CN101962658A - High-efficiency transgenic cotton expression vector and application thereof - Google Patents

Abstract

The invention discloses a plant expression vector and application thereof. The plant expression vector comprises an expression box expressing a tfdA gene, wherein the expression box comprises a CaMV35S promoter, a tfdA gene and a terminator that are sequentially connected; the nucleotide sequence of the tdfA gene is a sequence 2 in a sequence table, and the nucleotide sequence of the CaMV35S promoter is a sequence 1 in the sequence table. The construction of the vector of the invention has very important application values on the construction of the gene recombinant expression vector of the cotton, the gene transformation (especially providing incontestable evidence for the transgenes of pollen tubes in China), later generation screening of the transgenes and the whole cotton gene engineering for the research of the cotton transgenes.

Description

High-level efficiency transgene cotton expression vector and application

Technical field

The present invention relates to a kind of plant expression vector and application thereof, particularly high-level efficiency transgene cotton expression vector and application.

Background technology

Transgenic animal exemplary the earliest is that nineteen eighty-two is by reports " supermouse " such as the Palmiter of Washington, DC university.But before this, 1974, the method of usefulness microinjections such as Jaenisch imports to the DNA of SV40 in the blastular of mouse, has detected the DNA of SV40 in carrying the liver of mouse, nephridial tissue, and this proof imports foreign gene in the embryonic cell and realizes integrating is possible.1980, Gordon etc. adopted zygote protokaryon microinjection, and successfully with the dna fragmentation importing mouse genome of simplexvirus and SV40, Gordon and Ruddle claimed this transformed mouse to be " transgenic mice " at that time first.

Transgenic plant, nineteen eighty-three adopts agriculture bacillus mediated method to cultivate first routine transgenic plant---the transgene tobacco in the world.Genetically engineered has spreaded all over various animals and plants and microorganism now, because the develop rapidly of Protocols in Molecular Biology, transgenosis is being brought into play enormous function for improvement animals and plants quality, raising resistance and biomedicine field.

Domestic and international plant transgenic method: set up multiple method for transformation in the research that plant gene transforms: carrier conversion system, protoplastis dna direct import and transform, particle gun DNA imports conversion, pollen tube passage method etc.What application at present was maximum, mechanism research is the clearest and the most definite is the carrier conversion system, and its carrier comprises Ti-plasmids, Ri plasmid and viral conversion carrier etc.The pollen tube channel gene method is invented by China scientist: the period-luminosity space proposes dna fragmentation hybridization hypothesis on the basis of domestic and international distant hybirdization work that takes a broad survey, and has designed the pollen tube passage method that foreign DNA directly imports acceptor.

Usually transgenosis need make up efficient expression vector, in order to make the plant after the transgenosis screen easily, generally adopts binary expression vector.Plant expression vector commonly used is pBI121 and pCambia series.The selection markers gene is meant the marker gene that transformant (or individual) is screened from numerous non-transformed cells.They can produce the product that certain selective agent is had resistance by the render transgenic cell usually, thereby the render transgenic cell is normal growth on the substratum that adds this selection, but not transgenic cell can not grow, grows and break up because the shortage resistance then shows the susceptibility to this selective agent.When carrier construction, the selection markers gene is connected goal gene on one side, and both respectively have the gene regulating sequence (as promotor, terminator etc.) of oneself.Selection markers gene commonly used at present mainly contains two big classes: antibiotics resistance enzyme gene and Herbicid resistant enzyme gene.The former can produce certain antibiotic resistance, and the latter can produce the resistance to weedicide.Use maximum antibiotics resistance enzyme genes to comprise NPTII gene (producing neomycin phosphotransferase, anti-kantlex), HPT gene (producing hygromix phosphotransferase, the moisture resistance mycin) and Gent gene (anti-gentamicin) etc.Anti-herbicide gene commonly used comprises that the EPSP gene (produces 5-enol pyruvic acid shikimic acid-3-phosphate synthase, glyphosate resistant class i 5), GOX gene (producing glyphosate oxydase, degradation of glyphosate), bar gene (producing the PPT Transacetylase, anti-Bialaphos or glufosinate) etc.Wherein pCambia1301 and pCambia3301 are comparatively commonly used.In recent years, the biological safety of selection markers gene had caused whole world concern in the transgenic plant.For example, the antibiotics resistance marker gene of fears are entertained that transgenic plant shifts and enters in human or animal's the pathogenic bacteria, thereby causes that these pathogenic bacterias to antibiotic resistance, make microbiotic lose effectiveness.

The bar gene that pCambia3301 the adopts gene that serves as a mark adopts transgenic progeny to spray Basta (a kind of weedicide) and screen and can obtain the transgenic positive plant.But through discovering for many years, it is not high for screening cotton transgenic positive plant accuracy to spray Basta, adopt the pollen tube channel gene method of China's initiative simultaneously owing to domestic many research departments, if adopt this carrier more to be difficult to obtain to make the result of study of international counterparts conviction.

The pCAMBIA1301 carrier adopts super mycin screening, also is not suitable for cotton transgenic.We have made up pSPT high-efficiency plant expression vector through research for many years for this reason.

Summary of the invention

The purpose of this invention is to provide a kind of plant expression vector and application thereof.This plant expression vector can the high-efficiency breeding transgene cotton.

Plant expression vector provided by the present invention comprises and expresses tfdA expression of gene box; Described expression cassette is made up of the CaMV35S promotor, tfdA gene and the terminator that connect successively; The nucleotides sequence of described tfdA gene is classified sequence 2 in the sequence table as, and the nucleotides sequence of described CaMV35S promotor is classified sequence 1 in the sequence table as.

Also comprise the Flag label in the described plant expression vector, the nucleotides sequence of Flag label is classified sequence 3 in the sequence table as.

The base frame carrier of described plant expression vector is pCambia1300.

Described plant expression vector makes up according to following method:

1) the CaMV35S promotor is connected in the fragment that 5 of tfdA gene ' end obtains and is inserted between the BstXI and XhoI restriction enzyme site of pCambia1300, obtain recombinant vectors A;

2) with the multiple clone site of the 3 described Flag label fragments insertion recombinant vectors A of sequence in the sequence table, obtain described plant expression vector.

Described step 2) in, described Flag label fragment is preferred to reclaim Flag label fragment earlier with behind XbaI and the HindIII double digestion, inserts between the XbaI and HindIII of recombinant vectors A.

In the described step 1), the promotor of driving purposes genetic expression among the described pCAMBIA1300 (promotor before the multiple clone site) replaces with the super strong promoter, and the nucleotides sequence of described super strong promoter is classified sequence 5 in the sequence table as.

In the described step 1), the restriction enzyme site of the multiple clone site of described pCAMBIA1300 transform SalI, KpnI, BamI, SpeI, SalI, ApaI, SmaI, SwaI, PstI, HindIII, XbaI and AccIII as.

Plant expression vector of the present invention can be used for cultivating transgene cotton, and has following advantage:

PSPT carrier of the present invention has following advantage:

(1) goal gene obtains superpower expression.The Super strong promoter can guarantee that goal gene transforms and obtain high dosage behind the plant and express, so that to the functional analysis of goal gene, play a role at aspects such as resistance, output and qualities for improving transgenic plant simultaneously.

(2) transgenic positive plant (especially dicotyledons such as cotton) is convenient to simple and easy, quick, accurate screening.Because dicotyledonss such as cotton are very responsive to plant-growth regulator 2.4-D, available seedling spraying 2.4-D method is distinguished transgenosis and wild-type plant.With mass percentage concentration is the 2.4-D butyl acetate solution sprinkling transgenosis seedling of 0.003%-0.005%, can distinguish normal strain and unusual plant in general 7-10 days, because the transgenic positive plant carries the tfdA gene, so anti-2.4-D performance young leaves normal growth; Unusual strain is not owing to then carry the tfdA gene, thereby newly grows blade performance deformity (Fig. 3).Utilize this means when transgenic progeny is screened, accuracy is close to can reach 100%.

(3) distinguishing external source easily imports and native gene.Because cloned genes derives from plant itself usually, for distinguishing transgenosis and the existing gene of plant itself, we have increased the Flag sequence at 5 ' end of goal gene, on through marker gene identification basis, can also 5 ' the Flag sequences Design of holding use primer all, in conjunction with 5 ' terminal specific primer of foreign gene, only need utilize PCR is that provable positive plant exists foreign gene (Fig. 4) really.

(4) provide irrefutable evidence for the pollen tube transgenic method.The pollen tube channel gene method of cotton is proposed by China scientist, never obtain international mainstream scientist's approval, we utilize this vector construction to comprise the recombinant vectors of goal gene, after utilizing pollen tube channel gene, to the mixed seeds that obtains and plant out seedling thus and spray 2.4-D identification, in conjunction with Southern hybridization (Fig. 4) and Northern hybridization (Fig. 5) to transgenosis T3 generation, advantageously prove the reliability of transgenic positive plant, thereby provide irrefutable evidence for the feasibility of pollen tube channel gene method.

The structure of carrier of the present invention is studied for cotton transgenic: have earthshaking using value in cotton gene recombinant expression vector structure, gene transformation (especially providing irrefutable evidence for China's pollen tube transgenosis), transgenic progeny screening and even whole cotton gene engineering.

Description of drawings

Fig. 1 is a pSPT01 vector construction process synoptic diagram.

Fig. 2 is a pSPT carrier structure synoptic diagram.

Fig. 3 is a transgenic positive plant field The selection result, positive plant true leaf growth normal (right side, positive strain), and non-transgenic strain true leaf is a deformity (left side, wild strain).

Fig. 4 is the pSPT-At7 recombinant vectors that utilizes the pSPT vector construction.

Fig. 5 is for changeing pSPT-At7 cotton Southern hybridization detected result

Fig. 6 is for changeing pSPT-At7 cotton Northern hybridization detected result

Fig. 7 is that the cotton transgenic T3 that utilizes the pSPT-At7 carrier to obtain is for strain

Fig. 8 is for removing the performance of male cross-fertilize seed F1 field from

Fig. 9 is for removing male pollinating process from

Figure 10 is for removing male cross-fertilize seed performance in seedling stage (differentiating true and false cross-fertilize seed synoptic diagram) from

Embodiment

Experimental technique described in the following embodiment if no special instructions, is ordinary method.

Embodiment 1, the convenient screening of structure and high-efficient transgenic cotton expression vector

One, the acquisition of high-efficient transgenic cotton expression vector

The pSPT carrier is that transform on the basis with pCambia1300, the promotor of our used goal gene is the Super strong promoter, increased the Flag sequence in the promotor back, in addition reporter gene is replaced by the tfdA gene by Hygromicin (R) gene, through improved carrier called after pSPT (Fig. 2).The building process of pSPT carrier is as described below:

CaMV35S promotor among the pCAMBIA1300 is replaced by the Super strong promoter.At first transform the multiple clone site of pCAMBIA1300 in this laboratory, and improved site is: SalI, KpnI, BamI, SpeI, SalI, ApaI, SmaI, SwaI, PstI, HindIII, XbaI and AccIII.We have at first synthesized the dna fragmentation that contains MfeI, BamI, SpeI, SalI, ApaI, SmaI, SwaI, PstI, HindIII, XbaI, AccIII and HindIII restriction enzyme site, and its sequence is: CAATTG GGATCC ACTAGT GTCGACGGGCCC CCCGGG ATTTAAAT CTGCAG AAGCTT TCTAGA GTAGACAAGCTT.Then the polyclone fragment of pCAMBIA1300 carrier and synthetic is cut with EcoRI and HindIII enzyme, reclaim big fragment of carrier and polyclone fragment (order-checking again), connect, finished the replacing of restriction enzyme site thus with the T4 ligase enzyme.

Between AccIII and XbaI, insert the Super promotor then, increase the PinA restriction enzyme site, utilize the complementary sequence of AccIII and PinA enzyme to make do not have restriction enzyme site before the promotor at Super promotor 5 ' end.Called after pCAMBIA1300-Super carrier after sequence verification.Super promotor length is 1143bp, by pMSP3535H3 is template design primer upstream primer 5 '-agtactCTAGATTCGACGGTATCGCGATAAG (the front small letter partly is the PinA restriction enzyme site in the primer), downstream primer 5 '-tctagaGTCGATTTGGTGTATCGAGATTG (the front small letter partly is the XbaI enzyme cutting site in the primer) pcr amplification pcr amplification obtains (pMSP3535H3 is available from BVTech company), and its sequence is seen sequence table 5.Before the Super promotor that pcr amplification obtains is inserted between the AccIII of above-mentioned carrier and the XbaI, earlier with PinA and XbaI double digestion, can be connected to then with on the pCAMBIA1300 behind AccIII and the XbaI enzyme cutting, can eliminate the restriction enzyme site of promotor front thus.

On pCAMBIA1300-Super carrier basis, we have carried out following transformation:

1, the acquisition of CaMV35S promotor

At first we design primer and obtain the CaMV35S promotor, 5 ' end primer includes the BstXI restriction enzyme site, 3 ' end primer includes NcoI:BstXI-35S-5 ': 5 '-CCAACATGGTGGAGCACGACACTCTC-3 ' and 35S-NcoI-3 ': 5 '-CCATGGATCTCATTGCCCCCCCGGATCTG-3 ', with pCAMBIA1300 (available from Jin Weike (China) biotechnology center) is that template amplification obtains CaMV35S promotor (825bp), and sequence is a sequence 1.

2, the acquisition of tfdA gene

With pJP4 (available from DSMZ GmbH) is that template has obtained the tfdA gene, with upstream primer 5 ' CCATGGGTGAGCGTCGTCGCAAATC (5 ' end of primer adds the NcoI restriction enzyme site), downstream primer is 5 '-CTCGAGCTAGACGACGGCATCGTCCAGGGT (5 ' end of primer adds the XhoI restriction enzyme site), carry out pcr amplification, the result obtains the fragment of 888bp, order-checking shows that it is 5 of AY365053.1 ' end 36915-37778 position nucleotide sequence, i.e. tfdA gene order (sequence 2 in the sequence table) that this fragment has GENBANK Accesion version Number.

3, the structure of pSPT carrier

1) CaMV35S promotor and tfdA are connected respectively with the pMD18-T carrier on (available from Hua Lvyuan Bioisystech Co., Ltd), again with NcoI and SalI respectively enzyme cut the pMD18-T carrier that contains tfdA, reclaim the tfdA fragment, with being connected of this tfdA fragment and the pMD18-T carrier of cutting through NcoI and SalI enzyme that contains the CaMV35S promotor, being about to the tfdA gene and being connected on the pMD18-T carrier that contains the CaMV35S promotor then; To cut and check order through enzyme and show correct recombinant vectors called after pMD18-T-35S-tfdA; Among the pMD18-T-35S-tfdA, the CaMV35S promotor is connected in 5 of tfdA gene ' end.

2) cut the big fragment of pCAMBIA1300-Super carrier recovery carrier with BstXI and XhoI enzyme, cut pMD18-T-35S-tfdA with BstXI and SalI enzyme and reclaim the CaMV35S-tfdA fragment, to obtain big fragment of carrier and CaMV35S-tfdA and obtain recombinant vectors, through the correct recombinant vectors called after pSPT01 (Fig. 1) that contains CaMV35S and tfdA of sequence verification with the T4 ligase enzyme.In the pSPT01 carrier, 5 of tfdA gene ' end is connected with the CaMV 35S promoter, and 3 ' end links to each other with the PolyA terminator of pCambia1300-Super carrier self.

3) synthetic 5 ' end contains the Flag sequence label that the HindIII restriction enzyme site is contained in XbaI enzyme cutting site, 3 ' end:

TCTAGAGATGGCGGATTACAAGGATGACGACGATAAGGACTATAAAGATGACGATG ACAAGTCTAGAAAGCTTCTGCAGGTCGACGATTCCAAGCTT (sequence 3 in the sequence table), with XbaI and HindIII double digestion pSPT01 and above-mentioned synthetic fragment, connect with the T4 ligase enzyme again, the Flag sequence label is inserted the back of Super strong promoter, structure obtains recombinant vectors, cuts and check order through enzyme to show correct carrier called after pSPT carrier.

Two, the application of pSPT carrier in cotton transgenic:

1, transgenosis example pSPT-At7

Utilize the pSPT carrier, we have made up the pSPT-GbAt7 carrier with autonomous cloned genes At7 (patent No.: ZL 2,005 1 0098277.3).Is template with sea island cotton sea 7124 (available from National Cotton plantation resources bank) at the Huang cDNA that verticillium toxin induces the back to be obtained that withers, design primer GbAt7 primer: upstream primer is 5 '-CCATGGCTAGCTCAATGTCCCTTAAG, downstream primer is 5 '-TCACTTGACGCTGTTGCAGTCAGTG, reaches the GbAt7 sequence of 350bp shown in sequence in the sequence table 4 through pcr amplification.

GbAt7 is connected on the pMD18-T, obtains pMD18-GbAt7,, then GbAt7 is connected on the site of the PstI of pSPT carrier and KpnI, make up thus and obtain the pSPT-GbAt7 recombinant vectors with PstI and KpnI double digestion pMD18-GbAt7 and pSPT carrier.

Extract the pSPT-GbAt7 plasmid, transform self-fertile kind GK164 (passed through Hebei province's new variety authorization in 2007, the Ji is examined cotton No. 2007007) with the pollen tube channel method.Through the 2.4-D butyl acetate solution that continuous three generations's seedling spraying mass percentage concentration is 0.003%-0.005%, screening has obtained commentaries on classics pSPT-GbAt7 cotton T3 and for strain has been.

To screen acquisition and change pSPT-GbAt7 cotton T3 for carrying out Southern hybridization and Northern hybridization detection.Used probe is the ORF frame of GbAt7, at first cuts pSPT-GbAt7 with PstI and KpnI enzyme, reclaims GbAt7, uses dCTP isotopic labeling probe then, carries out Southern hybridization and Northern hybridization detection.

Result of study shows, we have obtained transgenosis purity and have reached 100% the transgenic progeny (seed that obtains after the transgenosis, after planting can obtain the normal T1 of true leaf for plant through spraying the 2.4-D discriminating, differentiate again after the plantation of the selfed seed of T1 results on generation emerged, can obtain T2 for plant, T2 is gathered in the crops a T3 seed for minute individual plant, the cotton seedling that the T3 seed is grown is differentiated with 2.4-D again, every strain system that the leaf strain no longer occurs is and has reached complete pure and mild plant, their purity has reached 100%) strain be 30 (part Southern results of hybridization as shown in Figure 5, part Northern results of hybridization as shown in Figure 6).

2, remove male cross-breeding technology from

The reporter gene tfdA that utilizes this carrier is as molecule marker, we not only can spray the positive plant of 2.4-D identification transgenic progeny, ought use the homozygote of transgenic progeny as male parent simultaneously, with the non-transgenic kind as female parent, removing directly pollination under the male situation from, can obtain to comprise maternal selfing and with the mixed seeds of paternal hybrid, after emerging under the seed kind to be mixed, can can when hybrid seeding, save castration program-realization thus and remove male hybrid seeding from by spraying 2.4-D identification cross-fertilize seed (comprising the tfdA reporter gene) and non-cross-fertilize seed (not comprising the tfdA reporter gene).Removing male hybrid seeding experiment from following cotton is example, and the application of carrier of the present invention is described.

1) acquisition of the male parent of commentaries on classics tfdA gene

We select cotton variety to comprise the new land early No. 33 (available from Xinjiang state cotton three benefits plant industry limited liability company) of Shine Early cotton flower variety as adopting Xinjiang, medium variety is a GK164 (self-fertile kind, passed through Hebei province's new variety authorization in 2007, the authorization numbering: the Ji is examined cotton No. 2007007, available from the emerging kind industry of Shandong farming company limited), medium variety is the material that nasal mucus conducts such as cotton No. 3 (available from Fengle Seed Breeding Co., Ltd., Hefei) makes up male parent.

Pollen tube passage method (Wang Changhai is adopted in the pSPT carrier utilization that step makes up, blue petrel, utilize pollen tube passage method exogenous plasmid dna to be injected the modification method of cotton, the cotton journal, 1999 04 phases) import above-mentioned cotton variety respectively, obtain T1 for seed after, at first be seeded in the greenhouse, the back of waiting to emerge is the cotyledon surface that 0.003% 2.4-D solution is sprayed on cotton seedling with mass percentage concentration, eliminate lopsided true leaf plant about 10 days and keep normal strain (may be transfer-gen plant), and then detect, and the PCR product checked order further confirm positive plant by special primer PCR.It is 5 '-ATGAAAAAGCCTGAACTCACCGC and 5 '-GTCCGCGGTGAAGAACGCAGCGG that PCR detects primer; PCR obtains the positive plant of segmental plant of 799bp.

Above-mentioned PCR is accredited as the male plant by the north in summer, winter, Hainan added generation, general T3 (gathers in the crops for minute individual plant T2 for obtaining homozygous lines, can obtain T3 for seed, can obtain T3 behind the insemination and emergence for seedling, seedling is carried out the 2.4-D processing and identification, everyly the improper leaf homozygous lines candidate strain system that promptly can be considered no longer occurs, further checking can be confirmed through PCR again).Carry out the following male hybridization of removing from being accredited as the homozygous lines of changeing the pSPT carrier as the hybridization male parent.

2) remove male hybridization from

Utilize the male parent of changeing the tfdA gene, select for use the improved seeds that are fit to the local climate characteristics, under not castration of female parent situation, directly pollinate with paternal pollen as female parent.After cotton emerges, by in the seedbed or big Tanaka spray 2.4-D, (this gene is from male parent because cross-fertilize seed carries the gene of anti-2.4-D, this hybridization of father and mother and acquisition cross-fertilize seed), female parent self-cross does not then carry resistant gene, again because cotton is very responsive to 2.4-D, therefore under extremely low concentration, can identify selfed seed (newly going out leaf malformation) and cross-fertilize seed (it is normal newly to go out the true leaf shape), can thoroughly remove selfed seed by artificial congnition, thereby guarantee that the field purity of hybrid reaches 100%.

The male parent of the commentaries on classics tfdA gene of above-mentioned acquisition is ground 18 with the Shandong cotton respectively remove male hybrid seeding from.It is as described below to remove male hybrid seeding concrete grammar from:

1. after male parent is bloomed, (please note and adjust) in female parent unanimity in flowering period, getting paternal pollen (male parent flower pesticide can be won the bud that will bloom next day in 5-6 o'clock noon before that day, also can directly get pollen at 6-10 point in morning next day) is about to open (corolla length surpasses 5cm) to the flower pollination of opening within 3 hours for female parent.Concrete operation method is: every morning 7～10, the pollen of getting the cotton male parent bottle of packing into, on little bottle cover, make a call to an aperture, size just in time can be held the column cap turnover of cotton, then female parent is torn corolla (then omitting this step) if flower has been opened, bottle is inverted makes column cap can enter bottle contact, can finish pollinating process (Fig. 9) bottom the tapping bottle with pointing with wherein pollen; The seed that is obtained during cotton harvesting includes cross-fertilize seed and selfed seed.

2) mixed seeds was seeded in seedbed or land for growing field crops in 1 year, application rate suitably increases, then be preferably bunch planting if be planted in the field, 3 seeds in every cave are comparatively suitable, and (present embodiment is selected the land for growing field crops field sowing, bunch planting, 3 seeds in every cave), treat that spray mass percentage concentration behind the cotton tidy seedlings output is 0.003% or 0.005% 2.4-D solution, attention will be sprayed with special-purpose atomizer band spray cap under calm situation, in order to avoid influence other dicotyledonss; Can keep the cotton seedling (cross-fertilize seed) of normal blade according to the true leaf shape in about 15 days behind the spray medicine, remove lopsided blade (selfed seed) and get final product.Figure 10 is for removing male cross-fertilize seed performance in seedling stage (discerning true and false cross-fertilize seed synoptic diagram) from.Later stage transplanting of cross-fertilize seed and field management are promptly removed male cross-fertilize seed F1 from for plant fully with other cotton crossbreeds through the normal cotton seedling that identification keeps, and F1 shows as Fig. 8 for the field of plant.Above-mentioned experimental results show that, 0.003% and 0.005% 2.4-D solution, can make the cotton seedling growth of cross-fertilize seed normal, make the cotton seedling true leaf of non-cross-fertilize seed deformity, under 2.4-D 0.003% and 0.005% activity, its action effect does not have difference, can use the 2.4-D solution-treated of 0.003%-0.005% at ordinary times, the screening cross-fertilize seed.

For removing male cross-fertilize seed of being prepared from, random sampling is planted in the greenhouse after treating the seed results, spray 2.4-D after emerging, the normal true leaf strain number of record after 7-10 days, and carry out as above to the plant of normal true leaf that the described PCR of step 2 detects the normal strain of screening, the ratio that normal strain accounts for total seedling number is the purity of hybrid of this mixed seeds.

According to the method described above, prove through repetition test for many years, in the mixing cotton seeds that step 1) pollination back obtains the ratio of cross-fertilize seed for usually about 67%, and female parent self-cross ratio about 33%; This may be because the pollen of foreign pollen ratio female parent self has more competitive power, and the inventive method has also selected to be beneficial to the time conditions of foreign pollen competitive power, above-mentioned experiment also proves, finally by step 2) cross-fertilize seed (seedling) purity that obtains of screening can reach 100%.

Above-mentioned experiment showed, of the present inventionly removed male cross-breeding technology system from and had three big advantages: (1) breeding cost is low.We were by large-scale experiment in 3 years, if removing directly pollination under the male situation from, every mu only needs recruitment 5.6 hours/day, and the artificial emasculation pollination approximately needs 30 hours/day every day.Therefore, remove male cross-breeding technology from and can save recruitment 81.3%; (2) purity of hybrid can reach 100%.After cotton emerges, utilize 2.4-D to handle, behind thinning rejecting selfed seed, can guarantee that purity of hybrid reaches 100%; (3) freely match combination.This technology only need adopt the male parent of carrying the tfdA gene, and female parent selection is unrestricted, can select for use the locality to have the kind of good economical character or excellent quality, compares with the sterile line technology, and easier acquisition is fit to the advantage cross combination of local ecotope.

Because 2.4-D specially kills the selective herbicide of dicotyledons, so remove male method for crossbreeding from and be suitable for other dicotyledonss outside the cotton equally.

In addition, utilize this carrier, we have also made up 8 of recombinant vectorss with function such as disease-resistant, have also obtained a plurality of transgenosis T3 generation pure and mild colony (Fig. 7) respectively by transgenosis.

More than experiment shows that pSPT carrier of the present invention has following advantage:

(1) genes of interest obtains superpower expression. The Super strong promoter can guarantee to obtain behind the genes of interest conversion of plant high dose and express, to the functional analysis of genes of interest, play a role at aspects such as resistance, output and qualities for improving genetically modified plants simultaneously.

(2) transgenic positive plant (the especially dicotyledon such as cotton) is convenient to simple and easy, quick, accurate screening. Because the dicotyledons such as cotton are very responsive to plant growth regulator 2.4-D, available seedling spraying 2.4-D method is distinguished transgenosis and wild type plant. Be that 0.003% 2.4-D butyl acetate solution sprays the transgenosis seedling with mass percentage concentration, can distinguish normal strain and Abnormal Plants in general 7-10 days, because the transgenic positive plant carries the tfdA gene, therefore anti-2.4-D performance young leaves normal growth; Unusual strain is not owing to then carry the tfdA gene, thereby newly grows blade performance deformity (Fig. 3). Utilize this means when transgenic progeny is screened, accuracy is close to can reach 100%.

(3) distinguishing easily external source imports and endogenous gene. Because clone's gene source is in plant itself usually, for distinguishing transgenosis and the existing gene of plant itself, we have increased the Flag sequence at 5 ' end of genes of interest, on through marker gene identification basis, can also 5 ' the Flag sequences Design of holding all use primer, in conjunction with 5 ' terminal specific primer of foreign gene, only need utilize PCR is that provable positive plant exists foreign gene (Fig. 4) really.

(4) provide irrefutable evidence for the pollen tube transgenic method. The pollen tube channel gene method of cotton is proposed by China scientist, never obtain international mainstream scientist's approval, we utilize this vector construction to comprise the recombinant vector of genes of interest, after utilizing pollen tube channel gene, to the seed mixture that obtains and plant out thus seedling and spray 2.4-D identification, in conjunction with Southern hybridization (Fig. 4) and the Northern hybridization (Fig. 5) to transgenosis T3 generation, advantageously prove the reliability of transgenic positive plant, thereby provide irrefutable evidence for the feasibility of pollen tube channel gene method.

Claims (8)

1. a plant expression vector comprises and expresses tfdA expression of gene box; Described expression cassette is made up of the CaMV35S promotor, tfdA gene and the terminator that connect successively; The nucleotides sequence of described tfdA gene is classified sequence 2 in the sequence table as, and the nucleotides sequence of described CaMV35S promotor is classified sequence 1 in the sequence table as.

2. plant expression vector according to claim 1 is characterized in that: comprise also in the described plant expression vector that Flag label, the nucleotides sequence of described Flag label classify sequence 3 in the sequence table as.

3. plant expression vector according to claim 1 and 2 is characterized in that: the base frame carrier of described plant expression vector is pCAMBIA1300.

4. according to claim 1 or 2 or 3 described plant expression vectors, it is characterized in that: described plant expression vector makes up according to following method:

1) the CaMV35S promotor is connected in the fragment that 5 of tfdA gene ' end obtains and is inserted between the BstXI and XhoI restriction enzyme site of pCAMBIA1300, obtain recombinant vectors A;

2) with the multiple clone site of the 3 described Flag label fragments insertion recombinant vectors A of sequence in the sequence table, obtain described plant expression vector.

5. plant expression vector according to claim 4, it is characterized in that: in the described step 1), the promotor of driving purposes genetic expression replaces with the super strong promoter among the described pCAMBIA1300, and the nucleotides sequence of described super strong promoter is classified sequence 5 in the sequence table as.

6. plant expression vector according to claim 5, it is characterized in that: in the described step 1), the restriction enzyme site of the multiple clone site of described pCAMBIA1300 transform SalI, KpnI, BamI, SpeI, SalI, ApaI, SmaI, SwaI, PstI, HindIII, XbaI and AccIII as.

7. according to claim 4 or 5 or 6 described plant expression vectors, it is characterized in that: described step 2), described Flag label fragment reclaims Flag label fragment earlier with behind XbaI and the HindIII double digestion, inserts between the XbaI and HindIII of recombinant vectors A.

8. the application of any described plant expression vector in cultivating transgene cotton among the claim 1-7.

Images