CN102154321B - Method for breeding stress-resistance transgenic rice - Google Patents

Abstract

The invention discloses a method for breeding stress-resistance transgenic rice. The method provided by the invention is to transfer the coding gene of arabidopsis thaliana homeobox-leucine zipper protein 17 (AtHB17) into a target plant to obtain the transgenic plants with improved stress resistance. Experiments prove that the drought tolerance of rice AtHB17 gene-transferred plant line is higher than a reverence plant line. Losing water through the transpiration of pore is a critical factor of drought tolerance, the pore density of the lower epidermis of the leaves of the AtHB17 gene-transferred plant line is reduced by 25 percent on average compared with that of the reference plant line, the great reduction in pore density reduces the rate of water loss of the plants from leaves under the action of transpiration, and thus, the water holding capacity of plants is improved greatly. Root growth condition is another critical factor of drought tolerance, the structure of the root of the AtHB17 gene-transferred plant line is also changed, namely the main root is elongated without obvious difference and the number of side roots is increased, so the root is more developed; and thus, when threatened by drought, the plants can absorb water from soil constantly.

Description

A kind of method of cultivating resistant transgenic rice

Technical field

The present invention relates to a kind of cultivation of resistant transgenic rice.

Background technology

Any discomfort environmental factors in the plant growth and development process all can be described as environment-stress, generally is divided into biology and coerces (as disease and pest) and abiotic stress.The latter comprises moisture (arid and damage caused by waterlogging), and temperature is saline and alkaline, illumination, and nutrition etc. are many-sided coerces.

The harm that environment-stress brings to agriculture production is global, abiotic stress, particularly the arid harm that causes weighs (Boyer JS.1982.Plant productivity and environment.Science 218:443-448) especially, can make crop production reduction 50% to 80%.Just because of this, a lot of scientists all with plant abiotic stress biology as research emphasis, in the hope of gene and the molecule mechanism of the anti-abiotic stress of accelerating discovery plant, for genetically engineered improvement farm crop resistance of reverse is seized the commanding elevation.

China is large agricultural country, and the harm that abiotic stress brings for China's agricultural is very serious, and wherein arid is the principal element of restriction China agricultural sustainability development with salting of soil.China can plough 50% of farmland and be subjected to drought impact, even in precipitation more Central China and South China, because the rainfall skewness, these regional paddy rice are the annual influence that all is subjected to arid in the critical period of flowering almost, directly influence output, when of a serious nature even No kernels or seeds are gathered, as in a year of scarcity.The rainfall amount in the most of area of northern China is on the low side, adds the salinization of heavy soil, has a strong impact on agriculture production.

The anti-contrary gene of research abiotic stress biology and separating clone is extremely important, global plant biological scholar has also done a large amount of work for this reason, and obtain a lot of new developments, especially utilizing high model plant Arabidopis thaliana to study aspect the salt tolerant molecule mechanism of plant, make the research in this field that breakthrough progress arranged.Number of patent application is that 200610171542.0 Chinese invention patent application discloses an Arabidopis thaliana transcription factor AtHB17, and it is relevant with salt tolerance and the drought tolerance of Arabidopis thaliana.

Summary of the invention

The purpose of this invention is to provide a kind of method of cultivating the resistant transgenic plant.

Method provided by the invention is that the encoding gene of AtHB17 is imported in the purpose plant, obtains the transgenic plant that resistance improves;

Described AtHB17 is following (a) or protein (b):

(a) protein of being formed by the amino acid residue sequence of sequence in the sequence table 2;

(b) with the amino acid residue sequence of sequence in the sequence table 2 through replacement and/or disappearance and/or the interpolation of one or several amino-acid residue and have the protein of being derived by (a) with (a) identical activity.

Wherein, the sequence in the sequence table 2 is made up of 275 amino-acid residues.

In order to make AtHB17 in (a) be secreted in cell pericentral siphon or the substratum or to make its function-stable, N end that can the protein that the amino acid residue sequence of sequence 2 is formed in by sequence table connects signal peptide sequence, for the AtHB17 in (a) is convenient to purifying, N end or C end that can the protein that the amino acid residue sequence of sequence 2 is formed in by sequence table connect label as shown in table 1.

The sequence of table 1. label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	11	EQKLISEEDL

Above-mentioned (b) but in the AtHB17 synthetic, also can synthesize its encoding gene earlier, carry out biology according to following method again and express and to obtain.The encoding gene of AtHB17 in above-mentioned (b) can be by the codon with one or several amino-acid residue of disappearance in the dna sequence dna of sequence in the sequence table 1, and/or carry out the missense mutation of one or several base pair, and/or at the encoding sequence of its 5 ' end attach signal peptide, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

The encoding sequence of the encoding gene of above-mentioned AtHB17 specifically can be the sequence 1 in the sequence table.

The encoding gene of above-mentioned AtHB17 imports in the described purpose plant by the recombinant expression vector that contains this gene.Described expression vector can be existing any plant expression vector.The promotor that starts transcription of foreign genes in the described plant expression vector is preferably cauliflower mosaic virus (CaMV) 35S promoter or figwort mosaic virus (FMV) 35S promoter or rice actin gene (Actin1) promotor.

Described recombinant expression vector specifically can be the recombinant vectors that obtains between the attR1 of the encoding gene insertion plant expression vector pCB2004 of described AtHB17 or pCB2006 and the attR2.

Above-mentioned plant expression vector pCB2004 obtains the postdigestive 35S promoter of DraIII with being connected with the carrier pCB2003 after the DraIII linearizing; Described carrier pCB2003 makes up the multiple clone site that fragment shown in the sequence in the sequence table 5 is inserted into pCB2002 to form;

Described pCB2002 inserts a slice section to obtain between the multiple clone site of pCAMBIA3301, described fragment is the double chain DNA fragment that the strand polynucleotide shown in the sequence 4 is annealed in the strand polynucleotide shown in the sequence 3 and the sequence table in the sequence table.

Above-mentioned plant expression vector pCB2006 obtains the postdigestive Actin1 promotor of DraIII with being connected with the above-mentioned carrier pCB2003 after the DraIII linearizing.

Described AtHB17 gene can be building up in the existing plant expression vector with existing method, can add any promotor that comprises constitutive promoter, strengthens promotor, inducible promoter, tissue-specific promoter, etap specificity promoter before its transcription initiation Nucleotide.For the ease of identifying and screen changeing described AtHB17 gene plant cell or plant, can process employed carrier, as the antibiotic marker thing (gentamicin, kantlex etc.) that adds the alternative mark (Bar gene, gus gene, luciferase genes etc.) of plant or have resistance.Carry that described AtHB17 expression carrier can Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, conventional biological method rice transformation cell or tissue such as agriculture bacillus mediated by using, and the paddy rice that transforms become plant through tissue cultivating, obtain the rice plant that resistance improves.

Further, above-mentioned resistant transgenic plant can be the drought resistance transgenic plant.

Say that further the stomatal frequency of above-mentioned drought resistance transgenic plant is lower than described purpose plant, pore size, root length and/or radical are greater than described purpose plant.

Above-mentioned plant is dicotyledons or monocotyledons, is preferably paddy rice.

The drought tolerance that experiment showed, paddy rice commentaries on classics AtHB17 gene strain system (transformant) is higher than contrast (not transgenic paddy rice) strain system.It is an important determinative of arid tolerance that transpiration by pore dries out, the strain of commentaries on classics AtHB17 gene is that the stomatal frequency of blade lower epidermis is compared with contrast, on average reduced by 25%, the reduction significantly of stomatal frequency, make plant reduce from the efficient that blade dries out by transpiration, this can improve plant greatly to the hold facility of moisture.The growing state of root system is another important determinative of arid tolerance, the strain of commentaries on classics AtHB17 gene is that variation has taken place the configuration of root equally: main root is elongated but difference is not remarkable, the lateral root number increases, the root system that mutant is described is more flourishing, and plant can continually be absorbed water from soil when being subjected to drought stress.

Description of drawings

Fig. 1 induces and the plant regeneration photo for the EMBRYO IN RICE callus, and last row is followed successively by picture a, b, c, d from left to right; Following row is followed successively by picture e, f, g, h, i from left to right.

Fig. 2 is transformant and contrast PCR result.

Fig. 3 is transformant and contrast Southern blot collection of illustrative plates.

Fig. 4 is the RT-PCR result of transformant and contrast.

Fig. 5 is transformant and contrast drought stress and rehydration photo.

Fig. 5 a is transformant and 6 days survival rate statistics of contrast 10 days rehydrations of drought stress.

Fig. 6 is that 15% PEG4000 coerces the photo that seedling recovered after 6 days 12 days again.

Fig. 6 a is that 15% PEG4000 coerces the survival rate statistics that seedling recovered after 6 days 12 days again.

Fig. 7 is that transformant and contrast stomatal frequency compare photo.

Fig. 7 a is transformant and contrast stomatal frequency statistics.

Fig. 7 b is transformant and contrast pore opening statistics.

Fig. 8 is that transformant and contrast root system compare photo.

Fig. 8 a is the statistics of transformant and contrast radical.

Fig. 8 b is transformant and the long statistics of contrast root.

Fig. 8 c is the statistics of transformant and contrast plant height.

Fig. 9 a is that the NcoI of pCB2004/AtHB17 and the enzyme of EcoRI are cut the evaluation collection of illustrative plates.

Fig. 9 b is that the EcoRI enzyme of pCB2006/AtHB17 is cut the evaluation collection of illustrative plates.

Figure 10 is that the bacterium colony PCR of agrobacterium tumefaciens (Agrobacterium tumefaciens) bacterial strain EHA105/pCB2004/AtHB17 and agrobacterium tumefaciens (Agrobacterium tumefaciens) bacterial strain EHA105/pCB2006/AtHB17 identifies collection of illustrative plates.

Embodiment

Experimental technique among the following embodiment if no special instructions, is ordinary method.

Percentage composition among the following embodiment if no special instructions, is the quality percentage composition.

The cultivation of embodiment 1, commentaries on classics AtHB17 transgenic paddy rice

One, the structure of transgene expression vector

1, the acquisition of AtHB17cDNA gene

Utilize SuperScript ^TMIII Reverse Transcriptase test kit (Invitrogen company, Ca t.No.18080-093) the RT-PCR amplification obtains the cDNA gene that nucleotide sequence is the AtHB17 of sequence 1 in the sequence table from the environmental Arabidopis thaliana of Columbia (Arabidopis thaliana Biological resources center Arabidopsis Bio logical Resource Center (ABRC)), detailed process is as follows: Trizol reagent (INVITROG EN) is adopted in the extracting of total amount RNA, use 1 microgram total amount RNA as the template of reverse transcription reaction, d (T) ₂₅As the primer of reverse transcription, each reverse transcription reaction uses the SUPERSCRIPT II ThermoScript II (INVITROGEN) of 200 units and carries out according to the ThermoScript II product manual.RT-PCR the primer sequence is according to the sequences Design of AtHB17 gene, its upstream primer: 5 '-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGATAAAACTACTATTTACGTACA-3 ' and downstream primer: 5 '-GGGGACCACTTTGTACAAGAAAGCTGGGTATCAACGATCACGCTCTTGCG-3 ', the pcr amplification system is for being total to 50uL, wherein, ExTaq polysaccharase (available from precious biotechnology (Dalian) company limited (Dalian TaKaRa company)) 0.25uL, cDNA template 2uL (0.2ug), 10 * PCR damping fluid 5uL, dNTPs 100uM, on, each 25uM of downstream primer is supplemented to 50uL with distilled water with reaction system again.The PCR response procedures is: 95 ℃ of 1min, 58 ℃ of 1min, 72 ℃ of 1min, totally 40 circulations.After reaction finishes, pcr amplification product is carried out agarose electrophoresis to be separated, reclaim and be cloned on the pMD 18-T Vector carrier, carry out sequencing analysis, sequencing result shows, this pcr amplification product has the nucleotide sequence of sequence 1 in the sequence table, is the cDNA gene of AtHB17, the albumen shown in the codified sequence 2.

2, the structure of transgene expression vector pCB2004/AtHB17 and pCB2006/AtHB17

(1) structure of pCB2004

PCB2004 makes up as follows: pCAMBIA3301 (CAMBIA) is digested with BstXI and SmaI, between the BstXI of pCAMBIA3301 and SmaI recognition site, insert by the BstXI of series connection successively, SstI, DraIII (a), AscI AvrII, SwaI, DraIII (b), multiple clone site fragment with the SmaI recognition sequence is formed obtains recombinant vectors pCB2002.Wherein above-mentioned multiple clone site fragment is following two synthetic polynucleotides: 5 ' AGCTCACGGGGTGGCGCGCCTAGGATTTAAATCACAAAGTGCCC3 ' (sequence 3 in the sequence table) and 5 ' GGGCACTTTGTGATTTAAATCCTAGGCGCGCCACCCCGTGAGCTCATG3 ' (sequence 4 in the sequence table) obtained 66 ℃ of annealing in 60 seconds.

Conversion A (sequence 5 in the sequence table) in the Gateway Conversion A test kit (Invitrogen, Gateway vector Conversion sy stem Cat.No.11828-019) is just obtained carrier is carrier pCB2003 by flat terminal the connection between the SmaI that is inserted into pCB2002 and the PmlI recognition site.

Be template with pCAMBIA3301 (CAMBIA), with primer 5 ' GGG CACGGGGTGGATTAGCCTTTTCAATTTCAGAAA3 ' and 5 ' GGG CACTTTGTGATTGTAAATAGTAATTGT3 ' pcr amplification tobacco mosaic virus (TMV) (Ca MV) 35S promoter, with tobacco mosaic virus (TMV) (CaMV) the 35S promoter PCR product that obtains with DraIII digestion after, directly be connected with the pCB2003 after the DraIII linearizing, obtain plasmid pCB2004.

(2) structure of pCB2006

Genomic dna with paddy rice is template, use PCR primer 5 '-GGGCACGGGGTGTAGCTAGCATACTCGAGGTCA-3 ' and 5 '-GGGCACGTTTTG AGTAGATATCCTCGGCGTCAG-3 ', pcr amplification paddy rice Actin 1 promotor, the PCR product after DraIII digestion, with the linearizing pCB2003 of DraIII at T ₄Cyclisation obtains pCB2006 under the effect of dna ligase.

(3) structure of pCB2004/AtHB17 and pCB2006/AtHB17

The cDNA gene of the AtHB17 gene that obtains in the step 1 is utilized Gateway ^RBP Clonase ^TM(Invitrogen Cat.No.11789-020) passes through Gateway to II EnzymeMix test kit ^TMCloning Technology recombinant clone obtains containing recombinant expression vector pCB2004/HB17 or the pCB2006/HB17 of AtHB17 gene between the attR1 and attR2 of pCB2004 or pCB2006.

Utilizing NcoI and EcoRI double digestion pCB2004/AtHB17 to carry out structure identifies, the result is shown in Fig. 9 a, and NcoI and EcoRI double digestion pCB2004/AtHB17 obtain size and be the NcoI of the pCB2004/AtHB17 of 1020bp (comprising 605bp 35S omega promotor part and 415bp AtHB17 cDNA 5 ' end) fragment and 9009bp and the carrier framework part between the EcoRI site; The cDNA gene that the AtHB17 gene is described has been inserted between the attR1 and attR2 of pCB2004.Utilizing EcoRI single endonuclease digestion pCB2006/AtHB17, EcoRI single endonuclease digestion pCB2006/AtHB17 to carry out structure identifies, the result is shown in Fig. 9 b, and EcoRI single endonuclease digestion pCB2006/AtHB17 obtains size and is the fragment (carrier framework part between two EcoRI sites of pCB2006/AtHB17) of the fragment of 1294bp (comprising the Actin 1 promotor part of 914bp and the AtHB17 cDNA 5 ' end of 380bp) fragment and 9093bp; The cDNA gene that the AtHB17 gene is described has been inserted between the attR1 and attR2 of pCB2006.

Among Fig. 9 a, swimming lane 1,2,3,4 is the result of NcoI and EcoRI double digestion pCB2004/AtHB17, and M is Fermentas DNA ladder (250bp-10K); Among Fig. 9 b, swimming lane 2,3,6 is the result of EcoRI single endonuclease digestion pCB2006/AtHB17, and M is Fermentas DNA ladder (250bp-10K).

Two, agriculture bacillus mediated genetic transformation

1, contains the preparation of agrobacterium tumefaciens (Agrobacterium tumefaciens) bacterial strain of pCB2004/AtHB17 or pCB2006/AtHB17

Agrobacterium tumefaciens (Agrobacterium tumefaciens) the bacterial strain EHA105 of-70 ℃ of preservations is coated on 28 ℃ of cultivation activation of LB (containing gentamicin 50ug/ml).Get 4-5 single colony inoculation then in 3mlLB liquid nutrient medium (containing gentamicin 50ug/ml) incubated overnight.The bacterium liquid of incubated overnight is inoculated in the LB liquid nutrient medium (containing gentamicin 50ug/ml) of 500ml by 1: 100 volume ratio, and 250rpm, is cultured to about 0D600=1.0 by 28 ℃.The centrifugal collection thalline of 5000rpm uses isopyknic aseptic deionized water of precooling resuspended then, repeats seven times, and thalline is resuspended in 10% glycerine of 0.5ml the most at last.(agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 competent cell is according to English process plate " Arabidopis thaliana laboratory manual " the .Detlef Weigel and Jane Glazebrook. .2004 of Chemical Industry Press March the 1st edition with 50ul agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 competent cell respectively to get the pCB2004/AtHB17 of 10ng or pCB2006/AtHB17 plasmid, the preparation of the 1st method of printing) mix after, join in the pole cup of precooling (0.2mm, Biorad company).(the electric shock program that the instrument of buying carries, on the specification sheets of instrument, specification sheets is: MicroPulser to use Agr electric shock program ^TMElectroporation Apparatus Operation Instruction and Applications Guide, Catalog Number 165-2100).The electric shock back added the recovery of SOC substratum after 4 hours, and coating contains the LB substratum of gentamicin 50ug/ml and kantlex 50ug/ml, 28 ℃, cultivates two days.

The fragment (primer sequence is 5 '-GCA ACA TGA GAG AGC AGA TAA TA-3 ' and 5 '-TCA AGA AGC AAA TCT TTC ACA CAT T-3 ') of getting in single bacterium colony amplification AtHB17 gene is carried out bacterium colony PCR checking.It is the bacterial strain that contains pCB2004/AtHB17 that PCR obtains agrobacterium tumefaciens (Agrobacterium tumefaciens) the bacterial strain EHA105 that the pCB2004/AtHB17 of the AtHB17 gene fragment band of 1091bp transforms, called after agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105/pCB2004/AtHB17, it is the bacterial strain that contains pCB2006/AtH B17 that PCR obtains agrobacterium tumefaciens (Agrobacterium tumefaciens) the bacterial strain EHA105 that the pCB2006/AtHB17 of the AtHB17 gene fragment band of 1266bp transforms, called after agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105/pCB2006/AtHB17.The bacterium colony PCR qualification result of agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105/pCB2004/AtHB17 and agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105/pCB2006/AtHB17 as shown in figure 10, swimming lane 1,2, the 3rd, the PCR result of agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105/pCB2004/AtHB17; Swimming lane 4,5, the 6th, negative control; Swimming lane 7,8, the 9th, the PCR result of agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105/pCB2006/AtHB17 all obtains 828bp AtHB17 gene fragment band, and M is Fermentas DNA ladder (250bp-10K).

2, paddy rice mature seed callus induces and subculture

1) spend 11 seeds (sky, Anhui standing grain paddy rice kind industry limited liability company) in the ripe paddy rice, remove kind of a shell by hand, standby;

2) get seed in aseptic triangular flask, 70% ethanol embathes 30sec, removes ethanol, sterile water wash one time;

3) 0.1% mercuric chloride solution soaking disinfection 15-20min, sterile water wash 5-6 time, the seed after the sterilization places on the aseptic filter paper, as far as possible suck dry moisture;

4) planting seed that sterilization is good is secretly cultivated 4-6 weeks for 26 ± 1 ℃ in inducing culture (MS+2,4-D 2.5mg/L);

5) the faint yellow granular callus that will grow changes subculture medium (J over to ₃+ 2,4-D 2.5mg/L), continue at 26 ± 1 ℃ of dark cultivations 2-3 week, the callus of this moment namely can be used for transforming.

3, the conversion of rice callus tissue and plant regeneration

1) chooses densification, dried particles shape embryo callus in pre-culture medium (MS+2,4-D 0.75mg/L), 26 ± 1 ℃ of dark cultivations 4 days;

2) the single colony inoculation of picking agrobacterium tumefaciens EHA105/pCB2004/AtHB17 or agrobacterium tumefaciens (Agrobacterium tumefaciens) bacterial strain EHA105/pCB2006/AtHB17 contains in the LB liquid nutrient medium of 250 μ g/ml Pyocianils in 10ml, 28 ℃ of overnight incubation are to logarithmic growth later stage (about 17hr), in 4 ℃, 5000rpm, centrifugal 10min, collect thalline, be 0.8-1.0 with the LB liquid nutrient medium dilution thalline that contains 250 μ g/ml Pyocianils to OD600, stand-by;

3) embryo callus of cultivating in advance changes the Agrobacterium bacterium liquid after the dilution over to, cultivates 30min altogether;

4) training finishes altogether, removes bacterium liquid, and callus is placed aseptic filter paper, inhales and removes unnecessary bacterium liquid;

5) shift callus to training substratum (MS+2,4-D 0.75mg/L+100 μ mol/L Syringylethanone) altogether, 19-20 ℃ of dark the cultivation 3 days;

6) after 3 days, change callus over to 50ml sterile tube with cover, embathe 20-30min, sterile water wash callus 6-7 time with the sterilized water that contains the 400mg/L Pyocianil;

7) aseptic filter paper blots the callus free surface moisture as far as possible;

8) callus that blots water changes the selection substratum (J of additional 400mg/L Pyocianil and 25mg/L weedicide grass ammonium phosphine (glufosinate ammoniums) over to ₃+ 2,4-D 0.6mg/L) go up growth, per 2 all subcultures once, subculture 2-3 time;

9) be transferred to the pre-differentiation substratum (N6+6-BA 0.5mg/L+KT 0.5mg/L+NAA 0.05mg/L) that adds 200mg/L Pyocianil and 25mg/L weedicide at the resistant calli of selecting substratum to grow, 26 ± 1 ℃ of dark cultivations 5-7 days;

10) shift the division culture medium (N6+6-BA 0.5mg/L+KT 0.5mg/L+NAA 0.05mg/L) that the pre-callus that breaks up on the substratum extremely adds 200mg/L Pyocianil and 25mg/L weedicide glufosinate ammonium, 26 ± 1 ℃ of illumination cultivation;

When 11) bud that differentiates of callus grows to 3-5cm, downcut bud, move into the root media (MS of additional 25mg/L weedicide glufosinate ammonium ₀), 26 ± 1 ℃ of illumination cultivation are taken root;

12) seedling grows to about 8-10cm height, and culturing bottle was uncapped hardening 1-2 days, and flush away root plant gel is planted in the field, Routine Management, and ripe the receipts planted.

The result shows planting seed about 3-4 week after inducing culture of the sterilization of shelling, the embryo place begins to expand and grows the particulate state callus, when all to 7-8, existing a large amount of callus generates (among Fig. 1 a), the callus of inducing generation is transferred to subculture medium continued growth (b among Fig. 1), can see after 3 weeks that a large amount of faint yellow particulate state callus form, selection surface drying, the faint yellow granular callus that embryo is strong continue pre-4 days (c among Fig. 1) of cultivation, can transform.D is at the resistant calli of selecting substratum to grow among Fig. 1, d can see from Fig. 1, transform not successful callus, after selecting substratum to select through certain hour, brownization, death, some callus then can be grown on the selection substratum, and grows the resistant calli of fine granularity around original callus.Resistant calli 2 all subcultures once, behind the subculture 3 times, kanamycin-resistant callus tissue is placed pre-1 week of differentiation culture medium culturing earlier, change the division culture medium differentiation again over to, e namely is the seedling that differentiates at pre-differentiation substratum among Fig. 1, for the transformant of guaranteeing to obtain is each different individuality, the seedling that every callus differentiates only keeps a strain; The seedling that differentiates changes root media over to, owing to added the weedicide of 20mg/L high density in the root media, therefore, the seedling of differentiation has 20% can not take root at root media after changing root media over to approximately, last withered and yellow dying, and 80% differentiation seedling can be taken root at root media (f among Fig. 1), its rooting rate is very fast, can see that at the immigration root media root of white grows from the base portion that breaks up seedling in 24 hours, and a week can grow up to; Transformant (T ₀Generation) take root after, the film that seals of culturing bottle is opened hardening, hardening finishes to move into the land for growing field crops, Fig. 1 g is for moving into 42 days conversion seedling of growth behind the land for growing field crops.Must wash clean root plant gel during transplanting, to transplant seedling dead because of long bacterium otherwise be easy to cause, and transplants to the rice seedling in land for growing field crops and carry out conventional field management, transformant and contrast equal normal mature (h among Fig. 1), receives kind of (i among Fig. 1), obtains T ₀Seed (T for transformant ₁Generation).

Among Fig. 1, a, induce 50 days callus; B, the callus of subculture just; C, callus are cultivated in advance; D, conversion back are selecting substratum to grow resistant calli; E, resistant calli differentiation and seedling emergence; F, take root at the substratum that contains weedicide; G, transformant are transplanted into normal growth behind the land for growing field crops; H, transformant are in the land for growing field crops maturation; The transformant seed of i, results.

Some are suitable for by the tissue of Agrobacterium-mediated Transformation or cell in the paddy rice, comprise meristematic tissue (as stem apex and the tip of a root etc.), and the callus in young fringe and rataria or mature embryo source etc., because the embryo callus separatist activities are more vigorous, cell state is relatively more responsive, be easy to receive importing and the integration of foreign gene, the callus height that the healing rate of young fringe and rataria and differentiation of calli rate are all induced than mature embryo in the experiment, but the time that obtains young fringe and rataria is shorter, draw materials and be very limited, what therefore this experiment was selected for use is the mature embryo callus induction of rice paddy seed, though ripe rice paddy seed is because it has organized differentiation fully, cell dedifferentiation and differentiation capability is poorer than young fringe and rataria again, but seed is preserved and is easier to, it is unrestricted to draw materials, and can take at any time as required, therefore can be used as the ideal material of evoked callus and genetic transformation.

Optimizing tissue culture and being total to culture condition is the key factor that rice genetic transforms success or failure.The inducing culture (MS+2,4-D 2.5mg/L) of Y.J.Lin etc. has been adopted in this experiment, is 2 of the additional 2.5mg/L of minimum medium, 4-D; Subculture medium is identical with inducing culture, but carbohydrate has changed maltose into from sucrose; Pre-culture medium subsequently, the suspension culture base, culture medium and selection substratum have all used maltose altogether, and used 2 of different concns all the time, 4-D, in selecting culturing process, solidify substratum and used agarose, added the phytokinin of high density in pre-differentiation and the regeneration culture medium, culture medium has also been added 100 μ mol/L Syringylethanones altogether, increased glucose in addition, add Syringylethanone, increasing the concentration of inductor to promote activation and the expression of Agrobacterium vir district gene, also is vital to transformed calli.The needed hormone concentration of callus induction difference in the plant of different varieties is very big, and 2 of 2.0mg/L, 4-D are selected in this experiment for use; The pH value of substratum also is an important factor, and low pH value is conducive to induce the vir expression of gene, so Agrobacterium should be under the lower pH value condition when infecting and cultivating altogether with callus, and this experiment is 5.2.

Three, the evaluation of transformant

1, PCR test of resistant plants Seven is identified

The rice seedling of in weedicide, taking root, after transplanting survives fully to the field, get blade, the CTAB method is extracted transformant and (is spent 11 in the paddy rice of commentaries on classics pCB2004/AtHB17 or pCB2006/AtHB17, represent with transformant in the drawings) and the contrast (spend 11 in the not genetically modified paddy rice, represent with WT in the drawings) genomic dna, be used for PCR and identify.The marker gene of transformant is the Bar gene, and design of primers is according to Bar gene two terminal sequences, and the upstream and downstream primer sequence is respectively P ₁: TCAAATCTCGGTGACGGGCA; P ₂: GTCTGCACCATCGTCAACCACTA.PCR reaction system (50 μ l system): archaeal dna polymerase Ex Taq (5U/ μ l) 0.25 μ l, 10 * Ex Taq buffer, 5 μ l, dNTPs (four kinds of dNTP, every kind of each 10mM) 4 μ l, P ₁(10 μ M) 2 μ l, P ₂(10 μ M) 2 μ l, genomic dna 2 μ l, ddH ₂O 34.75 μ l.

PCR response procedures: 95 ℃ of 5min of elder generation; 94 ℃ of 30sec then, 58 ℃ of 30sec, 72 ℃ of 30sec, totally 40 circulations; 72 ℃ of 10min again; Last 4 ℃ of preservations.Pcr amplification product detects by 0.8% agarose gel electrophoresis.

From the result as shown in Figure 2, transformant strain system can amplify the Bar gene purpose band of 552bp, and contrast is failed to expand and respective strap.Among Fig. 2, M:Marker; WT: contrast; All the other swimming lanes are the different individual plants that transform.Wherein, that change among 4-2, the 22-2 is pCB2004/AtHB17, and that change among 16-2, the 25-1 is pCB2006/AtHB17.

2, transfer-gen plant Southern blot analyzes

The rice seedling of 1) in weedicide, taking root, after transplanting survives fully to the field, get blade, the CTAB method is extracted transformant and (is spent 11 in the paddy rice of commentaries on classics pCB2004/AtHB17 or pCB2006/AtHB17, represent with transformant in the drawings) and the contrast (spend 11 in the not genetically modified paddy rice, represent with WT in the drawings) genomic dna, according to the foreign gene AtHB17 gene that changes over to, the own restriction enzyme site of Bar gene order and plasmid, select the oryza sativa genomic dna of SacI to carry out enzyme and cut digestion, after enzyme cuts entirely, with 1 * TAE damping fluid, 0.8% agarose gel electrophoresis, voltage 1V/cm, electrophoresis 12-14hr; Electrophoresis finishes, Taking Pictures recording under the ultraviolet lamp;

2) DNA is shifted on the nylon membrane, the nylon membrane after the transfer, the hybrid pipe of packing into adds new hybridization solution (consisting of of hybridization solution: SDS 7%, BSA (Casein) 1%, EDTA 1mM, the Na for preparing ₂HPO ₄12H ₂O 0.25M) 10-15ml is in 65 ℃ of prehybridizations 6hr at least;

3) radiolabeled probe's (this probe is the Bar gene) of adding sex change, 65 ℃ of hybridization 16-20hr; Hybridization finishes, and the hybridization solution that contains probe is poured appointment waste liquid cylinder into;

4) add 100ml 2 * SSC+0.1%SDS, screw lid, the upset pipe is washed film several times, and entire operation is at room temperature carried out, and the solution after washing is poured the waste liquid cylinder that holds radioactive substance into;

5) add 200ml 2 * SSC+0.1%SDS, wash film 5min in the hybrid heater room temperature, all the other are with 4);

6) add 200ml 0.2 * SSC+0.1%SDS, the hybrid heater room temperature is washed film 5min, and all the other are with 5);

7) add 200ml 0.1 * SSC+0.1%SDS, the hybrid heater room temperature is washed film 5min, and all the other are with 5);

8) 0.1 * SSC+0.1%SDS of 65 ℃ of preheatings of adding 200ml washes film 10-30min in 65 ℃ of hybrid heaters, and all the other are with 5);

9) film is placed a plastics casing, with SURVEY METER detection of radioactive intensity, according to the size of radioactive intensity, frontier inspection survey limit is washed with 0.1 * SSC+0.1%SDS of 65 ℃ of preheatings, until proper strength.

10) wash film and finish, filter paper blots unnecessary washing lotion on the film, preservative film parcel nylon membrane; Expose in the darkroom, film is fixed in the compressing tablet folder of high speed intensifying screens ,-80 ℃ of Ultralow Temperature Freezer radioautograph are taken pictures.

Wherein, probe is prepared as follows:

1. prepare following reaction solution in the Eppendorf tube, 95 ℃ of heating 3min place ice to cool off rapidly, place 5min.

Template 10ng-1 μ g

Random primer (code:D6045 carries for the Random Primer DNA Labeling Kit Ver.2 of TaKaRa company, 30reactions) 2 μ l

DH ₂O is up to 14 μ l.

Wherein, template is to be template with pCB2004, uses P ₁: TCAAATCTCGGTGACGGGCA; And P ₂: the PCR product that GTCTGCACCATCGTCAACCACTA obtains.

2. add 10 * Buffer (code:D6045 carries for the Random Primer DNA Labeling Kit Ver.2 of TaKaRa company, 30reactions), dNTP Mixture (four kinds of dNTP, every kind of each 0.2uM/ μ l) 2.5 μ l are for the dCTP* of mark ²(50 μ Ci) 5 μ l.

3. add 1 μ l Exo-free Klenow Fragment (2U/ μ l), 37 ℃ of reaction 60-120min;

4. 65 ℃ of heating 5min make enzyme deactivation;

5. place ice to cool off rapidly behind 95 ℃ of heating 3min;

6. extract reaction solution directly and use as probe.

The result as shown in Figure 3, transformant can hybridize band, contrast does not have, and further proves rice conversion success.Among Fig. 3, WT: contrast; All the other swimming lanes are the different individual plants that transform.

3, the expression analysis of AtHB17 gene in transformant

The PCR evaluation of the step 1 of learning from else's experience and the positive T of Southern blot analytical results of step 2 ₀T for 4 transformant strain systems such as transformant 4-2,22-2,16-2,25-1 ₀Carry out RT-PCR for seedling and contrast seedling (representing with WT in the drawings).

At transformant and contrast vegetative growth phase, get blade Trizol method extracting RNA, reverse transcription cDNA carries out RT-PCR, and mark in doing with paddy rice tubulin detects the expression of transgene in transformant.

(1) the Trizol test kit extracts rice leaf RNA

1) get 50mg grow vigorous transformant and contrast blade respectively, add 1ml Trizol, grinding at room temperature is placed 5min;

2) 4 ℃, 12000g, centrifugal 10min gets supernatant, and room temperature is placed 5min;

3) supernatant adds 200 μ l chloroforms, thermal agitation 15sec, and room temperature is placed 3min;

4) 4 ℃, 12000g, centrifugal 15min gets supernatant and adds 500 μ l Virahols;

5) room temperature is placed 10min, 4 ℃, 12000g, centrifugal 10min;

6) abandon supernatant, precipitation is washed once 7500g, centrifugal 5min with 75% ethanol;

7) abandon supernatant, precipitate the 5min that dries in the air, 10 μ l DEPC-H ₂The O dissolving;

8) ultraviolet spectrophotometer is measured A ₂₆₀, A ₂₈₀, check RNA quality and calculating concentration, standby.

(2)RT-PCR

1) Xiang Guanzhong adds RNA 3 μ g, Oligo d (T) ₂₅50pmol, dNTP (10mM) 1 μ l, add dH again ₂O is up to 14 μ l, mixing, and 65 ℃, 5min takes out and puts on ice 1min at least; With adding 5 * FSbuffer (Invitrogen Corporation's Super Script in the pipe ^TMIII Reverse Transcriptase test kit carries, and the cat. no of this test kit is Cat.No.18080-093) 4 μ l, 0.1M DTT 1 μ l, SSRTase III (Invitrogen Corporation's Super Script ^TMIII Reverse Transcriptase test kit carries, and the cat. no of this test kit is Cat.No.18080-093) 1 μ l, to cumulative volume 20 μ l, 50 ℃ of water-baths, 60min obtains first chain of cDNA.

2) cDNA that obtains with reverse transcription is template, amplifying rice tubulin, and the upstream and downstream primer sequence is: P ₃: GGAGATCCTCCACATCCAG; P ₄: CAGAAAGGGTAGCATTGTAAG; (Takara company) carries out pcr amplification with rTaq PCR test kit, and pcr amplification system (cumulative volume 20 μ l) is: rTaq (U/ μ l) 0.1 μ l, 10 * ExTaq buffer, 2 μ l, dNTPs (four kinds of dNTP, every kind of each 10mM) 1.6 μ l, P ₃(10 μ M) 2 μ l, P ₄(10 μ M) 2 μ l, template 1 μ l, dH ₂O 11.3 μ l.Pcr amplification condition: 95 ℃ of 3min of elder generation; 94 ℃ of 30sec, 68 ℃ of 1min then, 35 circulations; 72 ℃ of 10min again; Last 4 ℃ of preservations.

3) adjust interior mark, amplification AtHB17 gene, primer sequence is: P ₅: 5 '-TATCATATGGATTACGCATGCG-3 ' and P ₆: 5 '-GCAAGTACTTCCTTTTGTTTGG-3 ', (Takara company) carries out pcr amplification with rTaq PCR test kit, and the pcr amplification system is except primer is replaced with P ₅And P ₆Outward, other are with the pcr amplification system of tubulin; Pcr amplification condition: 95 ℃ of 3min of elder generation; 94 ℃ of 30sec, 56 ℃ of 30sec, 72 ℃ of 30sec then, 40 circulations; 72 ℃ of 10min again; Last 4 ℃ of preservations.The result show that the gene that changes over to all has expression in transformant, but expression amount is slightly different in different transformant as shown in Figure 4: the expression amount that 22-2,16-2 and 25-1 transform individual plant is slightly high than other several strains, and the expression amount of 4-2 conversion individual plant is lower.Among Fig. 4, WT: contrast; All the other swimming lanes are the different individual plants that transform.

The drought resistance of embodiment 2, commentaries on classics AtHB17 trans-genetic hybrid rice detects

To identify and the equal positive T of Southern blot analytical results through the PCR of embodiment 1 ₀The seedling that obtains for the seed of 7 transformant strains such as transformant 4-2,22-2,16-2 and 25-1 system and contrast (representing with WT in the drawings) seedling carry out that following drought resistance detects and physio-biochemical characteristics are measured, each transformant strain system and contrast equal 27 strains.

1, transformant soil drought resistance is identified

T with results ₀Sow at MS for rice paddy seed ₀(MS that does not contain any hormone) contains on the 20mg/L weedicide glufosinate ammonium culture plate, 40 of each transgenic line and contrast sowings, the strain system of all sprouting on the weedicide plate is as homozygote, to to onesize flowerpot, (spend soil to weigh in the flowerpot at the seedling replanting that the weedicide plate is sprouted, spend native weight identical, to guarantee the growing environment term harmonization as far as possible), every potted plant 9 strains, after seedling survives also vigorous growth fully, choose growth conditions good and consistent transformant and contrast, fully inhale permeable, carry out drought stress then and handle (continuing not water), and in the mensuration of carrying out drought-enduring relevant physiological biochemical indicator behind the drought stress different time and the morphologic observation after the rehydration.

Choose growth conditions unanimity, well-grown transformant and contrast and carry out the drought stress experiment simultaneously, drought stress is in the time of 5 days, contrasting most of blade curls, dries up, it is withered and yellow, dead that lower blade begins, have only a small amount of blade to keep deployed condition, and being the outermost layer blade, transformant begins to curl the attitude continued growth that still keeps standing upright of most of blade; Behind the drought stress 10 days, the contrast blade almost all curls withered and yellow, redgreen blade almost, though transformant has also taken place to curl because of the dehydration blade, but plant leaf still is green, just the chlorophyll that causes of dehydration is destroyed and cause the blade tip jaundice, and transformant and contrast are carried out rehydration, and rehydration is after 3 days, contrast only has a spot of plant to recover survival, survive out of order, it is green having only lobus cardiacus, but transformant blade major part all begins to stand upright again, only outer foil or rolled state, fail to recover fully, rehydration 6 days has more transformant blades to stand upright, whole strain plant recovers the growth conditions before the drought stress substantially, indivedual individual plant death are also arranged, and contrast just has indivedual individual plants to recover growth, and major part is death (Fig. 5) all.With drought stress after 10 days, 6 days plant of rehydration carries out the survival rate statistics, statistics shows, rehydration 6 days, the contrast survival rate has only 18.5%, and transformant on average can reach 60.8%, and the drought tolerance of visible transformant is far longer than contrast, behind the drought stress 10 days, the survival rate of 6 days transformant of rehydration and contrast present utmost point significant difference (p＜0.01) (Fig. 5, table 2).

6 days different transformation plant survival rates of 10 days rehydrations of table 2 drought stress

Strain system number	WT	4-2	22-2	16-2	25-1
						Total seedling number (strain)	27	27	27	27	27
Survival seedling number (strain)	5	15	16	13	23
						Survival rate (%)	18.5	55.5	59.3	48.1	85.2

Fig. 5 is a photo that the transformant strain is 16-2.Among Fig. 5, before a left side, the drought stress; In, drought stress 10 days; The right side, drought stress 10 days, rehydration 6 days.

In the table 2, WT and each strain system are the statistics of 27 strains.Among Fig. 5 a, transformant is that 4 transformant strain systems, each strain such as 4-2,22-2,16-2 and 25-1 are the statistics of 27 strains, and contrast also is the statistics of 27 strains.

2. transformant PEG4000 tolerance is identified

Get transgenic line and each 55-60 grain of contrast seed, wash 2min with 70% alcohol after shelling, 0.1% mercuric chloride 20min, aseptic water washing for several times, be seeded on MS+glu (25mg/L) substratum (contrast is sowed on the MS substratum), get the relatively more consistent transplantation of seedlings of growing way after 10 days in 96 orifice plates that cut off the bottom, place the Yoshida nutrient solution to grow.Grow and use the nutrient solution that has added 15%PEG after a week instead and cultivate.

Use the nutrient solution after 2 days that contains 15%PEG instead, each strain is that here withering to a certain degree all appears in young leaves, and it is light that the relative WT degree of transgenic line is wanted, and after 6 days, here the whole strain of WT system nearly all withers, and here the transgenic line young leaves withers, and Lao Ye is bud green (see figure 6) still.

15%PEG was coerced 6 days, the plant that recovered 12 days carries out the survival rate statistics, statistics shows, recovered 12 days, the contrast survival rate has only 15.9%, and transformant on average can reach 57.9%, and the drought tolerance of visible transformant is far longer than contrast, after 15%PEG coerced 6 days, the survival rate and the contrast that recover 12 days transformant presented utmost point significant difference (p＜0.01) (Fig. 6, table 3).

Table 3 15%PEG coerces and recovered 12 days different transformation plant survival rates in 6 days

Strain system number	WT	4-2	22-2	16-2	25-1
						Total seedling number (strain)	64	17	18	16	24
Survival seedling number (strain)	10	9	10	9	16
						Survival rate (%)	15.6	52.9	56	56.3	66.7

Fig. 6 is a photo that the transformant strain is 16-2.Among Fig. 5, before a left side, 15%PEG coerce; In, 15%PEG coerced 6 days; Right, 15%PEG coerced 6 days, recovered 12 days.

The associated biomolecule of embodiment 3, commentaries on classics AtHB17 trans-genetic hybrid rice is learned character observation

To identify and the equal positive T of Southern blot analytical results through the PCR of embodiment 1 ₀The seedling that obtains for the seed of 4 transformant strains such as transformant 4-2,22-2,16-2 and 25-1 system and contrast (representing with WT in the drawings) seedling carry out following biological character to be observed, each transformant strain system and contrast equal 27 strains.

T with results ₀Sow at MS for rice paddy seed ₀(MS that does not contain any hormone) contains on the 20mg/L weedicide glufosinate ammonium culture plate, 27 of each transgenic line and contrast sowings, the strain system of all sprouting on the weedicide plate is as homozygote, to to onesize flowerpot, (spend soil to weigh in the flowerpot at the seedling replanting that the weedicide plate is sprouted, spend native weight identical, to guarantee the growing environment term harmonization as far as possible), every potted plant 9 strains, after seedling survives also vigorous growth fully, choose the good and consistent transformant of growth conditions and contrast and carry out the observation that associated biomolecule is learned index.

1, blade stomatal frequency and size are observed

1) chooses transformant and the contrast of growth conditions unanimity, get the same position of same leaf position;

2) on slide glass, evenly smear permanent solid 502 super glue, selected rice leaf zone lower epidermis is close on the slide glass that scribbles glue, firmly press;

3) after the glue solidifies, blade is peeled off slide glass, rice leaf lower epidermis pore is namely opened up in slide glass;

4) microscopically is observed pore, records stomatal number in each visual field, and each blade records 50 visuals field at least, calculates each visual field area according to micrometer, and it is (individual/mm to calculate the blade stomatal frequency ²).

5) the measurement and record of stomatal number time, micrometer is measured pore length and width, and pore length is calculated with the strong point of the pore longitudinal axis, and stomatal width is to calculate perpendicular to longitudinal axis the widest part.

Upper and lower 400 times of light microscopic photos and 1000 times of light microscopic photos that are respectively contrast and transformant blade lower epidermis pore among Fig. 7, from the pore light microscopic photo of 400 times and 1000 times, it has been seen in that whether contrast and transformant there are differences on stomatal frequency, after at least 50 visual field pore quantity of statistics, calculate stomatal frequency and do statistical study, find that there is utmost point significant difference (p＜0.01) (Fig. 7 a in the quantity at pore between transformant not only and the contrast, and on pore opening, also have a utmost point significant difference (p＜0.01) (Fig. 7 b) table 4).Because the rice leaf pore is difficult to observe, therefore can only pore be opened up to get off to observe with the method for rubbing, record, so just can't observe and cartogram chrotoplast changing conditions, also be difficult to calculate stomatal index, can find out that from rice conversion body and contrast pore changing conditions the difference of transformant and contrast is less than observed pore variation in paddy rice.

The different transformation plant stomatal frequencies of table 4

Strain system number	WT	4-2	22-2	16-2	25-1
						Stomatal frequency is (individual/mm 2)	719	481	487	520	471

Fig. 7 is a photo that the transformant strain is 4-2.Among Fig. 7, a last left side, contrast lower epidermis pore (400 times); Last right, transformant lower epidermis pore (400 times); Bottom left, contrast lower epidermis pore (1000 times), bottom right, transformant lower epidermis pore (1000 times).Among Fig. 7 a and Fig. 7 b, transformant is that 4 transformant strain systems, each strain such as 4-2,22-2,16-2 and 25-1 are the statistics in 50 visuals field, and contrast also is the statistics in 50 visuals field.In the table 4, WT is the statistics in 50 visuals field, and 4 transformant strain systems, each strain such as 4-2,22-2,16-2 and 25-1 are the statistics in 50 visuals field.

2, the observation of root system

With the transformant rice planting seed at MS ₀(MS that does not contain any hormone) contains on the 25mg/L weedicide glufosinate ammonium culture plate, sprouts after 3 days, chooses each 20 of the consistent transgenic line of growth and contrasts, moves to MS ₀(MS that does not contain any hormone) do not contain on the culture plate of weedicide, vertically cultivates under the normal growth condition, cultivates after 8 days, adds up lateral root number and the statistical study of each strain system.

From statistics as can be seen, the root of transformant thicker than contrast, slightly long (Fig. 8), and difference reaches conspicuous level (p＜0.05) (Fig. 8 a) between transformant and the contrast, though but root is long and plant height is also variant, the difference between transformant and the contrast does not reach conspicuous level (Fig. 8 b and Fig. 8 c)

The different transformation plant root system of table 5 situation

Strain system number	WT	4-2	22-2	16-2	25-1
						Root long (cm)	8.22	6.35	8.38	6.89	7.09
Radical (root)	4.95	7	5.73	6.93	7.2
						Plant height (cm)	15.03	13.44	13.09	14.45	16.56

Fig. 8 is the photos of two transformant strain systems wherein just.In the table 5, WT is the statistics of 20 strains contrast, and 4-2,22-2,16-2 and 25-1 are that 4 transformant strain systems, each strain are the statistics of 20 strains.

Claims (4)

1. a method of cultivating the resistant transgenic plant is in the encoding gene importing purpose plant with AtHB17, obtains the transgenic plant that resistance improves;

Described AtHB17 is the protein that the amino acid residue sequence of sequence 2 in the sequence table is formed;

Described resistance is drought resistance;

Described plant is paddy rice.

2. method according to claim 1, it is characterized in that: the encoding sequence of the encoding gene of described AtHB17 is the sequence 1 in the sequence table.

3. method according to claim 2, it is characterized in that: the encoding gene of described AtHB17 imports in the described purpose plant by recombinant expression vector;

Described recombinant expression vector is the recombinant vectors that obtains between the attR1 of the encoding gene insertion plant expression vector pCB2004 of described AtHB17 or pCB2006 and the attR2;

Described plant expression vector pCB2004 obtains the postdigestive 35S promoter of Dra III with being connected with the carrier pCB2003 after the linearizing of Dra III;

Described carrier pCB2003 makes up the multiple clone site that fragment shown in the sequence in the sequence table 5 is inserted into pCB2002 to form;

Described pCB2002 inserts a slice section to obtain between the multiple clone site of pCAMBIA3301, described fragment is the double chain DNA fragment that the strand polynucleotide shown in the sequence 4 is annealed in the strand polynucleotide shown in the sequence 3 and the sequence table in the sequence table;

Described plant expression vector pCB2006 obtains the postdigestive Actin1 promotor of Dra III with being connected with the described carrier pCB2003 after the linearizing of Dra III.

4. according to arbitrary described method among the claim 1-3, it is characterized in that: the stomatal frequency of described drought resistance transgenic plant is lower than described purpose plant, and pore size, root length and/or radical are greater than described purpose plant.

Images