizing effect of Tat.Tat albumen has 86 amino acid, is that HIV duplicates necessary regulatory factor.The minimum peptide section that Schwarze etc. determine to have the protein transduction function is 47-57, is made up of 11 amino acid, and its sequence is YGRKKRRQRRR, and this section iso-electric point 12.7 is basic polypeptide, and transduction speed is fast, the efficient height.TAT can transduce the polypeptide that is attached thereto or full length protein and enter cell in several minutes, and can be transported to cerebral tissue by blood circulation in vivo, crossed over hemato encephalic barrier and entered in neurone or the spongiocyte.Existing at present tens kinds of compounds are successfully transduceed with protein and are entered different cells or cross over hemato encephalic barrier, and shown corresponding biological activity, and with the protein of multiple sex change, transduction enters in the mouse body and has recovered biological activity as beta-galactosidase enzymes, and the molecule that is brought into cell has kept their original activity separately basically.
Because 6 arginine and 2 lysine residues are arranged, therefore be the polypeptide that has the height positive charge in the TAT protein transduction domains sequence.Substitute wherein any one alkaline amino acid residue with uncharged L-Ala and all can make and wear film activity and reduce, wear film activity during other amino-acid residues in the alternative sequence and then can not change.This explanation TAT wear the film peptide with positive charge to be that it wears the film function necessary, infer therefore that these positive charges are likely can strong electrostatic interaction take place with eukaryotic cytolemma, wear membrane process thereby mediated.Affinity analysis to the TAT protein transduction domains finds that it can combine by electrostatic interaction consumingly with the negatively charged ion of many surface of cell membrane, and the bonded cell surface molecule can be paranuclein, proteoglycan etc. with it.In addition, discover that the TAT protein transduction domains can not influence it and wear film activity because of the change of chiral structure, its chiral molecules has the identical film activity of wearing with natural structure.This illustrates that this TAT protein transduction domains does not rely on specific binding site probably.Yet the length of polypeptide is the important factor that membrane efficiency is worn in influence.It is relevant with arginic number to wear membrane efficiency, contain 6 or more pR60 polypeptide than contain be less than 5 arginine polypeptides to wear membrane efficiency higher, during less than 15 amino acid, wearing membrane efficiency can strengthen along with the increase of polypeptide size at polypeptide.Though also can have the film activity of wearing greater than 15 amino acid whose polypeptide, its efficient can obviously reduce.
Although for the TAT protein transduction domains wear the many of film functional study, up to the present, the molecular mechanism that enters cell about the TAT protein transduction domains is not also studied clear fully.Early stage research is thought to pass cytolemma by direct transporting mechanism, and does not rely on energy, but nearest research also has the result different with this viewpoint.Although it is thorough that its mechanism that enters cell is also studied fully, the application of TAT protein transduction domains is very extensive.
Summary of the invention
The objective of the invention is to be to provide a kind of bacillus coli gene engineering strain, this bacterial strain can expressing protein transduction structural domain polypeptide (TAT-PTD) and white spot syndrome virus (WSSV) envelope protein VP28 genetic engineering fusion protein TAT-VP28.Its advantage is that expression amount is big and solvable, is easy to suitability for industrialized production, and cost is low, and security is good.
Another object of the present invention is the preparation method who has been to provide a kind of recombination fusion protein TAT-VP28 subunit vaccine; can prevent prawn white spot syndrome (WSS); compare with the recombination fusion protein VP28 subunit vaccine of expressing; on the prevention prawn white spot syndrome, higher, longer protection effect is arranged.
A further object of the present invention is the application of genetic engineering fusion protein in the medicine of preparation treatment or prevention white spot syndrome virus (WSSV).
Fusion rotein TAT-VP28 provided by the invention can effectively prevent prawn white spot syndrome (WSS).After recombination fusion protein TAT-VP28 process huge legendary turtle shrimp is oral, fusion rotein TAT-VP28 can pass the shrimp intestinal tissue and enter huge legendary turtle shrimp hemolymph, make subunit vaccine directly enter in the hemolymph without intramuscular injection, by hemolymph in the intravital circulation of shrimp, make its fusion rotein arrive different tissues, increased the competition neutral effect in WSSV virus, the immunoenzyme of the shrimp of also having competed is simultaneously lived and is acted on.
Innovation part of the present invention is that the fusion rotein of patent utilization escherichia coli expression TAT nexin transduction domain of the present invention and WSSV envelope protein VP28 is intended to prevent and treat WSS.The microbial medicine that the TAT-VP28 fusion rotein of producing by genetically engineered can be used as anti-WSS cause of disease is applied to shrimp culture industry, can significantly improve immunizing power and the resistance against diseases of prawn.Another innovation part of the present invention is, with nexin transduction domain peptide T AT and VP28 amalgamation and expression.TAT can carry VP28 albumen and directly enter in the hemolymph without intramuscular injection.Nexin transduction domain peptide T AT does not also directly apply to aquaculture at present, but its uniqueness to wear membrane efficiency very attractive.Solved subunit vaccine can directly be entered in the hemolymph without intramuscular injection, made it have the feasibility of actually operating.And the construction process of engineering strain disclosed by the invention can be applied in the large-scale aquaculture, and expression amount is big, and is simple to operate, and cost is low.
Technical scheme of the present invention is as follows:
One of technical essential of the present invention is the structure and the abduction delivering of the bacillus coli gene engineering strain of expressing gene engineering recombination fusion protein TAT-VP28.
The related molecular biology method of this experiment is an ordinary method, by those skilled in the art are familiar with.What do not elaborate among the present invention sees also " molecular cloning experiment guide " J. Sa nurse Brooker, chief editors such as D.W. Russell.
A kind of preparation method of recombination fusion protein TAT-VP28 subunit vaccine, its step is as follows:
1.WSSV the preparation of VP28 gene:
(1) the virus genomic preparation of WSSV: get the gill, stomach and the heart of ill prawn on ice, ice bath homogenate adds Proteinase K (100ug/ml) then, in boiling water, boiled 15 minutes, ice bath is 5 minutes immediately, and centrifugal 10 minutes of 12000rpm gets its supernatant and puts 4 ℃ of preservations.
(2) pcr amplification VP28 gene: according to the sequences Design PCR primer of the WSSV that has delivered among the GeneBank (GeneBank:EU414753), with above-mentioned supernatant as template DNA, pcr amplification goal gene VP28, the PCR product is by the dna gel electrophoresis detection, reclaim the PCR product and it is cloned in the pGEM-T carrier (purchasing in promega company), be transformed into e. coli jm109 (purchasing) in INVITROGEN company, picking list bacterium colony is cultivated, carry out enzyme with alkaline lysis a small amount of (15-20ug) extraction plasmid and cut evaluation, and check order, positive colony that obtains is the intestinal bacteria that comprise the VP28 gene, called after pGEM-T-vp28.
2. the structure of the preparation of fusion gene tat-vp28 and expression vector:
(1) pcr amplification tat-vp28 gene: upstream primer is that 3, downstream primer are 1: divide the synthetic tat-vp28 of PCR three times: with the pGEM-T-vp28 plasmid is template, upstream primer P1:CAGCGTCGTCGTGGATCCATGGATCTTTCTTTCA, downstream primer 1:GGC
CTCGAGCTACTCGGTCTCAGTGCCAGAGTA (line place is the Xhol site), 56 ℃ of annealing temperatures are done pcr amplification purpose fragment (clip size is 636bp), and electrophoresis also reclaims; Reclaiming product with previous step is template, upstream primer P2:CGTAAAAAACGTCGTCAGCGTCGTCGTGGATCC, downstream primer 1 GGC
CTCGAGCTACTCGGTCTCAGTGCCAGAGTA (line place is the Xhol site), annealing temperature is PCR for 56 ℃, does pcr amplification purpose fragment electrophoresis and also reclaims; Reclaiming product with previous step is template, upstream primer P3:GCG
GAATTCGGCTATGGCCGTAAAAAACGTCGT (line place is the EcoRI site), downstream primer 1GGC
CTCGAGCTACTCGGTCTCAGTGCCAGAGTA (line place is the Xhol site), annealing temperature is PCR for 56 ℃.Pcr amplification goal gene TAT-VP28 (clip size is 666bp), the PCR product is by the dna gel electrophoresis detection, reclaim the PCR product and it is cloned in the pGEM-T carrier (purchasing in promega company), be transformed into e. coli jm109 (purchasing) in INVITROGEN company, picking list bacterium colony is cultivated, extracting plasmid in a small amount with alkaline lysis carries out enzyme and cuts evaluation, and check order, positive colony that obtains is the intestinal bacteria that comprise the TAT-VP28 gene, called after pGEM-T-tat-vp28.
(2) structure of fusion gene tat-vp28 expression vector: with EcoR I and Xhol I double digestion plasmid pGEMT-TAT-VP28 and plasmid pET-28a (+) (purchasing) in INVITROGEN company, purpose fragment TAT-VP28 and open loop pET-28a (+) glue reclaim back 16 ℃ and are connected and spend the night, transformed into escherichia coli JM109 competent cell, picking list bacterium colony is cultivated, extracting plasmid in a small amount with alkaline lysis carries out enzyme and cuts evaluation, positive colony that obtains is the intestinal bacteria that comprise the TAT-VP28 gene, called after pET-28a (+)-TAT-VP28.
The preparation of 3 bacillus coli gene engineering bacterias:
With plasmid pET-28a (+)-TAT-VP28 (1ul) transformed into escherichia coli BL21 (DE
3) (e. coli bl21 (DE
3) this laboratory preservation, describe not on your life like this, please with e. coli bl21 (DE
3) the source write exactly, write the document source exactly) competent cell.The PCR evaluation and screening goes out positive transformant, the gained positive colony be the present invention relates to can amalgamation and expression TAT-VP28 recombination engineering strain Escherichia coli BL21 (pET-28a-TAT-VP28).
The expression of 4 genetic engineering fusion protein TAT-VP28:
Single colony inoculation of recombination engineering strain Escherichia coli BL21 (pET-28a-TAT-VP28) is in 20ml fresh liquid MDG (the 30ug/ml card that contains final concentration and be receive mycin) substratum.37 ℃ of 200rpm shaking table overnight incubation.The 5ml overnight culture is inoculated into the 200ml lactose respectively simultaneously induces ZYM5052 (the 30ug/ml card that contains final concentration and be receive mycin) substratum automatically.The 200rpm shaking table was cultivated after 3 hours, after 18 ℃ of low temperature are induced 16h automatically, and centrifugal 12000g, 4 ℃, 10min collects thalline, the resuspended ultrasonic disruption of usefulness 10mMPBS (pH8.0), cleer and peaceful precipitation and with the expression of SDS-PAGE electrophoresis detection target protein in the centrifugal collection.With the condition enlarged culturing after optimizing, behind the ultrasonic disruption, centrifugal (12000g, 20min) collects supernatant by 4 ℃.The purifying of fusion rotein TAT-VP28 is undertaken by the Ni-NTA specification sheets, detects the protein purification result with SDS-PAGE, obtains the TAT-VP28 of purifying.
It is characterized in that: it is 27.8KDa that fusion rotein has the molecular weight of wearing shrimp intestinal function and fusion rotein.
Two of technical essential of the present invention is that the proteic intestinal function of wearing of the oral TAT-VP28 of huge legendary turtle shrimp is identified.
After the oral genetic engineering fusion protein of huge legendary turtle shrimp was provided in one embodiment of the invention, fusion rotein was worn the method that intestines are identified in the shrimp body, and promptly ELISA detects the proteic intestinal function of wearing of TAT-VP28.Method is as follows:
(1) the VP28 antibody with purifying dilutes 100 times in the PBS damping fluid, and every hole adds 100 μ L in 96 hole enzyme plates.The aperture of enzyme plate is sealed and is placed on incubation 2h in 37 ℃ of constant incubators with sealing film, make antibody sandwich in the enzyme plate bottom.
(2) discard sample in the enzyme plate aperture,, seal and be placed in the refrigerator 4 ℃ of sealings and spend the night with sealing film in every aerial 100 μ L 5% (mass volume ratio) BSA that add.
(3) confining liquid in the drying enzyme plate aperture adds 300 μ L PBST damping fluids in every hole, soak 5min, and the intermittent control shaking enzyme plate makes washing more abundant.This step 3 of repetitive operation is inferior.
(4) draw anticoagulation lymph 100 μ L respectively and add in the enzyme plate aperture, do not add the enzyme plate aperture of anticoagulation lymph as blank only to add the PBS damping fluid simultaneously.The aperture of enzyme plate is sealed and is placed on incubation 1h in 37 ℃ of constant incubators with sealing film, the antigen in the hemolymph is fully combined with antibody in being coated on enzyme plate.
(5) repeating step is (3) three times.
(6) the VP28 antibody with horseradish peroxidase (HRP) mark dilutes 200 times in the PBST damping fluid, and every hole adds 100 μ L in the enzyme plate aperture.Seal and be placed on incubation 1h in 37 ℃ of constant incubators with sealing film, the VP28 antibody of HRP mark is fully combined with antigen.
(7) repeating step is (3) three times.
(8) in the enzyme plate aperture, add 300 μ L PBS damping fluids in every hole, soak 5min, and the intermittent control shaking enzyme plate makes washing more abundant.
(9) every hole adds 100 μ L colour developing liquid in the enzyme plate aperture, seals back lucifuge colour developing 20min in 37 ℃ of constant incubators with sealing film.
(10) every hole adds 50 μ L stop buffers in the enzyme plate aperture, the color development stopping reaction.And under the 490nm wavelength, measure the absorbance value in each hole with microplate reader.
ELISA result of the present invention shows: with nickel ion affinity chromatograph difference purifying TAT-VP28 and VP28 albumen, the former huge legendary turtle shrimp of albumen peroral immunity Ke Shi behind the purifying extracted hemolymph and also utilizes double-antibody sandwich elisa to detect antigen VP28 after 1.5 hours.The result has detected positive findings in the huge legendary turtle shrimp hemolymph after showing the oral TAT-VP28 albumen of huge legendary turtle shrimp, and the VP28 protein groups does not then detect positive findings.This result shows that TAT can carry the intestinal tissue that passes the huge legendary turtle shrimp with the VP28 albumen of its amalgamation and expression, and enters in the huge legendary turtle shrimp hemolymph.
A kind of bacillus coli gene engineering strain is characterized in that, this bacterial strain is reorganization engineering strain Escherichia coli BL21 (DE
3) pET-28a-TAT-VP28, CCTCC NO:M2010296.
Described recombination engineering strain Escherichia coli BL21 (DE
3) pET-28a-TAT-VP28, recombinant plasmid Escherichia coli BL21 (DE
3) pET-28a-TAT-VP28 for the present invention constructed.Described recombinant escherichia coli strain Escherichia coli BL21 (DE
3) pET-28a-TAT-VP28 has plasmid Escherichia coli BL21 (DE
3) coli strain of pET-28a-TAT-VP28, deposit number: CCTCC NO:M2010296, depositary institution: Chinese typical culture collection center, address: China. Wuhan. Wuhan University, preservation date: on November 10th, 2010, classification name: e. coli bl21 (DE
3) pET-28a-TAT-VP28 Escherichia coli BL21 (DE
3) pET-28a-TAT-VP28.Described encoding gene BL21 (DE
3) pET-28a-TAT-VP28 is the protein coding gene with nucleotide sequence of SEQUENCE NO.1.Described protein B L21 (DE
3) pET-28a-TAT-VP28 is the albumen with aminoacid sequence of SEQUENCE NO.2.A kind of isolating protein, its sequence are the aminoacid sequence shown in the SEQUENCE NO.2.This coli strain has following feature: optimum growth temperature is 37 ℃, and colonial morphology is a smooth type on common LB nutrient agar, and colony edge is neat, and the surface is glossy, moistening, smooth, be the lime look.E.coli.BL21 (DE
3) be used to efficiently express the gene of cloning in the expression vector that contains the phage t7 promotor.The T7 phage rna polymerase is positioned at lambda particles phage DE3 district, and this district is integrated on the karyomit(e) of BL21.
The present invention compares with the single VP28 subunit vaccine of existing report, and it is advantageous that: the TAT-VP28 recombinant protein that (1) is involved in the present invention, TAT can carry VP28 albumen and directly enter in the hemolymph without intramuscular injection.Solved subunit vaccine can directly be entered in the hemolymph without intramuscular injection, made it have the feasibility of actually operating.And the construction process of engineering strain disclosed by the invention can be applied in the large-scale aquaculture, and expression amount is big, and is simple to operate, and cost is low.(2) on the prevention prawn white spot syndrome, higher, longer protection effect is arranged with the VP28 subunit vaccine of expressing.The TAT-VP28 recombinant protein in the intravital circulation of shrimp, makes its fusion rotein arrive different tissues by hemolymph, has increased the competition neutral effect in WSSV virus, and the immunoenzyme of the shrimp of also having competed is simultaneously lived and acted on.
Description of drawings
Fig. 1 is the building process synoptic diagram of a kind of recombinant expression plasmid pET-28a (+)-TAT-VP28.
Fig. 2 cuts with PCR for the enzyme of a kind of recombinant expression plasmid pET-28a (+)-TAT-VP28 and identifies synoptic diagram.
1.D2000 2.TAT-VP28 PCR 3.pET-28a (+)-TAT-VP28 plasmid 4.pET-28a (+)-TAT-VP28 singly cuts/and Xho I 5.pET-28a (+)-TAT-VP28 is two to be cut/EcoR I, Xho I 6.MarkerIV.
Fig. 3 is that a kind of SDS-PAGE identifies synoptic diagram.
M: albumen Marker (Fermentas #SM0431)
1: inductive pET-28a-vp28 (BL21) not
2: induce the broken pET-28a-vp28 (BL21) in back automatically
3: the pET-28a-vp28 after inducing automatically (BL21) supernatant
4: the VP28 fusion rotein of purifying
5: inductive pET-28a-tat-vp28 (BL21) not
6: induce the broken pET-28a-tat-vp28 (BL21) in back automatically
7: the pET-28a-tat-vp28 after inducing automatically (BL21) supernatant
8: the TAT-VP28 fusion rotein of purifying
Fig. 4 is that a kind of ELISA of huge legendary turtle shrimp hemolymph detects synoptic diagram.
Fig. 5 is a kind of protection effect synoptic diagram of recombination fusion protein TAT-VP28 subunit vaccine.
Embodiment
The invention will be further described below in conjunction with drawings and the specific embodiments.All substratum and the molecular biology working method that relate in an embodiment are well known to those skilled in the art.The related molecular biology method of this experiment is an ordinary method, by those skilled in the art are familiar with.What do not elaborate among the present invention sees also " molecular cloning experiment guide " J. Sa nurse Brooker, chief editors such as D.W. Russell.
The preparation of embodiment 1:tat-vp28 gene.
(1) the virus genomic preparation of WSSV: get the gill, stomach and the heart of ill prawn on ice, ice bath homogenate adds Proteinase K (100ug/ml) then, in boiling water, boiled 15 minutes, ice bath is 5 minutes immediately, and centrifugal 10 minutes of 12000rpm gets its supernatant and puts 4 ℃ of preservations.
(2) pcr amplification VP28 gene: according to the sequences Design PCR primer of the WSSV that has delivered among the GeneBank (GeneBank:EU414753), with above-mentioned supernatant as template DNA, pcr amplification goal gene VP28, the PCR product is by the dna gel electrophoresis detection, reclaim the PCR product and it is cloned in the pGEM-T carrier (purchasing in promega company), picking list bacterium colony extracts plasmid in a small amount with alkaline lysis to carry out enzyme and cuts evaluation, and positive colony that obtains that checks order is the intestinal bacteria that comprise the VP28 gene, called after pGEM-T-vp28 is used for the propagation and the preservation of gene.
(3) pcr amplification tat-vp28 gene: upstream primer is 3, downstream primer 1: divide the synthetic tat-vp28 of PCR three times: with the pGEM-T-vp28 plasmid is template, upstream primer P1:CAGCGTCGTCGTGGATCCATGGATCTTTCTTTCA, downstream primer 1:GGC
AAGCTTCTACTCGGTCTCAGTGCCAGAGTA, 56 ℃ of annealing temperatures are done pcr amplification purpose fragment, and electrophoresis also reclaims; Reclaiming product with previous step is template (dip in and get a little), upstream primer P2:CGTAAAAAACGTCGTCAGCGTCGTCGTGGATCC, downstream primer 1GGC
AAGCTTCTACTCGGTCTCAGTGCCAGAGTA, annealing temperature is PCR for 56 ℃, and electrophoresis also reclaims; Reclaiming product with previous step is template (dip in and get a little), upstream primer P3:GCG
GAATTCGGCTATGGCCGTAAAAAACGTCGT, downstream primer 1GGC
AAGCTTCTACTCGGTCTCAGTGCCAGAGTA, annealing temperature is PCR for 56 ℃.PCR reaction system: 10 * Taq Buffer with KCl 2.5uL, MgCl
2(25mM) 1.5uL, dNTP Mixture (2.5mM) 1uL, each 1uL of upstream and downstream primer (25pmol), template 1uL, Taq archaeal dna polymerase (1U/uL) 1uL adds sterilized water to final volume 50uL.The PCR reaction conditions is:; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 50s (30 circulations); 72 ℃ of 10min.Obtain the PCR product of TAT-VP28.
Recovery, purifying and the subclone of embodiment 2:PCR product.
PCR product electrophoresis on sepharose with the TAT-VP28 that obtains among the embodiment 1, under ultraviolet lamp, downcut the band that desire reclaims rapidly, reclaim the test kit purifying with TIANGEN sepharose DNA, single target DNA band is put into clean Eppendorf pipe, take by weighing weight.(gel heavily is 0.1g, and its volume can be considered 100uL, by that analogy) to add the long-pending sol solutions PN of triploid in blob of viscose.50 ℃ of water-baths 10 minutes, gentleness spun upside down the Eppendorf pipe in per therebetween 2 minutes, fully dissolved to guarantee blob of viscose.Gained solution is got 750uL join in the adsorption column (adsorption column is put into collection tube), room temperature (identical below 20-25 ℃) was placed 2 minutes, and centrifugal 1 minute of 12000rpm outwells the waste liquid in the collection tube, and adsorption column is put into collection tube.Add the 600uL rinsing liquid in adsorption column, centrifugal 1 minute of 12000rpm outwells the waste liquid in the collection tube, and adsorption column is put into collection tube.Add the 600uL rinsing liquid again in adsorption column, centrifugal 1 minute of 12000rpm outwells the waste liquid in the collection tube, and adsorption column is put into collection tube.Centrifugal 2 minutes of void column 12000rpm eliminates rinsing liquid as far as possible.Adsorption column is put into a clean Eppendorf pipe, and room temperature was placed several minutes, thoroughly dried, and prevented that residual rinsing liquid from influencing next step experiment.To the unsettled dropping in adsorption film mid-way 30uL elution buffer, room temperature was placed 2 minutes, centrifugal 2 minutes of 12000rpm.
The subclone of PCR product:
The PCR product of recovery, purifying is connected with pGEM-T (purchasing in promega company), and linked system is as follows:
4 ℃ of water-baths of ligation liquid are placed and are spent the night.
Embodiment 3: the structure of plasmid pGEM-tat-vp28.
Calcium Chloride Method prepares competent escherichia coli cell: the steps include:
(1) with new activatory e. coli jm109 list bacterium colony on the transfering loop picking solid LB flat board, is inoculated into 20ml liquid LB substratum and (1g peptone, 0.5g yeast powder, 1g NaCl is dissolved in 75ml ddH
2Among the O, adjust pH value to 7.0, add ddH at last
2O is settled to 100ml, is sub-packed in five triangular flasks, and is standby behind 115 pounds of sterilising treatment 20min) in, 37 ℃, the activation of 250rpm shaking table is spent the night.
(2) get the above-mentioned activatory intestinal bacteria of 60ul under the aseptic condition in fresh 20ml liquid LB substratum, 37 ℃, the 250rpm shaking table is cultivated about 3 hours to OD
600Value is 0.4-0.6.(the following aseptic technique that all needs in steps)
(3) get the above-mentioned bacterium liquid of 1.5ml under the aseptic condition in aseptic Eppendorf pipe, placed 10 minutes, make culture be cooled to 0 ℃ on ice.4000rpm, 4 ℃ centrifugal 10 minutes, blot supernatant with liquid-transfering gun.
(4) add the 0.1MCaCl that 300ul ices precooling
2The resuspended bacterial sediment of solution, ice bath 30 minutes, 4000rpm, 4 ℃ centrifugal 10 minutes, blot supernatant with liquid-transfering gun.
(5) add the 0.1MCaCl that 100ul ices precooling
2The resuspended precipitation of solution promptly gets competent cell, places 4 ℃ of preservations, uses in 24 hours and is advisable.
Connect product transformed into escherichia coli competent cell: the steps include:
(1) gets ligation liquid 10ul under the aseptic condition, join in the 100ul escherichia coli jm109 competent cell, mixing gently, ice bath 30 minutes.(the following aseptic technique that all needs in steps)
Heat shock is 90 seconds in (2) 42 ℃ of water-baths, moves in the ice ice bath 2-3 minute rapidly.
(3) add 800ul liquid LB substratum, 37 ℃, the 150rpm jog, incubation made bacteria resuscitation in 45 minutes.
(4) 4000rpm is centrifugal 10 minutes, draws the 700ul supernatant and discards, and will remain bacterium liquid with liquid-transfering gun mixing gently.
(5) above-mentioned bacterium liquid is uniformly coated on aseptic triangle glass rod contains 10ul 1M IPTG, 40ul 20mg/ml X-gal, on the LB flat board of 10ul 200mg/ml Amp, forward was placed 1-2 hour, all absorbed until liquid, be inverted flat board overnight incubation in 37 ℃ of incubators.
There is this method can prepare the bacterium colony of E.coli JM109 pGEMT-TAT-VP28.
The enzyme of positive forward recon pGEMT-TAT-VP28 is cut evaluation:
With alkaline lysis in a small amount (15-20ug) extract E.coli JM109 pGEMT-TAT-VP28 plasmid pGEMT-TAT-VP28, institute's upgrading grain is carried out double digestion, it is as follows that enzyme is cut system:
(1) double digestion of recombinant plasmid pGEMT-TAT-VP28
Add sterilized water to final volume 20ul.
The endonuclease reaction condition is 37 ℃, and reaction times 2-3 hour, enzyme was cut product agarose gel electrophoresis analytical results.
Embodiment 4: the preparation of fusion gene and the structure of expression plasmid.
(1) structure of recombinant expression plasmid pET-28a (+)-TAT-VP28: the steps include:
With EcoR I and Xhol I double digestion plasmid pGEMT-TAT-VP28 and plasmid pET-28a (+) (purchasing) in INVITROGEN company, purpose fragment TAT-VP28 and open loop pET-28a (+) glue reclaim back 16 ℃ and are connected and spend the night, transformed into escherichia coli JM109 competent cell, method is as follows:
1. get ligation liquid 10ul under the aseptic condition, join in the 100ul escherichia coli jm109 competent cell, mixing gently, ice bath 30 minutes.(the following aseptic technique that all needs in steps) following table is a linked system:
2. heat shock 90 seconds in 42 ℃ of water-baths moved in the ice ice bath rapidly 2 minutes.
3. above-mentioned bacterium liquid is uniformly coated on aseptic triangle glass rod and contains final concentration and receive on the LB flat board of mycin for the 30ug/ml card, forward was placed 1-2 hour, was all absorbed until liquid, be inverted dull and stereotyped in 37 ℃ of incubators overnight incubation.Picking mono-clonal pET-28a (+)-TAT-VP28/JM109 is in 500ul fresh liquid LB substratum (the 30ug/ml card that contains final concentration and be receive mycin), 37 ℃, the 300rpm shaking table was cultivated 3-4 hour, with this bacterium liquid is template, upstream primer P1, P2, P3, downstream primer 1 carry out the PCR preliminary evaluation for primer, and its product is a TAT-VP28 total length fusion gene.The bacterium liquid switching 50ul that PCR is identified the gained positive colony is in 20ml fresh liquid LB substratum (card that contains final concentration and be 30ug/ml receive mycin), 37 ℃, 300rpm shaking table overnight incubation, alkaline lysis (15-20ug) in a small amount extracts plasmid, identify positive recombinant with EcoR I and Xhol I double digestion, recombinant plasmid called after pET-28a (+)-TAT-VP28, and order-checking and dna sequence dna are in full accord, meet translation and read frame.The building process of recombinant expression plasmid pET-28a (+)-TAT-VP28 is seen accompanying drawing 1, and enzyme is cut and accompanying drawing 2 is seen in the PCR evaluation.
Embodiment 5: the preparation of bacillus coli gene engineering bacteria.
With plasmid pET-28a (+)-TAT-VP28 (1ul) transformed into escherichia coli BL21 (DE
3) competent cell.The PCR evaluation and screening goes out positive transformant, the gained positive colony be the present invention relates to can amalgamation and expression TAT-VP28 recombination engineering strain Escherichia coli BL21 (pET-28a-TAT-VP28).
Embodiment 6: the expression of genetic engineering fusion protein TAT-VP28.
Single colony inoculation of recombination engineering strain Escherichia coli BL21 (pET-28a-TAT-VP28) is in 20ml fresh liquid MDG (the 30ug/ml card that contains final concentration and be receive mycin) substratum.37 ℃ of 200rpm shaking table overnight incubation.MDG culture medium prescription: take by weighing 0.55g glucose-H
2O, 0.28g aspartate-H
2O, with pipettor draw 20 respectively * the mixing salt 5ml (Na that wherein contains 500mmol/L
2HPO
4, 500mmol/L KH
2PO
4, 1mol/L NH
4The Na of Cl, 100mmol/L
2SO
4), 100 * MgSO
4(200mmol/L) 1ml adds deionized water and is settled to 100ml.115 ℃ of autoclaving 20min are standby.
The 5ml overnight culture is inoculated into the 200ml lactose respectively simultaneously induces ZYM5052 (the 30ug/ml card that contains final concentration and be receive mycin) substratum automatically.ZYM5052 culture medium prescription: take by weighing 10g Tryptones, 5g yeast extract, 0.55g glucose-H
2O, 2.1g lactose-H
2O, 6.3g glycerine, with pipettor draw 20 * the mixing salt 50ml (Na that wherein contains 500mmol/L
2HPO
4, 500mmol/L KH
2PO
4, 1mol/L NH
4The Na of Cl, 100mmol/L
2SO
4),, 100 * MgSO
410ml adds deionized water and is settled to 1000ml.115 ℃ of autoclaving 20min are standby.37 ℃, the 200rpm shaking table was cultivated after 3 hours, and 18 ℃ of low temperature are induced 16h automatically.With before inducing and induce the back Eppendorf pipe of sampling was in room temperature with 12000rpm centrifugal 1 minute in a small amount, supernatant discarded adds the resuspended bacterial sediment of 100ul sterilized water.Get each 20ul of above-mentioned sample respectively in 20ul 2 * sds gel sample loading buffer (100mM Tris-C1,200mM beta-mercaptoethanol, 4% SDS, 0.2% tetrabromophenol sulfonphthalein, 20% glycerine), 100 ℃ were heated 10 minutes, sample can be stored in-4 ℃, in order to application of sample on gel.Melt sample, in room temperature centrifugal 1 minute with 12000rpm.Getting the 10ul application of sample is to carry out electrophoresis in the 12%SDS polyacrylamide gel to acrylamide concentration.
Electrophoresis unloads gel, at coomassie brilliant blue staining liquid (1g Xylene Brilliant Cyanine G R-250,450ml methyl alcohol, 450ml ddH after finishing
2O, the 100ml Glacial acetic acid) middle dyeing 2 hours, use destainer (40ml methyl alcohol, 10ml acetate, 50ml ddH then
2O) decolouring was changed liquid once every 30 minutes, till background is taken off totally.The SDS-PAGE of fusion rotein TAT-VP28 identifies and sees accompanying drawing 3.
Embodiment 7: the purifying of fusion rotein TAT-VP28.
(1) fusion rotein TAT-VP28 extracts.
According to the fermentation of the derivational expression method among the embodiment 6 1L recombination engineering bacteria Escherichia coli BL21 (pET-28a-TAT-VP28),, collect and the weighing wet thallus in the centrifugal 20min of room temperature 4000rpm.Getting the 1g wet thallus joins 30ml lysis buffer (500mM NaCl is dissolved in 400ml ddH for 10mM imidazoles, 20mM Tris-HCl
2O adjusts PH to 7.9, adds ddH at last
2O is settled to 500ml), in-20 ℃ of multigelations three times, carrying out ultrasonication (4 ℃ were worked intermittently 4 seconds 4 seconds), it is limpid to treat that bacterium liquid is crushed to.In 4 ℃, centrifugal 20 minutes of 10000rmp collects bacterial sediment and supernatant liquor respectively with the bacterium liquid after the fragmentation.
(2) Ni-NTA Superflow post affinity chromatography purified fusion protein TAT-VP28.
1. (the millipore filtration size: Φ 25mm, the aperture: 0.45ul) filter, join then in the good pillar of balance, with the speed of peristaltic pump with 1ml/min, sample is gone up in 4 ℃ of three circulations, makes the His of fusion rotein front end with filter with above-mentioned 30ml supernatant liquor
6With Ni
2+Fully combination.Collect effluent liquid, i.e. leakage liquid.(following institute all carries out under 4 ℃ in steps)
2. wash post with 50ml lysis Buffer with the speed of 1ml/min, with in the wash-out lower prop not with Ni
2+Bonded albumen.
3. (500mM NaCl is dissolved in 400ml ddH for 20mM imidazoles, 20mM Tris-HCl to contain the Wash Buffer of 20mM imidazoles with 50ml
2O adjusts PH to 7.9, adds ddH at last
2O is settled to 500ml) wash post with the speed of 1ml/min, with Ni under the wash-out
2+Non-target protein on the post.
4. (500mM NaCl is dissolved in 400ml ddH for 250mM imidazoles, 20mM Tris-HCl to use Elute Buffer
2O adjusts PH to 7.9, adds ddH at last
2O is settled to 500ml) wash post with the speed of 1ml/4min, collect target protein TAT-VP28.An Eppendorf pipe 1ml collects 10 pipes.
5. it is that 12%SDS-PAGE detects purification effect that the albumen that gets collection carries out acrylamide concentration.
(3) the fusion rotein TAT-VP28 behind the ultrafiltration and concentration purifying and replace Elute Buffer.
1. the albumen behind the purifying is transferred in the ultrafiltration pipe (molecular weight cut-off is 10KD) with liquid-transfering gun, 4 ℃, centrifugal 20 minutes of 4700g discards the waste liquid in the collection tube.
2. add PBS (8gNaCl, 0.2gKCl, 1.44gK
2HPO
4, 0.24gKH
2PO
4, HCl adjust pH to 7.4 adds water and is settled to 1000ml, and is standby after 15 pounds of 20min sterilising treatment) and to scale marks, 4 ℃, centrifugal 20 minutes of 4700g discards the waste liquid in the collection tube.Repeat time step 3 time.
3. do not add PBS, 4 ℃, centrifugal 20 minutes of 4700g discards the waste liquid in the collection tube, collects sample carefully with the liquid-transfering gun of 200ul.
Embodiment 8:ELISA detects the proteic intestinal function of wearing of TAT-VP28.
(1) enzyme-linked immunosorbent assay (ELISA) related solution:
Colour developing liquid:
Take by weighing the 0.47g citric acid, 0.92g Na
2HPO
4-12H
2O is settled to 100ml, promptly is mixed with substrate buffer solution.Facing the time spent adds 40mg O-Phenylene Diamine, 0.1ml H in substrate buffer solution
2O
2, mixing gets final product.
The H of stop buffer: 2mol/L
2SO
4
The PBS damping fluid:
Take by weighing 8.5g NaCl, 2.85g Na respectively
2HPO
4-12H
2O, 0.2g KCl, 0.27g KH
2PO
4, add deionized water and be settled to 1000ml.
The PBST damping fluid:
In 1000ml PBS damping fluid, add the 0.5-2ml tween 20.
5% (mass volume ratio) BSA:
Take by weighing 0.5g BSA, be dissolved in the 10ml PBST damping fluid.
(2) experiment material:
Experiment,, is raised after buying back in this laboratory about body weight 15-20g available from aquatic products market, Wuhan City with the former huge legendary turtle shrimp of Ke Shi (Cambarus clarkii), about 26 ℃ of raising temperatures, and every day, feeding changed water once simultaneously.The new huge legendary turtle shrimp of buying is fed at least in the laboratory and treated that the in stable condition rear of huge legendary turtle shrimp can be used for experiment in 15 days.
(3) the sero-fast purifying of VP28:
The proteic antiserum(antisera) of the anti-VP28 of rabbit is by this prepared in laboratory, and is stored in-70 ℃.The Protein A that utilizes Invitrogen company is as affinity chromatography medium purifying VP28 antiserum(antisera), and concrete steps are as follows:
1. get the 1ml antiserum(antisera) and be diluted to 10ml with the Binding Buffer of Protein A affinity chromatography special use, in refrigerated centrifuge 4 ℃, 10, the centrifugal 10min of 000rpm.
2. get supernatant, and with 0.4 μ m membrane filtration, in order to last sample.
3. draw Protein A Sepharose with pipettor
TMThe CL-4B filler is packed chromatography column into to 1ml, with a large amount of deionized water rinsing fillers, and with Binding Buffer balance.
4. will filter good sample and slowly flow through the good filler of balance with certain flow velocity, and leakage liquid will be repeated twice in sample by constant flow pump.
5. sample flows through filler with an amount of Binding Buffer with certain flow velocity with after filler fully combines, and effluent liquid detects OD with the protein nucleic acid detector
280, treat that the OD value is continuously at 0 o'clock and promptly stops washing.
6. Elution Buffer crosses filler wash-out IgGs with velocity flow slowly, and elutriant is collected in respectively in the eppendorf pipe.In order to keep the antibody activity of IgGs preferably, in every pipe elutriant, add 100 μ L Neutralizing Buffer and mixings immediately.
4. the IgGs of SDS-PAGE electrophoretic analysis purifying measures the protein concentration of IgGs.
(4) preparation of anticoagulation lymph:
With purifying and measured the TAT-VP28 of concentration and the VP28 huge legendary turtle shrimp of throwing something and feeding respectively, every huge legendary turtle shrimp 200 μ L protein solutions of throwing something and feeding.The huge legendary turtle shrimp of PBS damping fluid will only throw something and feed simultaneously as negative control.1.5h hemolymph 200 μ L are got with the 1ml disposable sterilized injector in the back in the pericardial sac of huge legendary turtle shrimp, and adding contains in the eppendorf pipe of equal-volume antithrombotics immediately, in case the hemostasis lymph solidifies.With hemolymph in whizzer behind the centrifugal 5min of 300g, draw supernatant liquor and be used for ELISA and detect.
Huge legendary turtle shrimp hemolymph antithrombotics (27mmol/L citric acid, 336mmol/LNaCl, 115mmol/L glucose-H
2O, 9mmol/L EDTA): take by weighing 7.74g citric acid, 19.65g NaCl, 22.77g glucose-H respectively
2O, 3.35g EDTA-Na
2, add appropriate amount of deionized water it is dissolved fully, and add NaOH accent pH to 7.0, add deionized water at last and be settled to 1000ml.
(5) double-antibody sandwich elisa detects antigen:
1. the VP28 antibody with purifying dilutes 100 times in the PBS damping fluid, and every hole adds 100 μ L in 96 hole enzyme plates.The aperture of enzyme plate is sealed and is placed on incubation 2h in 37 ℃ of constant incubators with sealing film, make antibody sandwich in the enzyme plate bottom.
2. discard the sample in the enzyme plate aperture,, seal and be placed in the refrigerator 4 ℃ of sealings and spend the night with sealing film in every aerial 100 μ L 5% (mass volume ratio) BSA that add.
3. dry the confining liquid in the enzyme plate aperture, in every hole, add 300 μ L PBST damping fluids, soak 5min, and the intermittent control shaking enzyme plate makes washing more abundant.This step 3 of repetitive operation is inferior.
4. draw anticoagulation lymph 100 μ L respectively and add in the enzyme plate aperture, do not add the enzyme plate aperture of anticoagulation lymph as blank only to add the PBS damping fluid simultaneously.The aperture of enzyme plate is sealed and is placed on incubation 1h in 37 ℃ of constant incubators with sealing film, the antigen in the hemolymph is fully combined with antibody in being coated on enzyme plate.
5. repeating step is (3) three times.
6. the VP28 antibody with horseradish peroxidase (HRP) mark dilutes 200 times in the PBST damping fluid, and every hole adds 100 μ L in the enzyme plate aperture.Seal and be placed on incubation 1h in 37 ℃ of constant incubators with sealing film, the VP28 antibody of HRP mark is fully combined with antigen.
7. repeating step is (3) three times.
8. in the enzyme plate aperture, add 300 μ L PBS damping fluids in every hole, soak 5min, and the intermittent control shaking enzyme plate makes washing more abundant.
9. every hole adds 100 μ L colour developing liquid in the enzyme plate aperture, seals back lucifuge colour developing 20min in 37 ℃ of constant incubators with sealing film.
10. every hole adds 50 μ L stop buffers in the enzyme plate aperture, the color development stopping reaction.And under the 490nm wavelength, measure the absorbance value in each hole with microplate reader.Data see the following form:
Table one: double-antibody sandwich elisa detects antigen VP28 experimental data
| PBS organizes (OD 490) | VP28 organizes (OD 490) | TAT-VP28 organizes (OD 490) | |
| Parallel group one | 0.043 | 0.045 | 0.124 |
| Parallel group two | 0.042 | 0.042 | 0.127 |
| Parallel group three | 0.040 | 0.039 | 0.132 |
[0155]
Embodiment 8: the actual application of the anti-WSSV infection effect of genetic engineering fusion protein is:
(1) test sample and source:
VP28 and TAT-VP28 fusion rotein subunit vaccine, Sheng Ke institute of Wuhan University virusology National Key Laboratory genetically engineered drug and the development of insect viruses Molecular Biology Research Lab provide.VP28 and TAT-VP28 fusion rotein subunit vaccine preparation method are as follows: engineering strain e. coli bl21 (DE involved in the present invention
3) the engineering strain e. coli bl21 (DE that preserves of pET-28a-TAT-VP28 and laboratory
3) pET-28a-VP28 is through fermentation, centrifugal 20 minutes of fermented liquid 4000rpm, supernatant discarded is collected wet thallus.Take by weighing wet thallus 5g, use 20mL, the resuspended thalline of the PBS of 5mM PH7.4,-20 ℃ of multigelations three times, in Ultrasonic Cell Disruptor, the ice bath fragmentation, supernatant (mixing according to 1mL bacterium liquid and 5g feed) is adsorbed with commercial feed in broken back, adds an amount of 3-4g adhesive agent (Rhizoma amorphophalli powder) mixing again, and is standby.
WSSV suspension, Sheng Ke institute of Wuhan University virusology National Key Laboratory genetically engineered drug and the preparation of insect viruses Molecular Biology Research Lab provide.WSSV suspension preparation method is as follows: collect the crayfish head soft tissue that WSSV infects, add aseptic TN buffer (20mM Tris-HCl; 0.4M NaCl, pH 7.4) to mill, the sample of milling is in 4 ℃ of centrifugal 10min of 6500g, and the supernatant repeated centrifugation is once.Last centrifugal gained supernatant is crossed 0.45 μ m filter membrane, the filtered solution packing be stored in-80 ℃ standby.Viral extracting solution is diluted after 200,300,400,500,600 times with 200 μ l/ dosage only successively in the 3rd uromere infectable infection crayfish, reach highly diluted multiple 90% or more as testing injection concentration with mortality ratio in 10 days.
(2) test conditions:
Healthy huge legendary turtle shrimp (body weight 15g-20g) is bought in aquatic products market,, every box is thrown in 10 tails (75 * 50 * 20), and is indoor foster temporarily, uses in order to test.Average 25 °-26 ℃ of duration of test water temperature.
(3) test design, investigation and statistics:
Test is provided with negative control, positive control, and VP28 and TAT-VP28 fusion rotein subunit vaccine be totally 4 groups of processing, handles for every group and establish three repetitions.Each is handled the breed box and sticks respective labels, and specific implementation method is as follows:
First group (negative control): the normal shrimp feed of feeding, divide two meal feedings every day.Every box common feeding 4g feed every day.
Second group (positive control): the normal shrimp feed of feeding, divide two meal feedings every day.Every box common feeding 4g feed every day.Two week back direct injection WSSV viruses.(trial test that the WSSV injection is infected is so that determine the infectivity and the virus concentration of WSSV suspension, down together).
The 3rd group: twice above-mentioned bag of feeding every day is by the feed of VP28 fusion rotein subunit vaccine, and every box is total to feeding 4g, direct injection WSSV viruses after two weeks every day.
The 4th group: twice above-mentioned bag of feeding every day is by the feed of TAT-VP28 fusion rotein subunit vaccine, and every box is total to feeding 4g, direct injection WSSV viruses after two weeks every day.
3. investigate and add up: each processing project of observed and recorded (and salvaging) is cultured the dead shrimp in the box sooner or later day by day, the dead number of statistics accumulative total.After experiment finished, statistics was respectively handled remaining shrimp alive in the box for breeding, calculates last survival rate.Protection efficient is seen shown in the accompanying drawing 5.
Table two: the protection effect of recombination fusion protein TAT-VP28 subunit vaccine
An experiment number＞80
SEQUENCE LISTING
＜110〉the triumphant peptide in Wuhan comes bio tech ltd
＜120〉anti-white spot syndrome virus (WSSV) engineered protein TAT-VP28 and preparation and purposes
＜130〉anti-white spot syndrome virus (WSSV) engineered protein TAT-VP28 and preparation and purposes
<160> 2
<170> PatentIn version 3.1
<210> 1
<211> 771
<212> DNA
＜213〉recombinant DNA
<220>
<221> VP28 gene
<222> (151)..(762)
<223>
<220>
<221> TAT
<222> (111)..(144)
<223>
<400> 1
atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60
atggctagca tgactggtgg acagcaaatg ggtcgcggat ccgaattcgg atatggacgt 120
aaaaaacgtc gtcagcgtcg tcgtggatcc atggatcttt ctttcactct ttcggtcgtg 180
tcggccatcc tcgccatcac tgctgtgatt gctgtattta ttgtgatttt taggtatcac 240
aacactgtga ccaagaccat cgaaacccac acagacaata tcgagacaaa catggatgaa 300
aacctccgca ttcctgtgac tgctgaggtt ggatcaggct acttcaagat gactgatgtg 360
tcctttgaca gcgacacctt gggcaaaatc aagatccgca atggaaagtc tgatgcacag 420
atgaaggaag aagatgcgga tcttgtcatc actcccgtgg agggccgagc actcgaagtg 480
actgtggggc agaatctcac ctttgaggga acattcaagg tgtggaacaa cacatcaaga 540
aagatcaaca tcactggtat gcagatggtg ccaaagatta acccatcaaa ggcctttgtc 600
ggtagctcca acacctcctc cttcaccccc gtctctattg atgaggatga agttggcacc 660
tttgtgtgtg gtaccacctt tggcgcacca attgcagcta ccgccggtgg aaatcttttc 720
gacatgtacg tgcacgtcac ctactctggc actgagaccg agtagctcga g 771
<210> 2
<211> 254
<212> PRT
＜213〉polypeptide
<220>
<221> TAT-VP28 PEPTIDE
<222> (1)..(254)
<223>
<220>
<221> VP28
<222> (51)..(254)
<223>
<220>
<221> TAT
<222> (37)..(48)
<223>
<400> 2
Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro
1 5 10 15
Arg Gly Ser His Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg
20 25 30
Gly Ser Glu Phe Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg
35 40 45
Gly Ser Met Asp Leu Ser Phe Thr Leu Ser Val Val Ser Ala Ile Leu
50 55 60
Ala Ile Thr Ala Val Ile Ala Val Phe Ile Val Ile Phe Arg Tyr His
65 70 75 80
Asn Thr Val Thr Lys Thr Ile Glu Thr His Thr Asp Asn Ile Glu Thr
85 90 95
Asn Met Asp Glu Asn Leu Arg Ile Pro Val Thr Ala Glu Val Gly Ser
100 105 110
Gly Tyr Phe Lys Met Thr Asp Val Ser Phe Asp Ser Asp Thr Leu Gly
115 120 125
Lys Ile Lys Ile Arg Asn Gly Lys Ser Asp Ala Gln Met Lys Glu Glu
130 135 140
Asp Ala Asp Leu Val Ile Thr Pro Val Glu Gly Arg Ala Leu Glu Val
145 150 155 160
Thr Val Gly Gln Asn Leu Thr Phe Glu Gly Thr Phe Lys Val Trp Asn
165 170 175
Asn Thr Ser Arg Lys Ile Asn Ile Thr Gly Met Gln Met Val Pro Lys
180 185 190
Ile Asn Pro Ser Lys Ala Phe Val Gly Ser Ser Asn Thr Ser Ser Phe
195 200 205
Thr Pro Val Ser Ile Asp Glu Asp Glu Val Gly Thr Phe Val Cys Gly
210 215 220
Thr Thr Phe Gly Ala Pro Ile Ala Ala Thr Ala Gly Gly Asn Leu Phe
225 230 235 240
Asp Met Tyr Val His Val Thr Tyr Ser Gly Thr Glu Thr Glu
245 250
Claims (5)
1. isolating genetic engineering fusion protein, its sequence is the nucleotide sequence shown in the SEQ ID NO:1.
2. isolating genetic engineering fusion protein, its sequence is the aminoacid sequence shown in the SEQ ID NO:2.
3. a bacillus coli gene engineering strain is characterized in that, this bacterial strain is the reorganization engineering strain
Escherichia coliBL21(DE
3) pET-28a-TAT-VP28, CCTCC NO:M2010296.
4. the preparation method of the described a kind of bacillus coli gene engineering strain of claim 3 the steps include:
A, the preparation of the VP28 gene of WSSV: the gill of at first getting ill prawn on ice, stomach and heart, ice bath homogenate, add Proteinase K: 100ug/ml then, in boiling water, boiled 15 minutes, ice bath is 5 minutes immediately, centrifugal 10 minutes of 12000rpm, get supernatant and put 4 ℃ of preservations, design PCR primer, with supernatant as template DNA, pcr amplification goal gene VP28, the PCR product is by the dna gel electrophoresis detection, reclaim the PCR product and it is cloned in the pGEM-T carrier, transformed into escherichia coli JM109, picking list bacterium colony carry out enzyme with the alkaline lysis method of extracting plasmid and cut evaluation, and check order, positive colony that obtains is the intestinal bacteria that comprise the VP28 gene, is pGEM-T-VP28, is used for the propagation and the preservation of gene;
The preparation of TAT-VP28 fusion gene: by the method amplification protein transduction structural domain peptide T AT of PCR, and with the VP28 gene fusion, with the PCR product cloning in the pGEM-T carrier, transformed into escherichia coli JM109, picking list bacterium colony carries out enzyme with the alkaline lysis method of extracting plasmid and cuts evaluation, and checks order, and positive colony that obtains is the intestinal bacteria that comprise the TAT-VP28 gene, be pGEM-T-TAT-VP28, be used for the propagation and the preservation of gene;
The structure of C, integrative gene expression vector: at first double digestion recombinant plasmid pGEM-T-TAT-VP28 and plasmid pET-28a(+), glue reclaims fragment and the open loop pET-28a(+ that contains the TAT-VP28 gene) fragment, be transformed into competence after 16 ℃ of connections
E.coliAmong the JM109, resulting positive colony is the intestinal bacteria of the TAT-VP28 fusion gene that the present invention relates to, called after pET-28a(+)-TAT-VP28;
The preparation of D, bacillus coli gene engineering bacteria: with plasmid pET-28a(+)-TAT-VP28 is transformed into competence BL21(DE3) in, the PCR evaluation and screening goes out positive transformant, and the gained positive colony is the bacillus coli gene engineering strain of expressing TAT-VP28;
The preparation of E, genetic engineering fusion protein: above-mentioned activatory genetic engineering bacterium is transferred in the lactose automatic induction culture medium ferments, fusion rotein TAT-VP28 expresses.
5. claim 1 or the 2 described a kind of genetic engineering fusion proteins application in the medicine of preparation treatment or prevention white spot syndrome virus (WSSV).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010572930 CN102206660B (en) | 2010-12-03 | 2010-12-03 | Engineered protein TAT-VP28 against white spot syndrome virus of shrimp and its preparation and purpose |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010572930 CN102206660B (en) | 2010-12-03 | 2010-12-03 | Engineered protein TAT-VP28 against white spot syndrome virus of shrimp and its preparation and purpose |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102206660A true CN102206660A (en) | 2011-10-05 |
| CN102206660B CN102206660B (en) | 2013-07-31 |
Family
ID=44695722
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010572930 Active CN102206660B (en) | 2010-12-03 | 2010-12-03 | Engineered protein TAT-VP28 against white spot syndrome virus of shrimp and its preparation and purpose |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102206660B (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102766645A (en) * | 2012-06-08 | 2012-11-07 | 武汉凯肽来生物科技有限公司 | Oral recombinant protein TAT-GH for promoting ricefield eel growth, and preparation method and application thereof |
| CN102899342A (en) * | 2012-06-08 | 2013-01-30 | 武汉凯肽来生物科技有限公司 | Silurus asotus growth hormone (saGH)-cell penetrating peptide trans-activating transcriptional activator (TAT) fusion protein and its preparation method and use |
| CN103789333A (en) * | 2014-03-05 | 2014-05-14 | 湖北肽洋红生物工程有限公司 | Orally-taken recombined fusion protein TAT-MAP30, preparation method and applications |
| CN104356210A (en) * | 2014-10-24 | 2015-02-18 | 中国水产科学研究院黄海水产研究所 | High-efficiency expression and application of VP28 protein fragment having binding activity with litopenaeus vannamei protein molecule Rab7 |
| CN104744595A (en) * | 2015-04-23 | 2015-07-01 | 湖北肽洋红生物工程有限公司 | Grass carp haemorrhagic virus resisting engineered protein TAT (Trans-activating Transcriptional Activator)-VP7-TAT as well as preparation method and application thereof |
| CN109879971A (en) * | 2019-04-03 | 2019-06-14 | 天津师范大学 | A kind of the TAT-CP recombinant protein and purposes of anti-β Nodavirus |
| CN111018955A (en) * | 2020-01-06 | 2020-04-17 | 济南大学 | Polypeptide for inhibiting viral genome RNA replication |
| CN113121645A (en) * | 2021-04-25 | 2021-07-16 | 中国水产科学研究院黄海水产研究所 | Prawn PcRab7 protein and WSSV envelope protein VP28 interaction blocker polypeptide |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6485937B1 (en) * | 1999-10-15 | 2002-11-26 | The Rockefeller University | System for rapid generation of recombinant baculovirus-based expression vectors for silkworm larvae |
| CN101280021A (en) * | 2008-05-20 | 2008-10-08 | 广西天池海洋生物药业有限公司 | Engineered protein against shrimp white spot syndrome virus, preparation and use thereof |
-
2010
- 2010-12-03 CN CN 201010572930 patent/CN102206660B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6485937B1 (en) * | 1999-10-15 | 2002-11-26 | The Rockefeller University | System for rapid generation of recombinant baculovirus-based expression vectors for silkworm larvae |
| CN101280021A (en) * | 2008-05-20 | 2008-10-08 | 广西天池海洋生物药业有限公司 | Engineered protein against shrimp white spot syndrome virus, preparation and use thereof |
Non-Patent Citations (3)
| Title |
|---|
| 《Acta Oceanologica Sinica》 20071231 ZHU Yanbing，YANG Feng Construction of white spot syndrome virus(WSSV) whole genome phage display library 75-83 1-5 第26卷, 第2期 * |
| 《Vaccine》 20091231 P. Krishnan et al DNA constructs expressing long-hairpin RNA (lhRNA) protect Penaeus monodon against White Spot Syndrome Virus 3849-3855 1-5 第27卷, * |
| 《水利渔业》 20080131 薛宇醒等 罗氏沼虾白斑综合症病毒WSSV ORF147片段的克隆、表达与序列分析 105-108 1-5 第28卷, 第1期 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102766645A (en) * | 2012-06-08 | 2012-11-07 | 武汉凯肽来生物科技有限公司 | Oral recombinant protein TAT-GH for promoting ricefield eel growth, and preparation method and application thereof |
| CN102899342A (en) * | 2012-06-08 | 2013-01-30 | 武汉凯肽来生物科技有限公司 | Silurus asotus growth hormone (saGH)-cell penetrating peptide trans-activating transcriptional activator (TAT) fusion protein and its preparation method and use |
| CN102766645B (en) * | 2012-06-08 | 2013-06-05 | 武汉凯肽来生物科技有限公司 | Oral recombinant protein TAT-GH for promoting ricefield eel growth, and preparation method and application thereof |
| CN102899342B (en) * | 2012-06-08 | 2014-01-01 | 武汉凯肽来生物科技有限公司 | Silurus asotus growth hormone (saGH)-cell penetrating peptide trans-activating transcriptional activator (TAT) fusion protein and its preparation method and use |
| CN103789333A (en) * | 2014-03-05 | 2014-05-14 | 湖北肽洋红生物工程有限公司 | Orally-taken recombined fusion protein TAT-MAP30, preparation method and applications |
| CN103789333B (en) * | 2014-03-05 | 2016-02-24 | 湖北肽洋红生物工程有限公司 | A kind of oral recombination fusion protein TAT-MAP30 and preparation method and application |
| CN104356210A (en) * | 2014-10-24 | 2015-02-18 | 中国水产科学研究院黄海水产研究所 | High-efficiency expression and application of VP28 protein fragment having binding activity with litopenaeus vannamei protein molecule Rab7 |
| CN104744595A (en) * | 2015-04-23 | 2015-07-01 | 湖北肽洋红生物工程有限公司 | Grass carp haemorrhagic virus resisting engineered protein TAT (Trans-activating Transcriptional Activator)-VP7-TAT as well as preparation method and application thereof |
| CN104744595B (en) * | 2015-04-23 | 2018-03-02 | 湖北肽洋红生物工程有限公司 | Anti- GCHV engineered protein TAT VP7 TAT and preparation method and application |
| CN109879971A (en) * | 2019-04-03 | 2019-06-14 | 天津师范大学 | A kind of the TAT-CP recombinant protein and purposes of anti-β Nodavirus |
| CN111018955A (en) * | 2020-01-06 | 2020-04-17 | 济南大学 | Polypeptide for inhibiting viral genome RNA replication |
| CN113121645A (en) * | 2021-04-25 | 2021-07-16 | 中国水产科学研究院黄海水产研究所 | Prawn PcRab7 protein and WSSV envelope protein VP28 interaction blocker polypeptide |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102206660B (en) | 2013-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102206660B (en) | Engineered protein TAT-VP28 against white spot syndrome virus of shrimp and its preparation and purpose | |
| AU659867B2 (en) | Improved expression of influenza A M2 protein in baculovirus and uses of M2 protein | |
| Li et al. | Characterization of a chitin-binding protein GP37 of Spodoptera litura multicapsid nucleopolyhedrovirus | |
| CN102703483B (en) | Recombinant oral protein TAT-GH of tilapia, preparation method for recombinant oral protein TAT-GH and application of recombinant oral protein TAT-GH | |
| CN102250255A (en) | Genetic engineering protein TAT-VP28-GH capable of resisting white spot syndrome virus (WSSV) as well as preparation and application thereof | |
| CN103184230B (en) | Fusion protein gene TAT-sVP7 and application thereof | |
| CN102181469A (en) | Recombinant spore for displaying human serum albumin on surface of bacillus subtilis and preparation method thereof | |
| CN102643835A (en) | Prokaryotic expression, polyclonal antibody preparation and applications of Chinese giant salamander iridovirus major capsid protein | |
| CN107884578A (en) | For echinococcosis antibody test card in Quantitative detection serum | |
| CN101280021B (en) | Engineered protein VP28-C against shrimp white spot syndrome virus, preparation and use thereof | |
| CN102492714A (en) | Method for preparing recombinant Chinese rural dog interferon-alpha | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN102766645B (en) | Oral recombinant protein TAT-GH for promoting ricefield eel growth, and preparation method and application thereof | |
| CN103789333B (en) | A kind of oral recombination fusion protein TAT-MAP30 and preparation method and application | |
| CN102174091B (en) | Truncated and expressed duck plague virus (DPV) recombinant envelope gI protein and preparation method and application thereof | |
| CN104744595B (en) | Anti- GCHV engineered protein TAT VP7 TAT and preparation method and application | |
| CN110845584A (en) | Hog cholera virus envelope protein oligomeric protein body and preparation method and application thereof | |
| CN113845579B (en) | Preparation method of immune lectin for improving killing efficiency of beauveria bassiana on cotton bollworms | |
| Chen et al. | Development and evaluation of nucleoprotein-based rapid detection test for Siniperca chuatsi rhabdovirus | |
| Chaivisuthangkura et al. | Development of a polyclonal antibody specific to VP19 envelope protein of white spot syndrome virus (WSSV) using a recombinant protein preparation | |
| CN101434958A (en) | Method for preparing porcine alpha-interferon | |
| CN110221077B (en) | Paralichthys rhabdovirus detection test paper and preparation method thereof | |
| Hukuhara et al. | A bacterially produced virus enhancing factor from an entomopoxvirus enhances nucleopolyhedrovirus infection in armyworm larvae | |
| CN103319590B (en) | Application of Chlamys farreri peptidoglycan recognition protein (CfPGRP-S1) | |
| CN107827986B (en) | Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: HUBEI TAIYANGHONG BIOLOGICAL ENGINEERING CO., LTD. Free format text: FORMER OWNER: WUHAN KAITAILAI BIOTECHNOLOGY CO.,LTD. Effective date: 20140312 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 430071 WUHAN, HUBEI PROVINCE TO: 436042 EZHOU, HUBEI PROVINCE |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20140312 Address after: 436042 No. 118 Liu Liu Avenue, Ezhou, Hubei Patentee after: HUBEI TAIYANGHONG BIOLOGICAL TECHNOLOGY CO., LTD. Address before: 430071, Wuhan, Hubei, Wuchang fruit lake road, No. 3, unit 22, room 2, room 4 Patentee before: Wuhan Kaitailai Biotechnology Co.,Ltd. |
|
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: Engineered protein TAT-VP28 against white spot syndrome virus of shrimp and its preparation and purpose Effective date of registration: 20161010 Granted publication date: 20130731 Pledgee: Ezhou City Tatsu Tatsu Asset Management Co., Ltd. Pledgor: HUBEI TAIYANGHONG BIOLOGICAL TECHNOLOGY CO., LTD. Registration number: 2016420000041 |
|
| PLDC | Enforcement, change and cancellation of contracts on pledge of patent right or utility model |