CN101654685B - Human Bcl-2 and human VEGF165 double-gene co-expression recombinant vector and building method thereof - Google Patents

Abstract

The invention relates to a human Bcl-2 and human VEGF165 double-gene co-expression recombinant vector and a building method thereof, and is characterized in that IRES segment is utilized to connect an hBc1-2 gene and an hVEGF165 gene, and homologous recombination mechanisms in bacterium are utilized to recombine and build the human Bcl-2 and human VEGF165 double-gene co-expression recombinant vector according to an AdEasy system. The invention leads the Bcl-2 gene with anti-apoptosis capacity and the VEGF165 gene which currently promotes angiogenesis cytokine with strongest function to recombine on a same vector to be co-expressed, and solves the problem of low survival rate of transplanted cells under the condition of hypoxia and inflammation, simultaneously plays the function of promoting angiogenesis of VEGF165, plays an important part in the gene therapy of myocardial infarction and the cell transplantation research field, and has wide application prospect.

Description

People Bcl-2 and people VEGF 165Double gene coexpression recombinant vectors and construction process thereof

Technical field

The present invention relates to a kind of double gene coexpression recombinant vectors and construction process thereof, particularly related to a kind of people Bcl-2 and people VEGF ₁₆₅Double gene coexpression recombinant vectors and construction process thereof.Belong to biological gene treatment field.

Background technology

Myocardial infarction (Myocardium infarction, MI) is coronary blood to occur for sharply reducing or interrupting on the coronary artery pathological changes basis, cause corresponding cardiac muscle seriously and enduringly ischemic cause myocardial necrosis.The myocardial cell is terminally differentiated cells, can not repair by cell regeneration after the myocardial damage, but form the fibrosis scar.Mainly be pharmacological agent, percutaneous coronary intervention and coronary bypass to the methods for the treatment of of MI clinically at present, although this three large method can make the revascularization of part patient obturation and recover blood perfusion, save to a certain extent dying cardiac muscle, slow down myocardial remodelling and heart failure process, alleviate patient's symptom, reduce case fatality rate.But because these therapies can't make the Myocardial Regeneration of infarct, so that long-term prognosis is still undesirable.Heart transplantation is then owing to existing the defectives such as donor shortage, immunological rejection and somewhat expensive to make it be difficult to clinically promote.Therefore, the effective means that needs clinically a kind of new this disease for the treatment of.

Gene therapy or be the focus of studying now the myocardial infarction treatment method to transplantation treatment behind the stem cell genetic modification, what entered clinical study is the monogenic methods for the treatment of such as anti-apoptotic genes expression or Angiogensis gene.Relate to the dual-gene adenovirus carrier of a kind of restructuring among the Chinese invention patent CN200810302770.6, be characterized at a carrier two kinds of different genes of having recombinated, although its effect aspect curative effect is better than using the single-gene result for the treatment of, but the gene that these two kinds of genes are respectively bFGF albumen and the gene of PDGF-B albumen, belong to the factor that promotes vasculogenesis, its effect can only be to promote that vasculogenesis increases, and this patent is to adopt two to start the factors, easily produces and mutually suppresses between two promotors to cause a genetic expression to suppress the drawback of another genetic expression.

Find in the research, the Bcl-2 gene family is the gene family of at present known most important regulating cell apoptosis.The albumen mass-energy of Bcl-2 gene and coding thereof is not in the situation that affect the cell cycle and the differentiation inhibited apoptosis, prolong cell survival.Vascular endothelial growth factor (Vascular endothelial growth factor, VEGF) is the strongest cytokine of angiogenesispromoting effect of finding at present.There are some researches show, use separately the Bcl-2 gene or VEGF gene pairs myocardial infarction has obvious result for the treatment of, but still undesirable, the space of further lifting is arranged.In most cells, exist the cascade connection of mutual rise between Bcl-2 gene and the VEGF gene, on biological function, can form synergy.

Summary of the invention

One of purpose of the present invention is in order to make up a kind of people Bcl-2 and people VEGF ₁₆₅The double gene coexpression recombinant vectors is for the research of combined gene therapy myocardial infarction lays the foundation.

Two of purpose of the present invention is for a kind of construction process of above-mentioned recombinant vectors is provided.

One of purpose of the present invention is achieved through the following technical solutions:

People Bcl-2 and people VEGF ₁₆₅The double gene coexpression recombinant vectors is characterized in that: described recombinant vectors comprises people Bcl-2 gene (hBcl-2) and people VEGF ₁₆₅Gene (hVEGF ₁₆₅);

Wherein, the hBcl-2 gene order is such as sequence table SEQ ID №: as described in 1; HVEGF ₁₆₅Gene order is such as sequence table SEQ ID №: as described in 2; Utilize the IRES fragment to connect hBcl-2, hVEGF ₁₆₅Gene utilizes homologous recombination mechanism recombination to construct hBcl-2 of the present invention and hVEGF in the bacterium take the AdEasy system as the basis ₁₆₅The double gene coexpression recombinant vectors.

Used carrier of the present invention is adenovirus carrier, and the adenovirus carrier host range is wide, transfection efficiency and gene expression dose is high, security is better, is the excellent carrier of gene therapy, is the comparatively desirable carrier of myocardial infarction gene therapy.Also can use other carriers such as other adeno-associated viruses, slow virus and plasmid.

Two of purpose of the present invention is achieved through the following technical solutions:

People Bcl-2 and people VEGF ₁₆₅The construction process of double gene coexpression recombinant vectors is characterized in that: mainly comprise following step:

1) obtains hBcl-2, hVEGF ₁₆₅Gene; (2) make up shuttle vector of adenovirus pAd-Track-CMV-hBcl-2-IRES-hVEGF ₁₆₅(3) recombination to construct carries hBcl-2 gene, IRES fragment and hVEGF ₁₆₅Adenovirus carrier plasmid pAd-Easy-CMV-hBcl-2-IRES-hVEGF ₁₆₅(4) packing of liposome transfection method mediation recombinant adenoviral vector plasmid in the HEK293 cell.

Two of purpose of the present invention can also be achieved through the following technical solutions:

A kind of embodiment of two of purpose of the present invention is: step 1) can obtain hBcl-2, hVEGF by RT-PCR ₁₆₅Gene; According to gene order design synthetic amplification hBcl-2 and hVEGF among the Genebank ₁₆₅The PCR primer;

The PCR primer sequence of hBcl-2 of wherein increasing is:

Forward 5 ' GAAGATCTATGGCGCACGCTGGGAGAA introduces the BglII site, and oppositely 5'ACGCGTCGACTCACTTGTGGCTBCAGATAGGCACC introduces the SalI site;

Amplification hVEGF ₁₆₅The PCR primer sequence be:

Forward 5 ' GCTCTAGAATGAACTTTCTGCTGTCTTGGGTGC introduces the XbaI site, and reverse 5 ' CCGGATATCGCTCACCGCCTCGGCTTGTCACAT introduces the EcoRV site.

A kind of embodiment of two of purpose of the present invention is: step (2) mainly comprises people Bcl-2 gene, IRES fragment and people VEGF ₁₆₅Orientation is loaded into the adenovirus shuttle vector plasmid successively.

A kind of embodiment of two of purpose of the present invention is: step (3) is as the basis, with the dephosphorylized recombinant shuttle vector plasmid of linearizing pAd-Track-CMV-hBcl-2-IRES-hVEGF take the AdEasy system ₁₆₅Utilize homologous recombination mechanism restructuring in the bacterium with skeleton plasmid pAd-Easy-1.

The beneficial effect that the present invention has is as follows:

1, the present invention will have Bcl-2 gene and the present the strongest cytokine VEGF of angiogenesispromoting effect of anti-apoptosis capacity ₁₆₅Gene recombination is coexpression on identical carrier, performance VEGF when having solved the transplanted cells problem that survival rate is low under the condition of hypoxemia, inflammation ₁₆₅Angiogenesispromoting effect, and utilize Bcl-2 and VEGF ₁₆₅Mutual rise effect, single effects of action is amplified, both form synergistic effect at biological function, and then promote that revascularization, the myocardial cell of heart repairs behind the heart stalk, accelerate the recovery of heart function.The present invention will play a significant role in gene therapy and the Transplanted cells research field of myocardial infarction, has broad application prospects.

2, the present invention is carried anti-accent die gene Bcl-2 and Angiogensis gene VEGF in identical carrier ₁₆₅, realize the coexpression of two genes by the connection of IRES fragment.The present invention utilizes the IRES fragment to connect hBcl-2, hVEGF ₁₆₅Gene is realized double gene coexpression, has avoided using the drawback that there is the genetic expression inhibition that the mutual phenomenon that suppresses may cause between promotor in double-promoter.

Description of drawings

Fig. 1 is the adenovirus vector construct schematic diagram.

Fig. 2 is the adenovirus shuttle vector plasmid map.

Fig. 3 is hBcl-2 and hVEGF ₁₆₅PCR product electrophorogram.Among the figure, M:DL2000; The hBcl-2 fragment of 1:734bp; The hVEGF of 2:595bp ₁₆₅Fragment.

Fig. 4 is pMD19T-hBcl-2 plasmid enzyme restriction evaluation figure.Among the figure, M:DL2000; 1:pMD19T-hBcl-2 plasmid BglII, SalI double digestion product.

Fig. 5 is pMD19T-hBcl-2 plasmid gene sequencer map.

Fig. 6 is pMD19T-hVEGF ₁₆₅Plasmid enzyme restriction is identified figure.Among the figure, M:DL2000; 1:pMD19T-hVEGF ₁₆₅Plasmid XbaI, EcoRV double digestion product.

Fig. 7 is pMD19T-hVEGF ₁₆₅The plasmid gene sequencer map.

Fig. 8 is shuttling expression plasmid vector pAd-Track-CMV-hBcl-2-IRES-hVEGF ₁₆₅Enzyme is cut evaluation figure.Among the figure, M:DL15000marker 1:BglII the SalI double digestion obtain the fragment of 722bp; 2:XbaI the EcoRV double digestion obtain the fragment of 584bp; 3:XhoI the fragment of XbaI double digestion 641bp; 4:BglII the EcoRV double digestion obtain fragment about 2Kb.

Fig. 9 is that the enzyme of recombinant adenoviral vector plasmid is cut evaluation figure.Among the figure, M:1kb ladder Marker; 1: recombinant adenoviral vector plasmid PacI single endonuclease digestion product.

Figure 10 is that the PCR of recombinant dna identifies.Among the figure, M:DL2000; The hVEGF of 1:584bp ₁₆₅Fragment; The hBcl-2 fragment of 2:734bp.

The HEK293 cellular form changes and with the expression of visual field GFP in Figure 11 adenovirus packing amplification procedure.Among the figure,

A: 2 hours HEK293 (* 100) B after the transfection: the expression of 2 hours GFP (* 100) after the transfection

C: the 3rd day HEK293 cell (* 100) D after the transfection: the expression (* 100) of the 3rd day GFP after the transfection

E: second takes turns the 7th day HEK293 cell (* 100) F of amplification: second takes turns the expression (* 100) of the 7th day GFP of amplification

G: second takes turns the 10th day HEK293 cell (* 200) H of amplification: second takes turns the expression (* 200) of the 10th day GFP of amplification

Embodiment

Describe by the following examples the present invention, should be noted that, cited embodiment should not be construed as limitation of the present invention.

Specific embodiment 1

Fig. 1～11 consist of specific embodiments of the invention 1.

People Bcl-2 and people VEGF ₁₆₅The double gene coexpression recombinant vectors comprises people Bcl-2 gene and people VEGF ₁₆₅Gene; Wherein, people Bcl-2 gene order is such as sequence table SEQ ID №: as described in 1; People VEGF ₁₆₅Gene order is such as sequence table SEQ ID №: as described in 2; Described carrier is adenovirus carrier, also can use other carriers such as other adeno-associated viruses, slow virus and plasmid.

Described people Bcl-2 and people VEGF ₁₆₅The building process of double gene coexpression recombinant adenoviral vector as shown in Figure 1, its construction process is specific as follows:

1, main experiment reagent and equipment:

Biochemical reagents: DNA Marker (Japanese Takara), Tryptones, yeast extract, agar powder (Japanese Oxoid), agarose (Spain Biowest), kantlex, penbritin (U.S. Amresco) Trizol reagent (American I nvitrogen).

Toolenzyme and test kit: reverse transcription reaction test kit, Lipofectamine2000 (American I nvitrogen), the little extraction reagent kit of plasmid, glue reclaims test kit (German Qiagen), remove to measure in the intracellular toxin plasmid extraction kit (German MN), the PCR primer, LA Taq enzyme reagent kit, pMD19T support agent box (Japanese Takara), the T4 ligase enzyme, alkaline phosphatase and restriction enzyme BglII, SalI, XbaI, EcoRV, XhoI, XbaI, PacI, PmeI (U.S. NEB), the DMEM cell culture fluid, the Opti-MEMI cell culture fluid, foetal calf serum (U.S. GIBCO), adenovirus precipitator method purification kit (U.S. GENMED).

Plasmid, bacterial strain and cell strain: A549 lung cancer cell line, pIRES plasmid, AdEasy system (pAd-Track-CMV plasmid, the E.coli BJ5183 that contains the pAd-Easy-1 plasmid, HEK293 cell), bacillus coli DH 5 alpha (preservation of Guangzhou Medical College experimental medicine research centre).

Key instrument and equipment: FORMA3111 water jacket CO2 incubator (U.S. Thermo), real-time fluorescence quantitative PCR instrument (U.S. Bio-rad), Bechtop (Suzhou Decontamination Equipment Plant), inversion type biological microscope (German Leica), gel imaging system (U.S. Bio-rad), nucleic acid-protein quantitative instrument (U.S. Nano Drop), shaking culture case (U.S. Thermo), multi-functional cell electroporation instrument (German Eppendorf).

2, experiment content

2.1hBcl-2, hVEGF ₁₆₅The acquisition of gene

2.1.1 recover, the A549 cell of cultivating, go down to posterity

Take out the A549 cell of preserving in the liquid nitrogen, put into rapidly 37 ℃ water bath with thermostatic control, and acutely rock, it is melted as early as possible, enchylema is transferred in the 15mL centrifuge tube the centrifugal 5min of 1000rpm in the Bechtop, with the DMEM nutrient solution resuspension that contains 10%FBS, and be transferred in the T-25 Tissue Culture Flask, replenish nutrient solution to 5mL, put 37 ℃, 5%CO ₂Cultivate in the cell culture incubator, change nutrient solution next day, continue to cultivate, observe growing state.Treat that cell grows to abundance and approximately discards old training liquid 80% the time, tryptic digestive juice (0.25%) peptic cell that adds 37 ℃ of preheatings of 1mL, observation of cell form under the inverted microscope, treat that most cells becomes no longer to connect between circle, the cell and remove Digestive system when in blocks, add fresh nutrient solution, with dropper cell is blown and beaten into single cell suspension, go down to posterity in ratio inoculation in 1: 3, continue to cultivate.

2.1.2 extract total RNA of A549 cell

With glassware, the EP pipe of experiment usefulness, rifle head through 0.1%DEPC soaked overnight deactivation RNA enzyme, and autoclaving.Select growth conditions good, abundance is 80% cell approximately, is undertaken by Trizol reagent specification sheets: at first discard cell culture fluid, add 1mL Trizol reagent bedding cell, repeatedly shake to cell detachment, move in the EP pipe of 1.5mL room temperature incubation 5min.Add the 0.2mL chloroform, vibration 15s leaves standstill 2min.4 ℃ are centrifugal, and 12000g * 15min gets supernatant, with colourless water gently sucking-off be transferred in another EP pipe.Add the 0.5mL Virahol, with the mixing gently of liquid in the pipe, room temperature leaves standstill 10min.4 ℃ are centrifugal, 12000g * 10min, and as seen supernatant is abandoned in a little flocks.Add 1mL 75% ethanol, mixing, gently washing precipitation are shaken in the top.4 ℃ centrifugal, and 7500g * 5min abandons supernatant.Dry, add the DEPC water dissolution of 25 μ l.Get 5 μ l agarose gel electrophoresis and identify the RNA integrity.The nucleic acid-protein quantitative instrument is quantitative.All the other are stored in-80 ℃ of refrigerators at once.

2.1.3 reverse transcription reaction obtains cDNA

Carry out 20 μ l reaction systems by M-MLV reverse transcription reaction test kit specification sheets:

Following 4 kinds of reagent adding is gone in the PCR pipe of RNA enzyme:

oligo(dT)(500μg/mL) 1μl

Total RNA 2 μ l

10mM dNTP Mix 1μl

Sterile distilled water 8 μ l

With 65 ℃ in mixture heating 5min, then rapid moving is on ice, adds 3 kinds of reagent in the PCR pipe with the PCR pipe is simple centrifugal:

5×First-strand Buffer 4μl

0.1M DTT 2μl

40U/μl Rnase inhibitor 1μl

Shake up gently behind the centrifuge tube 37 ℃ and place 2min, adding M-MLV RT 1 μ l (200U) in the pipe shakes up gently, puts on the PCR instrument 37 ℃ and hatches 50min, and 70 ℃, 15min, resulting cDNA put-20 ℃ of preservations as the template of next step PCR.

2.1.4 PCR obtains hBcl-2 and hVEGF ₁₆₅Gene

According to gene order design synthetic amplification hBcl-2 and hVEGF among the Genebank ₁₆₅The PCR primer, sequence is respectively: hBcl-2: forward 5 ' GAAGATCTATGGCGCACGCTGGGAGAA introduces the BglII site, oppositely 5'ACGCGTCGACTCACTTGTGGCTBCAGATAGGCACC introduces the SalI site; HVEGF ₁₆₅: forward 5'GCTCTAGAATGAACTTTCTGCTGTCTTGGGTGC introduces the XbaI site, and oppositely 5'CCGGATATCGCTCACCGCCTCGGCTTGTCACAT introduces the EcoRV site.

By following component preparation PCR reaction solution, 50 μ l reaction systems:

TaKaRa LATaq(5U/μl) 0.5μl

10×LAPCR Buffer II(Mg2+Plus) 5μl

DNTP Mixture (each 2.5mM) 8 μ l

Template cDNA 0.5 μ l

Upstream primer (20 μ M) 1 μ l

Downstream primer (20 μ M) 1 μ l

Sterile purified water 34 μ l

Reaction conditions:

94℃ 3min

94℃ 30s

58 ℃ (hBcl-2), 55 ℃ of (hVEGF ₁₆₅) 35 circulations of 30s

72℃ 1min

72℃ 10min

Store at 4℃

Getting 10 μ l PCR product row agarose gel electrophoresis (2% agarose that contains Ethidum Eremide) detects.Detected result as shown in Figure 3, the hBcl-2 fragment of the visible 734bp of PCR product agarose gel electrophoresis and the hVEGF of 595bp ₁₆₅Fragment.

2.1.5 from the PCR product, reclaim purifying DNA fragment

Use QIAquick ^TMGel Extraction Kit gel purification PCR product: 40 μ l PCR products are all carried out agarose gel electrophoresis (2% agarose), downcut the gel that contains DNA band to be recycled with clean sharp knife blade under the uv analyzer, put in the colourless EP pipe of 1.5mL, weigh.Add Buffer QG (adding Buffer QG 300 μ l by every 100mg gel), put 50 ℃ of water-bath 10min; Check that institute adds Buffer and solute color, yellow i.e. fully dissolving; Pillar is placed on the 2mL collection tube, mentioned solution is added on the post.4 ℃ of centrifugal 13000g * 1min; Discard liquid in the collection tube, adsorption column is reentered in the collection tube.Add 500 μ l BufferQG on post, 4 ℃ of centrifugal 13000g * 1min discard liquid in the collection tube.Add 750 μ l Buffer PE on post, 4 ℃ of centrifugal 13000g * 1min discard liquid in the collection tube.4 ℃ of centrifugal 13000g * 1min discard collection tube.Post is put in the new 1.5mL EP pipe, adds 50 μ l buffer EB on post.Place 1min, 4 ℃ of centrifugal 13000g * 1min, liquid is the dna fragmentation of recovery in this EP pipe.Get the DNA electrophoresis detection that 5 μ l reclaim, the nucleic acid-protein quantitative instrument is quantitative.

2.1.6 Calcium Chloride Method prepares the competence bacillus coli DH 5 alpha

A. directly get frozen bacillus coli DH 5 alpha with transfering loop, in the line of LB culture medium flat plate surface, cultivate 16h in 37 ℃;

B. single bacterium colony of picking is inoculated in the LB substratum of 5mL antibiotic-free, in 37 ℃, 200rpm shaking culture 5h;

C. nutrient solution all forwards in the 100mL LB substratum and cultivates 2h-3h, to OD ₆₀₀=0.3～0.4;

D. nutrient solution is changed in the 1.5mL centrifuge tube, place 15-30min on ice;

E.4 ℃ centrifugal, 4000rpm * 5min abandons supernatant;

F. the 0.1mol/L CaCl that adds the 0.8mL precooling ₂Solution suspends and precipitates, on ice precooling 10min;

G.4 ℃ centrifugal, 4000rpm * 5min abandons supernatant;

H. the 0.1mol/L CaCl that adds the 0.2mL precooling ₂Solution suspends and precipitates, and it is 15% that the glycerine of adding precooling makes cumulative volume, and packing 100 μ l/ pipes place-70 ℃ of prolonged preservation.

2.1.7pMD19T-hBcl-2 plasmid, pMD19T-hVEGF ₁₆₅The acquisition of plasmid

Undertaken by Takara pMD19T simple vector test kit specification sheets: the following dna solution of preparation in Eppendorf tube, full dose is 5 μ l:

pMD19-T Simple Vector 1μl

DNA (hBcl-2 or hVEGF ₁₆₅) 0.1pmol

Sterilization distilled water up to 5 μ l

The Solution I liquid that adds 5 μ l, 16 ℃ of reaction 30min, full dose (10 μ l) is added among the competence E.coliDH5 α (use before in thaw in ice), places 30min in the ice, 42 ℃ hatch 45s after, in ice, place again 1min, add 890 μ l LB substratum, 37 ℃ of shaking culture 60min get 100 μ l and are coated on the LB culture medium flat plate that contains penbritin, be inverted for 37 ℃ and cultivate 16h, form single bacterium colony of white.Select 8 white colonies and be inoculated in respectively the LB substratum that 2mL contains penbritin, 37 ℃, 200rpm shaking culture 12h, visible liquid becomes muddy.

2.1.8 pMD19T-hBcl-2 plasmid, pMD19T-hVEGF ₁₆₅The bacterium colony PCR of plasmid identifies and order-checking is identified

Get the centrifugal 1min of 50 μ l bacterium liquid 1000rpm, abandon supernatant, add 30 μ l distilled waters, boil 10min, the centrifugal 1min of 1000rpm, getting 2 μ l supernatants is the template performing PCR, reaction system and reaction conditions are the same.Bacterium colony PCR is identified that positive bacterium liquid send the order-checking of Dalian precious biotechnology company limited, and sequencing primer is M13.

With BglII, SalI double digestion pMD19T-hBcl-2 plasmid, agarose gel electrophoresis sees that the certain enzyme of 722bp and 2.6Kb cuts product (such as Fig. 4), and gene sequencing result (such as Fig. 5) is identical with the hBcl-2 sequence gi|161277340| among the Genebank by the BLAST comparison.PMD19T-hVEGF ₁₆₅Plasmid is through XbaI, EcoRV double digestion, and agarose gel electrophoresis sees that the certain enzyme of 584bp and 2.6Kb cuts product (such as Fig. 6), and gene sequencing result (such as Fig. 7) is by the hVEGF among BLAST comparison and the Genebank ₁₆₅Sequence gi|19909064| is identical.

2.2 shuttle vector of adenovirus plasmid pAd-Track-CMV-hBcl-2-IRES-hVEGF ₁₆₅Structure

2.2.1pMD19T-hBcl-2, pMD19T-hVEGF ₁₆₅, three kinds of plasmids of pAd-Track-CMV extraction undertaken by QIAprep Spin Miniprep Kit specification sheets:

A. get correct pMD19T-hBcl-2 plasmid, the pMD19T-hVEGF of order-checking that 5 μ l glycerine are preserved ₁₆₅Plasmid bacterium liquid is inoculated in the LB substratum that contains penbritin by 1: 1000 volume ratio; AdEasy system (pAd-Track-CMV) plasmid is inoculated in the LB substratum that contains kantlex, and 37 ℃ of shaking culture are spent the night;

B. under the room temperature that bacterium liquid 10000rpm * 3min is centrifugal, sop up the LB substratum;

C. add 250 μ l P1 liquid resuspensions, then piping and druming be transferred to the EP pipe to not seeing that bacterial aggregate is arranged;

D. add 250 μ l P2 liquid, be inverted and rock (can not shake) 4-6 time, to mixing fully, be blueness;

E. add 350 μ l N3 liquid, be inverted at once and rock 4-6 time, most white;

F.13000rpm * and 10min is centrifugal, and supernatant is drawn to pillar, and 13000rpm * 60s is centrifugal, abandons waste liquid;

G. add 500 μ l PB liquid, then 13000rpm * 60s is centrifugal;

H. add 750 μ l PE liquid, 13000rpm * 60s is centrifugal, abandons waste liquid, the more centrifugal residue washing lotion of once removing;

I. put a clean EP pipe below pillar, add 50 μ l EB liquid to pillar, leave standstill 1min, centrifugal 1min obtains respectively three kinds of plasmids, and quantitative with the nucleic acid-protein quantitative instrument.

2.2.2 restructuring pAd-Track-CMV-hBcl-2 plasmid

With pAd-Track-CMV, pMD19T-hBcl-2 BglII, SalI double digestion, 50 μ l enzymes are cut system respectively:

pAd-Track-CMV 2μg

Or pMD19T-hBcl-2

BglII 1μl

SalI 1μl

10 * NEB damping fluid, 35 μ l

100×BSA 0.5μl

Sterilization distilled water to 50 μ l

37 ℃ of enzymes are cut and are spent the night, and get 5 μ l enzymes and cut the evaluation of product agarose gel electrophoresis gel, determine to use QIAquick after enzyme is cut correctly ^TMThe pAd-Track-CMV plasmid fragment of the incision of Gel Extraction Kit recovery 9205bp and the hBcl-2 gene fragment of 726bp, and quantitative with the nucleic acid-protein quantitative instrument.

Be that 1: 10 ratio is set up 20 μ l linked systems in the mole ratio of pAd-Track-CMV and hBcl-2, use T ₄16 ℃ of connections of dna ligase are spent the night.Connect the product full dose and add among the competence E.coliDH5 α (in ice, thawing in before using), place 30min in the ice, behind 42 ℃ of heating 45s, in ice, place again 1min, add 890 μ l LB substratum, 37 ℃ of shaking culture 60min.Get 100 μ l and be coated on kantlex LB culture medium flat plate, be inverted for 37 ℃ and cultivate 16h, form single bacterium colony of white, select 8 white colonies and be inoculated in respectively the LB substratum that 2mL contains kantlex, 37 ℃, 200rpm shake bacterium 12h, as seen LB becomes muddy, and the bacterium colony PCR of row hBcl-2 identifies (method is the same).The little extraction reagent kit of plasmid of using of the PCR positive is extracted plasmid, identify with BglII, SalI double digestion, and quantitative with the nucleic acid-protein quantitative instrument.

2.2.3 restructuring pAd-Track-CMV-hBcl-2-hVEGF ₁₆₅Plasmid

Respectively with pAd-Track-CMV-hBcl-2, pMD19T-hVEGF ₁₆₅Plasmid XbaI, EcoRV double digestion, 50 μ l enzymes are cut system:

pAd-Track-CMV-hBcl-2 2 ug

(or pMD19T-hVEGF ₁₆₅)

XbaI 1μl

EcoRV 1μl

10 * NEB damping fluid, 25 μ l

100×BSA 0.5μl

Sterilization distilled water to 50 μ l

37 ℃ of enzymes are cut and are spent the night, and get 5 μ l enzymes and cut the evaluation of product Normal Agarose Gel, determine to use QIAquick after enzyme is cut correctly ^TMGel Extraction Kit reclaims the incision pAd-Track-CMV-hBcl-2 plasmid fragment of 9925bp and the hVEGF of 584bp ₁₆₅Gene fragment, and quantitative with the nucleic acid-protein quantitative instrument.

Press pAd-Track-CMV-hBcl-2 and hVEGF ₁₆₅Mole ratio be that 1: 10 ratio is set up 20 μ l linked systems, use T ₄16 ℃ of connections of dna ligase are spent the night.To connect product full dose transformed competence colibacillus E.coliDH5 α, be coated on kantlex LB culture medium flat plate, select 8 white colonies after the cultivation, be inoculated in the LB substratum that contains kantlex, row hVEGF ₁₆₅Bacterium colony PCR identifies (method is the same).The little extraction reagent kit of plasmid of using of the PCR positive is extracted plasmid, XbaI, the evaluation of EcoRV double digestion, and quantitative with the nucleic acid-protein quantitative instrument.

2.2.4 restructuring pAd-Track-CMV-hBcl-2-IRES-hVEGF ₁₆₅Plasmid

Respectively with pAd-Track-CMV-hBcl-2-hVEGF ₁₆₅, the pIRES plasmid is with XhoI, XbaI double digestion, enzyme is cut system:

pAd-Track-CMV-hBcl-2-hVEGF ₁₆₅ 2μg

(or pIRES)

XhoI 1μl

XbaI 1μl

10 * NEB damping fluid, 25 μ l

100×BSA 0.5μl

Sterilization distilled water to 50 μ l

37 ℃ of enzymes are cut and are spent the night, and get 5 μ l enzymes and cut the evaluation of product Normal Agarose Gel, determine to use QIAquick after enzyme is cut correctly ^TMGel Extraction Kit reclaims the incision pAd-Track-CMV-hBcl-2-hVEGF of 10507bp ₁₆₅The IRES fragment of plasmid fragment and 641bp, quantitative with the nucleic acid-protein quantitative instrument.

Press pAd-Track-CMV-hBcl-2-hVEGF ₁₆₅With the mole ratio of IRES be that 1: 10 ratio is set up 20 μ l linked systems, use T ₄16 ℃ of connections of dna ligase are spent the night.To connect product full dose transformed competence colibacillus E.coliDH5 α, and be coated on kantlex LB culture medium flat plate, and select 8 white colonies after the cultivation, and be inoculated in the LB substratum that contains kantlex, row bacterium colony PCR identifies that (primer is hBcl-2 upstream and hVEGF ₁₆₅The downstream).The little extraction reagent kit of plasmid of using of the PCR positive is extracted plasmid, XhoI, the evaluation of XbaI double digestion, and quantitative with the nucleic acid-protein quantitative instrument.

2.2.5 recombinant shuttle vector plasmid pAd-Track-CMV-hBcl-2-IRES-hVEGF ₁₆₅Enzyme cut evaluation

Recombinant shuttle vector plasmid pAd-Track-CMV-hBcl-2-IRES-hVEGF ₁₆₅Through BglII SalI, XbaI EcoRV, XhoI XbaI, BglII the double digestion identification and analysis of four kinds of combinations of EcoRV.The result as shown in Figure 8, agarose gel electrophoresis is seen the band that conforms to plasmid map.

2.3 the structure of recombinant adenoviral vector plasmid and evaluation

2.3.1 contain the preparation of the BJ5183 electroporation competence bacterium of skeleton plasmid pAd-Easy-1

Containing streak culture BJ5183 on the penbritin LB flat board (containing the pAd-Easy-1 plasmid).The single colony inoculation 3mL of picking LB liquid nutrient medium, 37 ℃, 200rpm shaking culture spend the night.Next day, by 2% volume inoculation 100mL LB liquid nutrient medium, 37 ℃, the 200rpm shaking culture is to OD600=0.4～0.6 with overnight culture.With culture ice bath 30min, the centrifugal 10min results of 4000rpm thalline.Discard all supernatants, with equal-volume, the cold resuspended bacterium of WB solution (WB=10% glycerine, 90% distilled water, autoclaving) of ice bath, 4 ℃, 4000rpm, centrifugal 30min.Repeat previous step 2 times.Discard most of WB, make residual volume be primary culture 0.5%), resuspended, namely prepare the BJ5183 Electroporation-competent cells that contains pAd-Easy-1.Every pipe packing 50 μ l ,-80 ℃ frozen for subsequent use.

2.3.2 linearizing dephosphorylation recombinant shuttle vector plasmid

With the PmeI single endonuclease digestion linearizing of recombinant shuttle vector plasmid, 50 μ l enzymes are cut system:

pAd-Track-CMV-hBcl-2-IRES-hVEGF ₁₆₅ 2μg

10 * NEB damping fluid, 45 μ l

100×BSA 0.5μl

PmeI 1μl

Sterilization distilled water to 50 μ l

37 ℃ of enzymes are cut and are spent the night, and enzyme are cut product CIAP enzyme dephosphorylation, 50 μ l reaction systems:

Enzyme is cut product 43 μ l

10×CIAP buffer 5μl

ClAP 2μl

50 ℃ of reaction 30min, phenol/chloroform/primary isoamyl alcohol (25: 24: 1) extracts twice, chloroform/primary isoamyl alcohol (24: 1) extracts once, add the NaOAC of the 3M of 5 μ l, add the cold ethanol of 125 μ l (2.5 times), at-20 ℃ of lower cold insulation 1h, precipitation is reclaimed in centrifugation, with after the cold ethanol cleaning, drying of 200 μ l 70% with the aseptic distillation water dissolution of 20 μ l.Prepare linearizing not with the shuttle vectors matter pAd-Track-CMV-GFP of therapeutic gene with same procedure.

2.3.3 homologous recombination in the bacterium of shuttling expression plasmid vector and skeleton plasmid

Taking out the electroporation competence BJ5183 that a pipe is stored in-80 ℃ melts on ice.Get the dephosphorylized shuttling expression plasmid vector of 0.4 μ g linearizing electroporation under 1700V, 5ms condition and transform, add 900 μ l and do not contain antibiotic LB substratum, 37 ℃ to shake the LB that inoculation behind the bacterium 1h contains the 50mg/L kantlex dull and stereotyped, is positioned over 37 ℃ and hatches 24h.Select ten white colonies of volume minimum, be inoculated in 5mL and contain kantlex LB substratum, 37 ℃ are shaken bacterium and spend the night.Bacterium colony PCR primary dcreening operation (method is the same).The little extraction reagent kit of plasmid extracts the plasmid of PCR positive bacteria liquid, surveys concentration.Candidate's positive plasmid is cut evaluation with the preliminary enzyme of PacI, and 20 μ l enzymes are cut system:

Plasmid 1 μ g

10 * NEB damping fluid, 42 μ l

100×BSA 0.2μl

PacI 0.5μl

Sterilization distilled water to 20 μ l

The full dose enzyme is cut the product agarose gel electrophoresis to be observed.With positive plasmid Calcium Chloride Method transformed competence colibacillus E.coliDH5 α amplification (method is the same).Spend amount plasmid extraction kit extraction plasmid in the intracellular toxin, carry out according to specification sheets:

A. extracting waste bacterium colony is inoculated in the ammonia benzyl resistance LB substratum of 5mL, 37 ℃, 300rpm shaking culture 8h;

B. get 2mL bacterium liquid is inoculated in 200mL in 1: 100 ratio ammonia benzyl resistance LB substratum, 37 ℃, 300rpm shaking culture 16h;

C. ultraviolet spectrophotometer is surveyed bacterium liquid OD value, passes through V[ml]=800/OD ₆₀₀Calculate the most fit long-pending;

D.4 ℃, 6000g * 15min is centrifugal, abandons supernatant;

E.6mL RES-EF buffer resuspension blows even with pipettor;

F. add 16mL LYS-EF, softly rock 5 times, room temperature is placed 5min;

G. take out the resin filter post, the moistening pillar of 15mL EQU-EF buffer;

H. add 16mL NEU-EF buffer, softly put upside down immediately 10 times, shake up, place 5min on ice;

I. mixed solution is poured Filter column into, and liquid flows to end with gravity, and 5mL FIL-EF buffer cleans pillar, flows to end backward Filter column and adds 35mL ENDO-EF buffer cleaning, flows to end rear interpolation 15mL WASH-EFbuffer;

J. flow to end rear interpolation 5mL ELU-EF buffer dissolving plasmid DNA, collect with the centrifuge tube of 15mL;

K. the isopropanol precipitating plasmid DNA that adds 3.5mL is placed 2min, 4 ℃ of centrifugal 6000g * 30min after fully mixing;

1. the 70% ethanol washing and precipitating that adds 2mL, centrifugal 6000g * 5min under the room temperature, pipettor carefully exhausts supernatant, drying at room temperature 15min;

M.100 μ l goes the heavy molten precipitation of intracellular toxin water, and further the PacI enzyme is cut evaluation;

Agarose gel electrophoresis after the PacI enzyme is cut, can be observed the large fragment of a treaty 30Kb and the small segment (such as Fig. 9) of a treaty 4.5Kb, prompting shuttling expression plasmid vector and skeleton plasmid pAd-Easy-1 recombinate at right arm and left arm district, the success of recombinant adenoviral vector plasmid construction.

Obtain recombinant adenoviral vector plasmid (pAd-Easy-hBcl-2-IRES-hVEGF ₁₆₅Plasmid), utilize the nucleic acid-protein quantitative instrument quantitative.Do not carry the contrast adenovirus carrier plasmid pAd-Easy-GFP of therapeutic gene with the same procedure preparation.

2.4 the packing of recombinant adenoviral vector plasmid in the HEK293 cell

2.4.1 pAd-Easy-hBcl-2-IRES-hVEGF before the transfection ₁₆₅The preparation of plasmid

The PacI digested plasmid, 50 μ l enzymes are cut system:

pAd-Easy-hBcl-2-IRES-hVEGF ₁₆₅ 3μg

10 * NEB damping fluid, 45 μ l

100×BSA 0.5μl

PacI 2μl

Sterilization distilled water to 50 μ l

37 ℃ of enzymes are cut and are spent the night, and get after 5 times of the 1 μ l dilutions agarose gel electrophoresis and determine that whether complete enzyme cut, and the linearizing plasmid of ethanol precipitation purifying (method is the same) heavily is dissolved in 20 μ l sterilization distilled water.

2.4.2 the preparation of packing cell HEK293 cell

Take out the HEK293 cell of preserving in the liquid nitrogen, put into rapidly 37 ℃ water bath with thermostatic control, and acutely rock, it is melted as early as possible, enchylema is transferred in the 15mL centrifuge tube the centrifugal 5min of 1000rpm in the Bechtop, the cell culture fluid resuspension, and be transferred in the T-25 Tissue Culture Flask, replenish nutrient solution to 5mL, put 37 ℃, 5%CO ₂Cultivate in the cell culture incubator, change nutrient solution next day, continue to cultivate, observe growing state.Treat that cell grows to abundance and approximately discards old training liquid 80% the time, tryptic digestive juice (0.25%) peptic cell that adds 37 ℃ of preheatings of 0.5mL, observation of cell form under the inverted microscope, treat that most cells becomes no longer to connect between circle, the cell and remove Digestive system when in blocks, add fresh nutrient solution, with dropper will be peptic cell blow and beat into single cell suspension, go down to posterity in ratio inoculation in 1: 3, be cultured to several bottles of cells, selected the cell that state is good, degrees of fusion is 50%-70% and prepare transfection.

Transfection was examined under a microscope cellular form after 3 days considerable change, and fluorescence microscope is expressed to the GFP that is dispersed in, and after this visible GFP has diffusion tendency; The typical CPE such as the second the 7th day visible most cells of taking turns amplification becomes and justify, hikes up, transparence increase change; Almost all cells hiked up, botryoidal CPE changes (such as Figure 11) in the 10th day.

2.4.3 liposome transfection HEK293 cell, expression and the cell situation of observing fluorescence

Carry out transfection according to Lipofectamine2000 transfection reagent specification sheets:

A. the linearizing plasmid of 3 μ g and 15 μ l liposomes are mixed in the Opti-MEMI substratum of 500 μ l, place 30min under the mixture room temperature;

Discard the nutrient solution of HEK293 cell when b. waiting in Bechtop, the serum-free DMEM nutrient solution that adds 4mL is cleaned remaining serum, sucks DMEM, adds 2.5mL Opti-MEMI nutrient solution, 37 ℃, 5%CO ₂Place 10min in the incubator;

C. mixture is added in the Tissue Culture Flask 37 ℃, 5%CO ₂Cultivate in the incubator;

D.6h add afterwards the DMEM nutrient solution of the serum-free of 8mL.

Observation of cell variation every day after the transfection, use behind the 10d-20d without the mycetocyte sleaker and scrape cell, be transferred to the 15mL centrifuge tube, 4 ℃ of centrifugal 500g * 10min stay the 2mL supernatant, pipettor piping and druming resuspension cell, place 30min for-80 ℃, 37 ℃ melt rapidly, and four cracking cells of multigelation are with releasing virus, 4 ℃ of centrifugal 500g * 10min remove cell debris, with supernatant-20 ℃ preservation.The adenovirus of getting half volume is inoculated in the HEK293 cell that grows to 90% degrees of fusion, continue to cultivate with the DMEM nutrient solution that contains 2% serum, observe GFP and cytopathic effect (cytopathic effect, CPE) every day: namely cell rounding, bright degree increase, hike up, are thyrsiform etc.As cultivate and do not occur CPE behind the 7d and then continue to be inoculated in the HEK293 cell by above-mentioned way results virus.As CPE occurring not yet, then re-start transfection.

2.4.4 obtain recombinant adenoviral vector

Continue virus inoculation stoste in the HEK293 cell until can occur obvious CPE in the 3d, harvested cell is got 10% mixed solution multigelation and is used for continuation and inoculates amplicon virus, all the other then be stored in-80 ℃ as former generation recombinant adenoviral vector for subsequent use.Preparation contrasts adenovirus Ad-GFP in the same way.

2.4.5 the PCR of recombinant adenoviral vector DNA identifies

Get respectively recombinant adenoviral vector Ad-hBcl-2-hVEGF ₁₆₅Supernatant 50 μ l add 20mg/mL Proteinase K 2 μ l in the EP pipe, place 56 ℃ of reaction 1h, boiling water bath 10min, and behind centrifugal 13000rpm * 10min, getting 2 μ l is the capable hBcl-2 of dna profiling and hVEGF ₁₆₅PCR reaction (primer, reaction system and reaction conditions are the same), with the negative contrast of Ad-GFP virus supernatant.

The DNA of recombinant adenovirus, the hBcl-2 fragment of the visible 734bp of PCR product agarose gel electrophoresis take it as template and the hVEGF of 595bp are extracted in success ₁₆₅Fragment (Figure 11) proves among the DNA of recombinant adenovirus with hBcl-2 sequence and hVEGF ₁₆₅Sequence.

2.5 the amplification of recombinant adenoviral vector and purifying

Carry out according to GENMED a small amount of adenovirus precipitator method purification kit specification sheets:

A. the Tissue Culture Flask that the HEK293 cell is inoculated in 5 T-75 is cultivated, until remove nutrient solution when reaching 90% cytogamy, and with the remaining serum of the DMEM flush away of serum-free;

B. the virus stock solution used of getting a pipe preservation divides 5 parts to add 5 bottles of HEK293 cells, cruciform slowly rocks culturing bottle is evenly distributed virus stock solution used, cultivate 2h in 37 ℃, 5%CO2 incubator, each culturing bottle adds and continues to cultivate after 15mL contains the DMEM nutrient solution of 2% serum;

C. 72h or until use the cell that scrapes all culturing bottles without the mycetocyte sleaker when the cell detachment of CPE and 50% occurring after infecting merges together with nutrient solution and is transferred to the 50mL centrifuge tube, 4 ℃ of centrifugal 500g * 10min, careful supernatant discarded;

D. add 1mL GENMED lysate, vortex vibration 30s places 5min under the room temperature;

E. add 100 μ l GENMED precipitated liquid, vortex vibration 60s pipettes 500 μ l mixed solutions to the GENMED Filter column;

F.4 ℃ centrifugal 500g * 2min discards Filter column;

G. continue to pipette remaining 500 μ l mixed solutions to new Filter column, 4 ℃ of centrifugal 500g * 2min discard Filter column;

H. add respectively 100 μ l GENMED and preserve liquid, mixing ,-80 ℃ of Refrigerator stores.

2.5 the titer determination of recombinant adenoviral vector

The HEK293 cell is inoculated in 96 well culture plates, and being cultured to the cytogamy degree with the DMEM that contains 10%FBS is 80%; Adenovirus stoste to be measured is made 1: 10 doubling dilution with maintenance medium (DMEM that contains 2%FBS); Discard the nutrient solution in 96 orifice plates, the virus liquid that the inoculation dilution is good, each 6 hole of extent of dilution inoculation, 100 μ l/ holes; Place 37 ℃, 5%CO ₂Incubator is cultivated 24h; Fluorescence number under fluorescent microscope in each hole of counting, a luminous cell is a ceneme, calculates virus titer by following formula: virus titer (pfu/mL)=GFP positive cell number * viral dilution multiple/0.1mL.

The recombinant adenoviral vector titre is 5 * 10 behind four-wheel amplification and final purifying ⁹Pfu/mL.

Sequence table

＜110〉the First Affiliated Hospital of Kunming Medical School

＜120〉people Bcl-2 and people VEGF ₁₆₅Double gene coexpression recombinant vectors and construction process thereof

<160>1

<210>1

<211>720

<212>DNA

＜213〉artificial sequence

<220>

＜223〉people Bcl-2 gene utilizes this gene and people VEGF ₁₆₅Gene co-expressing makes up recombinant adenoviral vector, is applied in gene therapy and the Transplanted cells research field of myocardial infarction.

<400>1

atggcgcacg ctgggagaac ggggtacgat aaccgggaga tagtgatgaa gtacatccat 60

tataagctgt cgcagagggg ctacgagtgg gatgcgggag atgtgggcgc cgcgcccccg 120

ggggccgccc ccgcaccggg catcttctcc tcccagcccg ggcacacgcc ccatccagcc 180

gcatcccggg acccggtcgc caggacctcg ccgctgcaga ccccggctgc ccccggcgcc 240

gccgcggggc ctgcgctcag cccggtgcca cctgtggtcc acctgaccct ccgccaggcc 300

ggcgacgact tctcccgccg ctaccgccgc gacttcgccg agatgtccag ccagctgcac 360

ctgacgccct tcaccgcgcg gggacgcttt gccacggtgg tggaggagct cttcagggac 420

ggggtgaact gggggaggat tgtggccttc tttgagttcg gtggggtcat gtgtgtggag 480

agcgtcaacc gggagatgtc gcccctggtg gacaacatcg ccctgtggat gactgagtac 540

ctgaaccggc acctgcacac ctggatccag gataacggag gctgggatgc ctttgtggaa 600

ctgtacggcc ccagcatgcg gcctctgttt gatttctcct ggctgtctct gaagactctg 660

ctcagtttgg ccctggtggg agcttgcatc accctgggtg cctatctgag ccacaagtga 720

<210>2

<211>576

<212>DNA

＜213〉artificial sequence

<220>

＜223〉people VEGF ₁₆₅Gene utilizes this gene and people Bcl-2 gene co-expressing to make up recombinant adenoviral vector, is applied in gene therapy and the Transplanted cells research field of myocardial infarction.

<400>2

atgaactttc tgctgtcttg ggtgcattgg agccttgcct tgctgctcta cctccaccat 60

gccaagtggt cccaggctgc acccatggca gaaggaggag ggcagaatca tcacgaagtg 120

gtgaagttca tggatgtcta tcagcgcagc tactgccatc caatcgagac cctggtggac 180

atcttccagg agtaccctga tgagatcgag tacatcttca agccatcctg tgtgcccctg 240

atgcgatgcg ggggctgctg caatgacgag ggcctggagt gtgtgcccac tgaggagtcc 300

aacatcacca tgcagattat gcggatcaaa cctcaccaag gccagcacat aggagagatg 360

agcttcctac agcacaacaa atgtgaatgc agaccaaaga aagatagagc aagacaagaa 420

aatccctgtg ggccttgctc agagcggaga aagcatttgt ttgtacaaga tccgcagacg 480

tgtaaatgtt cctgcaaaaa cacagactcg cgttgcaagg cgaggcagct tgagttaaac 540

gaacgtactt gcagatgtga caagccgagg cggtga 576

Claims (4)

1. people Bcl-2 and people VEGF ₁₆₅The double gene coexpression recombinant vectors is characterized in that:

1) described recombinant vectors comprises people Bcl-2 gene and people VEGF ₁₆₅Gene, wherein the Bcl-2 gene order is as described in the sequence table SEQ ID No:1; VEGF ₁₆₅Gene order is as described in the sequence table SEQ ID No:2;

2) described recombinant vectors utilizes the IRES fragment to connect people Bcl-2, people VEGF ₁₆₅Gene;

3) described people Bcl-2 gene and people VEGF ₁₆₅Gene is prepared by the A549 lung cancer cell line.

2. people Bcl-2 according to claim 1 and people VEGF165 double gene coexpression recombinant vectors, it is characterized in that: described carrier is adenovirus carrier.

3. people Bcl-2 according to claim 1 and people VEGF ₁₆₅The construction process of double gene coexpression recombinant vectors is characterized in that: comprise following step:

1) obtains people Bcl-2, people VEGF ₁₆₅Gene;

2) make up shuttle vector of adenovirus;

3) make up carrier Bcl-2 gene, IRES fragment and people VEGF ₁₆₅The recombinant adenoviral vector plasmid;

4) packing of liposome transfection method mediation recombinant adenoviral vector plasmid in the HEK293 cell.

4. people Bcl-2 according to claim 3 and people VEGF ₁₆₅The construction process of double gene coexpression recombinant vectors is characterized in that: according to gene order design synthetic amplification people Bcl-2 and people VEGF among the Genebank ₁₆₅The PCR primer;

The PCR primer sequence of people Bcl-2 of wherein increasing is:

Forward 5 ' GAAGATCTATGGCGCACGCTGGGAGAA introduces Bgl

The site, reverse 5 ' ACGCGTCGACTCACTTGTGGCTBCAGATAGGCACC introduces Sal

The site;

Amplification people VEGF ₁₆₅The PCR primer sequence be:

Forward 5 ' GCTCTAGAATGAACTTTCTGCTGTCTTGGGTGC introduces Xba

The site, reverse 5 ' CCGGATATCGCTCACCGCCTCGGCTTGTCACAT introduces the EcoRV site.

Images