CN101792793B - Application of miR-182 as glioma generating molecular marker and detective reagent kit thereof - Google Patents
Application of miR-182 as glioma generating molecular marker and detective reagent kit thereof Download PDFInfo
- Publication number
- CN101792793B CN101792793B CN2009100446187A CN200910044618A CN101792793B CN 101792793 B CN101792793 B CN 101792793B CN 2009100446187 A CN2009100446187 A CN 2009100446187A CN 200910044618 A CN200910044618 A CN 200910044618A CN 101792793 B CN101792793 B CN 101792793B
- Authority
- CN
- China
- Prior art keywords
- mir
- glioma
- primer
- peripheral blood
- reagent kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of a miR-182 as a glioma generating molecular marker and a detective reagent kit thereof. On the basis of providing the molecular marker as the early diagnosis of the glioma, the detective reagent kit is prepared, a method for detecting peripheral blood miR-182 is provided and comprises the steps of: (1) collecting a peripheral blood sample of an individual to be detected and extracting total RNA; (2) carrying out reverse transcription on miR-182 specificity into cDNA by using total RNA as a template; and (3) carrying out real-time quantitative PCR amplification by using a miR-182 specific primer for obtaining a relative quantitative delta CT value, and when delta CT <=7.61, promoting that miR-182 expresses positive. The method and the reagent kit can be used for detecting the expression condition of miR-182 in the peripheral blood of all people in order to forecast the suffering risk of the glioma, screening high-risk people of the glioma and carrying out early and quick non-invasive diagnosis on glioma patients.
Description
Technical field
The present invention relates to tumour generation molecular marker, be specifically related to Microrna (miRNA) as the application of molecular marker in the glioma diagnosis.
Background technology
Glioma comprises the tumour in various neuro epitheliums source, is modal malignant tumour in the central nerve neuroma, accounts for 40%～50% of whole intracranial tumorss.Since most of colloid knurls be infiltrative growth and with the surrouding brain tissue obscure boundary; Even the most modern Neurological Surgery technology also is difficult to accomplish the full excision on the pathology; Thereby glioma postoperative recurrence rate is very high; And along with the increase of operation and recurrent number, its grade malignancy has the trend of increase.After using complex treatment measures such as modern microsurgical technique, radiotherapy, chemotherapy, the glioma prognosis of patients is still undesirable, the glioblastoma multiforme of high malignancy (GBM) patient, and 1 year and 2 years survival rates are merely 58% and 31%.The diagnosis of glioma still is in the empirical stage that is the basis with clinical, pathology and iconography information, and one after diagnosing, the overwhelming majority is late period, can not adapt to the demand of glioma being carried out high risk population's examination and early diagnosis far away.Therefore, the glioma early diagnosis marker of seeking non-invasive carries out examination to the high risk population, so that Patients with Brain Tumors is carried out early diagnosis, early treatment.
MicroRNA (miRNA) is the non-coding RNA of the about 21-25 of a length Nucleotide; MiRNA can discern specific target mRNA and bring into play the effect that negative regulator gene is expressed at post-transcriptional level through the degraded and/or the inhibition translation process that promote said target mrna; The research of miRNA in glioma at present still is in the starting stage, but the confirming of special miRNA express spectra in the glioma, for gliomatous Clinics and Practices provides new direction; Correlative study the earliest is to adopt microarray chip technology by people such as Ciafre; In 9 pairs of clinical tumor samples (cancer and cancer beside organism) and 10 kinds of human malignant glioma cell line (is contrast with normal adult and embryo and brain sample), 245 kinds of miRNA are detected, the chip results analysis shows; 9 kinds of miRNAs expression in glioblastoma such as miR-221, miR-21 are significantly raised; Wherein miR-221 rise degree is the highest, and miR-128, miR-181a; The miRNAs that content enriches in cerebral tissue such as miR-181b and miR-181c is down-regulated expression then, and the miRNAs that these expression levels change maybe be closely related with the glioblastoma incidence and development.In addition; Up-to-date discovers, the miRNA that derives from various tissues or the organ can be secreted in the microvascular peripheral blood, in serum and blood plasma, has the miRNA of equivalent; And these miRNA stablized in ten minutes; Be not easy the degraded by blood endogenous and exogenous RNases, the characteristic of this stable existence is enough to demonstrate miRNA in the great potential of seeking aspect the early diagnosis of tumor molecular marker.
Summary of the invention
The object of the invention is to propose miR-182 (miRBase accession number: MI0000272) can be applied to field of medicaments as one of molecular marker of the occurrence risk of glioma, thereby the glioma peripheral blood diagnostic kit that a kind of cost performance is high, be easy to apply is provided.
In the research work in early stage, the contriver finds that there is evident difference in miR-182 in the samples of human glioma of different stage, and along with the pathology rank of glioma increases, the expression of miR-182 obviously raises.Confirm through further research: miR-182 is one and the closely-related tumor gene of glioma incidence and development; In various samples of human glioma, express obviously and raise; And not obvious in other brain tumor tissue (comprising meningioma, acoustic tumor, schwannoma, pituitary adenoma, medulloblastoma etc.) variation, this prompting miR-182 can be used as the diagnosis sign thing of glioma.Research also finds, miR-182 and does not receive degraded and the stable existence of RNA enzyme in the utmost point commitment of tumor invasion both can secrete extremely microvascular peripheral blood from tumor tissues.Therefore, the contriver proposes the molecular marker that peripheral blood miR-182 can be used as the glioma early diagnosis, preparation glioma peripheral blood diagnostic kit.
Detection peripheral blood miR-182 method of the present invention: 1) collect individual peripheral blood sample to be measured, extracted total RNA; 2) be that template is cDNA with miR-182 specificity rt with total RNA; 3) carry out real-time quantitative PCR amplification with the miR-182 Auele Specific Primer, obtain relative quantification Δ CT value, Δ CT value=miR-182 judges in the difference of internal control gene mean CT-number, the prompting miR-182 expression positive when Δ CT≤7.61.
Detection kit of the present invention comprises: 1) extracted total RNA agents useful for same from peripheral blood comprises EDTA anticoagulant tube, lymphocyte separation medium, Trizol, trichloromethane, Virahol, no enzyme water; 2) be that template is the cDNA agents useful for same with miR-182 specificity rt with total RNA, comprise rt damping fluid, magnesium chloride, triphosphoric acid base deoxynucleotide, RNA enzyme inhibitors, reversed transcriptive enzyme and miR-182 specificity reverse transcriptase primer; 3), comprise damping fluid, miR-182 real-time quantitative PCR Auele Specific Primer, SYBR-Green dyestuff, Taq polysaccharase and distilled water with cDNA real-time quantitative PCR agents useful for same; The Auele Specific Primer of said miR-182 is: hsa-miR-182 forward primer: ACTTTTGGCAATGGTAGAACTCAC; Hsa-miR-182 reverse primer: AATCCATGAGAGATCCCTAGCG; Said its forward primer of U6snRNA specific PCR primer is 5 '-ATTGGAACGATACAGAGAAGATT-3 ', reverse primer is 5 '-GGAACGCTTCACGAATT TG-3 '.
Method of the present invention and test kit can detect the expression situation of miR-182 in various crowd's peripheral bloods, thus the prediction glioma ill risk, be used for glioma high risk population's examination, and to the glioma patient make in early days, non-invasive diagnosis fast.In addition, owing to the expression of the miR-182 progress along with glioma pathology rank increases, therefore, the detection of the expression amount of peripheral blood miR-182 also can be used as the important indicator that the glioma prognosis of patients is judged.
Description of drawings
Fig. 1 in situ hybridization detects the tissue slice figure of the expression of miR-182 in normal cerebral tissue and other samples of human glioma of different pathological level;
Fig. 2 real time quantitative PCR method detects the expression of results figure of miR-182 in normal cerebral tissue and brain tumor tissue;
Fig. 3 real time quantitative PCR method detects the expression of results figure of miR-182 in normal people and Patients with Brain Tumors peripheral blood.
Embodiment
In previous research work, when the contriver utilizes the miRNA of differential expression in miRNA chip and SAM software analysis examination 10 routine normal cerebral tissues and the 10 routine samples of human glioma, find that there is notable difference in miR-182 in normal cerebral tissue and samples of human glioma.
Detect research through further miR-182 probe in situ hybridization; The contriver finds: there is evident difference in miR-182 in the samples of human glioma of different stage; And along with the pathology rank of glioma increases; The expression of miR-182 obviously raises by (referring to accompanying drawing 1), and A, B, C, D, E are respectively normal cerebral tissue and glioma I, II, III among Fig. 1, the in situ hybridization of IV level pathological tissue detects the tissue slice figure that the miR-182 probe is expressed.MiR-182 probe in situ hybridization detected result shows: it is that miR-182 is positive that cytolemma or endochylema are brown yellow granule, and feminine gender then cytolemma and endochylema does not all have brown yellow granule.Its positive expression degree adopts PIPS-2020 high-definition color pathology picture and text analytical system to carry out quantitative analysis, every section 5 high power lens visuals field of picked at random (* 400), and the average optical density value of measuring positive reaction under each visual field is as this routine observed value.This experimental result shows: the average optical density value that the miR-182 of I, II, III, IV level glioma expresses is respectively 0.24 ± 0.03,0.38 ± 0.06,0.56 ± 0.04 and 0.65 ± 0.05; Along with the pathology rank raises and increases, than difference significance (P＜0.05) is arranged all with normal cerebral tissue (0.09 ± 0.01).
MiR-182 is one and the closely-related tumor gene of glioma incidence and development simultaneously; In various samples of human glioma, express and obviously raise (referring to accompanying drawing 2); And it is not obvious to express variation at other brain tumor tissue (comprising meningioma, acoustic tumor, schwannoma, pituitary adenoma, medulloblastoma etc.), and this prompting miR-182 can be used as the specific molecular diagnosis marker of glioma.
Research also finds, miRNA and does not receive degraded and the stable existence of RNA enzyme in the utmost point commitment of tumor invasion both can secrete extremely microvascular peripheral blood from tumor tissues.
According to above-mentioned discovery; The contriver has further detected the expression of miR-182 in normal people and Patients with Brain Tumors peripheral blood; Find that miR-182 expresses obviously rising in glioma patient peripheral blood, have notable difference (p＜0.01) (referring to accompanying drawing 3) with expression in normal people's peripheral blood.Even in glial cells hyperplasia (utmost point commitment that glioma takes place) peripheral blood of patients; Still can detect the differential expression (p＜0.05) in miR-182 and the normal people patient's peripheral blood; And the miR-182 expression changes not obvious in other Patients with Brain Tumors to be detected (comprising pituitary tumor, meningioma, acoustic tumor, schwannoma, craniopharyngioma and medulloblastoma etc.); Compare with normal people's peripheral blood miR-182 expression, do not have significant difference (p＞0.05).Prompting peripheral blood miR-182 can be used as the specificity molecular marker of glioma early diagnosis.
Embodiment 1 preparation glioma peripheral blood diagnostic kit (50 secondary response)
1. lymphocyte separation medium 300ml,
2.Hank ' s liquid or PBS 300ml,
3. Virahol 100ml,
4. trichloromethane 100ml,
5.Trizol?50ml，
6.DEPC water or do not have enzyme water 10ml, distilled water 10ml,
7.5 * rt damping fluid 1ml,
8.25mM magnesium chloride 1ml,
9.10mM triphosphoric acid base deoxynucleotide 1ml,
10.5U/ μ l RAN enzyme inhibitors 500 μ l,
11.200U/ μ l MMLV reversed transcriptive enzyme 50 μ l or 25U/ μ lAMV enzyme 50 μ l,
12.2 * real-time quantitative PCR damping fluid 2ml,
13.5U/ μ l Taq polysaccharase 50 μ l,
14.5 μ M hsa-miR-182 specific PCR primer 50 μ l,
Its forward primer is 5 '-ACTTTTGGCAATGGTAGAACTCAC-3 ',
Its reverse primer is 5 '-AATCCATGAGAGATCCCTAGCG-3 '.
15.5 μ M U6snRNA specific PCR primer 30 μ l
Its forward primer is 5 '-ATTGGAACGATACAGAGAAGATT-3 '
Its reverse primer is 5 '-GGAACGCTTCACGAATT TG-3 '
16.10 μ M hsa-miR-182 specificity reverse transcriptase primer 20 μ l (Shanghai Ji Ma Bioisystech Co., Ltd, QPM010).
17.10 μ M U6snRNA specificity reverse transcriptase primer 20 μ l (Shanghai Ji Ma Bioisystech Co., Ltd, QPM010).
The detection of miR-182 in the embodiment 2 peripheral blood samples
1, the extracting of peripheral blood RNA: adopt the EDTA anticoagulant tube, gather individual peripheral blood sample 5ml to be measured.Need gently to shake back and forth anticoagulant tube after the blood sampling, let blood fully contact with the antithrombotics of tube wall, action is soft in case haemolysis, the total RNA of extracting peripheral blood immediately.
1) PMBC extracts: get EDTA anticoagulation 5ml, the centrifugal 6min of 1000rpm draws upper plasma-70 ℃ of preservations in the EP pipe, adds isopyknic Hanks liquid to the PBC of lower floor and puts upside down mixing; Get lymphocyte separation medium 6ml in centrifuge tube, the hemocyte of mixing is slowly injected parting liquid along tube wall, make to keep interface clearly between two liquid, the centrifugal 20min of 2000rpm; Draw mononuclearcell layer between blood plasma and the parting liquid in the EP pipe, 4 ℃ of centrifugal 10min of 6000rpm; Abandon supernatant, add Hanks liquid 1ml piping and druming mixing, 4 ℃ of centrifugal 10min of 6000rpm; Abandon supernatant, add Trizol 1ml piping and druming mixing, leave standstill 5-10min on ice, extract RNA or-70 ℃ of preservations.
2) Trizol extracts cell total rna: add chloroform 200 μ l/mlTrizol in Tube, shake 15-30s with hand, place 5min on ice, 4 ℃ of centrifugal 15min of 12000g; Carefully get the upper strata water and go among the new tube, add the Virahol 0.5ml/mlTrizol mixing of precooling ,-20 ℃ of refrigerators leave standstill 20min, 4 ℃ of centrifugal 10min of 12000g; Abandon supernatant, add the water-reducible ethanol 1-2ml of 75% DEPC mixing, 4 ℃ of centrifugal 5min of 7500g abandon supernatant as far as possible, and drying at room temperature 5-10min adds DEPC water 10-20 μ l dissolving RNA.Concentration and the quality of spectrophotometric instrumentation RNA, OD260/280 ratio are between 1.6-1.8 and carry out the EB gel electrophoresis and detect RNA quality ,-70 ℃ of preservations.
2, miR-182 specificity rt: use the rt test kit (A3500) of Pu Luomaige Promega company and the Hairpin-itTM miR-182 rt Auele Specific Primer (QPM010) of Shanghai Ji Ma Bioisystech Co., Ltd production to carry out rt.The system of 20 μ L reverse transcription reactions is following:
Become divided dose/pipe
5 * rt damping fluid, 4 μ l
Mg ion (25mM) 3 μ l
Triphosphoric acid base deoxynucleotide (10mM) 0.75 μ l
MiR-182 reverse transcriptase primer (1 μ M) 1.20 μ l
RNA enzyme inhibitors (40U/ μ l) 0.25 μ l
MMLV reversed transcriptive enzyme (200U/ μ l) 0.2 μ l
RNA sample (the total 1RNA of 1 μ g) X μ l
No enzyme water To 20 μ l
Before carrying out reverse transcription reaction, must all ingredients except reversed transcriptive enzyme be mixed into the rt mixed solution,, the rt mixed solution be beaten several times with the pipettor suction, can not use vibrator with pointing the pipe that flicks installed reagents.
MiR-182 rt program: 16 ℃ 30 minutes, 42 ℃ 30 minutes, 85 ℃ 10 minutes.
3, miR-182 specificity real-time quantitative PCR: earlier the rt product is diluted to 2 times, then mixing.20 μ L reaction systems are following:
Become divided dose/pipe
2 * real-time quantitative PCR damping fluid, 10 μ l
MiR-182 Auele Specific Primer (5 μ M) 0.4 μ l
CDNA product 2 μ l
Taq polysaccharase (5U/ μ l) 0.2 μ l
Distilled water To 20 μ l
MiR-182 real-time quantitative PCR response procedures: 95 ℃ 3 minutes, 40 circulations, 95 ℃ 12 seconds, 62 ℃ 35 seconds.
Use the SYBR-Green dyestuff to carry out the real-time quantitative PCR amplification.
The Auele Specific Primer of miR-182 is:
Hsa-miR-182 forward primer: ACTTTTGGCAATGGTAGAACTCAC
Hsa-miR-182 reverse primer: AATCCATGAGAGATCCCTAGCG
U6 SnRNA is as internal control gene, and its primer sequence is:
Forward primer: 5 '-ATTGGAACGATACAGAGAAGATT-3 '
Reverse primer: 5 '-GGAACGCTTCACGAATT TG-3 '
4, Δ C
TThe mensuration of index: Δ C
TRefer in the same sample difference of miRNA to be checked and the average Ct value of confidential reference items U6 SnRNA.Be miRNA Δ C
T=miRNA MeanC
T-control MeanC
T, among the present invention, Δ C
TAverage C for miR-182 and U6snRNA
TThe difference of value obtains relative quantification Δ CT value, and judges, when Δ CT≤7.61, and the generation of indication glioma.
The clinical verification of miR-182 detection method in the embodiment 3 peripheral blood samples
With above-mentioned detection method, detected the expression of miR-182 in 22 routine normal people's peripheral bloods and the 106 routine doubtful Patients with Brain Tumors peripheral bloods (the initial patient who newly is admitted to hospital is before the operation).
Compare with the expression of normal people's peripheral blood miR-182, wherein the expression of miR-182 raises in 33 routine patient's peripheral bloods, and its Δ CT all≤7.61; 33 routine patients are performing the operation after pathology confirms: glioma 31 examples, pituitary adenoma 1 example, schwannoma 1 example; 73 routine patients are when peripheral blood miR-182 real-time quantitative PCR detects in addition; It is not obvious that miR-182 changes, and its Δ CT value is equal＞and 7.61, difference does not have significance (p＞0.05).Handling Pathological diagnoses confirms: craniopharyngioma 5 examples, medulloblastoma 4 examples, meningioma 17 examples, pituitary adenoma 21 examples, schwannoma 13 examples, acoustic tumor 10 examples, arteria communicans knurl 1 example, capillary hemangioma 2 examples.
More than research shows; Peripheral blood miR-182 can be used as the specificity molecular marker of glioma patient diagnosis; When Δ CT value≤7.61, the possibility that the indication glioma takes place is 93.94%, detects the expression of peripheral blood miR-182; Have good stability, can be used for glioma high risk population examination and early diagnosis.
SEQUENCE?LISTING
< 110>Central South University
< 120>miR-182 is as the application and the detection kit thereof of glioma generating molecular marker
<140>200910044618.7
<141>2009-10-26
<160>4
<170>PatentIn?version?3.5
<210>1
<211>24
<212>DNA
<213>Homo?sapiens
<400>1
acttttggca?atggtagaac?tcac 24
<210>2
<211>22
<212>DNA
<213>Homo?sapiens
<400>2
aatccatgag?agatccctag?cg 22
<210>3
<211>23
<212>DNA
<213>Homo?sapiens
<400>3
attggaacga?tacagagaag?att 23
<210>4
<211>19
<212>DNA
<213>Homo?sapiens
<400>4
ggaacgcttc?acgaatttg 19
Claims (2)
1. test kit that detects peripheral blood miR-182, comprising: 1) extracted total RNA agents useful for same from peripheral blood comprises EDTA anticoagulant tube, lymphocyte separation medium, Trizol, trichloromethane, Virahol, no enzyme water; 2) be that template is the cDNA agents useful for same with miR-182 specificity rt with total RNA, comprise rt damping fluid, magnesium chloride, triphosphoric acid base deoxynucleotide, RNA enzyme inhibitors, reversed transcriptive enzyme and miR-182 specificity reverse transcriptase primer; 3), comprise damping fluid, miR-182 real-time quantitative PCR Auele Specific Primer, SYBR-Green dyestuff, Taq polysaccharase and distilled water with cDNA real-time quantitative PCR agents useful for same; MiR-182 Auele Specific Primer used in the real-time quantitative PCR process of said miR-182 is: the hsa-miR-182 forward primer: 5 '-ACTTTTGGCAATGGTAGAACTCAC-3 '; The hsa-miR-182 reverse primer: 5 '-AATCCATGAGAGATCCCTAGCG-3 '; Its forward primer of confidential reference items U6snRNA specific PCR primer is 5 '-ATTGGAACGATACAGAGAAGATT-3 ', reverse primer is 5 '-GGAACGCTTCACGAATT TG-3 '.
2. detection kit as claimed in claim 1 is characterized in that: the reversed transcriptive enzyme in the said rt process is the MMLV reversed transcriptive enzyme.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100446187A CN101792793B (en) | 2009-10-26 | 2009-10-26 | Application of miR-182 as glioma generating molecular marker and detective reagent kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100446187A CN101792793B (en) | 2009-10-26 | 2009-10-26 | Application of miR-182 as glioma generating molecular marker and detective reagent kit thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101792793A CN101792793A (en) | 2010-08-04 |
| CN101792793B true CN101792793B (en) | 2012-05-23 |
Family
ID=42585707
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100446187A Expired - Fee Related CN101792793B (en) | 2009-10-26 | 2009-10-26 | Application of miR-182 as glioma generating molecular marker and detective reagent kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101792793B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140464B (en) * | 2010-12-30 | 2013-09-11 | 苏州吉玛基因股份有限公司 | Human miR-1238 antisense nucleic acid and applications thereof |
| CN102140470B (en) * | 2010-12-30 | 2013-09-18 | 苏州吉玛基因股份有限公司 | Human miR-1236 antisense ribonucleic acid and application thereof |
| CN102424843B (en) * | 2011-12-22 | 2013-03-27 | 中南大学 | Application and detection kit of human miR-183/96/182 cluster |
| CN103529200A (en) * | 2013-10-25 | 2014-01-22 | 中南大学 | Colorimetric method for simultaneously detecting multiple miRNA (micro-ribonucleic acid) sequences based on competitive hybridization reaction |
| CN105838822A (en) * | 2016-06-07 | 2016-08-10 | 苏州立特适生物技术有限公司 | MiR-106a-5p hematological malignancy auxiliary diagnostic reagent and application thereof |
| CN107557441B (en) * | 2017-10-27 | 2020-06-05 | 中南大学湘雅医院 | Glioma diagnosis marker Circ2:23823258|23823569 and application |
| CN108753984B (en) * | 2018-08-28 | 2021-07-13 | 北京市神经外科研究所 | Biomarker combination for predicting or diagnosing postoperative recurrence of brain malignant glioma and application and kit thereof |
| CN109234399B (en) * | 2018-11-09 | 2019-08-02 | 山东大学第二医院 | MiR-532-3p is preparing the application in High Grade Gliomas and intracranial lymphoma diagnosis and differential diagnosis preparation |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007114896A2 (en) * | 2006-03-31 | 2007-10-11 | Ordway Research Institute | Prognostic and diagnostic method for cancer therapy |
| WO2008021483A2 (en) * | 2006-08-17 | 2008-02-21 | Ordway Research Institute | Prognostic and diagnostic method for disease therapy |
| WO2008153692A2 (en) * | 2007-05-22 | 2008-12-18 | The Brigham And Women's Hospital, Inc. | Microrna expression profiling of cerebrospinal fluid |
-
2009
- 2009-10-26 CN CN2009100446187A patent/CN101792793B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007114896A2 (en) * | 2006-03-31 | 2007-10-11 | Ordway Research Institute | Prognostic and diagnostic method for cancer therapy |
| WO2008021483A2 (en) * | 2006-08-17 | 2008-02-21 | Ordway Research Institute | Prognostic and diagnostic method for disease therapy |
| WO2008153692A2 (en) * | 2007-05-22 | 2008-12-18 | The Brigham And Women's Hospital, Inc. | Microrna expression profiling of cerebrospinal fluid |
Non-Patent Citations (1)
| Title |
|---|
| 秦娜.microRNA与胶质瘤的研究现状.《中华神经外科疾病研究杂志》.2008,第7卷(第5期),475-477. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101792793A (en) | 2010-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Condrat et al. | miRNAs as biomarkers in disease: latest findings regarding their role in diagnosis and prognosis | |
| CN101792793B (en) | Application of miR-182 as glioma generating molecular marker and detective reagent kit thereof | |
| AU2017213457B2 (en) | Micro-RNA biomarkers and methods of using same | |
| US10457994B2 (en) | 4-miRNA signature for predicting clear cell renal cell carcinoma metastasis and prognosis | |
| Zhang et al. | Circulating microRNA 216 as a marker for the early identification of severe acute pancreatitis | |
| CN102031261B (en) | Serum/plasma miRNA (micro Ribonucleic Acid) marker relevant to gestational diabetes and application thereof | |
| CN102876676B (en) | Blood serum/blood plasma micro ribonucleic acid (miRNA) marker relevant with pancreatic cancer and application thereof | |
| CN103642914B (en) | Plasma/serum circulation microRNA marker related to mlignnt melnom and application of marker | |
| CN106119393B (en) | Plasma miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN105518154B (en) | Brain cancer detection | |
| CN109609633A (en) | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN107475258A (en) | A kind of RNAcircEPSTI1 and its application in three cloudy breast cancer | |
| CN108531586B (en) | Circulating miRNA marker on X chromosome related to breast cancer auxiliary diagnosis and application thereof | |
| CN102443638B (en) | Internal reference for detecting miRNA (micro Ribonucleic Acid) in serum/blood plasma and application of internal reference | |
| CN101560553A (en) | Usage of miR-381 as encephaloma occurrence molecule mark and testing method thereof | |
| CN105624271A (en) | miRNA associated with colorectal cancer and application thereof | |
| Wei et al. | Expression of miR-4739 in gastric cancer and its relationship with clinical pathological features of patients | |
| EP2942399A1 (en) | Method for the diagnosis of breast cancer | |
| CN108753981A (en) | Application of the quantitative detection of HOXB8 genes in colorectal cancer Index for diagnosis | |
| CN107586848A (en) | Glioma prognostic marker circ8:127890589 | 127890998 and application | |
| WO2021159562A1 (en) | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof | |
| CN109563548A (en) | For identifying the in-vitro method of cancer of pancreas or pancreatic intraductal papillary mucinous tumor | |
| CN102424843B (en) | Application and detection kit of human miR-183/96/182 cluster | |
| CN104278100B (en) | MiRNA-188 is preparing the purposes in diagnostic reagent as tagged molecule | |
| CN109295059A (en) | A kind of single stranded RNA of covalent annular closed and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120523 Termination date: 20171026 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |