CN101831461B - Human small RNA-148a expression vector and use thereof - Google Patents
Human small RNA-148a expression vector and use thereof Download PDFInfo
- Publication number
- CN101831461B CN101831461B CN201010161597XA CN201010161597A CN101831461B CN 101831461 B CN101831461 B CN 101831461B CN 201010161597X A CN201010161597X A CN 201010161597XA CN 201010161597 A CN201010161597 A CN 201010161597A CN 101831461 B CN101831461 B CN 101831461B
- Authority
- CN
- China
- Prior art keywords
- small rna
- human small
- expression vector
- cell
- colorectal cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention provides a human small RNA-148a expression vector. In the invention, oligonucleotide segments are designed and synthesized according to the precursor sequence of a human small RNA-148a, and then loaded in a pcDNA6.2-GW/EmGFP-miR expression vector, and the oligonucleotide segments have complementary oligonucleotide sequences SEQ ID No.1 and SEQ ID No.2. The human small RNA-148a expression vector of the invention has a specific human small RNA-148a overexpression characteristic. The vector can be used to transfect colorectal cancer cells and induce the apoptosis of colorectal cancer cells, and can also be used in the preparation of medicaments for promoting the apoptosis of the colorectal cancer cells. Meanwhile, the invention also discloses the use of the human small RNA-148aexpression vector in the preparation of antitumor medicaments taking a BCL2 gene as a target gene.
Description
Technical field
The invention belongs to technical field of biomedical materials, relate to a kind of human small RNA-148 expression vector and this carrier cells transfected and treat the application in the colorectal cancer disease medicament with preparation.
Background technology
The little RNA of people (MicroRNA is that one type of length of finding in recent years is the non-coding small molecule RNA about 20 Nucleotide miRNA), a large amount of research proofs its can discern target gene 3 ' the non-volume district through incomplete complementary transcription after reticent expression of target gene.MiRNA not only when growth, propagation, apoptosis and the differentiation of mammalian cell have to and tissue specificity, and in the generative process of stem cell, equally also play a significant role; If considering intercellular signal transduction and interact, we possibly also need the adjusting of miRNA mediation, also not at all surprising in the different phraseology of the different steps miRNA of different tumours and tumour so.Since Carlo Croce research group in 2002 confirms in chronic bone-marrow-derived lymphocyte white blood disease that first miRNA and tumour have direct relation,, lung cancer, mammary cancer, liver cancer, cancer of the stomach and colorectal cancer etc. have been comprised about the research of tumour and miRNA relates to various tumours.Along with the intervention of miRNA chip technology, it is more and more easier to make the miRNA group learn research.At present with the more many tumours of corresponding healthy tissues in all find the miRNA of up-regulated and downward modulation; The miRNA express spectra can also be judged the somatotype, clinical stages etc. of tumour according to its different composition phraseology except distinguishing tumor tissues and healthy tissues; LuJ etc. analyse through the miRNA group credit that hundreds of example tumor tissues and healthy tissues are carried out system; Success with these stagings with by stages, and they have proved that the miRNA group can better predict the somatotype of tumour and by stages than mRNA express spectra surprisingly.The effect of MiRNA in tumour is similar with encoding sox.Can be used as proto-oncogene equally and work, also can be used as cancer suppressor gene and work; Suppress cancer suppressor gene as the acting miRNA of proto-oncogene through transcribing the back, thereby make its expression decline promote tumour to generate, and suppress tumour formation through transcribing back inhibition proto-oncogene as the acting miRNA of cancer suppressor gene.Therefore, further study the generation in tumour, the mechanism of action and the function of miRNA, will disclose the tumor development process and even establish molecular basis for tumor diagnosis and treatment.
Summary of the invention
The object of the invention provides a kind of human small RNA-148 expression vector, is that the precursor sequence according to human small RNA-148 designs and synthesizes oligonucleotide fragment, is loaded into the pcDNA6.2-GW/EmGFP-miR expression vector, has SEQ ID N
o: 1 with SEQ ID N
o: 2 complementary oligonucleotide sequence, SEQ ID N
o: 1:
5’-TGCTGAGGCAAAGTTCTGAGACACTCCGACTCTGAGTATGATA
GAAGTCAGTGCACTACAGAACTTTGTCTC-3’
SEQ?ID?N
o：2：
5’-CCTGGAGACAAAGTTCTGTAGTGCACTGACTTCTATCATACTCAGAGT
CGGAGTGTCTCAGAACTTTGCCTC-3’；
Small RNA-148 expression vector among the present invention makes up through following method: synthetic two oligonucleotide fragments, positive-sense strand sequence (SEQ ID N
o: 1) and antisense strand sequence (SEQ ID N
o: 2); Above-mentioned synthetic good oligonucleotide is dissolved into 100uM with distilled water, respectively gets 5 μ l mixings, add annealing buffer 2 μ l, supply 20 μ l with distilled water, 95 ℃ were heated 5 minutes, placed the room temperature naturally cooling then 20 minutes.Double chain oligonucleotide after the annealing is diluted to 10nM, gets 4 μ l and 2 μ l pcDNA
TM6.2-GW/EmGFPmiR carrier mixes, and adds 4 μ l and connects damping fluid, supplies behind the 20 μ l 16 ℃ with distilled water and spends the night.Add in the competence intestinal bacteria that 200 μ l prepare connecting product, ice bath is 42 ℃ of heat shocks ice bath 3 minutes after 90 seconds after 30 minutes; Add 800 μ l LB liquid nutrient mediums, 37 ℃, 150 rev/mins are shaken bacterium and get 200 μ l bacterium liquid after 1 hour and evenly coat on the LB agar culture plate of the spectinomycin positive (50 μ g/ml).Be inverted flat board, 12-16h in 37 ℃ of incubators, whether each conversion flat board 3 clones of picking respectively checks order, consistent with the oligonucleotide sequence that designs to insert fragment sequence in the checking recombinant clone.
Another purpose of the present invention's invention provides said human small RNA-148 expression vector and promotes the application in the colorectal cancer apoptosis medicine in preparation.With the BCL2 gene application in the antitumor drug of target gene also simultaneously in preparation.
For validity and the practicality that confirms human small RNA-148 expression vector provided by the present invention; The present invention adopts liposome transfection method colorectal cancer clone RKO cell; Through cell cultures; Extract RNA, adopted stem ring rt fluorescence quantitative PCR detection and changeed the human small RNA-148 of RKO cell then, the result has proved that this carrier can cross the expressing human small RNA-148.
In order to probe into the human small RNA-148 mechanism of action, the pcDNA6.2-GW/EmGFP-human small RNA-148 expression vector that the present invention builds through transfection has been set up human small RNA-148 stable transfection colorectal cancer cell model RKO-miR-148a to the RKO cell.Adopt the Flow cytometry apoptosis, the result finds to compare with the cell model RKO-miR-NTC of transfection control vector, and finder's small RNA-148 has obviously induces the apoptotic effect of RKO; Should act in order further to verify, the present invention adopts human small RNA-148 antisense oligonucleotide antagonism to cross the human small RNA-148 of expression, has the apoptosis-induced effect of human small RNA-148 that antagonism is crossed expression after finder's small RNA-148 is suppressed.In order to inquire into human small RNA-148 cell death inducing mechanism; The present invention has adopted the information biology software prediction target gene of human small RNA-148; And adopting the protein immunoblot method to carry out experimental verification, the result shows that the mechanism of action of human small RNA-148 cell death inducing is relevant with its inhibition BCL2 genetic expression.This human small RNA-148 expression vector has the advantages that specificity is crossed the expressing human small RNA-148, and utilizes this carrier transfection colorectal cancer cell, induces its apoptosis, and the purposes in the preparation treatment colorectal cancer medicine is provided.
Description of drawings
Fig. 1 is the expression of human small RNA-148 among the human small RNA-148 stable transfection colorectal cancer cell model RKO-miR-148, and the expression of human small RNA-148 is apparently higher than control group RKO-miR-NTC.
Fig. 2 induces RKO apoptosis situation for human small RNA-148, and the RKO-miR-148a apoptosis is apparently higher than the RKO-miR-NTC cell, and apoptosis reduces behind employing human small RNA-148 antisense oligonucleotide (Anti-miRNA-148a) the antagonism human small RNA-148.Wherein A figure is the RKO cell without any processing; B figure is the RKO cell of transfection contrast expression vector; C figure is the RKO cell of transfection human small RNA-148 expression vector of the present invention, and D figure is the RKO cell of human small RNA-148 expression vector of the present invention and human small RNA-148 antisense oligonucleotide cotransfection.
Fig. 3 induces the apoptotic quantitative analysis of RKO for human small RNA-148; The RKO apoptosis of transfection human small RNA-148 expression vector of the present invention obviously increases, and RKO cell (miR-148a+Anti-miRNA-148a) apoptosis of human small RNA-148 expression vector of the present invention and human small RNA-148 antisense oligonucleotide cotransfection falls for a short time.
Fig. 4 is a BCL2 expression conditions behind the human small RNA-148 stable transfection colorectal cancer cell; RKO-miRNA-148a cell BCL2 expresses obviously and descends, and BCL2 expresses and raises behind employing human small RNA-148 antisense oligonucleotide (Anti-miRNA-148a) the antagonism human small RNA-148.
Among the present invention, the above with following embodiment in, employed technology comprises gene clone, gene sequencing, cell cultures and cell transfecting equimolecular biology techniques, except that specified otherwise, is the known routine techniques of this area investigative technique personnel; Employed plant and instrument, reagent, cell strain etc. are this area except that specified otherwise investigative technique personnel can obtain through public approach.
Embodiment
Below in conjunction with specific embodiment the present invention is described further, but protection scope of the present invention is not limited in this.
Embodiment one
The human small RNA-148 expression vector establishment
1. the oligonucleotide design is with synthetic: design and synthesize following two oligonucleotide fragments, positive-sense strand (SEQID N
o: 1) be 5 '-TGCTGAGGCAAAGTTCTGAGACACTCCGACTCTGAGTATGATAGAAGTCAGTGCAC TACAGAACTTTGTCTC-3 ', antisense strand (SEQ ID N
o: 2) be 5 '-CCTGGAGACAAAGTTCTGTAGTGCACTGACTTCTATCATACTCAGAGTCGGAGTGT CTCAGAACTTTGCCTC-3 '.
2. the clone of human small RNA-148: above-mentioned synthetic good oligonucleotide is dissolved into 100uM with distilled water, respectively gets 5 μ l mixings, add annealing buffer 2 μ l, supply 20 μ l with distilled water, 95 ℃ of heating 5 minutes were placed the room temperature naturally cooling 20 minutes then.Double chain oligonucleotide after the annealing is diluted to 10nM, gets 4 μ l and 2 μ l pcDNA
TM6.2-GW/EmGFPmiR carrier mixes, and adds 4 μ l and connects damping fluid, supplies behind the 20 μ l 16 ℃ with distilled water and spends the night.Add in the competence intestinal bacteria that 200 μ l prepare connecting product, ice bath is 42 ℃ of heat shocks ice bath 3 minutes after 90 seconds after 30 minutes; Add 800 μ l LB liquid nutrient mediums, 37 ℃, 150 rev/mins are shaken bacterium and get 200 μ l bacterium liquid after 1 hour and evenly coat on the LB agar culture plate of the spectinomycin positive (50 μ g/ml).Be inverted flat board, 12-16h in 37 ℃ of incubators, each conversion flat board 3 clones of picking respectively checks order, and sequencing result shows that the sequence of inserting is consistent with the oligonucleotide sequence of design.
Embodiment two
Human small RNA-148 expression vector cell transfecting and detection
1. plasmid extracts: the mono-clonal of picking among the embodiment one is transferred in the LB liquid nutrient medium of the spectinomycin positive (50 μ g/ml) 220 rev/mins and shaken bacterium and uses adsorption column centrifuging extraction plasmid after 16 hours.
2. cell transfecting: transfection previous day, with 1 * 105 cell shop to 6 orifice plates; The Lipofectmine2000 working instructions operation that transfection method provides with reference to Invitrogen company.Add 10 μ L transfection reagents behind 500 μ L serum free mediums and the 4 μ g plasmid mixings, VOTEX10 is after second, and normal temperature leaves standstill 5min.The gentle cell twice that cleans of PBS adds the substratum that 1.5ml contains serum.The homomixture of above-mentioned plasmid and transfection reagent is added dropwise in the cells and supernatant, simultaneously the slight wobble plate.The lid lid shifts out super clean bench, and is clockwise all around in the plane again, and counterclockwise evenly wabble board is gone into incubator after making it evenly and cultivated.Use blasticidin to carry out drug screening after 24 hours, cell transfer to the 96 orifice plate picking mono-clonal after the screening carries out enlarged culturing.
3. the detection of human small RNA-148: use TRIZOL to extract cell total rna, carry out rt, 100mM dNTPs (with dTTP) 0.15 μ L, MultiScribe by following system (ABI, 4366596,4373130)
TMReverse Transcriptase 1.00 μ L, 10 * Reverse Transcription Buffer1.50 μ L, RNase Inhibitor 0.19 μ L, RT-primer 3.00 μ L, total RNA10ng supplies DEPC water to 15 μ L; 16 ℃ in the rearmounted PCR appearance of mixing, 30 minutes; 42 ℃, 30 minutes; 85 ℃, 5 minutes.Reaction finishes the back according to following system (ABI; 4324018) carry out the fluorescent PCR reaction; TaqMan MicroRNAAssay (20 *) 1.00 μ L; Product from RT reaction 1.33 μ L, TaqMan 2 * Universal PCRMaster Mix 10.00 μ L, Nuclease-free water 7.67 μ L; Rearmounted fluorescent PCR appearance (ABI7900) 95 ℃ of mixing, 10 minutes; 95 ℃, 15 seconds, 60 ℃, 45 seconds, 40 circulations.Obtain the CT value according to fluorescence curve and calculate relative expression quantity.The result is referring to Fig. 1, and the expression of human small RNA-148 is apparently higher than cellular control unit RKO-miR-NTC among the human small RNA-148 stable transfection colorectal cancer cell model RKO-miR-148.
Embodiment three
Human small RNA-148 promotes the colorectal cancer apoptosis
1. apoptosis detects behind the human small RNA-148 expression vector transfection colorectal cancer cell: collecting cell is also estimated cell quantity, and PBS washes 1 time, and 800 μ l binding buffer liquid are washed once, and the adjustment cell concn is 1 * 10
6/ ml gets 100 μ l cell suspensions (1 * 10
5Cell), add 5 μ L Annexin V/FITC, bullet is even, and lucifuge was dyed 10 minutes, added 10 μ L PI, and the upflowing cell instrument is analyzed immediately.Shown in the result schemes referring to C figure among Fig. 2 and B behind the human small RNA-148 expression vector transfection RKO cell apoptosis rate reach 90%, apparently higher than cellular control unit, proved from forward that human small RNA-148 has and obviously induced the apoptotic effect of RKO.
2. apoptosis detects behind the human small RNA-148 antisense oligonucleotide human small RNA-148 that suppressed to express: adopt the human small RNA-148 Antisense OligodeoxynucleotideTransfection Transfection to cross the colorectal cancer cell RKO cell of expressing human small RNA-148; 1 the method for pressing among the embodiment three detects apoptosis; The result is referring to C figure among Fig. 2 and D figure; The RKO apoptosis of human small RNA-148 expression vector and human small RNA-148 antisense oligonucleotide cotransfection obviously descends; Explain to have the apoptosis-induced effect of human small RNA-148 that antagonism is crossed expression after human small RNA-148 is suppressed, proved that human small RNA-148 has and obviously induce the apoptotic effect of RKO from reverse.
3. the quantitative analysis human small RNA-148 is induced the RKO apoptosis: through repeating above-mentioned experiment, the result is referring to Fig. 3, and human small RNA-148 can promote the colorectal cancer apoptosis.
Embodiment four
Human small RNA-148 promotes the colorectal cancer apoptosis through suppressing BCL-2
1. adopt the information biology software prediction BCL-2 be the target gene of human small RNA-148.
2. protein immunoblot detects the expression that human small RNA-148 suppresses BCL-2: preparation 15%SDS-PAGE gel, after boiling 5 minutes with the sample-loading buffer mixing behind the protein quantification, if go up an appearance hole, the 80V electrophoresis changed the 120V electrophoresis into 90 minutes after 30 minutes.Target protein 100V is shifted 100 minutes to pvdf membrane.After the 5% skimmed milk sealing 2 hours, BCL-2 one anti-4 ℃ of incubated overnight are washed fluorescence two anti-hatching 45 minutes behind the film 3 times, wash scanning analysis result behind the film 3 times.The result is referring to Fig. 4, and small RNA-148 stable transfection colorectal cancer cell (RKO-miRNA-148a) BCL2 expresses obviously and descends, and BCL2 expresses and raises behind employing human small RNA-148 antisense oligonucleotide (Anti-miRNA-148a) the antagonism human small RNA-148.
The sequence that the present invention relates to
< 120>human small RNA-148 expression vector and application
<160>2
<210>1
<211>72
<212>DNA
< 213>artificial sequence
<400>1
TGCTGAGGCAAAGTTCTGAGACACTCCGACTCTGAGTATGATAGAAGTC
AGTGCACTACAGAACTTTGTCTC 72
<210>2
<211>72
<212>DNA
< 213>artificial sequence
<400>2
CCTGGAGACAAAGTTCTGTAGTGCACTGACTTCTAT
CATACTCAGAGTCGGAGTGTCTCAGAACTTTGCCTC 72
Claims (2)
1. a human small RNA-148 expression vector promotes the application in the colorectal cancer apoptosis medicine in preparation; Said carrier is that the precursor sequence according to human small RNA-148 designs and synthesizes oligonucleotide fragment; Be loaded into the pcDNA6.2-GW/EmGFP-miR expression vector, have N like SEQ ID
O: positive-sense strand shown in 1 and SEQ ID N
O: the complementary oligonucleotide sequence that the antisense strand shown in 2 forms,
SEQ?ID?NO：1：
5’-TGCTGAGGCAAAGTTCTGAGACACTCCGACTCTGAGTATGATAGAAGTCAGTGCACTACAGAACTTTGTCTC-3’，
SEQ?ID?NO：2：
5’-CCTGGAGACAAAGTTCTGTAGTGCACTGACTTCTATCATACTCAGAGTCGGAGTGTCTCAGAACTTTGCCTC-3’。
2. human small RNA-148 expression vector according to claim 1 is the application in the resistive connection rectum cancer medicine of target gene with the BCL2 gene in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010161597XA CN101831461B (en) | 2010-04-30 | 2010-04-30 | Human small RNA-148a expression vector and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010161597XA CN101831461B (en) | 2010-04-30 | 2010-04-30 | Human small RNA-148a expression vector and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101831461A CN101831461A (en) | 2010-09-15 |
| CN101831461B true CN101831461B (en) | 2012-01-04 |
Family
ID=42715680
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010161597XA Expired - Fee Related CN101831461B (en) | 2010-04-30 | 2010-04-30 | Human small RNA-148a expression vector and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101831461B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102618576A (en) * | 2012-03-12 | 2012-08-01 | 山西农业大学 | Carrier for regulating mammal coat color phenotype and application of carrier |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101657547A (en) * | 2006-07-13 | 2010-02-24 | 俄亥俄州立大学研究基金会 | Be used to diagnose and treat the method and composition based on Microrna of colon cancer-related diseases |
-
2010
- 2010-04-30 CN CN201010161597XA patent/CN101831461B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101657547A (en) * | 2006-07-13 | 2010-02-24 | 俄亥俄州立大学研究基金会 | Be used to diagnose and treat the method and composition based on Microrna of colon cancer-related diseases |
Non-Patent Citations (2)
| Title |
|---|
| 唐彤宇等.基于微小RNA的乙肝病毒RNA干扰表达载体的构建.《中国老年学杂志》.2008,第28卷240-241. * |
| 曹锴等.miRNA在结肠癌早期诊断和筛选中的作用.《世界华人消化杂志》.2009,第17卷(第35期),3615-3619. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101831461A (en) | 2010-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399306A (en) | sgRNA and gene vector for inhibiting bladder cancer by targeting human lncRNA-UCA1 and application of sgRNA | |
| CN102421917A (en) | Means and methods for counteracting, preventing and/or determining heart failure, or a risk of heart failure | |
| CN109136376B (en) | Application of bladder cancer related cyclic RNA, siRNA and application thereof | |
| CN111500734A (en) | Liver cancer diagnosis marker and application thereof | |
| CN108179194A (en) | A kind of tumor cells marker circBIRC6 and its inhibitor and purposes | |
| CN104611449B (en) | Application of the WWP1 genes in osteosarcoma diagnostic products and medicine is prepared | |
| CN105861551A (en) | Vector for jointly expressing MicroRNAs to inhibit breast cancer cell proliferation and construction method and application thereof | |
| CN101831461B (en) | Human small RNA-148a expression vector and use thereof | |
| CN107828872A (en) | The detection reagent of Pygo2 gene expressions in Wnt signal paths based on peptide nucleic acid probe | |
| CN107881173A (en) | A kind of small molecules of miRNA 21 and application thereof | |
| Wcisło-Dziadecka et al. | Effect of adalimumab on the expression of genes encoding TNF-α signal paths in skin fibroblasts in vitro | |
| CN107693535A (en) | A kind of microRNA application | |
| CN110317878A (en) | A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring | |
| CN106167822A (en) | A kind of long-chain non-coding RNA and application thereof | |
| CN112746101B (en) | Osteoporosis diagnosis marker and nucleic acid medicine for promoting osteoporosis bone regeneration | |
| CN112359115B (en) | miR-517a-3p related to cisplatin resistance of tumor cells and application thereof | |
| CN107502610A (en) | One kind targeting STAT3 signal paths miRNA and its preparation method and application | |
| CN108192977A (en) | A kind of and relevant molecular marker of gastric cancer occurrence and development | |
| CN106995857A (en) | Applications of the biomarker ENSG00000267416 in cancer | |
| CN107227362A (en) | A kind of gene related to liver cancer and its application | |
| CN112458089A (en) | Long-chain non-coding gene and related biological material and application thereof | |
| CN108642176A (en) | Applications of the PART1 as breast cancer diagnosis, treatment and prognostic marker | |
| CN111228292B (en) | Application of human TPT1/TCTP gene in preparation of antitumor drugs | |
| CN107875402B (en) | Application of modified siRNA of targeted gene UBE2J2 | |
| CN107881240A (en) | The diagnosis and treatment mark of osteosarcoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120104 |