CN101715487A - influenza b viruses having alterations in the hemaglutinin polypeptide - Google Patents

influenza b viruses having alterations in the hemaglutinin polypeptide Download PDF

Info

Publication number
CN101715487A
CN101715487A CN200880020720A CN200880020720A CN101715487A CN 101715487 A CN101715487 A CN 101715487A CN 200880020720 A CN200880020720 A CN 200880020720A CN 200880020720 A CN200880020720 A CN 200880020720A CN 101715487 A CN101715487 A CN 101715487A
Authority
CN
China
Prior art keywords
virus
cell
type
influenza virus
influenza
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN200880020720A
Other languages
Chinese (zh)
Inventor
H·金
陈忠英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
MedImmune LLC
MedImmune Vaccines Inc
Original Assignee
MedImmune Vaccines Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MedImmune Vaccines Inc filed Critical MedImmune Vaccines Inc
Publication of CN101715487A publication Critical patent/CN101715487A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5254—Virus avirulent or attenuated
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16211—Influenzavirus B, i.e. influenza B virus
    • C12N2760/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16211—Influenzavirus B, i.e. influenza B virus
    • C12N2760/16234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16211—Influenzavirus B, i.e. influenza B virus
    • C12N2760/16241—Use of virus, viral particle or viral elements as a vector
    • C12N2760/16243—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16211—Influenzavirus B, i.e. influenza B virus
    • C12N2760/16261—Methods of inactivation or attenuation

Abstract

The present invention encompasses methods of producing influenza B viruses in cell culture. The influenza B viruses may have desirable characteristics, such as enhanced replication in eggs and may be used, for example, in vaccines and in methods of treatment to protect against influenza B virus infection.

Description

Vicissitudinous Type B influenza virus in the hemagglutinin polypeptide
Background of invention
Influenza virus is formed with the outer lipoprotein envelope with stromatin lining by comprising the genomic internal ribosomal nucleoprotein core of sectional single stranded RNA.A type influenza virus and Type B influenza virus respectively contain the negative polarity single stranded RNA of 8 sections.11 kinds of albumen of 8 locus section codings of Type B influenza virus.All components of 3 kinds of maximum genes encoding RNA polymerase, PB1, PB2 and PA.Section 4 coding HA albumen.Section 5 coding NP.Section 6 coding NA albumen and NB albumen.These two kinds of albumen of NA and NB are all from two overlapping reading frame translations along anti-mRNA.The section 7 of Type B influenza virus also encode two kinds of albumen: M1 and BM2.Minimum two kinds of products of section coding: NS1 translates from full-length RNA, and NS2 is from the mRNA variant translation of montage.
The vaccine that can produce the specificity protection immunne response of influenza virus was produced more than 50 years.These vaccines can be characterized by the live-virus vaccine of whole virus vaccine, split-virus vaccine, SAV and attenuation.Though appropriate formulation any in these vaccine types all can produce the general immune response, the live-virus vaccine of attenuation can also be in respiratory tract internal stimulus local mucous membrane immunizing power.
FluMist TMIt is a kind of attenuated live vaccine, can protect children and adult not to suffer from influenza (Belshe etc., (1998), " the attenuated live influenza vaccines are to children's effect in the trivalent nose of acclimatization to cold " (The efficacy oflive attenuated, cold-adapted, trivalent, intranasal influenza virus vaccine inchildren), N Engl J Med 338:1405-12; Nichol etc., (1999), " the attenuated live influenza vaccines are to adult effect health, work in the nose: random contrast clinical trial " (Effectiveness oflive, attenuated intranasal influenza virus vaccine in healthy, working adults:arandomized controlled trial), JAMA 282:137-44).FluMist TMVaccine strain contains the HA and the NA constant gene segment C of the wild-type strain that derives from current popular and derives from common main donor virus (common master donor virus) six constant gene segment Cs (MDV).
Up to the present, all commercialization influenza vaccines of the U.S. all breed in containing the embryo egg.Many strains poor growth in egg of Type B influenza virus, " adaptation egg " must become.Yet the Type B influenza virus causes the amino-acid residue 196 of HA polypeptide or the glycosylation site that the forfeiture N-of 197 places connects to the adaptability of egg.The antigenicity and the corresponding vaccine potency of the glycosylation site forfeiture influence virus that N-connects.Stablizing N-in the Type B influenza virus that grows in the egg, to connect glycosylation site significant for Type B production of Influenza virus etc.
Summary of the invention
An embodiment of the invention comprise the method for preparing the Type B influenza virus.Introducing in Type B influenza virus gene group causes the aminoacid replacement of 141 of HA to become arginic sudden change.The Type B influenza virus gene group of sudden change is duplicated under the condition that produces the Type B influenza virus.
Another embodiment of the present invention comprises the method for preparing the Type B influenza virus.A plurality of carriers are introduced a group host cell.Described carrier comprises corresponding to following nucleotide sequence: (a) at least 6 internal gene group sections of the first Type B strains of influenza viruses and (b) one or more genome sections of coding HA and NA polypeptide at least the second Type B strains of influenza viruses.The HA polypeptide comprises arginine at amino acid/11 41 places.This host cell group cultivates in the temperature that is no more than 35 ℃.Reclaim influenza virus.
The accompanying drawing summary
Fig. 1: the synoptic diagram of pAD3000 plasmid.
Fig. 2: the synoptic diagram that produces 8 pUC pUCs of Type B influenza virus.
Fig. 3 A-D:A and B characterize recombinant mdv-B virus by RT-PCR; C and D characterize reorganization B/Yamanashi/166/98 virus by RT-PCR.
The sequence of the pAD3000 of Fig. 4 A and B:GeneBank form (SEQ ID NO:3).
The sequence alignment of Fig. 5 A-AE:MDV-B and 8 kinds of plasmids, A-E, PB1 section (SEQ IDNO:4); F-J, PB2 section (SEQ ID NO:5); K-O, PA section (SEQ ID NO:6); P-S, HA section (SEQ ID NO:7); T-W, NP section (SEQ ID NO:8); X-Z, NA section (SEQ ID NO:9); AA-AC, M section (SEQ ID NO:10); AD-AE, NS section (SEQ ID NO:11).
Fig. 6: the RT-PCR product that the HA of the Type B strains of influenza viruses that increases simultaneously and NA section obtain.
Fig. 7: the histogram of describing the relative titre of reorganization and reprovision virus.
Fig. 8: the synoptic diagram that in PA, NP and M1 albumen, contains three-genetic recombinants of wild-type residue.
Fig. 9: the growth tabulation of list-gene and two-gene recombined virus.
Figure 10: in the nucleoprotein corresponding to the tabulation of the amino-acid residue of non--ts phenotype.
Figure 11: the histogram that the difference of description reprovision virus is duplicated.The ash frame table shows the wild-type amino acid residue.It is 2.0log (ts) that dotted line represents to block temperature (shut-off temperature) 10
Near Figure 12: the comparison of the HA sequence 196/197 glycosylation site of several egg amplification Type B strains of influenza viruses.Victoria pedigree virus and reference strain B/Victoria/2/87 (SEQ ID NO:12) comparison.Yamagata pedigree virus and B/Yamagata/16/88 (SEQ ID NO:13) virus.Only show the residue that is different from the reference strain in the comparison.Underscore and arrow have marked 196/197 possible N-glycosylation site (N-X-T/S).Aminoacid deletion in ". " expression B/Yamagata pedigree." x " represents kilnitamin (mixed amino acid).
Figure 13: by western blotting checking HA glycosylation.With 10%SDS-PAGE to the B/Shanghai/361/02 (B/SH) of 196-199 sequence shown in having, 6: 2 B/Jilin/20/03 (B/JL) and 6: 2B/Jiangsu/10/03 (B/JS) carries out electrophoresis.Utilize the anti-HA antibody of polyclone, detect HA1 and HA2 albumen by western blotting.Underscore is represented the original series that exists in the viral egg isolate.
Figure 14: the virus that contains arginic egg cultivation at HA residue 141 places keeps the glycosylation (site) at residue 196-197 place.141 and 196/197 place have shown in 6: 2 B/Shanghai/361/02 (B/SH), 6: 2 B/Ohio/1/05 (B/Ohio) and 6 of residue: 2B/Jiangsu/10/03 (B/JS) cultivates in egg, with 10%SDS-PAGE virus is carried out electrophoresis.Utilize the anti-HA antibody of polyclone, detect HA1 and HA2 albumen by western blotting.Move slower HA1 and show that 196/197 site is by glycosylation, shown in *.Underscore is represented the original series that exists in the viral egg isolate.
Describe in detail
The present invention includes by carrier being introduced the system that cultured cell produces the Type B influenza virus. The Type B influenza virus that the method produces can have impact virus replication capacity in egg at ad-hoc location, maybe can affect the amino acid residue of the feature after virus copies in egg.
Unless otherwise defined, all Science and Technology terms are interpreted as having and the conventional identical meanings of using of the technical field of the invention. For purposes of the present invention, defined following term.
" nucleic acid ", " polynucleotide ", " polynucleotide sequence " and " nucleotide sequence " can be strand or double-stranded DNA Nucleotide or ribonucleoside acid polymer, or its mosaic or analogue.These terms can also comprise the polymkeric substance of natural nucleus glycoside acid-like substance, and it has the essential attribute of natural nucleotide, can be to hybridize single-chain nucleic acid (for example peptide nucleic acid(PNA)) with the similar mode of natural generation Nucleotide (as peptide nucleic acid(PNA)).
" gene " refers to have any nucleic acid of biological function.Gene comprises encoding sequence and/or the required adjusting sequence of its expression." gene " can refer to concrete genome sequence, also refers to cDNA or mRNA that genome sequence is coded.
Gene also comprises the nucleic acid segment of non-expression, as forms other proteic recognition sequences.The adjusting sequence of non-expression comprises " promotor " and " enhanser ", thereby adjusting albumen such as transcription factor can be adjoined or near sequence in conjunction with transcribing with it.The promotor of " tissue specificity " or enhanser are at certain particular tissue type or cell type, or regulate the promotor or the enhanser of transcribing in the broad variety.
" carrier " can be the instrument that is used between microorganism, cell or cellular component propagation and/or transfer nucleic acid.Carrier comprises plasmid, virus, phage, provirus, phagemid, transposon and artificial chromosome etc., but carrier self-replicating or be incorporated in the karyomit(e) of host cell.Carrier can also be naked RNA polynucleotide, naked DNA polynucleotide, by being positioned at polynucleotide, poly-lysine link coupled DNA or RNA, peptide link coupled DNA or RNA that same intrachain DNA and RNA form, liposome link coupled DNA etc., these carriers can not self-replicating.
" expression vector " can be can start expression and duplicate the carrier that mixes nucleic acid wherein, as plasmid.Expressed nucleic acid can " operability connection " in promotor and/or enhanser, and be subjected to the transcriptional control of promotor and/or enhanser.
" two-way expression vector " is characterized by usually with respect to the nucleic acid between two promotors, opposite two alternative promotors on direction, thus can begin to express to transcribe out just (+) or positive-sense strand and negative (-) or antisense strand RNA in either direction.In addition, two-way expression vector can be the ambisense carrier, and virus mRNA and virus genome RNA (for example, cRNA) are expressed from same chain.
When " isolating " refers to biologic material, for example when nucleic acid or protein, its can be substantially free of in its natural surroundings with its normally together or the biomaterial of interactional component.Isolating material can also be chosen wantonly and comprise its natural surroundings, as non-existent material in the cell.
" recombinant chou " can be represented through material (as nucleic acid or albumen) artificial or synthetic (non-natural) change.This change can be to being in its natural surroundings or state, or the material that takes out from its natural surroundings or state carries out.
Reprovision virus comprises and contains the heredity that is derived from more than one parental virus strains or source and/or the virus of polypeptide fraction.For example, 7: 1 reassortants comprise 7 the viral genome sections (or constant gene segment C) that come from first parental virus and a viral genome section of second parental virus, as, the section of coding hemagglutinin or neuraminidase.6: 2 reassortants comprise 6 genome sections of first parental virus, and modal is two genome sections of 6 internal gene and second parental virus, for example hemagglutinin and neuraminidase (coding section).6: 1: 1 reassortants comprise 1 genome section of the 3rd parental virus of 1 genome section of second parental virus of 6 genome sections (modal is 6 internal gene), coding hemagglutinin of first parental virus and coding neuraminidase.Described 6 internal gene also can be those genes of a plurality of parental virus.
Introducing carrier or nucleic acid can refer to nucleic acid is mixed in eucaryon or the prokaryotic cell prokaryocyte.Carrier or nucleic acid can mix cell by mixing its genome (for example, karyomit(e), plasmid, plastid or Mitochondrial DNA), can change into self-replicating or can transient expression (for example, transfection mRNA).Introducing comprises such as " infection ", " transfection ", " conversion " and methods such as " transductions ".Can (lipofection) nucleic acid be introduced cell by the transfection (fat transfection) of electroporation, calcium phosphate precipitation or lipid mediation.
Host cell can be to contain heterologous nucleic acids, as carrier, and the cell of support nucleic acid replication and/or expression.Host cell can be prokaryotic cell prokaryocyte such as intestinal bacteria, or eukaryotic cell such as yeast, insect cell, amphibian animal cell, birds cell or mammalian cell, comprises people's cell.Host cell comprises Vero cell (African green monkey kidney cell), Per.C6 cell (people embryo retinene cell), bhk cell (baby hamster kidney cell), former generation chicken nephrocyte (PCK), Ma-Da Er Shi (Madin-Darby) dog kidney (MDCK) cell, Ma-Da Er Shi ox kidney (MDBK) cell, 293 cells (as the 293T cell) and COS cell (as COS1, COS7 cell).The term host cell also comprises the combination or the mixture of cell, as the mixed culture (for example, Vero and CEK cell) of different cell types or clone.For example, the PCT/US04/42669 that submitted on December 22nd, 2004 has described the co-cultivation of electroporation Vero cell.
Compare with 33 ℃, temperature sensitive (ts) virus of Type B strains of influenza viruses descends 100 times or more 37 ℃ titre.The virus of acclimatization to cold (ca) usually shows 25 ℃ being grown in 100 times of its 33 ℃ of growths.(att) of attenuation virus in the upper respiratory tract of ferret, duplicate usually but in lung tissue, detect less than, can not cause that influenza sample disease appears in animal.Growth is to measure the virus quantity of representing by titre, plaque size or form, pellet density or well known to those skilled in the art other.
Engineered virus, viral nucleic acid or encoding viral product are to contain by recombination method as polypeptide, vaccine, introduce virus, nucleic acid or the product of at least one sudden change as directed mutagenesis, PCR mutagenesis etc.The engineered virus (or virus composition or product) that contains one or more coding mutations and/or aminoacid replacement refers to that the viral genome or the genome section of coding virus (or virus composition or product) are not to be derived from natural origin, as existing zoo virus strain natural generation or by non-recombination method (as going down to posterity) preparation 25 ℃ of following progressions, for example wild-type or acclimatization to cold A/Ann Arbor/6/60 or B/Ann Arbor/1/66 strain.
Carrier
In the certain methods that the present invention includes, each the viral genome section corresponding to 8 sections of Type B influenza virus can be inserted variety carrier for operation with produce influenza virus.This variety carrier can comprise 8 kinds of carriers; Comprise 8 kinds of carriers corresponding to the nucleotide sequence of 8 genome sections of one or more Type B influenza viruses.This variety carrier can comprise more or less carrier.For example, this variety carrier can comprise 11 kinds of carriers; Comprise 11 kinds of carriers corresponding to the nucleotide sequence of 11 kinds of Type B influenza virus protein encoding sequences.Perhaps, this variety carrier can comprise a kind of carrier; Each a kind of carrier that comprises 8 genome sections of one or more Type B influenza viruses.This variety carrier also can comprise 2,3,4,5,6,7,9 or 10 kind of carrier.
Carrier can be virus vector, plasmid, clay, phage or artificial chromosome.If carrier is a plasmid, plasmid can provide can be in bacterium and eukaryotic cell one or more replication orgin of performance function, and optional mark is so that screening or select to mix the cell of this plasmid sequence.Exemplary carrier is pAD3000 shown in Figure 1.
If carrier is a plasmid, this plasmid can be two-way expression vector, and this carrier can start transcribing of viral genome section on either direction, thereby produces (+) chain RNA and (-) chain viral RNA molecule.For realizing bidirectional transcription, each viral genome section all is inserted in the carrier that contains two independent startup at least, such first rna polymerase promoter (being Pol I) can be transcribed the copy of virus genome RNA from a chain, and the synthetic virus mRNA of second rna polymerase promoter (being Pol II).Therefore, two promotors are arranged in the opposite direction, and at least one is fit to insert the cloning site (being restriction endonuclease recognition sequence) of virus genome RNA section side joint, preferred unique cloning site.Perhaps, can use " ambisense " carrier, wherein (+) chain mRNA and (-) viral RNA (for example, cRNA) are transcribed from same chain of this carrier.
Expression vector
It is synthetic with mediation mRNA that influenza virus gene group section operability to be expressed is connected in suitable transcriptional control sequence (promotor).Various promotors all are applicable to transcribing with regulation and control influenza virus gene group section in the expression vector.In some embodiments, when for example carrier was plasmid pAD3000, used promotor was cytomegalovirus (CMV) dna dependent rna polymerase II (PolII) promotor.If desired,, also can replace to induce RNA to transcribe under given conditions, perhaps in specific tissue or cell, transcribe with other promotor for example for the control condition expression.Many viruses and Mammals can be used as people's promotor, perhaps can separate according to specific purposes.For example, other promotor that obtains from animal and Human virus's genome comprises the promotor and the miscellaneous retroviruses promotor of adenovirus (as adenovirus 2), papillomavirus, hepatitis B virus, polyomavirus and simian virus 40 (SV40).Mammalian promoter comprises actin promoter, immunoglobulin promoter, heat-inducible promoter etc.In addition, phage promoter also can with the coupling of homologous RNA polymerase, as the T7 promotor.
Optional strengthen and transcribe by comprising enhancer sequence.Enhanser is generally shorter, and about 10-500bp is a kind of cis-acting DNA element, can strengthen with promotor to transcribe.From mammalian genes (oxyphorase, elastoser, albumin, alpha-fetoprotein and Regular Insulin) and eukaryotic cell virus, many enhancer sequence have been separated.Enhanser can be connected to 5 ' or 3 ' position of allogeneic coding sequence in the carrier, but general 5 ' of all being inserted into promotor.Usually, select promotor and transcribe enhancement sequences (if necessary) to optimize expression (Scharf etc., (1994) " heat stress promotor and transcription factor " (Heat stress promoters andtranscription factors) the Results Probl Cell Differ 20:125-62 of allogeneic dna sequence DNA in the host cell type that it is introduced; Kriegler etc., (1990) " assembling of enhanser, promotor and splice site is with the expression of control metastatic gene " (Assembly ofenhancers, promoters, and splice signals to control expression of transferredgenes) Methods in Enzymol 185:512-27).Amplicon is also optional to contain ribosome bind site or internal ribosome entry site (IRES) so that begin translation.
Carrier of the present invention also can comprise the required sequence of Transcription Termination and stable mRNA, as polyadenylic acid site or terminator sequence.This sequence places the 5 ' non-translational region of eucaryon or viral DNA or cDNA usually, also places 3 ' non-translational region sometimes.In one embodiment, for example relate in the embodiment of plasmid pAD3000, SV40 polyadenylic acid sequence provides the polyadenylic acid signal.
In addition, as mentioned above, expression vector is optional to comprise one or more selectable marker gene to provide the screening transformed host cell required phenotypic character, and except the listed gene in front, marker such as Tetrahydrofolate dehydrogenase or neomycin resistance all are suitable for selecting eukaryotic cell culture.
The carrier that contains above-mentioned suitable dna sequence dna and suitable promotor or control sequence can be used for transforming the host cell that allows protein expression.
Other Expression element
The proteic genome section of encoding influenza virus can comprise the required any extra sequence of this section expression.For example, can comprise specific start signal to help effectively to translate allogeneic coding sequence.These signals comprise, for example ATG initiator codon and adjoin sequence.In order to ensure the whole protein of this genome section coding of translation, in the correct frame of initiator codon insertion with respect to viral protein.Exogenously transcribing element and initiator codon can be various sources, can be natural, also can be synthetic.Can improve expression efficiency by including the enhanser that is suitable for used cell system in.
Additional Expression element of coding such as extra polynucleotide sequences such as signal sequence, secretion or positioning sequence can mix carrier, usually with the same frame of interested polynucleotide sequence, thereby, for example make expression of polypeptides target required cell compartment, film or organoid, perhaps be secreted in the cell culture medium.These sequences are well known by persons skilled in the art, comprise secretion leading peptide, organoid target sequence (being detained signal, mitochondrial transport sequence as nucleus positioning sequence, ER), film location/anchor series (as stopping to transport sequence, GPI anchor series) etc.
Internal gene group section
The internal gene group section of Type B strains of influenza viruses can be the internal gene group section of one or more main donor Type B influenza viruses.Can select described one or more main (donor) Type B influenza viruses according to the relevant desired characteristic of vaccine administration.For example, can select main donor Type B strains of influenza viruses according to attenuation phenotype, acclimatization to cold and/or temperature sensitivity.Thus, ca B/Ann Arbor/1/66 or the engineered Type B strains of influenza viruses that mixes listed one or more aminoacid replacement of table 17 can be main donor Type B strains of influenza viruses.These aminoacid replacement can comprise the replacement that is positioned at next place or many places: PB2 630PA 431PA 497NP 55NP 114NP 410NP509; M1 159And M1 183Described aminoacid replacement can comprise following one or more: PB2 630(S630R); PA 431(V431M); PA 497(Y497H); NP 55(T55A); NP 114(V114A); NP 410(P410H); NP509 (A509T); M1 159(H159Q) and M1 183(M183V).Aminoacid replacement can comprise the replacement that is positioned at following whole positions: PB2 630PA 431PA 497NP 55NP 114NP 410NP509; M1 159And M1 183Replacement can be following whole: PB2 630(S630R); PA 431(V431M); PA 497(Y497H); NP 55(T55A); NP 114(V114A); NP 410(P410H); NP509 (A509T); M1 159(H159Q) and M1 183(M183V).
Can be (promptly with one or more main donor Type B strains of influenza viruses, PB1, PB2, PA, NP, NB, M1, BM2, NS1 and NS2) 6 internal gene group sections and strain in the antigenicity coideal, for example expection can cause the hemagglutinin and the neuraminidase section co-transfection of the strain of tangible part or whole influenza infection to go into proper host cell.Reprovision virus is at the suitable temp of efficient recovery, for example be equal to or less than 35 ℃, 30 ℃-35 ℃ according to appointment, 32 ℃-35 ℃ according to appointment, 32 ℃-34 ℃ according to appointment, or about 30 ℃ or about 31 ℃ or about 32 ℃, or about 33 ℃ or about 34 ℃ or about 35 ℃ under, after in cell culture, duplicating, reclaim reprovision virus.The virus that reclaims can be duplicated in containing the embryo egg.The virus that reclaims can be duplicated in cultured cells.Can utilize denaturing agent, for example formaldehyde or the beta-propiolactone deactivation recovery virus of in containing embryo egg or culturing cell, duplicating.
The Type B influenza virus that attribute changes
Thereby the inventive method comprises that also introducing sudden change forms aminoacid replacement at 141 places, HA position.Compare with the unsubstituted influenza virus of HA, this sudden change can strengthen the ability that the Type B influenza virus is duplicated in containing the embryo egg.The replacement at 141 places, HA position also allows influenza virus to keep the glycosylation at HA amino-acid residue 196/197 place.The replacement at 141 places, HA position also can obviously not change the antigenicity of HA.The replacement at 141 places, HA position can be to replace arginine, Histidine or halfcystine.
Compare with the influenza virus of unmodified, in HA, introduce aminoacid replacement can duplicate the Type B influenza virus in egg ability enhancing at least 10% or at least 20% or at least 30% or at least 40% or at least 50% or at least 60% or at least 70% or at least 80% or at least 90% or at least 100% or at least 200% or at least 300% or at least 400% or at least 500%.The titre of replication enhanced virus can be 5.0log at least in egg 10PFU/ml, 6.0log at least 10PFU/ml, 6.5log at least 10PFU/ml, 7.0log at least 10PFU/ml, 7.25log at least 10PFU/ml, 7.5log at least 10PFU/ml, 7.75log at least 10PFU/ml, 8.0log at least 10PFU/ml, 8.25log at least 10PFU/ml, 8.5log at least 10PFU/ml, 8.75log at least 10PFU/ml, 9.0log at least 10PFU/ml or 9.5log at least 10PFU/ml.Compare with the influenza virus of unmodified, replication enhanced Type B influenza virus has also kept the HA glycosylation at amino acid residue position 196/197 place in egg.
Compare with the virus of unmodified, introduce the antigenicity that aminoacid replacement also can obviously not change the influenza virus of replacement.The antigenicity of the influenza virus that replaces and the difference of unmodified virus are less than 5%, 10%, 20%, 25%, 30%, 40% or 50%.The method of measuring virus antigenicity is well known in the art.
The sudden change that introducing causes 141 places, HA residue position that aminoacid replacement takes place can be regulated the receptor-binding activity of HA.The receptor-binding activity of HA include but not limited to HA be present on cell surface glycoprotein or the glycolipid sialic acid residues (for example, 2, the sialic acid that 6-connects-galactosyl part [Sia α (2,6) Gal] and 2, the sialic acid that 3-connects-galactosyl part [Sia α (2,3) Gal]) combination.Check HA bonded method is well known in the art.The sudden change that introducing causes HA residue 141 places that aminoacid replacement takes place can strengthen HA and [Sia α (2,3) Gal] part combination.In (for example) well known to those skilled in the art hemagglutination test (hemaagglutination assay), strengthen at least 10% or at least 20% or at least 30% or at least 40% or at least 50% or at least 60% or at least 70% or at least 80% or at least 90% or at least 100% or at least 200% with the combination of [Sia α (2,3) Gal] part.
Type B influenza virus variant also can have following one or more attributes, comprises attenuation, acclimatization to cold, temperature sensitive or their any combination.Type B influenza virus variant can be because of having mixed main donor Type B influenza virus, for example the internal gene group section of influenza B/Ann Arbor/1/66 and have in these attributes one or more.
Described Type B influenza virus variant can be included in 141 any Type B influenza viruses with HA polypeptide of glycine residue.Described Type B influenza virus HA polypeptide can be the HA polypeptide of following strains of influenza viruses: B/Victoria/2/87, B/Hong Kong/330/01, B/Brisbane/32/02, B/Malaysia/2506/04, B/Hawaii/13/04, B/Ohio/1/05, B/Yamagata/16/88, B/Yamanashi/166/98, B/Johannesburg/5/99, B/Vicotria/504/00, B/Shanghai/361/02, B/Jilin/20/03 or B/Florida/7/04.
Cell cultures
In the certain methods that the present invention includes, a plurality of carriers are introduced host cell.These host cells comprise that for example Vero cell, Per.C6 cell, bhk cell, mdck cell, 293 cells and COS cell comprise 293T cell, COS7 cell.Perhaps, can adopt to comprise in the above clone two kinds, for example mdck cell and 293T or COS cell unite cultivation, for example ratio is 1: 1.Can be at the controlled humidity and the CO that are fit to keep neutral buffered pH (for example, pH is between 7.0-7.2) 2Under the concentration, cell is maintained in the suitable commercially available culture medium, for example added the serum improved Eagle substratum of Dulbecco of (as, 10% foetal calf serum), or maintained in the serum free medium.Substratum is optional (for example to contain microbiotic, penicillin, Streptomycin sulphate etc.) preventing bacterial growth, and/or extra nutrition, for example L-glutaminate, Sodium.alpha.-ketopropionate, non-essential amino acid, extra additive is to promote growth characteristics, for example trypsinase, beta-mercaptoethanol etc.
Method for culturing mammalian cells is widely reported, be those skilled in the art will know that these methods.Universal method sees, for example Freshney (1983) " animal cell culture: the basic fundamental handbook ( Culture Of Animal Cells:Manual of Basic Technique), Arl Inc. (Alan R.Liss), New York; Paul (1975) " cell and tissue culture " ( Cell and Tissue Culture), the 5th edition, livingston company (Livingston), Edinburg; Adams (1980) " biochemist is used for biological chemistry and Molecular Biology Lab's technology of cell cultures " ( Laboratory Techniques in Biochemistry And Molecular Biology-Cell Culture for Biochemists), Work and Burdon (volume) Elsevier, Amsterdam.The details of the interested especially tissue culture method of produced in vitro influenza virus is seen, Merten etc. for example, (1996) " produce the influenza virus that is used for vaccine production " (Production of influenza virus in cell cultures for vaccine preparation) in cell culture. publish in Cohen and Shafferman (volume) " new departure of vaccine design and production " ( Novel Strategies In Design and Production of Vaccines), it includes this paper by reference in full in.In addition, by normal experiment the changing form of these methods of the present invention of being not difficult to determine to be applicable to.
Can in containing serum or serum free medium, cultivate the cell of producing the Type B influenza virus.In some cases, for example be the virus of preparation purifying, cultivating host cell under serum-free condition is ideal.
Can any scale culturing cell.Cell can adopt on a small scale, the following substratum of 25ml for example, shaking culture in culture tube or culturing bottle or big culturing bottle, in rolling bottle, or the microcarrier bead in culturing bottle, bottle or reactor is (as the DEAE-Dextran microcarrier bead, as many Mu Saier company (Dormacell), (Pfeifer of PL company; Langen); Super pearl (Superbead), FL company (FlowLaboratories); Styrol copolymer-three-methylamine pearl, as Heineken company (Hillex), Suo Heer company (Solohill), AA company (Ann Arbor)) go up and cultivate.Microcarrier bead is a kind of bead (diameter is the 100-200 micron), for the growth of the adherent cell in the unit volume cell culture fluid provides big surface-area.For example, 1 liter of substratum can comprise the microcarrier bead more than 2,000 ten thousand, provides above 8000mm 2Growth surface.For the commercialization production of virus, as production of vaccine, culturing cell is an ideal in bio-reactor or fermentor tank.The volume of available bio-reactor can from below 1 liter to more than 100 liters, as this nimonic company of Austria (Osmonics, Minnetonka, Cyto3 bio-reactor MN) of Minnesota State Ming Neitongka; New Jersey Ai Dixun NBS company (New Brunswick Scientific, Edison, NBS bio-reactor N.J.); Root BBBI company of Germany Mel Soviet Union (B.Braun BiotechInternational, B.Braun Biotech, Melsungen, the bio-reactor of laboratory Germany) and commercialization scale.
No matter the size of volume of culture, cultivation can maintain and be less than or equal to 35 ℃, be less than or equal to 34 ℃, be less than or equal to 33 ℃, be less than or equal to 32 ℃, be less than or equal to 31 ℃ or be less than or equal under 30 ℃ the temperature.Can be with under 34 ℃ of about 30 ℃-35 ℃ of cell cultures, about 32 ℃-35 ℃, about 32 ℃-Yue or about 32 ℃-33 ℃ temperature.
Carrier is introduced host cell
Can will comprise corresponding to the carrier of the nucleotide sequence of influenza virus gene group section according to method well known in the art and introduce (as transfection) host cell, these methods comprise, for example calcium phosphate coprecipitation method, electroporation, microinjection, lipofection and utilize the transfection of polyamines transfection reagent.For example, can utilize polyamines transfection reagent TransIT-LT1 (Mai Lesi company (Mirus)) that carrier such as plasmid are introduced host cell, as the combination of COS cell, 293T cell or COS or 293T cell and mdck cell according to the working instructions of producer.Can be used on the about 2 μ l TransIT-LT1 that dilute in the 160 μ l substratum each carrier of about 1 μ g is introduced the host cell group, cumulative volume is 200 μ l.DNA: the transfection reagent mixture is incubation 45 minutes at room temperature, adds 800 μ l substratum then.Transfection mixture is added host cell, cultivate as mentioned above.
Perhaps, also can adopt electroporation will comprise and introduce host cell corresponding to the carrier of the nucleotide sequence of influenza virus gene group section.For example, can be according to following flow process, the employing electroporation will comprise corresponding to the plasmid vector of the nucleotide sequence of Type B influenza virus gene group section introduces the Vero cell.With 5 * 10 of cultivation in the improvement Eagle substratum (MEM) that has added 10% foetal calf serum (FBS) 6Individual Vero cell is resuspended among the 0.4ml OptiMEM, places in the electroporation cup.20 micrograms of DNA that volume mostly are 25 μ l most join in the celliferous cup, and tapping is gently to mix then.According to the working instructions of producer (for example, be connected with the BR gene pulse instrument II (BioRadGene Pulser II with Capacitance Extender Plus connected) of reinforced capacitance increase device) carry out electroporation, 300 volts, 950 microfarads, time constant are the 28-33 millisecond.Beat the remix cell by gentleness, the MEM that 0.7ml was contained 10%FBS in about 1-2 minute behind the electroporation directly adds in the cuvette.Then cell transfer is arrived in 2 holes of standard 6 hole tissue culturing plates, the hole includes the OPTI-MEM of 2ml MEM+10%FBS or serum-free.The washing cuvette is to reclaim any remaining cell, and the washing suspension is divided into two holes.Final volume is about 3.5ml.Be fit to incubation cell under the condition of viral growth then.
Reclaim virus
Can from the nutrient solution of the cell of introducing a plurality of carriers, reclaim virus.Obtain rough nutrient solution earlier and clarify the influenza virus in the clarifying nutrient solution of reconcentration.Concentration method commonly used comprises filtration, ultrafiltration, barium sulfate absorption and wash-out and centrifugal.For example, at first can be in the centrifugal enough time of for example 1000-2000 * g, as the rough nutrient solution of clarifying infected culture in 10 to 30 minutes to remove cell debris and other large particulate matter.Perhaps, nutrient solution can filter to remove complete cell and other large particulate matter through the acetate cellulose filters of 0.8 μ m.The nutrient solution supernatant of optional then centrifugal clarification is with the precipitation influenza virus, as with the centrifugal about 3-5 of 15,000 * g hour.Virus group is resuspended in the suitable damping fluid, as STE (0.01M Tris-HCl; 0.15M NaCl; 0.0001M EDTA) or after in the phosphate-buffered saline of pH7.4 (PBS), utilize sucrose (60%-12%) or soluble tartrate (50%-10%) density gradient centrifugation concentrating virus.Lasting or centrifugal all suitable step by step, as the saccharose gradient of 12%-60%, 4 steps, per step 12%.Enough rotating speeds and time to be arranged so that virus is condensed into the visible band for recovery during gradient centrifugation.Perhaps, use for large-scale commercial, the zonal centrifuge that can utilize the continuous-mode operation is from density gradient elutriation virus.Following document provides is enough to the guidance technology personnel prepare influenza virus from tissue culture other details: for example, Furminger, " vaccine production " (Vaccine Production), publish in (volumes) such as Nicholson, " influenza virus textbook " (Textbook of Influenza), the 324-332 page or leaf; Merten etc., (1996) " the preparation influenza virus is used for the preparation of vaccine in cell culture " (Production of influenza virus in cellcultures for vaccine preparation), publish in Cohen and Shafferman (volume), " new departure of vaccine design and preparation " (Novel Strategies in Design and Production of Vaccines), the 141-151 page or leaf; And No. 5,690,937, United States Patent (USP).If desired, the virus of recovery can also be stored in-80 ℃ in the presence of the sucrose-phosphoric acid salt-glutaminate (SPG) that has as stablizer.
The preventative method and composition that gives vaccine
Reorganization of the present invention and reprovision virus can be preventative to the specific immune response that is stimulated one or more strains of influenza viruses with suitable vehicle or vehicle.Described vehicle or vehicle can be pharmaceutically acceptable vehicle or vehicle, as sterilized water, aqueous saline solution, aqueous buffered salt solution, aqueous glucose solution, aqueous glycerol solution, ethanol, do not infect the allantoic fluid (being normal allantoic fluid " NAF ") or their combination of egg.Can guarantee this solution of aseptic, pH, isotonicity and stability according to methods known in the art preparations.The selection of vehicle or vehicle should reduce transformation reactions or other untoward reaction usually as far as possible, and is fit to specific route of administration, as in subcutaneous, muscle, the nose etc.
The administered dose of influenza virus of the present invention is enough to stimulate the specific immune response of one or more strains of influenza viruses usually.Those skilled in the art know dosage and the method that excites the protective immunological reaction of resisting one or more strains of influenza viruses.For example, the dosage of the influenza virus of deactivation is about 1-1000HID 50(HID), promptly each dosage gives about 10 5-10 8Pfu (plaque forming unit).Perhaps, about 10-50 μ g, 15 μ g HA do not add adjuvant and give according to appointment, and lower dosage will give with adjuvant.Generally can in this scope, adjust dosage according to age, physical appearance, body weight, sex, diet, administration time and other clinical factor.The preventative vaccine preparation can be used syringe needle and syringe, and perhaps Needleless injection device is by for example subcutaneous or intramuscular injection and general gives.Perhaps, vaccine preparation also can perhaps can spray into the upper respiratory tract by giving in drops, macrobead aerosol (greater than the about 10 microns) nose.For intranasal administration, can utilize the live-virus vaccine of attenuation, for example attenuation, acclimatization to cold and/or temperature sensitive reorganization or reprovision influenza virus.Though preferably utilize single dose to stimulate protective immunological reaction, give extra dose by identical or different route of administration and also can realize required protection effect.
Perhaps, available influenza virus exsomatize or body in the target dendritic cell come immune response stimulating.For example, the dendritic cell of propagation is contacted so that dendritic cell is caught influenza antigen with virus with time enough with enough consumptions.By standard intravenously implantation method cell transfer is arrived in the subject of immunity then.
Can there be one or more Type B influenza viruses in the preparation of preventative or therapeutic treatment influenza.A kind of preparation can comprise a kind of Type B influenza virus.A kind of preparation can comprise a kind of Type B influenza virus and a kind of A type influenza virus.A kind of preparation can comprise a kind of Type B influenza virus and two kinds of A type influenza viruses.Can comprise two kinds of Type B influenza viruses and two kinds of A type influenza viruses in a kind of preparation.Can comprise two kinds of Type B influenza viruses in a kind of preparation.At least a Type B influenza virus in the preparation can comprise arginine at amino-acid residue 141 places.
The preparation that protectiveness gives influenza virus or its subunit can also comprise one or more adjuvants to strengthen the immune response at influenza antigen.Suitable adjuvant comprises: saponin, mineral coagulant such as aluminium hydroxide, surfactant such as lysolecithin, pluronic polyvalent alcohol, polyanion, peptide, oil or hydrocarbon emulsion, bacillus bacille Calmette-Guerin vaccine (BCG), CBP (Corynebacterium parvum) and synthetic adjuvant QS-21 and MF59.
The preventative preparation that gives influenza virus can with one or more molecules of immunization stimulus couplings.Molecules of immunization stimulus comprise have immunostimulation, immunostimulant and short scorching active various cytokines, lymphokine and chemokine, for example, interleukin (as IL-1, IL-2, IL-3, IL-4, IL-12, IL-13); Somatomedin (as granulocyte-macrophage (GM)-G CFS (CSF)); With other molecules of immunization stimulus, as scavenger cell inflammatory factor, Flt3 part, B7.1, B7.2 etc.Molecules of immunization stimulus can give in a kind of preparation with influenza virus, also can give respectively.The expression vector that can give protein or coded protein is to produce immune-stimulating effect.
In another embodiment, can coupling above-mentioned suitable medicine vehicle or vehicle and comprise corresponding to the carrier of the present invention of the nucleotide sequence of influenza virus gene group section heterologous nucleic acids is introduced host living beings or host cell, mammalian cell for example, as derive from the cell of people's object.Heterologous nucleic acids can be inserted the nonessential region of gene or constant gene segment C.Heterologous polynucleotide sequence codified polypeptide or peptide, perhaps RNA is as sense-rna or ribozyme.Mix the recombinant virus of heterologous nucleic acids and this heterologous nucleic acids has been introduced host or host cell by preparation then, given virus as mentioned above.
Perhaps, the carrier of the present invention that can will comprise heterologous nucleic acids by the carrier cotransfection has been gone into to infect the cell of influenza virus is introduced host cell and expression therein.Optionally then cell is fed back or being delivered to this object, generally is to be delivered to the position that obtains cell.In some applications, can adopt existing cell transfer or implantation method that these cells are transplanted in interested tissue, organ or system position (as mentioned above).For example, can the employing standard send or infusion techniques with the stem cell of hematopoietic cell system, be delivered to object as the hemopoietic stem cell in marrow, Cord blood or peripheral blood source.
Perhaps, the virus that contains heterologous nucleic acids can be delivered in the intravital cell of object.This method can comprise and gives the target cell group (for example, hemocyte, skin cells, liver cell, nerve (comprising brain) cell, nephrocyte, uterine cell, muscle cell, intestinal cells, cervical cell, vaginal cell, prostatic cell etc. with carrier granule; And the tumour cell that is derived from various cells, tissue, organ).Can give virion by for example vein, also can pass through the whole bag of tricks, comprise injection (utilizing syringe needle or syringe), needleless vaccine delivery, topical or push tissue, organ or skin part and virion directly is delivered to one or more interested positions.For example, vector particles can by suck, under oral, the intravenously, subcutaneous, corium, in the intradermal, intramuscular, intraperitoneal, tracheae, transvaginal or rectal administration, perhaps in surgical procedure for example, virion is placed the lacuna of health or other position and sends.
Method of the present invention and virus can be used for therapeutic or the multiple disease of prophylactic treatment, comprise heredity and acquired disease, for example the vaccine of associated diseases such as conduct virus, bacterium.
Test kit
For the ease of using carrier of the present invention and influenza virus, can be experiment or therapeutic purpose and with any of these carrier and virus, and be used to other component of packing and infecting, for example damping fluid, cell, medium package become the form of test kit.Except that said components, test kit can comprise other material, for example implements working instructions, wrapping material and the container of the inventive method.
Viral nucleic acid and proteinic operation
For the present invention, can be according to known Protocols in Molecular Biology operation influenza nucleic acids and/or protein.Many this methods, the detailed protocol that comprises amplification, clone, mutagenesis, conversion etc. is described in following document: Ausubel etc., " up-to-date Protocols in Molecular Biology " (Current Protocols inMolecular Biology) (augmenting in 2000), (the John Wiley ﹠amp of John Willie father and son company; Sons), New York (" Ausubel "); Sambrook etc., " molecular cloning-laboratory manual " (MolecularCloning-A Laboratory Manual) (second edition), 1-3 volume, cold spring harbor laboratory, cold spring port, New York, 1989 (" Sambrook "); And Berger and Kimmel " molecule clone technology guidance, Enzymology method " (Guide to Molecular Cloning Techniques, Methods in Enzymology), 152 volumes, academic press (Academic Press, Inc.), San Diego, California (" Berger ").
Except above-mentioned document, the amplification in vitro technical scheme of other cDNA probe of the present invention that can be used for increasing, for example the technology (as NASBA) of polymerase chain reaction (PCR), ligase chain reaction (LCR) (LCR), Q β-replicative enzyme amplification and the mediation of other RNA polymerase as seen: Mullis etc., (1987) United States Patent (USP) 4,683, No. 202; " PCR scheme-methods and applications instruct " (PCR Protocols A Guideto Methods and Applications) volumes such as () Innis, academic press, San Diego, California (1990) (" Innis "); Arnheim and Levinson (1990) C ﹠amp; EN 36; The Journal OfNIH Research (1991) 3:81; Kwoh etc., (1989) Proc Natl Acad Sci USA 86,1173; Guatelli etc., (1990) Proc Natl Acad Sci USA 87:1874; Lomell etc., (1989) J ClinChem 35:1826; Landegren etc., (1988) Science 241:1077; VanBrunt (1990) Biotechnology 8:291; Wu and Wallace (1989) Gene 4:560; Barringer etc., (1990) Gene 89:117 and Sooknanan and Malek, (1995) Biotechnology13:563.Other method that can be used for cloning nucleic acid of the present invention comprises No. the 5th, 426,039, the United States Patent (USP) of Wallace etc.Be summarized in Cheng etc. by improving one's methods of pcr amplification large nucleic acids, (1994) Nature 369:684 and reference thereof.
Can utilize various solid phase techniques to synthesize some polynucleotide of the present invention, oligonucleotide for example, comprise based on mononucleotide-and/or trinucleotide-phosphoramidite coupling chemical process.For example, can be by synthetic nucleic acid sequence on the polynucleotide chain that activatory monomer and/or tripolymer is added in proper order to extension.Referring to Caruthers, M.H. etc., (1992) Meth Enzymol211:3.
Except synthetic required sequence, can also be from any basically nucleotide sequence of various commercial source customization, as MCRC company (Midland Certified Reagent Company, mcrc@oligos.com), (the The Great American Gene Company of GAGC company, www.genco.com), EG company (ExpressGen, Inc., www.expressgen.com), (Operon Technologies, Inc. is www.operon.com) with many other companies in OT company.
In addition, can replace specified amino acid on the viral polypeptide by for example site-directed mutagenesis.For example, can prepare by the viral nucleic acid fragment of specific mutant being introduced the coding viral polypeptide and contain on function and phenotypic characteristic, as the viral polypeptide of attenuation phenotype, acclimatization to cold, aminoacid replacement that temperature sensitivity is relevant.The method of site-directed mutagenesis is well known in the art, and is referring to for example Ausubel, Sambrook and Berger, the same.But many test kit commercializations of carrying out site-directed mutagenesis are buied, Ka Meilong site-directed mutagenesis test kit (Chameleon Site DirectedMutagenesis Kit as La Jolla Xstrata genome company, Stratagene, La Jolla), can the one or more aminoacid replacement described in table 6 or the table 17 be introduced the genome section of coding A or Type B influenza virus polypeptide respectively according to the working instructions of producer.
Embodiment
1. one kind prepares the method for duplicating enhanced HA glycosylation Type B influenza virus in egg, comprising:
(a) will cause the aminoacid replacement at 141 places, HA position is that Type B influenza virus gene group is introduced in arginic sudden change; With
(b) under the condition that produces the Type B influenza virus, duplicate the influenza virus gene group of this sudden change.
2. as the method for enforcement mode 2, wherein implement to introduce step by site-directed mutagenesis.
3. one kind prepares the method for duplicating enhanced HA glycosylation Type B influenza virus in egg, comprising:
(a) a plurality of carriers are introduced a group host cell, described carrier comprises corresponding to following nucleotide sequence:
(i) at least 6 internal gene group sections of the first Type B strains of influenza viruses; With
(ii) one or more genome sections of the coding HA of at least the second Type B strains of influenza viruses and NA polypeptide, wherein said HA polypeptide comprises arginine at amino-acid residue 141 places;
(b) cultivate this group host cell under 35 ℃ the temperature being no more than; With
(c) reclaim influenza virus.
4. as the method for enforcement mode 3, also be included in step (i) before:
In a carrier of described a plurality of carriers, introduce sudden change;
Wherein this carrier comprise corresponding to the coding HA the genome section nucleotide sequence and
Wherein to cause amino-acid residue 141 places be arginine in this sudden change.
5. as the method for enforcement mode 3 or 4, the wherein said first Type B influenza virus has one of following attribute: temperature sensitivity, attenuation or acclimatization to cold.
6. as implement among the mode 3-5 each method, wherein, the described first Type B influenza virus comprises following amino-acid residue: PB2630 (630R); PA431 (431M); PA497 (497H); NP55 (55A); NP114 (114A); NP410 (410H); NP510 (510T); M1159 (159Q) and M1183 (183V).
7. as the method for enforcement mode 6, further comprising the steps of:
In the carrier of described a plurality of carriers, introduce sudden change;
Wherein said carrier comprise corresponding to the nucleotide sequence of 6 internal gene group sections of the described first Type B strains of influenza viruses and
Wherein this sudden change causes existing following amino-acid residue: PB2630 (630R); PA431 (431M); PA497 (497H); NP55 (55A); NP114 (114A); NP410 (410H); NP510 (510T); M1159 (159Q) and M1183 (183V).
8. as implement among the mode 3-7 each method, the wherein said first Type B influenza virus is virus strain B/Ann Arbor/1/66.
9. as implement among the mode 3-8 each method, wherein said cell is following a kind of: Vero cell, Per.C6 cell, bhk cell, PCK cell, mdck cell, MDBK cell, 293 cells or COS cell.
10. as implement among the mode 3-9 each method, wherein said carrier is a plasmid.
11. as implement among the mode 3-10 each method, wherein said a plurality of carriers comprise 8 plasmid groups, wherein the nucleotide sequence of each self-contained different genes group section corresponding to the described first or second Type B strains of influenza viruses of this 8 plasmid.
12. as implement among the mode 3-11 each method, each plasmid comprises all nucleotide sequences in wherein said a plurality of carriers.
13. as implement among the mode 3-12 each method, wherein this method does not comprise and utilizes helper virus.
14. as implement among the mode 3-13 each method, wherein implement described introducing step by the transfection or the electroporation of lipid mediation.
15. as implement among the mode 3-14 each method, wherein said temperature is between 30-35 ℃.
16. as implement among the mode 3-15 each method, wherein said temperature is between 32-35 ℃.
17. as implement among the mode 3-16 each method, also comprise and utilize egg to duplicate the influenza virus of recovery;
The influenza virus that wherein utilizes egg to duplicate keeps HA amino acid residue position 196/197 glycosylation site; With
Wherein said influenza virus copies to the peak value titre of 7.0log10PFU/ml at least with egg.
18. Type B influenza virus by each method preparation among the embodiment 1-17.
19. an immunogenic composition, it comprises the Type B influenza virus of embodiment 18.
20. a vaccine, it comprises the Type B influenza virus of embodiment 19.
21. as the vaccine of enforcement mode 20, it is suitable for intranasal administration.
22. as implement among the mode 3-17 each method, also comprise:
Kill and wound the virus of described recovery.
23., also comprise as enforcement mode 1 or 2 described methods:
A) reclaim influenza virus; With
B) kill and wound the virus of recovery.
24. the Type B influenza virus vaccine alive of an attenuation, it comprises the virus by each method preparation among the embodiment 1-17.
24. the method for the virus infection of a treatment target comprises:
Give the virus of this object by each method preparation among the embodiment 1-17, its administered dose is enough to produce the immune response of resisting this virus infection.
Embodiment
Embodiment 1: make up pAD3000
Modify plasmid pHW2000 (Hoffmann etc. (2000) " from the DNA transfection system of 8 plasmids generation A type influenza viruses " (A DNA transfection system for generation of influenza Avirus from eight plasmids) Proc Natl Acad Sci USA 97:6108-6113), substitute Trobest (BGH) polyadenylic acid signal with the polyadenylic acid signal sequence in simian virus 40 (SV40) source.
Utilize following oligonucleotide, with the sequence in Taq MasterMix (fast and smart company (Qiagen)) amplification SV40 source, direction is appointed as 5 ' to 3 ': polyA.1:AACAATTGAGATCTCGGTCACCTCAGACATGATAAGATACATTGATGA GT (SEQ ID NO:1); PolyA.2:TATAACTGCAGACTAGTGATATCCTTGTTTATTGCAGCTTATAATGGT TA (SEQ ID NO:2).
Plasmid pSV2His is as template.According to the working instructions of producer, with the Topo TA cloning vector of hero company (Invitrogen) the amplification fragment consistent and be cloned into pcDNA3.1 with the 175bp product of expecting.The required 138bp fragment that will contain SV40 polyadenylic acid signal with EcoRV and BstEII is downcut from resulting plasmid, agarose gel electrophoresis separates, utilize then routine techniques (referring to, for example Ausubel, Berger, Sambrook) be cloned between the unique PvuII and BstEII site of pHW2000.The gained plasmid, pAD3000 (Fig. 1) finds to contain SV40 polyadenylic acid site in the right direction through order-checking.The Nucleotide 295-423 of pAD3000 corresponds respectively to the Nucleotide 2466-2594 of SV40 strain 777 (AF332562).
Embodiment 2: 8 pUC pUCs of preparation MDV-B
Utilize Rneasy test kit (the RNeasy Kit of the fast and smart company in Valencia, California, Qiagen, Valencia, CA) from the infected 100 μ l allantoic fluids that contain the embryo egg, extract the viral RNA of the acclimatization to cold variant of influenza B/AnnArbor/1/66 (ca/Master Ann Arbor/1/66 P1 Aviron 10/2/97), this virus strain is exemplary Type B influenza virus master donor virus strain (MDV-B), and this RNA is washed 40 μ l H 2Among the O.Utilize the RT-PCR test kit of the fast and smart company in Valencia, California to carry out the RT-PCR of genome section, the RNA that each reaction uses 1 μ l to extract.RT-is reflected at 50 ℃ to carry out 50 minutes, carried out 15 minutes at 94 ℃ then.PCR carries out 25 to take turns: 94 ℃ were carried out 1 minute, and 54 ℃ are carried out carrying out 3 minutes in 1 minute and 72 ℃.Utilization contains the section primer amplified P-gene in BsmBI site, thereby produces two fragments (table 1).
The RT-PCR primer of 8 vRNA of table 1. amplification influenza ca B/Ann Arbor/1/66
Figure G2008800207207D00211
The complementary sequence of these influenza sequences shows with black matrix.5 '-end has the recognition sequence of restriction endonuclease BsmBI (Bm) or BsaI (Ba).
Cloned plasmids
Separate the PCR fragment,, insert the BsmBI site of above-mentioned pAD3000 (derivative of pHW2000, it can be transcribed and bear adopted vRNA and positive mRNA) with BsmBI (or for NP BsaI) digestion.2-4 gained plasmid checks order separately and also compares according to the consensus sequence that the RT-PCR fragment is directly checked order with MDV-B.By cloned plasmids or the plasmid that utilizes the quick change test kit (Quikchange kit) " reparation " of La Jolla, California Xstrata genome company to have to cause the amino acid Nucleotide different to replace with consensus sequence.The B/Ann Arbor/1/66 plasmid that obtains is appointed as pAB121-PB1, pAB122-PB2, pAB123-PA, pAB124-HA, pAB125-NP, pAB126-NA, pAB127-M and pAB128-NS.Utilize this bidirectional transcription system, in born of the same parents, produce all viral RNAs and protein, thereby produce infectious Type B influenza virus (Fig. 2).
It should be noted that with consensus sequence and compare that pAB121-PB1 and pAB124-HA have 2, pAB128-NS has 1 reticent Nucleotide and replaces (table 2).These Nucleotide changes do not cause amino acid change, and estimating can not influence viral growth and rescue.Thereby keep these reticent gene types that helps recombinant virus that replaces.
The plasmid group of 8 sections of table 2. expression B/ANN ARBOR/1/66 (MDV-B)
Figure G2008800207207D00221
Have the plasmid that Nucleotide replaces in PA, NP and the M1 gene for being structured in, plasmid pAB123-PA, pAB125-NP, pAB127-M are as template.Utilize the quick change test kit of La Jolla, California Xstrata genome company to change Nucleotide.Perhaps, utilize the primer contain required sudden change, by two fragments of pcr amplification, with BsmBI digestion and adopt three fragment ligations to insert pAD3000-BsmBI.The plasmid that order-checking produces does not contain unwanted sudden change to guarantee cDNA.
Utilize rhodamine or d rhodamine-terminator cycle sequencing easy reaction test kit (Rhodamineor dRhodamine dye-terminator cycle sequencing ready reaction kit) and (the Perkin-Elmer Applied Biosystems of Foster city, California PEAB company, Inc, Foster City, CA)
Figure G2008800207207D00231
Archaeal dna polymerase FS measures the sequence of template DNA.By the electrophoretic separation sample, analyze with 373 type PE/ABI, 373 type Stretch or 377 type dna sequencing instrument.
In another experiment, as described in above MDV-B strain, the viral RNA of amplification influenza B/Yamanshi/166/98 also is cloned into pAD3000, turns:94 ℃ of were carried of and the exception part is that amplification is carried out 25 and taken out 30 seconds, 72 ℃ of 54 ℃ of are carried of and out carrying out, 3 minutes in, 30 seconds and. utilize same primers as amplification B/Yamanashi/166/98 strain section, use respectively following primer increase NP and NA section: MDV-B 5 ' BsmBI-NP:TATTCGTCTCAGGGAGCAGAAGCACAGCATTTTCTTGTG (SEQ ID NO:36) and MDV-B 3 ' BsmBI-NP:ATATCGTCTCGTATTAGTAGAAACAACAGCATTTTTTAC (SEQ ID NO:37) and Bm-NAb-1:TATTCGTCTCAGGGAGCAGAAGCAGAGCA (SEQ ID NO:38) and Bm-NAb-1557R:ATATCGTCTCGTATTAGTAGTAACAAGAGCATTTT (SEQ ID NO:39) instead. The B/Yamanashi/166/98 plasmid is appointed as pAB251-PB1, pAB252-PB2, pAB253-PA, pAB254-HA, pAB255-NP, pAB256-NA, pAB257-M and pAB258-NS.In PA, identify and help recombinating and the reticent nucleotide difference in 3 places of the gene type of reprovision B/Yamanashi/166/98 virus.
Embodiment 3: preparation infectious reorganization Type B influenza virus and reprovision influenza virus
Prepare infectious reorganization B influenza virus by co-cultivation 293T or COS-7 cell (having the active primate cell of high efficiency of infection and polI) with mdck cell (allowing the influenza virus growth).The 293T cell maintains in the Opti-MEM I-AB substratum that contains 5%FBS, and the COS-7 cell maintains in the DMEM I-AB substratum that contains 10%FBS.Mdck cell maintains the 1xMEM that has added microbiotic and anti-mycotic agent, among the 10%FBS.Before the transfection of viral genome carrier, earlier with 5mlPBS or the substratum washed cell that does not contain FBS once.10ml trypsinase-EDTA is added to 75cm 2The converging of culturing bottle (mdck cell incubation 20-45 minute, 293T cell incubation 1 minute) on the cell.Eccentric cell is resuspended among the 10ml OptiMEM I-AB.Every kind of cell is got 1ml and is diluted among the 18ml OptiMEM I-AB mixing then.Subsequently the cell equal portions are added 6 orifice plates, every hole 3ml.After 6-24 hour, every kind of plasmid is got 1 μ g and is added to (x μ l plasmid+x μ l OptiMEM I-AB+x μ l TransIT-LT1=200 μ l) in the 1.5ml centrifuge tube (Eppendorf tube) that contains OptiMEM I-AB; Every microgram plasmid DNA is with 2 μ l TransIT-LT1.Mixture is incubation 45 minutes at room temperature.Add 800 μ l OptiMEM I-AB then.Remove cell culture medium, transfection mixture added cell (t=0), 33 ℃ incubation 6-15 hour.Slowly remove transfection mixture from cell, add 1mlOptiMEM I-AB, cell was 33 ℃ of incubations 24 hours.After the transfection 48 hours, 1ml is contained the tryptic OptiMEM I-AB of 1 μ g/ml TPCK-add cell.After the transfection 96 hours, 1ml is contained the tryptic OptiMEM I-AB of 1 μ g/ml TPCK-add cell.
Between 4 days and 7 days, take out the 1ml cell culture supernatant, after the transfection by HA or plaque test monitoring.In brief, 1ml supernatant liquor equal portions are added centrifuge tube, centrifugal 5 minutes of 5000rpm.900 μ l supernatant liquors are transferred in the new pipe, carry out serial dilution, add mdck cell (for example, in 12 orifice plates) with 500 μ l/ holes.Supernatant liquor and cell incubation are removed and are replaced after 1 hour to contain the 1 tryptic infection substratum of μ g/ml TPCK-(1xMEM).Carry out HA test or plaque test then.For example, for plaque test, be used in 33 ℃ with 0.8% agarose, 3 days the mdck cell titration supernatant liquor of thing incubation that superposes.For infecting egg, 6 or 7 weeks were collected the supernatant liquors of transfectional cells after the transfection, 33 ℃, contained the embryo egg with what 100 μ l viral dilution liquid of Opti-MEM I preparation were injected into 11 ages in days.Inoculate after 3 days TCID by mdck cell 50The test determination titre.
Be to produce MDV-B, with the 293T-MDCK or the COS-7-MDCK cell of each plasmid transfection co-cultivation of 1 μ g.When detecting in 5-7 days after transfection, the mdck cell showed cell pathology effect (CPF) of co-cultivation shows from clone's cDNA to have produced infectious MDV-B virus.In cell, do not observe CPE (table 3) with 7 plasmid transfections.For measuring the efficient that the DNA rotaring redyeing system produces virus, the supernatant liquor of mdck cell titration cell is used in transfection after 7 days, by plaque test determination virus titer.The virus titer of the supernatant liquor of co-cultivation 293T-MDCK is 5.0x10 6Pfu/ml is 7.6x10 in the COS7-MDCK cell 6Pfu/ml.
Table 3. produces infectious Type B influenza virus from 8 plasmids
Figure G2008800207207D00241
Figure G2008800207207D00251
With the 293T-MDCK (1,2) of 7 or 8 plasmid transient transfection co-cultivation or the COS7-MDCK cell (3,4) of co-cultivation.The cytopathic effect (CPE) in the mdck cell of co-cultivation is monitored in transfection after 7 days.After the transfection 7 days, with the supernatant liquor of MDCK titration transfectional cell.The data representation of pfu/ml is the mean value of (for example, 3 times or 4 times) transfection experiment repeatedly.
Utilize the B/Yamanashi/166/98 plasmid vector in transfection experiment, to obtain comparable result.These results show that from the beginning rotaring redyeing system can reproducibly produce the Type B influenza virus from 8 plasmids.
The gene type of reorganization Type B influenza virus
After doing follow-up going down to posterity with mdck cell, adopt RT-PCR to confirm that institute produces viral verity to the supernatant liquor of cells infected.Section Auele Specific Primer (table 1) with all 8 sections carries out RT-PCR.As shown in Figure 3A, all sections all produce the PCR product.Directly the PCR product of order-checking PB1, HA and NS section discloses find among 4 Nucleotide analyzing and plasmid pAB121-PB1, pAB124-HA and the pAB128-NS identical.These results confirm that the virus that is produced is to be produced by designed plasmid, side by side except the laboratory pollution (Fig. 3 B) of (except negative control) any possible parental virus.
Similarly, behind the B/Yamanashi/166/98 plamid vector transfection, reclaim virus, amplification comprises the zone of the Nucleotide 1280-1290 of PA section.Order-checking confirms the reorganization B/Yamanashi/166/98 (Fig. 3 C and D) of the virus of recovery corresponding to the plasmid source.
The phenotype somatotype of rMDV-B
MDV-B virus shows two kinds of characteristic phenotypes: temperature sensitivity (ts) and acclimatization to cold (ca).Virus titer difference is that 2log (or higher) is defined as ts when 33 ℃ are compared 37 ℃, and virus titer difference is defined as ca less than 2log when 33 ℃ are compared 25 ℃.With transfection virus infection chicken kidney of former generation (PCK) cell in parental virus MDV-B and plasmid source to measure three kinds of viral growths under the temperature.
Carry out the plaque test with the mdck cell that converges in 6 orifice plates (ECACC).Viral dilution liquid was at 33 ℃ of incubation 30-60 minutes.On cell, cover 0.8% agarose stack thing.At 33 ℃ or 37 ℃ of cells that incubation infects.Infect after 3 days, with 0.1% crystal violet solution staining cell and measure the plaque number.
At 25,33 and 37 ℃, by the TCID of viral sample 50The ca-ts phenotypic assay is carried out in titration.This test form is by (25 ℃, 33 ℃ and 37 ℃) under the differing temps, in 96-porocyte culture plate, detect influenza virus to former generation chicken nephrocyte individual layer cytopathic effect (CPE) detect TCID 50Titre.This test does not rely on the plaque form that becomes with temperature and virus strain; But only depend on the ability that CPE was duplicated and caused to influenza virus.To be suspended in MEM (Earl) substratum that contains 5%FCS by former generation chicken kidney (PCK) cell suspension of the former generation tissue preparation of trypsin treatment.
The PCK cell inoculation was cultivated 48 hours in 96 porocyte culture plates, with the individual layer of preparation degree of converging＞90%.After 48 hours, washed the PCK cell monolayer 1 hour with the serum-free MEM substratum (being called phenotype analytical substratum (PAM)) that contains 5mM L-glutaminate, microbiotic, non-essential amino acid.10 times of serial dilutions that prepare viral sample at 96 orifice plates that contain PAM.Viral sample with dilution is applied in 96 orifice plates on the PCK individual layer of washing then.At each extent of dilution of viral sample, with the virus infection six multiple holes of dilution.Every duplicate samples comprises that the non-infected cells in six multiple holes contrasts as cell.Each viral sample is got the multiple hole titration of 2-4.Each test is included in 25 ℃, 33 ℃ and the 37 ℃ phenotype contrast viruses of measuring titre in advance.Be the ts phenotype of mensuration viral sample, 33 ℃ and 37 ℃, at 5%CO 2Incubation is all dull and stereotyped 6 days in the cell cultures incubator.Characterize all dull and stereotyped 10 days of 25 ℃ of incubations for the ca-phenotype.Calculate virus titer by the Karber method, use Log 10TCID 50Titre mean value (n=4)/ml ± standard deviation is represented.The standard deviation of the virus titer shown in Fig. 1-3 is between 0.1 to 0.3.The virus titer difference of 33 ℃ and 37 ℃ is used to measure the ts phenotype, and the virus titer difference of 25 ℃ and 33 ℃ is used to measure the ca phenotype.
Be derived from MDV-B (recMDV-B) virus of plasmid as was expected and in cell culture, show two kinds of characteristic phenotypes, ca and ts.The ca phenotype is effectively duplicated at 25 ℃, during with the PCK cellular assay virus for example the titre difference between 25 ℃ and 33 ℃ be less than or equal to 2log10.Parental generation MDV-B and recMDV-B all show ca; Difference between 25 ℃ and 33 ℃ is respectively 0.3 and 0.4log10 (table 4).Also detected the ts phenotype by the titre of observing PCK cell under two kinds of differing tempss; Yet, for this phenotype, the little 2log10 of titre that 37 ℃ titre should be than 33 ℃ or more.For parental generation MDV-B and recMDV-B, the difference between 33 ℃ and 37 ℃ is respectively 3.4 and 3.7log10 (table 4).Therefore, the MDV-B virus that is derived from recombinant plasmid shows ca and two kinds of phenotypes of ts.
33 ℃, the titre of recombinant virus is 7.0log 10TCID 50/ ml, in the time of 37 ℃ is 3.3TCID 50/ ml is 8.8log in the time of 25 ℃ 10TCID 50/ ml (table 4).Therefore, the recombinant virus that obtains with 8 influenza MDV-B genome section plasmid transfections has ca and ts phenotype simultaneously.
Table 4. is from the MDV-B of plasmid generation and the phenotype analytical of rMDV-B
Figure G2008800207207D00261
Figure G2008800207207D00271
With recombinant virus (recMDV-B) infector in parental virus MDV-B and plasmid source for the chicken nephrocyte.Measure the virus titer under 3 kinds of differing tempss.
Embodiment 7: the generation of reprovision B/Yamanashi/166/98 virus
The amplification represent the main pedigree of Type B influenza virus several different strains HA and NA section and be cloned into pAD3000, basically as mentioned above.Optimize primer with while RT-PCR amplification HA and NA section.Relatively represent the vRNA stub area of the non-coding region of section 4 (HA) and section 6 (NB/NA) to show that 5 ' terminal 20 Nucleotide and 3 ' 15 terminal Nucleotide are consistent between the HA of Type B influenza virus and the NA gene.The used primer of synthetic RT-PCR is to (the italic sequence is that the Type B influenza virus is specific): Bm-NAb-1:TAT TCG TCT CAG GG
Figure G2008800207207D00272
(SEQ IDNO:38); Bm-NAb-1557R:ATA TCG TCT CGT ATT
Figure G2008800207207D00273
Figure G2008800207207D00274
(SEQ ID NO:39), and the HA and the NA gene (Fig. 6) of the various Type B strains of influenza viruses that are used for increasing simultaneously.The HA and the NA PCR section that separate B/Victoria/504/2000, B/Hawaii/10/2001 and B/Hong Kong/330/2001 with BsmBI digestion, insert pAD3000.These results show that these primers are applicable to that effective amplification contains the Type B influenza virus HA in several different wild-type virus source and the plasmid of NA gene, and described wild-type virus has been represented the main pedigree of Type B influenza virus.The RT-PCR product is used for order-checking and/or is cloned into expression plasmid.
In order to prove the antigen that utilizes the various Type B influenza virus of B/Yamanashi/166/98 (a kind of B/Yamagata/16/88 sample virus) energy effective expression pedigree source, preparation contains PB1, PB2, PA, NP, M, NS and representative Victoria and the HA of Yamagata pedigree and the reprovision virus (6+2 reprovision virus) of NA of B/Yamanashi/166/98.According to the method described above, with 6 plasmids representing B/Yamanashi/166/98 with contain two virus strain (B/Hong Kong/330/2001 and B/Hawaii/10/2001) of B/Victoria/2/87 pedigree, and the instantaneous COS7-MDCK cell of cultivating altogether of the plasmid co-transfection of the cDNA of the HA of a virus strain (B/Victoria/504/2000) of B/Yamagata/16/88 pedigree and NA section.After the transfection 6 to 7 days, with fresh mdck cell titration supernatant liquor.The titre of all 6+2 reprovision viruses is in 4-9 * 10 6Between the pfu/ml (table 5).6 internal gene of these digital proofs B/Yamanashi/166/98 can effectively form infectious virus with the HA and the NA constant gene segment C of the sick pedigree of two kinds of Type B influenzas.
After the transfection 6 or 7 days, the supernatant liquor of COS7-MDCK cell was cultivated in titration altogether, utilizes mdck cell to pass through plaque test determination virus titer.
Table 5: the plasmid group that is used to produce B/Yamanashi/166/98 and 6+2 reprovision virus
Wild-type B/Yamanashi/166/98 duplicates in egg and can obtain higher titre.Whether experimentize and measure this specific character is the intrinsic phenotype of 6 " inside " genes of this virus.In order to estimate this specific character, the output of the wild-type B/Victoria/504/2000 that will can only moderately duplicate in egg is made comparisons with the output of the 6+2 reprovision virus of expressing B/Victoria/504/2000HA and NA.Except the B/Yamanashi/166/98 of wild-type and reorganization, these viruses separately with 100 or 1000pfu be inoculated into 3 or 4 and contain in the embryo egg.
Infected back 3 days, and collected allantoic fluid, measure TCID with mdck cell from egg 50Titre.The output of 6+2 reprovision virus in allantoic fluid is similar to wild-type and reorganization B/Yamanashi/166/98 virus strain (Fig. 7).The titre difference of B/Victoria/504/2000 and 6+2 recombinant virus is about 1.6log 10TCID 50(0.7-2.5log 10TCID 50/ ml, 95%CI).Different experimental results show that variant between B/Victoria/504/2000 and the 6+2 recombinant virus (P＜0.001) by 3.These results prove that the egg growth characteristics of B/Yamanashi/166/98 can give HA and the NA that is difficult to the virus strain normal expression that duplicates in egg.
The molecular basis of embodiment 8:ca B/Ann Arbor//1/66 attenuation
MDV-B virus (ca B/Ann Arbor/1/66) is attenuation in human body, shows the attenuation phenotype in ferret, shows acclimatization to cold phenotype and temperature sensitive phenotype in cell culture.Utilize blast search algorithm relatively the derivation aminoacid sequence and the Los Alamos influenza virus database (Website: sequence flu.lanl.gov) of MDV-B internal gene.Identify the exclusive amino acid (table 6) of non-existent 8 MDV-B in any other virus strain.The genome section of coding PB1, BM2, NS1 and NS2 shows does not have unique residue that replaces.PA and M1 albumen respectively have 2, and NP albumen has 4 unique amino acid (table 6) that replace.Find the amino acid (another virus strain B/Harbin/7/94 (AF170572) also has arginine residues in 630 positions) of a replacement at 630 places, position of PB2.
These results suggest constant gene segment Cs PB2, PA, NP and M1 may participate in the attenuation phenotype of MDV-B.Adopt the mode similar to above-mentioned MDV-A, can utilize 8 pUC pUCs produce reorganization and reprovision virus (single and/or two, that is, 7: 1; 6: 2 reprovision virus), with the mode that do not rely on helper virus with relevant plasmid according to the similar mode of above-mentioned MDV-A simply cotransfection go into cultured cells.For example, but the HA and the NA section in 6 internal gene of coupling B/Lee/40 and MDV-B source produce 6+2 reprovision virus.
The amino acid that the uniqueness of table 6:B/Ann Arbor/1/66 replaces
Figure G2008800207207D00291
8 kinds of proteic aminoacid sequences of extrapolating of ca B/Ann Arbor are used for the BLAST retrieval.Shown amino acid position inequality between MDV-B and the aligned sequences.There is the Nucleotide of underscore to represent the position of substitution in the codon.
For the amino acid difference of determining these 8 uniquenesses effect characteristics MDV-B phenotype whether, make up a recombinant virus, wherein the amino acid of all 8 nucleotide positions coding reflection wild-type influenza virus genetic complementation situations.Made up one group of plasmid, wherein 8 residues of PA, NP and M1 gene pass through the site-directed mutagenesis change with reflection wild-type amino acid (as shown in table 6).Recombinant virus with all 8 changes is called rec53-MDV-B, and it is to obtain by the COS7-MDCK cell that the structure plasmid co-transfection is cultivated altogether.Cultivate mdck cell altogether and after transfection is guaranteed in 33 ℃ of growths, contain high virus titer in 6-7 days the supernatant liquor.The supernatant liquor of titration transfectional cell utilizes the titre of 33 ℃ of mdck cell and PCK raji cell assay Rajis and 37 ℃ by plaque test.
As shown in Figure 8, in two different independent experiments, recMDV-B can both express the ts-phenotype in mdck cell and PCK cell.The three gene resortments virus rec53-MDV-B of design contains all 8 amino acid changes that show non--ts-phenotype, and 33 ℃ and 37 ℃, the intracellular titre difference of PCK has only 0.7log 10This titre is lower than ts and defines desired 2log 10Difference, also significantly be lower than the viewed about 3log of recMDV-B 10Difference.8 amino acid changes in these presentation of results PA, NP and the M1 albumen are enough to produce non--ts, the wild-type sample virus with homology and allos glycoprotein.
Measured of the effect of each constant gene segment C subsequently to the ts phenotype.Produced the recombinant virus in the plasmid source of containing PA, NP or M constant gene segment C and wild-type amino acid complementation (section) by DNA cotransfection technology.37 ℃, all single-gene recombinant viruses are presented at mdck cell and PCK Intracellular growth restricted (Fig. 9), and the change of prompting individual gene section can not reverse the ts phenotype.In addition, the recombinant virus that carries NP and M or PA and M constant gene segment C has also kept the ts-phenotype.On the contrary, the titre difference of the recombinant virus that contains PA and NP constant gene segment C when 37 ℃ and 33 ℃ is 2.0log 10Or lower, similar to rec53-MDV-B.These presentation of results NP and PA gene are the oligogenes that influences the ts-phenotype.
Whether influence non--ts phenotype for measuring proteic all 4 amino acid of NP and proteic 2 amino acid of PA, prepared the NP with change and three genes and the dual-gene recombinant virus (Figure 10) of PA gene alteration.Two aminoacid replacement in the NP albumen, A114 → V114 and H410 → P410 produces non--ts phenotype.Have single replacement in nucleoprotein, the virus of H410 → P410 shows non--ts phenotype in MDCK and PCK cell.On the other hand, single A55 of replacement → T55 shows the ts-phenotype, and is the same with single replacement at 509 places, position.The amino-acid residue V114 of these presentation of results NP and P410 participate in effective growth (Figure 11 A) of 37 ℃.Adopt the scheme of type to analyze two amino acid whose effects in the PA gene.Make up one group of recombinant virus, respectively comprise the PA gene that has the total amino acid whose NP constant gene segment C of 4 wild-types and have only one of two total wild-type amino acids.Ts (Figure 11 B) is kept in the replacement of H497 → Y497, proves that this locus does not have very influence to the expression of phenotype.On the contrary, replacing M431 with V431 causes the ts phenotype to reverse.These results show that amino acid A114 and the M431 among H410 and the PA among the NP is the main determining factor of the temperature sensitivity of MDV-B.
According to former evidence, ts-phenotype and attenuation phenotype height correlation.Now confirmed in the lung tissue of infected ferret to detect, and in lung tissue, can detect the Type B influenza virus of non-attenuation behind the intranasal infection less than ca B/Ann Arbor/1/66 virus.Whether based on identical sudden change, carried out following research for determining ts and att phenotype.The recombinant virus that obtains after the transfection goes down to posterity in containing the embryo egg to produce viral original seed.The ferret intranasal vaccination virus in 9 ages in week, each nostril 0.5ml, titre is 5.5,6.0 or 7.0log 10Pfu/ml.Infect and put to death ferret after 3 days, detect their lung and concha as mentioned previously.
Ferret (4 every group) intranasal infection recMDV-B or rec53-MDV-B.Collect concha and lung tissue in 3 days behind the infective virus, detect the existence of virus.Use 7.0log 10Detect less than virus in the ferret lung tissue that pfu rec MDV-B infects.Use 7.0log 10Have 3 in lung tissue, to detect virus (reason of an animal in this group is unclear) only in 4 animals that pfu rec53-MDV-B infects.Infect low dosage (5.5log 10Pfu) there are 2 in lung tissue, to isolate virus in 4 of rec53-MDV-B ferrets.Therefore, the change of proteic 8 unique amino acids of PA, NP and the M1 non--att phenotype that is enough to make the att phenotype to be transformed into.
Because the data presentation PA and the NP of cell cultures play a major role to the ts-phenotype, therefore rec53-MDV-B (PA, NP, M), rec62-MDV-B (PA), the NPrec71-MDV-B (NP) with 6log pfu infects ferret in second experiment.There are 2 in lung, to detect virus in 4 animals with the rec53-MDV-B infection.Infect single and dual ferret of joining virus and in lung tissue, do not detect virus.Therefore, except PA and the proteic amino acid of NP, M1 albumen is also very important for the att phenotype.Virus with wild-type PA and NP reproducible not in the ferret lung illustrates that the sudden change subgroup that participates in attenuation also participates in the ts phenotype.
Therefore, the ts of B/Ann Arbor/1/66 and att phenotype are at most by 3 gene decisions.PA, NP and proteic 8 amino acid of M1 are transformed into the wild-type residue can make recombinant virus have replication at 37 ℃.Equally, contain 6 internal gene of MDV-B and the HA of B/Hong Kong/330/01 and the 6+2 recombinant virus of NA section and show the ts-phenotype, and three gene recombined virus right and wrong-ts.
We utilize the result of MDV-B skeleton show 6 amino acid be enough to the ts/att phenotype be transformed into non--ta/ non--the att phenotype.Therefore, we interested be determine to introduce those six " attenuation " residues whether these biological characteristicses to be passed to allos wild-type, non-attenuation Type B influenza virus, for example B/Yamanashi/166/98.
Reorganization reprovision B/Yamanashi/166/98 (recYam) (7) and recombinant virus (rec6-Yam) have been prepared: contain 6 amino acid change PA (V431 → M431, H497 → Y497), NP (V114 → A114, P410 → H410) and M1 (H159 → Q159, M183 → V183).Compares RecYam with 33 ℃ and reduce 0.17log10, and rec6Yam obviously is ts that the difference of virus titer is 4.6log10 between 37 ℃ and 33 ℃ 37 ℃ titre.Virus as typical wild-type Type B influenza virus is estimated from the infection recYam the ferret efficient recovery.When rec6Yam being inoculated, in lung tissue, do not detect virus (table 7) into ferret.Therefore, the ts/att locus of transfer MDV-B is enough to ts-is passed to different virus (divergent virus) with the att-phenotype.
Table 7: the attenuation research in ferret
Recombinant virus The wild-type component a The Ts-phenotype Ferret Dosage [log10pfu] Concha b??[log10pfu/g] Lung tissue [log10EID50/g] c
??rMDV-B Do not have ??ts ??4 ??6.0 ??4.01 ??＜1.5
??rec53-B ??NP，PA，M Non--ts ??4 ??6.0 ??4.65 ??3.81
??rec62-B ??NP，PA Non--ts ??4 ??6.0 ??4.69 ??＜1.5
??rec71NP-B ??NP ??ts ??4 ??6.0 ??4.13 ??＜1.5
??rec71M-B ??M ??ts ??4 ??6.0 ??4.17 ??＜1.5
??RecYam Non--ts ??4 ??6.0 ??4.92 ??3.31
??rec6Yam ??ts ??4 ??6.0 ??4.02 ??＜1.5
aUtilization has the recombinant virus intranasal infection ferret of the amino acid whose MDV-B of the containing skeleton that is different from wild-type.RecYam is reorganization B/Yamanashi/166/98, and Rec6Yam is illustrated in the virus that has 6 " MDV-B-attenuation " amino acid changes among NP, PA and the M1, contains the B/Yamanashi skeleton.
bInfected back 3 days, and measured the virus titer of concha and lung tissue, shown the average titer of 4 infected ferrets.
c＜1.5 show and do not detect virus.
Therefore, the artificial reconstructed variant with Type B influenza virus of one or more these aminoacid replacement shows ts and att phenotype, and it for example is applicable to and comes production attenuated live influenza virus vaccine as main donor virus strain.
Embodiment 9: the locus of measuring the acclimatization to cold phenotype of control B/ANN ARBOR/1/66 influenza virus
(ca) B/Ann Arbor/1/66 of acclimatization to cold is an attenuated live Type B influenza virus
Figure G2008800207207D00321
The main donor virus (MDV-B) of vaccine.To carry 6 of the HA of 6 internal gene being derived from ca B/Ann Arbor/1/66 and popular wild-type strain and NA surface glycoprotein: 2B type influenza virus vaccine is characterized by acclimatization to cold (ca), temperature sensitivity (ts) and attenuation (att) phenotype.Sequential analysis shows that MDV-B contains non-existent 9 amino acid in the wild-type Type B strains of influenza viruses in PB2, PA, NP and M1 albumen.We determine that (except these 3 ts locus, (Q159H, V183M) two amino acid in are given att phenotype to M1 for A114V, H410P) 3 the amino acid decision ts phenotypes in for PA (M431V) and NP.
For understanding the molecular basis of ca phenotype, adopt and assess of the effect of these 9 MDV-B specific amino acid the ca phenotype based on the reverse genetic system of plasmid.25 ℃ and 33 ℃ of following recombinant mdv-B effectively duplicate in chicken embryonic kidney (CEK) cell.On the contrary, the reorganization wild-type B/AnnArbor/1/66 that contains 9 wild-type amino acids can not effectively duplicate under 25 ℃.Determine always to have 5 wild-type amino acids and be that to reverse MDV-B ca phenotype fully required: one in PB2 (R630S), one in PA (M431V), 3 in NP (A114V, H410P, T509A).In addition, substitute with wild-type amino acid two amino acid in the M1 albumen of MDV-B or 6: 2 vaccine strains (Q159H, V183M) significantly enhanced virus 33 ℃ of (but not being 25 ℃) duplicating in the CEK cell; V183M changes bigger to this variable effect.
Embodiment 10: the electroporation by the Vero cell is from 8 plasmid rescue influenza viruses
Also can adopt electroporation from Vero cellular rescue recombinant influenza.These methods are suitable for producing A type influenza virus and Type B strains of influenza viruses, can also from the Vero cell that serum-free condition is grown down, reclaim, for example acclimatization to cold, temperature sensitivity, attenuated virus, thereby helping preparing is adapted at the attenuated live vaccine that gives in the nose intradermal vaccine preparation for example.Except it was widely used in various virus strain, electroporation technology need not extra reagent except the growth medium of cell substrate, so the possibility of noxious pollutant is lower.Specifically, this method utilization adapts to the Vero cell of growing under serum-free condition, for example pathogen-free domestic and be suitable for the Vero cellular segregation thing of production of vaccine and effectively produce reorganization and reprovision virus.This feature becomes with the suitable business method in the DNA transfered cell substrate electroporation technology.
With electroporation technology and the whole bag of tricks of DNA being introduced the Vero cell, comprise and utilize the transfection of a large amount of lipid reagent, calcium phosphate precipitation and cell microinjection to compare.Though utilize lipid reagent rescue A type influenza virus to obtain certain success, have only electroporation to show and from the Vero cell, to save Type B influenza virus and A type influenza virus.
Preceding one day of electroporation separates the Vero cell that 90-100% converges, with each T225 culturing bottle 9x10 6The density of individual cell be seeded among the MEM that has added penicillin/streptomycin, L-glutaminate, non-essential amino acid and 10%FBS (MEM, 10%FBS).Second day, the trypsin treatment cell also was resuspended in the phosphate-buffered saline (PBS) of each T225 culturing bottle 50ml.Make cell precipitation then and be resuspended among the OptiMEM I of each T225 culturing bottle 0.5ml.Can choose wantonly utilize customization do not contain the originate OptiMEM substratum of component of human or animal.Measure cell density, for example with behind 1: 40 diluent of Hematocyte Counter counting, with 5x10 6Individual cell adds 0.4cm electroporation cup, and final volume is 400 μ l OptiMEM I.Then 20 μ g DNA are added in the celliferous cup, described DNA by mix genomic 8 plasmids of MDV-A or MDV-B etc. molar mixture constitute, its volume is no more than 25 μ l.By tunking soft cell mixing, carry out electroporation, 300 volts, 950 microfarads with the BR gene pulse instrument II that is connected with enhancement type electric capacity incrementer.Time constant is the 28-33 millisecond.
By beaing soft inclusion of mixing cup, contained the MEM of 10%FBS behind the electroporation in about 1-2 minute with 1ml transfer pipet adding 0.7ml.Blow and beat soft once more for several times cell mixing up and down with transfer pipet then, assign to subsequently in 2 holes of 6 hole plates, every hole contains 2ml MEM, 10%FBS.Use 1ml MEM then, 10%FBS washs cuvette, assigns in two holes, and final volume is about the 3.5ml/ hole.
In other experiment, as mentioned above to being suitable for the serum-free growth conditions, Carlsbad, the California hero (Invitrogen of company for example, Carlsbad, CA) the Vero cell of OptiPro (SFM) carries out electroporation, behind electroporation in OptiMEM I, with OptiPro (SFM) diluting cells, culturing cell is for rescue virus subsequently.
To be suitable for duplicating and reclaiming the viral condition of introducing through the cell of electroporation then, that is, and for acclimatization to cold master donor virus strain growth under 33 ℃.Second day (for example, behind the electroporation about 19 hours) removes substratum, with OptiMEM I or OptiPro (SFM) washed cell, every hole 3ml.The OptiMEM I or the OptiPro (SFM) that will contain penicillin/streptomycin add each hole, every hole 1ml, and collect supernatant liquor by replacing substratum every day.Supernatant liquor is kept among the SPG in-80 ℃.Usually behind electroporation, observed the peak value viral yield in 2-3 days.
Table 8: the result who utilizes 8 plasmid rescue MDV virus strain of different cell types, the different transfection methods of employing
Figure G2008800207207D00341
Embodiment 11:B type influenza virus grows in egg and causes the forfeiture of HA 196/197 glycosylation site
Most of Type B influenza virus clinical isolates contain the glycosylation site that potential HA N-connects.For the B/Yamagata strain, this HA N-connects glycosylation site and is present near the amino-acid residue 196-199, is present near the amino-acid residue 197-199 for the B/Victoria strain.Nearest popular B/Victoria strain, for example B/Malaysia/2506/04 and B/Ohio/1/05, and popular B/Yamagata strain recently, for example B/Florida/7/04 contains this potential HA N-and connects glycosylation site.
Whether the HA glycosylation site of these strains keeps in order to determine going down to posterity afterwards by egg, cultivates each strain in egg, carries out nucleotide sequencing to determine coded HA amino acid sequence of polypeptide.Be used for the CDC (CDC) of the described virus of the research available from Atlanta, the Georgia State.Utilize this virus inoculation available from Charles River, Franklin, northern Connecticut State company (Charles River SPAFAS, Franklin, CT, North) contain the embryo egg, it was fertilized before virus inoculation 10-11 days.The egg of inoculation is at 33 ℃ of incubations.By the HA viral RNA of virus in the RT-PCR amplification inoculation egg, order-checking then.
After egg went down to posterity, the HA amino acid sequence of polypeptide of Type B influenza virus B/Ohio/1/05, B/Malaysia/2506/04 and B/Florida/7/04 all changed at the glycosylation site place that N-is connected.The sequence at the glycosylation site place of B/Ohio/1/05 changes over SET from NET.The sequence at the glycosylation site place of B/Malaysia/2506/04 changes over NEA or SET from NET.The sequence at the glycosylation site place of B/Florida/7/04 changes over NKP, DKT or IKT from NKT.See table 9.
Table 9: the influenza B HA 196/197 glycosylation site sequence before and after in egg, going down to posterity
Figure G2008800207207D00351
*Doctor M.Shaw of CDC provides the HA sequence of clinical isolates.
aX represents mixed sequence.
Detected the aminoacid sequence at HA glycosylation site place of various other strains of Type B influenza virus.Referring to Figure 12, it provides with the go down to posterity section H A aminoacid sequence of back 6 kinds of B/Victoria strains and 8 kinds of B/Yamagata strains of egg.Potential N-connects glycosylation site (N-X-T/S) and lines out below in the drawings.After should be noted that egg goes down to posterity, none keeps their potential N-X-T/S N-connection glycosylation sites 14 kinds of Type B strains of influenza viruses that detected.
The forfeiture of embodiment 12:HA 196/197 glycosylation site has reduced the antigenicity of Type B influenza virus
Detected of the antigenic influence of HA 196-197 glycosylation site subsequently to Type B strains of influenza viruses B/Ohio/1/05, B/Malaysia/2506/04 and B/Florida/7/04.Be the antigenicity of relatively glycosylation and non-glycosylated virus, adopt reverse genetic to learn a skill to prepare corresponding to each a pair of virus (seeing embodiment 3) among Type B strains of influenza viruses B/Ohio/1/05, B/Malaysia/2506/04 and the B/Florida/7/04.Two members of every couple are identical, the HA polypeptide that contains except first member has the wild-type amino acid sequence, promptly, contain the HA aminoacid sequence that the N-that exists connects glycosylation site from the strain that CDC obtains, second member is contained and is lacked the HA polypeptide that N-connects glycosylation site, that is, from the egg HA aminoacid sequence that back virus obtains that goes down to posterity.
6 kinds of plasmids that use during reverse genetic learns a skill provide the nucleotide sequence corresponding to the internal gene group section of ca B/Ann Arbor/1/66 (MDV-B).The 7th plasmid provides the nucleotide sequence corresponding to the genome section of the wild-type NA polypeptide of each wild-type virus of coding, for example utilizes the wild-type NA polynucleotide sequence of B/Ohio/1/05 strain to prepare each right member of B/Ohio/1/05 virus.The 8th plasmid provides the nucleotide sequence corresponding to the genome section of coding HA polypeptide.Described HA polypeptide can be HA wild-type or that egg goes down to posterity, depends on that this influenza virus is the first right member of this virus or second member.
NA by RT-PCR amplification wild-type virus or HA vRNA also are cloned in the cDNA of amplification between two BsmBI sites of pAD3000, thereby obtain the NA and the HA polynucleotide sequence of wild-type virus.Utilize La Jolla, California Xstrata genome company
Figure G2008800207207D00361
The plasmid that site-directed mutagenesis test kit site-directed mutagenesis contains wild-type HA section prepares and contains corresponding to the go down to posterity plasmid of nucleotide sequence of genome section of HA polypeptide of coding egg.
Plasmid transfection is gone into MDCK and 293 cells of cultivating altogether.The virus of all rescues is effectively duplicated in mdck cell, and titre is 6-7log 10PFU/mL.After the transfection 7 days, collect the supernatant liquor of transfectional cell, by plaque test titration.The sequential analysis of reclaiming virus confirms to have kept the HA aminoacid sequence that wild-type or egg go down to posterity, and is consistent with the HA plasmid that is used to prepare virus during transfection.
Utilize and infect back ferret serum, detect the right antigenicity of each virus by the HAI test.Intranasal vaccination 6-7log 10Back 21 days of PFU virus is collected serum from ferret.By resisting the antibody horizontal of various viruses in hemagglutinin-inhibition (HAI) test assessment ferret serum.Carry out the HAI test by the serum sample of adding 25 μ L serial dilutions in 96-hole microtiter plate at the bottom of the V-arrangement and the influenza virus (25 μ L volume) of 4HA unit.Behind the incubation 30 minutes, add 50 μ l, 0.5% turkey red corpuscle and detect hemoagglutination.The HAI titre is expressed as the highest serum extent of dilution that suppresses viral platelet aggregation effect.Table 10 provides (the HA glycosylation of paired wild-type +)/egg-go down to posterity (HA glycosylation -) viral antigenicity.
Table 10: the antigenicity of HA 196/197 glycosylation site variant in the ferret
Figure G2008800207207D00371
The serum that produces with HA glycosylation virus is higher than the non-glycosylated virus of the paired HA of institute to the HAI titre of HA glycosylation virus, and is higher to the HAI titre of the non-glycosylated virus of the paired HA of institute with the serum that the non-glycosylated virus of HA produces.Each is that 1.5-4.5 does not doubly wait to the antigenic specificity of the non-glycosylated virus of HA glycosylation/HA in the HAI test.This difference shows that 196/197 glycosylation site influences virus antigenicity.
Embodiment 13: the Type B influenza virus with HA 196/197 glycosylation site can not be in egg Duplicate
For whether each member of the paired strains of influenza viruses of determining embodiment 12 can duplicate in egg, virus is with 10 2PFU/ egg or 10 4-10 5PFU/ egg inoculation contains the embryo egg, 33 ℃ of incubations 3 days.Then by the viral peak value titre in the plaque test determination mdck cell.Duplicate situation (virus titer) and each virus the sequence at HA amino-acid residue 196-199 place of virus in egg sees Table 11 in pairs.
Table 11. is HA 196/197 glycosylation variant duplicating in egg in pairs
Figure G2008800207207D00381
A, bWith shown in 6: 2 reprovision virus with 10 2The PFU/ egg ( a) or 10 4-10 5The PFU/ egg ( b) the inoculation egg.
cMensuration reclaims the HA sequence of virus from egg, aminoacid sequence lines out below changing.
dND: undetermined.
Right for each virus, viral member well-grown in egg of shortage glycosylation site grows to titre and is higher than 8.0log 10PFU/mL.Yet the viral member with glycosylation site (NXT) is in inoculation 10 2Duplicate not good in the egg of PFU virus.Referring to table 11, it shows that it is 2.1log that HA glycosylation virus B/Ohio/1/05, B/Malaysia/2506/04 and B/Florida/7/04 only grow to virus titer respectively 10PFU/mL, 1.7log 10PFU/mL and 3.0log 10PFU/mL.When with more substantial virus (10 4-10 5When the PFU/ egg) inoculating egg, can detect duplicating of HA glycosylation virus member.The sequential analysis of these replication-competent viruses is presented at 196/197 glycosylation site place and has introduced aminoacid replacement.Referring to table 11, its wild-type glycosylation sequences that shows B/Ohio/1/05 changes to SET from NET, the wild-type glycosylation sequences of B/Malaysia/2506/04 changes to SET or NEN from NET, and the wild-type glycosylation sequences of B/Florida/7/04 changes to the glutamine of NKI or proline(Pro) replacement next-door neighbour NXT glycosylation sequences C-end from NKT.(Bause, Biochem be (1983) J.209: 331-336 in research in the past; Gavel and Von Heijne, Protein Eng.3 (1990): 433-442) show that the proline(Pro) that adjoins HA NXT glycosylation site C-end stops the glycosylation of N-connection.Therefore, it seems that it is that the Type B influenza virus is well duplicated required that HA 196/197 place lacks glycosylation in egg.
Embodiment 14: the HA glycosylation that evaluation can be duplicated in egg + The Type B strains of influenza viruses
For determine whether any Type B strains of influenza viruses that contains 196/197 glycosylation site can duplicate in egg, with various wild-type Type B strains of influenza viruses inoculation eggs.Measure the HA sequence of replication-competent virus then.The most of Type B influenza viruses that can duplicate in egg locate not contain the NXT glycosylation site at residue 197-199 (or 196-198).Even the virus that egg goes down to posterity contains the NXT glycosylation site, they are also in the forfeiture process; The NXT sequence is one of the sequence group at the proteic residue 197-199/196-198 of HA place.
Two kinds of virus strain-B/Jilin/20/03 (B/JL) and B/Jiangsu/10/03 (B/JS)-be accredited as have NXT glycosylation sequences, NKT after egg goes down to posterity.B/JL has proline(Pro) at 199 places, position of next-door neighbour 196-198 glycosylation site C-end.As mentioned above, the proline(Pro) of next-door neighbour's glycosylation site residue C-end may disturb and stop 196/197 glycosylation.Be more careful detection B/JL and the duplicate situation of B/JS in egg, by learn a skill preparation B/JL, B/JS shortage separately and relevant Type B strains of influenza viruses B/Shanghai/361/02 (B/SH) and contain the paired Type B strains of influenza viruses of NXT glycosylation site sequence of embodiment 12 described reverse genetics.Measure these the duplicate situation of virus in mdck cell and egg in pairs then.Referring to table 12.
Table 12.B/Jiangsu/10/03 has kept the 196-197 glycosylation site in egg
A, bWith shown in virus infect mdck cell with 0.004 moi, be used in increase in the mdck cell shown in 6: 2 reprovision virus with 10 2The PFU/ egg ( a) or 10 4-10 5The PFU/ egg ( b) inoculation egg and 33 ℃ of incubations 3 days, described virus has (G+) or does not have (G-) 196/197HA glycosylation site.By the viral peak value titre in the plaque test determination mdck cell.
cMensuration reclaims the HA sequence of virus from egg, aminoacid sequence lines out below changing.
All 3 pairs of viruses are duplicated in mdck cell well, and the titre scope is 6.4-7.5log 10PFU/mL.Yet not all virus is well duplicated in egg.With 10 2Log 10HA 196/197 glycosylation (glycosylation sequences NKTQ) B/SH or the B/JL virus replication of PFU inoculation egg are not good.The dosage of inoculation of B/SH or B/JL HA is increased to 10 4-10 5Log 10PFU then can detect virus replication.Check order these replication-competent viruses show glycosylation sites forfeitures (change into SKT or DKT from NKT among the B/SH, change into NKS from NKT among the B/JL).Different with B/JL virus with B/SH, the B/JS virus that is with or without glycosylation site all can well be duplicated in egg, and titre is respectively 7.3 and 8.4log 10PFU.
Each viral glycosylation state that the western blotting confirmation of HA specific antibody is grown in mdck cell and egg.By the virus of mdck cell culture supernatant or allantoic fluid is mixed with 2x protein cleavage damping fluid (hero company), carry out western blotting with the 10%SDS-PAGE gel electrophoresis.To on gel, move to nitrocellulose filter by electrophoretic protein transduction, and utilize the anti-Type B strains of influenza viruses of chicken antiserum(antisera) to carry out western blotting.With the HRP link coupled anti--the chicken antibody incubation after, utilize the chemiluminescence detection kit of GHBS company (GE Healthcare Bio-Sciences) to detect protein-antibody complex.
Western blot analysis shows when utilizing mdck cell to duplicate, the HA glycosylation +Virus keeps its glycosylation site, and therefore migration is slower than the paired HA of institute glycosylation on gel -Virus.Referring to, the swimming lane 1 and 2 of Figure 13 a for example, its demonstration and glycosylation +The band migration of the HA antiserum(antisera) cross reaction of HA (swimming lane 1) virus is slower than has glycosylation -The swimming lane band of HA virus (swimming lane 2).B/SH (Figure 13 a, swimming lane 3 and 4) and B/JL (Figure 13 a, swimming lane 5 and 6) virus obtain similar result.
When duplicating with egg, have only a kind of virus, promptly B/JS virus has kept migration model, wherein glycosylation +The band of HA virus (Figure 13 b, swimming lane 3) migration is slower than glycosylation -The band of HA virus (Figure 13 b, swimming lane 4).This mode annunciations B/JS virus is the unique virus that can duplicate and keep the HA glycosylation site with egg of being tested.
The arginine at embodiment 15:HA amino acid residue position 141 places is stablized 196-197 glycosylation position The point
Table 12 shows, though B/JS and B/JL strains of influenza viruses have aminoacid sequence NKTQ at amino-acid residue 196-199 place, has only B/JS can well duplicate and keep the NKTQ glycosylation site in egg.The HA aminoacid sequence of B/JS and B/JL virus relatively identified 3 different amino-acid residues.In these 3 residues, 141R and 237E are B/JS exclusive (with respect to other Type B influenza viruses).Most of Type B strains of influenza viruses contain glycine at amino acid residue position 141 and 237 places.For whether in check 141R and/or the 237E amino-acid residue one or two has effect to stablizing B/JS HA196 glycosylation site, mutagenesis B/JS HA changes over glycine with 141R and/or 237E.Measure the duplicate situation of various B/JS viruses in egg then.
As shown in table 13, when B/JS HA residue 141 when R changes over G, with 10 2This virus of PFU dose inoculation can not be duplicated in egg.Dosage of inoculation is increased to 10 4-10 5PFU makes this virus to duplicate in egg.What order-checking had a HA 141G residue duplicates B/JS virus to determine whether 196/197 glycosylation site keeps.Order-checking shows the forfeiture of NKT glycosylation site, and changes with DKT or NKTP.This discovery shows that HA 141 arginine residues of B/JS may stablize the 197/197HA glycosylation site.The glutamine that replaces B/JS HA amino-acid residue 237 places with glycine does not influence its growth in egg.Data not shown.
196/197 glycosylation site during table 13:HA 141R stablizes egg and goes down to posterity
Figure G2008800207207D00411
A, bWith shown in virus infect mdck cell with 0.004 moi, be used in increase in the mdck cell shown in 6: 2 reprovision virus with 10 2The PFU/ egg ( a) or 10 4-10 5The PFU/ egg ( b) inoculation egg and 33 ℃ of incubations 3 days, described virus has (G+) or does not have (G-) 196/197HA glycosylation site.By the viral peak value titre in the plaque test determination mdck cell.
cMensuration reclaims the HA sequence of virus from egg, aminoacid sequence lines out below changing.
For further confirming that HA residue 141R is enough to stablize influenza B HA 196/197 glycosylation site between the egg replicative phase, introduce aminoacid replacement with the glycine at HA 141 places of arginine replacement B/SH and B/Ohio/1/05.As shown in table 13, have glycine at 141 places, HA position and can in egg, effectively duplicate to B/SH and B/Ohio/1/05 virus that arginine replaces, titre is about 8.0log 10PFU/mL.B/SH and B/Ohio/1/05 virus with HA 141R replacement have also kept the HA glycosylation between the egg replicative phase.Referring to Figure 14, its western blotting that provides confirms the B/SH with HA 141R residue (swimming lane 2), B/Ohio (swimming lane 4) and the viral HA glycosylation of B/JS (swimming lane 6) that egg goes down to posterity.These data show that HA residue 141 influences the purposes of HA 196/197 glycosylation site of the Type B influenza virus of egg growth.
The arginine at embodiment 16:B type influenza virus residue 141 places does not influence the antigenicity of virus
Checked and replaced of the antigenic influence of HA amino acid position 141 place's arginine residues the Type B strains of influenza viruses.Whether influence virus antigenicity for measuring the 141R residue, with different glycosylations and non-glycosylated virus preparation ferret serum.Check ferret serum is to containing the reactivity of the virus of different modifying in 141 and 196/197 residue.
Utilize 7.0log 10The virus in PFU egg source prepares ferret serum by the intranasal vaccination ferret, and described virus contains heredity signature GD (non-glycosylated) or RN (glycosylation) in 141 and 196/197 site respectively.Serum is for check antigenicity in the HAI test after collecting the infection of ferret after 21 days.
Prepare the B/SH/361/02, the B/Ohio/1/05 that respectively contain heredity signature GD, RN or GN at HA amino acid position 141 and 196/197 place and B/JS/10/03 virus respectively and check antigenicity at ferret serum.Prepare these virus from the mdck cell that infects; The influenza virus that contains G141 and 196/197N residue can not grow in egg.
In the HAI test, good with the ferret serum and the reaction of non-glycosylated B/SH/361/02 virus of non-glycosylated (GD) B/SH/361/02 generation, but do not react with glycosylation B/SH/361/02 virus; The HAI titre of ferret serum is 4 times of glycosylation virus after the infection of non-glycosylated virus.Similarly, good with the ferret serum and the reaction of glycosylation B/SH/361/02 virus of the generation of glycosylation (RN) B/SH/361/02 virus, but do not react with non-glycosylated B/SH/361/02 virus.The difference of the HAI titre of ferret serum is still 4 times after the infection of non-glycosylated virus.This difference of 4 times shows the antigenic specificity of non-glycosylated and glycosylation between viral, and embodiment 12, and table 10 also has discussion.
In the HAI test, the ferret serum that produces with glycosylation (RN) B/SH/361/02 reacts with RN and GN glycosylation virus similarly; To the titre of RN glycosylation virus 2 times of GN glycosylation virus.This small difference in the reactive behavior shows that the amino-acid residue at 141 places, position changes over arginine from glycine the B/SH/361/02 antigenicity is had no significant effect.When utilizing Type B strains of influenza viruses B/Ohio/1/05 and B/JS/10/03 to carry out one group of identical HAI test, obtain analog result.Referring to table 14.
Table 14: the antigenicity of 141 pairs of Type B strains of influenza viruses of amino-acid residue is influence not
Figure G2008800207207D00421
Utilize the HAI titre of chicken red blood cell check ferret serum to MDCK source virus.
Infect the average HAI titre of back serum computational geometry from 3 portions of ferrets.
Line out below the similar HAI titre.
The glycosylation influence of embodiment 17:HA 196/197 place connects sialic combination with α-2,3
Because the glycosylated Type B influenza virus in HA 196/197 site well-grown in mdck cell, but in egg, do not grow, HA 196/197 place glycosylation may influence the virus receptor binding specificity.Sia (α-2,3) Gal and Sia (α-2,6) Gal are two kinds of principal recipient parts of difference distribution in different host cells.Mdck cell is expressed Sia (α-2,3) Gal and Sia (α-2,6) Gal part simultaneously.Chicken embryo chorioallantois theca cell is only expressed Sia (α-2,3) Gal part.Can pass through hemagglutination test, the red corpuscle (RBC) of the different animals of utilization variance expression Sia (α-2,3) and Sia (α-2,6) Gal part detects the virus receptor binding specificity.Horse RBC mainly expresses Sia (α-2,3) Gal acceptor, and cavy RBC mainly expresses Sia (α-2,6) Gal acceptor.Turkey and chicken RBC great expression Sia (α-2,3) and Sia (α-2,6) Gal part (Ito etc., Virol.156 (1997): 493-499).
Utilize the glycosylation in horse RBC (hRBC), cavy RBC (gpRBC) and turkey RBC (tRBC) check egg source +(RN) or glycosylation -The B/Ohio/1/05 of (GS, RS, GD or RD) and the HA titre of B/Jiangsu/10/03 virus.The glycosylation state of Type B influenza virus no matter, they all similarly with gpRBC and the tRBC good combination of expressing Sia (α-2,6) Gal part.On the contrary, glycosylation +(RN) virus and the hRBC that only expresses Sia (α-2,3) part in conjunction with not good or in conjunction with level detection less than, prompting HA 196/197 place glycosylation suppresses virus and Sia (α-2,3) Gal receptors bind.Referring to table 15.
Table 15:HA 196/197 glycosylation suppresses HA and connects sialic acceptor in conjunction with having α-2,3
Figure G2008800207207D00431
Glycosylated virus can not for example contain the allantoic cell of embryo egg in conjunction with the cell of expressing Sia (α-2,3) part, makes Type B influenza vaccines strain be difficult to grow in egg.The glycosylation site forfeiture makes the Type B strains of influenza viruses to grow in egg, but has changed the antigenicity of strain.If can keep HA 196/197 glycosylation site of Type B influenza virus, maintain the antigenicity of growing in the egg simultaneously and will help production of vaccine with virus.Introducing arginine at the HA of Type B strains of influenza viruses amino acid position 141 places is the means that realize this purpose.
Though describe the present invention in detail for purpose clear and that understand, those skilled in the art should know by reading this paper and can make various changes in form and details and not break away from true scope of the present invention.For example, can variously be used in combination above-mentioned all technology and equipments.Show the degree of including this paper for all purposes by reference in separately as each part publication, patent, patent application or other file, the application's all publications of quoting, patent, patent application or other file included this paper in by reference in full for all purposes.
Specifically, this paper is included in full in following patent application by reference in: the U.S. Provisional Application of submitting on June 18th, 2007 number 60/944,600.

Claims (24)

1. one kind prepares the method for duplicating the glycosylated Type B influenza virus of enhanced HA in egg, and this method comprises:
(a) will cause the aminoacid replacement at 141 places, HA position is that Type B influenza virus gene group is introduced in arginic sudden change; With
(b) under the condition that produces the Type B influenza virus, duplicate the influenza virus gene group of this sudden change.
2. method as claimed in claim 2 is characterized in that, implements described introducing step by site-directed mutagenesis.
3. one kind prepares the method for duplicating the glycosylated Type B influenza virus of enhanced HA in egg, and this method comprises:
(a) a plurality of carriers are introduced a group host cell, described carrier comprises corresponding to following nucleotide sequence:
(i) at least 6 internal gene group sections of the first Type B strains of influenza viruses; With
(ii) one or more genome sections of the coding HA of at least the second Type B strains of influenza viruses and NA polypeptide, wherein said HA polypeptide comprises arginine at amino-acid residue 141 places;
(b) cultivate this group host cell under 35 ℃ the temperature being no more than; With
(c) reclaim influenza virus.
4. method as claimed in claim 3 is characterized in that, also is included in step (i) before:
In a carrier of described a plurality of carriers, introduce sudden change;
A wherein said carrier comprise corresponding to the coding HA the genome section nucleotide sequence and
It is arginine that wherein said sudden change causes amino-acid residue 141 places.
5. as claim 3 or 4 described methods, it is characterized in that the described first Type B influenza virus has one of following attribute: temperature sensitivity, attenuation or acclimatization to cold.
6. as claim 3 or 4 described methods, it is characterized in that the described first Type B influenza virus comprises following amino-acid residue: PB2 630(630R); PA 431(431M); PA 497(497H); NP 55(55A); NP 114(114A); NP 410(410H); NP 510(510T); M1 159(159Q) and M1 183(183V).
7. method as claimed in claim 6 is characterized in that, and is further comprising the steps of;
In the carrier of described a plurality of carriers, introduce sudden change;
Described carrier comprise corresponding to the nucleotide sequence of 6 internal gene group sections of the described first Type B strains of influenza viruses and
Described sudden change causes existing following amino-acid residue: PB2 630(630R); PA 431(431M); PA 497(497H); NP 55(55A); NP 114(114A); NP 410(410H); NP 510(510T); M1 159(159Q) and M1 183(183V).
8. as claim 3 or 4 described methods, it is characterized in that the described first Type B influenza virus is virus strain B/Ann Arbor/1/66.
9. method as claimed in claim 3 is characterized in that, described cell is a kind of in Vero cell, Per.C6 cell, bhk cell, PCK cell, mdck cell, MDBK cell, 293 cells or the COS cell.
10. method as claimed in claim 3 is characterized in that described carrier is a plasmid.
11. method as claimed in claim 10 is characterized in that, described a plurality of carriers comprise 8 plasmid groups, the nucleotide sequence of each self-contained different genes group section corresponding to the described first or second Type B strains of influenza viruses in wherein said 8 plasmids.
12. method as claimed in claim 10 is characterized in that, each plasmid comprises all nucleotide sequences in described a plurality of carriers.
13. method as claimed in claim 3 is characterized in that, described method does not comprise utilizes helper virus.
14. method as claimed in claim 3 is characterized in that, implements described introducing step by the transfection or the electroporation of lipid mediation.
15. method as claimed in claim 3 is characterized in that, described temperature is between 30-35 ℃.
16. method as claimed in claim 3 is characterized in that, described temperature is between 32-35 ℃.
17. method as claimed in claim 3 is characterized in that, also comprises the influenza virus of duplicating recovery with egg;
Wherein the influenza virus of duplicating with egg keeps HA amino acid residue position 196/197 glycosylation site; With
Wherein said influenza virus copies to the peak value titre of 7.0log10PFU/ml at least with egg.
18. Type B influenza virus by claim 3 or 7 described method preparations.
19. an immunogenic composition, it comprises the described Type B influenza virus of claim 18.
20. a vaccine, it comprises the described Type B influenza virus of claim 19.
21. vaccine as claimed in claim 20 is characterized in that, described vaccine is suitable for intranasal administration.
22. as claim 3 or 17 described methods, it is characterized in that, also comprise:
Kill and wound the virus of described recovery.
23. the Type B influenza virus vaccine alive of an attenuation, it comprises the virus by claim 3 or 8 described method preparations.
24. the method for a treatment target virus infection comprises:
Give the virus of described object by claim 3 or 8 described method preparations, its administered dose effectively produces the immune response of resisting described virus infection.
CN200880020720A 2007-06-18 2008-06-18 influenza b viruses having alterations in the hemaglutinin polypeptide Pending CN101715487A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US94460007P 2007-06-18 2007-06-18
US60/944,600 2007-06-18
PCT/US2008/067301 WO2008157583A1 (en) 2007-06-18 2008-06-18 Influenza b viruses having alterations in the hemaglutinin polypeptide

Publications (1)

Publication Number Publication Date
CN101715487A true CN101715487A (en) 2010-05-26

Family

ID=40156672

Family Applications (1)

Application Number Title Priority Date Filing Date
CN200880020720A Pending CN101715487A (en) 2007-06-18 2008-06-18 influenza b viruses having alterations in the hemaglutinin polypeptide

Country Status (8)

Country Link
US (2) US8673613B2 (en)
EP (2) EP2674486A1 (en)
JP (1) JP5666905B2 (en)
CN (1) CN101715487A (en)
CA (1) CA2690196A1 (en)
ES (1) ES2523587T3 (en)
HK (1) HK1133442A1 (en)
WO (1) WO2008157583A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102864130A (en) * 2011-09-08 2013-01-09 中国农业科学院上海兽医研究所 Recombination influenza virus for high-efficiency expression HA (hemagglutinin) protein and preparation method and application thereof

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7465456B2 (en) 2002-04-26 2008-12-16 Medimmune, Llc Multi plasmid system for the production of influenza virus
KR101169468B1 (en) * 2002-04-26 2012-08-01 메디뮨 엘엘씨 Multi plasmid system for the production of influenza virus
CA2551489C (en) 2003-12-23 2013-09-03 Gregory Duke Multi plasmid system for the production of influenza virus
AU2005314563B2 (en) 2004-11-03 2011-06-30 Seqirus UK Limited Influenza vaccination
CA2690196A1 (en) 2007-06-18 2008-12-24 Medimmune, Llc Influenza b viruses having alterations in the hemaglutinin polypeptide
US20120027813A1 (en) * 2008-02-22 2012-02-02 Novartis Vaccines And Diagnostics Srl Adjuvanted influenza vaccines for pediatric use
US8506966B2 (en) 2008-02-22 2013-08-13 Novartis Ag Adjuvanted influenza vaccines for pediatric use
EP2376628B1 (en) 2008-12-16 2018-05-16 Ology Bioservices, Inc. Production of influenza vaccines
CN102307590A (en) 2009-02-10 2012-01-04 诺华有限公司 Influenza vaccines with reduced amounts of squalene
US9109013B2 (en) 2009-10-26 2015-08-18 Wisconsin Alumni Research Foundation High titer recombinant influenza viruses with enhanced replication in vero cells
EA033027B1 (en) * 2012-07-17 2019-08-30 Мериал, Инк. Attenuated swine influenza vaccines and methods of making and use thereof
JP2016524915A (en) 2013-07-15 2016-08-22 ウィスコンシン アルムニ リサーチ ファンデイション High titer recombinant influenza virus with enhanced replication in MDCK, Vero cells or eggs
WO2015196150A2 (en) 2014-06-20 2015-12-23 Wisconsin Alumni Research Foundation (Warf) Mutations that confer genetic stability to additional genes in influenza viruses
US10633422B2 (en) 2015-06-01 2020-04-28 Wisconsin Alumni Research Foundation (Warf) Influenza virus replication by inhibiting microRNA lec7C binding to influenza viral cRNA and mRNA
US9890363B2 (en) 2015-07-06 2018-02-13 Wisconsin Alumni Research Foundation (Warf) Influenza virus replication for vaccine development
US11197925B2 (en) 2016-02-19 2021-12-14 Wisconsin Alumni Research Foundation (Warf) Influenza B virus replication for vaccine development
JP2022527235A (en) 2019-01-23 2022-06-01 義裕 河岡 Mutations that impart genetic stability to additional genes in influenza virus
CN113874496A (en) 2019-02-08 2021-12-31 威斯康星校友研究基金会(Warf) Humanized cell lines
CN114929269A (en) 2019-05-01 2022-08-19 威斯康星校友研究基金会(Warf) Improved influenza virus replication for vaccine development
US11807872B2 (en) 2019-08-27 2023-11-07 Wisconsin Alumni Research Foundation (Warf) Recombinant influenza viruses with stabilized HA for replication in eggs
CN116144612B (en) * 2022-12-08 2023-11-10 广州医科大学附属第一医院（广州呼吸中心） Recombinant influenza B virus and preparation method and application thereof

Family Cites Families (68)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB660109A (en) 1946-10-01 1951-10-31 American Cyanamid Co Improvements in or relating to the treatment of allantoic fluid containing a propagated virus together with non-viral proteins to obtain the virus in purified and viable from for use in a vaccine
US3992522A (en) * 1973-01-24 1976-11-16 The United States Of America As Represented By The Department Of Health, Education And Welfare Temperature-sensitive recombinant mutant viruses and a process for producing same
US3874999A (en) * 1973-10-31 1975-04-01 American Cyanamid Co Process for the purification of virus vaccine
US4071618A (en) * 1974-09-03 1978-01-31 Research Foundation For Microbial Diseases Of Osaka University Process for preparing virus disease live vaccines
US4000257A (en) * 1975-12-22 1976-12-28 American Cyanamid Company Process for the purification of influenza virus vaccine
US4057626A (en) * 1976-10-08 1977-11-08 Richardson-Merrell Inc. Process for detoxifying influenza B virus
US4338296A (en) * 1979-10-16 1982-07-06 Smithkline-Rit Influenza virus and process of producing a vaccine therefrom
US4337242A (en) * 1980-02-05 1982-06-29 Merck & Co., Inc. Vaccine stabilizer containing L-glutamic acid and L-arginine
US4512972A (en) * 1980-06-30 1985-04-23 Kureha Chemical Industry Co., Ltd. Nasal preparation and processes for their production
JPS57136528A (en) * 1981-02-09 1982-08-23 Hayashibara Biochem Lab Inc Preparation of viral vaccine
FR2505657A1 (en) * 1981-05-13 1982-11-19 Pasteur Institut IMPROVEMENTS IN LIVE STABILIZING AGENTS FOR THE PREPARATION OF VACCINES, AND STABILIZED VACCINES CONTAINING SAID STABILIZING AGENTS
US4512285A (en) * 1983-12-27 1985-04-23 Gof Manufacturing Company, Inc. Apparatus and method for egg turning during incubation
US4634666A (en) * 1984-01-06 1987-01-06 The Board Of Trustees Of The Leland Stanford Junior University Human-murine hybridoma fusion partner
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
GB8914968D0 (en) 1989-06-29 1989-08-23 Connaught Lab Production of virus and purification of viral envelope proteins for vaccine use
US5840520A (en) * 1989-08-28 1998-11-24 Aviron Recombinant negative strand RNA virus expression systems
US5854037A (en) * 1989-08-28 1998-12-29 The Mount Sinai School Of Medicine Of The City University Of New York Recombinant negative strand RNA virus expression systems and vaccines
US5166057A (en) * 1989-08-28 1992-11-24 The Mount Sinai School Of Medicine Of The City University Of New York Recombinant negative strand rna virus expression-systems
US6887699B1 (en) * 1990-05-22 2005-05-03 Medimmune Vaccines, Inc. Recombinant negative strand RNA virus expression systems and vaccines
CA2118234A1 (en) 1992-04-14 1993-10-28 Peter Palese Genetically engineered attenuated viruses
IL105456A (en) * 1992-04-21 1996-12-05 American Home Prod Attenuated respiratory syncytial virus vaccine compositions
CA2075521C (en) * 1992-05-05 1995-11-28 Kuniaki Koyama Stabilized live vaccine
US5426039A (en) 1993-09-08 1995-06-20 Bio-Rad Laboratories, Inc. Direct molecular cloning of primer extended DNA containing an alkane diol
ES2210273T5 (en) 1994-07-18 2010-03-29 Conzelmann, Karl-Klaus, Prof. Dr. VIRUS WITH NEGATIVE CHAIN NON-SEGMENTED RECOMBINANT INFECTIVE.
US5824536A (en) * 1994-08-23 1998-10-20 St. Jude Children's Research Hospital Influenza virus replicated in mammalian cell culture and vaccine production
US5716821A (en) * 1994-09-30 1998-02-10 Uab Research Foundation Prevention and treatment of respiratory tract disease
WO1996010633A1 (en) 1994-09-30 1996-04-11 Aviron Chimeric influenza virus and electroporation method
US5789229A (en) * 1994-09-30 1998-08-04 Uab Research Foundation Stranded RNA virus particles
US6146873A (en) * 1994-11-10 2000-11-14 Baxter Aktiengesellschaft Production of orthomyxoviruses in monkey kidney cells using protein-free media
US7153510B1 (en) 1995-05-04 2006-12-26 Yale University Recombinant vesiculoviruses and their uses
US5690937A (en) * 1995-06-05 1997-11-25 Aviron Temperature sensitive clustered changed-to-alanine mutants of influenza virus PB2 gene
DE69510207T3 (en) 1995-08-09 2007-02-15 Schweiz. Serum- & Impfinstitut Bern Process for producing infectious minus-stranded RNA viruses
AU727923B2 (en) 1995-09-27 2001-01-04 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Production of infectious respiratory syncytial virus from cloned nucleotide sequences
EP0865296B1 (en) 1995-10-20 2002-02-27 Yissum Research Development Company Of The Hebrew University Of Jerusalem Influenza vaccine
EP0864645B9 (en) 1995-10-31 2006-03-22 Dnavec Research Inc. Negative-strand rna virus vector having autonomously replicating activity
CA2236378C (en) 1995-11-01 2011-01-25 Dnavec Research Inc. Recombinant sendai virus
US6090391A (en) * 1996-02-23 2000-07-18 Aviron Recombinant tryptophan mutants of influenza
DE19612966B4 (en) * 1996-04-01 2009-12-10 Novartis Vaccines And Diagnostics Gmbh & Co. Kg MDCK cells and methods of propagating influenza viruses
BRPI9710363B8 (en) 1996-07-15 2021-07-06 Us Gov Health & Human Serv attenuated recombinant respiratory syncytial virus (rsv) particle, vaccine to induce protection against recombinant respiratory syncytial virus (rsv), expression vector, and method of producing an infectious recombinant respiratory syncytial virus (rsv).
AU4427897A (en) 1996-09-27 1998-04-17 American Cyanamid Company 3' genomic promoter region and polymerase gene mutations responsible for att enuation in viruses of the order designated mononegavirales
KR100702523B1 (en) 1997-05-23 2007-04-04 더 가번먼트 오브 더 유나이티드 스테이츠 오브 아메리카, 에즈 레프리젠티드 바이 더 디파트먼트 오브 헬쓰 앤드 휴먼 서비시즈 Production of attenuated parainfluenza virus vaccines from cloned nucleotide sequences
DE69837764T2 (en) 1997-07-11 2008-01-31 Yale University, New Haven RHABDOVIRUS WITH GENUINE CHANGED CASE
KR20010030630A (en) 1997-09-19 2001-04-16 윌리암 에이취 캘넌, 에곤 이 버그 Attenuated respiratory syncytial viruses
GB9815040D0 (en) 1998-07-10 1998-09-09 Medical Res Council Conditional mutant
US6177082B1 (en) * 1998-08-13 2001-01-23 The University Of Pittsburgh-Of The Commonwealth System Of Higher Education Cold-adapted equine influenza viruses
US6544785B1 (en) * 1998-09-14 2003-04-08 Mount Sinai School Of Medicine Of New York University Helper-free rescue of recombinant negative strand RNA viruses
US6146642A (en) * 1998-09-14 2000-11-14 Mount Sinai School Of Medicine, Of The City University Of New York Recombinant new castle disease virus RNA expression systems and vaccines
CN1163613C (en) 1998-11-20 2004-08-25 中国科学院上海生物化学研究所 Human interleukin 6 core transcription factor expression plasmid series and its application in treating tumour
EP1035209A1 (en) 1999-03-06 2000-09-13 ARTEMIS Pharmaceuticals GmbH Stable recombinant influenza viruses free of helper viruses
DE122008000061I1 (en) 1999-04-06 2009-02-12 Wisconsin Alumni Res Found RECOMBINANT INFLUENZA VIRUSES FOR VACCINATION AND GENE THERAPY
US8715940B2 (en) * 1999-04-06 2014-05-06 Wisconsin Alumni Research Foundation Method of making recombinant influenza virus
GB9923176D0 (en) 1999-09-30 1999-12-01 Smithkline Beecham Biolog Novel composition
AU2001250352B2 (en) * 2000-03-02 2006-01-12 Polymun Scientific Immunbiologische Forschung Gmbh Recombinant influenza a viruses
IL152426A (en) * 2000-04-28 2011-07-31 St Jude Childrens Res Hospital Dna transfection system for the generation of infectious negative strand rna virus
KR20030061810A (en) * 2000-09-25 2003-07-22 폴리문 사이언티픽 임무노이비오로기쉐 포르슝 게엠베하 Live vaccine and method of manufacture
US7195905B2 (en) * 2001-12-10 2007-03-27 Baxter Healthcare S.A. Enveloped virus vaccine and method for production
US7465456B2 (en) 2002-04-26 2008-12-16 Medimmune, Llc Multi plasmid system for the production of influenza virus
KR101169468B1 (en) * 2002-04-26 2012-08-01 메디뮨 엘엘씨 Multi plasmid system for the production of influenza virus
US20060110406A1 (en) * 2003-02-25 2006-05-25 Medimmune Vaccines, Inc. Refrigerator-temperature stable influenza vaccine compositions
KR101190932B1 (en) * 2003-02-25 2012-10-16 메디뮨 엘엘씨 Methods of producing inflenza vaccine compositions
WO2005018539A2 (en) * 2003-06-16 2005-03-03 Medimmune Vaccines, Inc. Influenza hemagglutinin and neuraminidase variants
US7037707B2 (en) * 2003-09-04 2006-05-02 St. Jude Children's Research Hospital Method for generating influenza viruses and vaccines
CA2551489C (en) 2003-12-23 2013-09-03 Gregory Duke Multi plasmid system for the production of influenza virus
EP1748790B1 (en) 2004-05-24 2015-07-15 MedImmune, LLC Multi plasmid system for the production of influenza virus
WO2006041819A1 (en) 2004-10-06 2006-04-20 Medimmune Vaccines, Inc. Refrigerator-temperature stable influenza vaccine compositions
ES2382446T3 (en) 2004-11-01 2012-06-08 Eiken Kagaku Kabushiki Kaisha H5 avian influenza virus detection method
CA2690196A1 (en) 2007-06-18 2008-12-24 Medimmune, Llc Influenza b viruses having alterations in the hemaglutinin polypeptide
WO2009122431A2 (en) * 2008-02-15 2009-10-08 Sun Pharma Advanced Research Company Ltd., Oral controlled release tablet

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102864130A (en) * 2011-09-08 2013-01-09 中国农业科学院上海兽医研究所 Recombination influenza virus for high-efficiency expression HA (hemagglutinin) protein and preparation method and application thereof

Also Published As

Publication number Publication date
EP2674486A1 (en) 2013-12-18
US20100322969A1 (en) 2010-12-23
JP2010530248A (en) 2010-09-09
US8673613B2 (en) 2014-03-18
EP2069484B1 (en) 2014-08-13
EP2069484A1 (en) 2009-06-17
HK1133442A1 (en) 2010-03-26
WO2008157583A1 (en) 2008-12-24
US20140199683A1 (en) 2014-07-17
AU2008265760A1 (en) 2008-12-24
ES2523587T3 (en) 2014-11-27
US9068986B2 (en) 2015-06-30
EP2069484A4 (en) 2011-06-01
JP5666905B2 (en) 2015-02-12
CA2690196A1 (en) 2008-12-24

Similar Documents

Publication Publication Date Title
CN101715487A (en) influenza b viruses having alterations in the hemaglutinin polypeptide
CN1678345B (en) Multi plasmid system for the production of influenza virus
JP5264955B2 (en) Multiple plasmid systems for influenza virus production
KR101316350B1 (en) Methods of producing influenza vaccine compositions
KR20080024212A (en) Methods and compositions for expressing negative-sense viral rna in canine cells
CN101528941A (en) Methods and compositions for expressing negative-sense viral RNA in canine cells
CN104278014A (en) Influenza hemagglutinin and neuraminidase variants
CN104611299B (en) H9N2 avian flus strain, preparation method, vaccine combination and its application of a kind of artificial recombination
CN101243189A (en) Methods and compositions for expressing negative-sense viral RNA in canine cells
AU2008265760B2 (en) Influenza B viruses having alterations in the hemaglutinin polypeptide

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20100526