CN101631796A

CN101631796A - Compound having structure derived from mononucleoside or mononucleotide, nucleic acid, labeling substance, and method and kit for detection of nucleic acid

Info

Publication number: CN101631796A
Application number: CN200880007635A
Authority: CN
Inventors: 冈本晃充; 池田修司; 久保田健
Original assignee: Independent Administrative Institution Physical Chemistry Institute
Current assignee: Dnaform KK
Priority date: 2007-03-09
Filing date: 2008-03-06
Publication date: 2010-01-20
Anticipated expiration: 2028-03-06
Also published as: CN101285094A; CN101631796B

Abstract

Disclosed is a labeling substance which enables to detect a double-stranded structure in a nucleic acid effectively. Specifically disclosed is: a compound having a structure derived from a mononucleoside or mononucleotide, wherein the structure is represented by the formula (1), (1b) or (1c); a tautomer or stereoisomer of the compound; or a salt of the compound, the tautomer or the stereoisomer. Wherein B represents an atomic group having a nucleobase skeleton; E represents an atomic group having a deoxyribose skeleton, a ribose skeleton or a structure derived from the deoxyribose skeleton or the ribose skeleton, or an atomic group having a peptide structure or a peptoid structure; and Z<11> and Z<12> independently represent a hydrogen atom, a protecting group or a fluorescent atomic group, and may be the same as or different from each other.

Description

Have compound, nucleic acid, marker and nucleic acid detection method and test kit by monokaryon glycosides or mononucleotide deutero-structure

Technical field

The present invention relates to have compound, nucleic acid, marker and nucleic acid detection method and test kit by monokaryon glycosides or mononucleotide deutero-structure.

Background technology

In the gene diagnosis of disease and expression of gene analysis etc., need detect nucleic acid with certain particular sequence.The normal for this reason method of utilizing fluorescence of using is for example used usually by a kind of fluorescence dye being covalently bound to fluorescent probe that DNA the goes up gained thing that serves as a mark.

The problem of such marker (fluorescent probe) is for example still sending fluorescence under the double-helical situation less than forming with complementary nucleic acid.Though utilize the method effective (non-patent literature 1-4 etc.) of FRET for the fluorescence of eliminating probe itself, have the problems such as cost of introducing two kinds of fluorescence dyes.

In addition, known thiazole orange (thiazole orange) is one of cyanine dye as the fluorescence dye that increases fluorescence intensity by the interaction with DNA or RNA.Though attempted by making the thiazole orange covalent bonds make the example of fluorescent probe to DNA, yet it is still by sending intensive fluorescence (non-patent literature 5) with the interaction of the single stranded DNA that contains purine bases, therefore the increase of fluorescence intensity is less when forming duplex, can not say so successfully (non-patent literature 6 and 7).

Non-patent literature 1:Tyagi, S.Kramer, F. R. (1996) Nat.Biotechnol.14,303-308.

Non-patent literature 2:Nazarenko, I.A., Bhatnagar.S.K., Hohman, R.J. (1997) Nucleic Acids Res.25,2516-2521.

Non-patent literature 3:Gelmini, S., Orlando, C., Sestini, R., Vona, G., Pinzani, P., Ruocco, L., Pazzagli, M. (1997) Clin.Chem.43,752-758.

Non-patent literature 4:Whitcombe, D., Theaker, J., Buy, S.P., Brown, T., Little, S. (1999) Nat.Biotechnol.17,804-807.

Non-patent literature 5:Biopolymers 1998,46,39-51.

Non-patent literature 6:Analytica Chimica Acta 2002,470,57-70.

Non-patent literature 7:Chemistry-A European Journal 2006,12,2270-2281.

Summary of the invention

Therefore, the purpose of this invention is to provide and to detect the double-stranded marker of nucleic acid effectively.

In order to address the above problem, compound of the present invention is compound, its tautomer or the steric isomer that has by monokaryon glycosides or mononucleotide deutero-structure, or its salt, and wherein said structure is with following formula (1), (1b) or (1c) expression.

[changing 20]

In described formula (1), (1b) with (1c),

B is the atomic group with natural acid base (VITAMIN B4, guanine, cytosine(Cyt), thymus pyrimidine or uridylic) skeleton or artificial nucleic acid base skeleton,

E is

(i) have ribodesose skeleton, ribose skeleton or by the atomic group of this arbitrary skeleton deutero-structure wherein, or

The atomic group that (ii) has peptide structure or plan peptide structure,

Z ¹¹And Z ¹²Represent hydrogen atom, protecting group respectively or show epipolic atomic group, can be identical or different,

Q exists

When E is the atomic group of aforementioned (i), be O,

When E is aforementioned (ii) atomic group, be NH,

X exists

When E is the atomic group of aforementioned (i), be hydroxyl protecting group, phosphate (phosplate base), bisphosphate base (bisphosphate ester group) or the triphosphoric acid base (triphosphoric acid ester group) of hydrogen atom, the enough sour deprotections of energy,

When E is aforementioned (ii) atomic group, be hydrogen atom or amino protecting group,

Y exists

When E is the atomic group of aforementioned (i), be hydrogen atom, hydroxyl protecting group or phosphoramidite base (phosphoramidite group),

When E is aforementioned (ii) atomic group, be hydrogen atom or protecting group,

L ¹, L ²And L ³The linker (bridge formation atom or atomic group) of respectively doing for oneself, main chain long (backbone atoms number) is any, in main chain, all can contain or not contain C, N, O, S, P and Si separately, in main chain, all can contain or not contain singly-bound, two key, triple bond, amido linkage, ester bond, disulfide linkage, imido grpup, ehter bond, thioether bond and thioester bond, L separately ¹, L ²And L ³Each other can be identical or different,

D is CR, N, P, P=O, B or SiR, and R is hydrogen atom, alkyl or any substituting group,

B is singly-bound, two key or triple bond,

Perhaps, in described formula (1), L ¹And L ²Be described linker, L ³, there is not L in D and b ¹And L ²Be directly connected in B,

In the described formula (1b), T exists

When E is the atomic group of aforementioned (i), be phosphoric acid bridging (PO ₄ ^-), wherein the Sauerstoffatom more than 1 (O) can be substituted by sulphur atom (S),

When E is aforementioned (ii) atomic group, be NH.

In addition, nucleic acid of the present invention be have at least a with following formula (16), (16b), (17), (17b), (18) or nucleic acid, its tautomer or the steric isomer of structure (18b), or its salt.In addition, in this manual, when chemical formula (for example with following formula (16), (16b), (17), (17b), (18) and the key (18b) extends outside bracket from bracket inside and in the bracket outside when described key adds asterisk, described asterisk is illustrated on this key in conjunction with certain atom or atomic group.

[changing 21]

[changing 22]

[changing 23]

[changing 24]

[changing 25]

[changing 26]

Formula (16), (16b), (17), (17b), (18) and (18b) in

B, E, Z ¹¹, Z ¹², L ¹, L ², L ³, D and b separately with above-mentioned formula (1), (1b) or (1c) structure identical,

Wherein

In formula (16), (17) and (18), E be above-mentioned formula (1), (1b) or (1c) in the atomic group of (i), at least one O atom can be substituted by the S atom in the phosphoric acid bridging,

Formula (16b), (17b) and (18b) in, E be above-mentioned formula (1), (1b) or (1c) in described atomic group (ii),

Formula (17) and (17b) in, each B can be identical or different, each E can be identical or different.

In addition, marker of the present invention is

(i) such marker: intramolecular two plane chemical structures are not in same plane, but exist at an angle, but this molecule is inserting or ditch when being attached in the nucleic acid, described two plane chemical structures alignment arrangements in same plane, thus produce fluorescence radiation;

The (ii) marker that forms by two above dye molecule groups, wherein, though because two above dye molecules are not because the exciton effect that parallel gathering produced can show fluorescence radiation, but these molecules are inserting or ditch when being bonded in the nucleic acid, and the releasing by described state of aggregation can produce fluorescence radiation; Perhaps

A (iii) species complex marker, its with the chemical structure that has two above dye molecules at same intramolecularly as the characteristic chemical structure, wherein, though because the exciton effect that the parallel gathering of plural dye molecule is produced can not show fluorescence radiation, but these molecules are inserting or ditch when being attached in the nucleic acid, and the releasing by described state of aggregation can produce fluorescence radiation.

In addition, nucleic acid detection method of the present invention is:

(I) nucleic acid detection method that may further comprise the steps:

With marker of the present invention---it is synthetic that mark mononucleotide or labeled oligonucleotide carry out nucleic acid as substrate, thus synthetic be inserted with or ditch is combined with the described double-strandednucleic acid that shows epipolic atomic group or molecular structure of dye;

Measure the fluorescence intensity of described double-strandednucleic acid synthesis step front and back respectively; And

It is synthetic to detect nucleic acid by the fluorescence intensity before and after the more described double-strandednucleic acid synthesis step;

(II) nucleic acid detection method that may further comprise the steps:

With marker of the present invention---single-chain nucleic acid is as first nucleic acid, with its with have that to carry out nucleic acid synthetic with the described first nucleic acid complementary sequence or with second nucleic acid hybridization of the similar sequence of described complementary sequence, thereby synthetic be inserted with or ditch is combined with the described double-strandednucleic acid that represents epipolic atomic group or molecular structure of dye;

Detect described by the fluorescence intensity before and after the more described double-strandednucleic acid synthesis step

The hybridisation events of first nucleic acid and described second nucleic acid;

(III) nucleic acid detection method that may further comprise the steps:

Detect the hybridisation events of described first nucleic acid and described second nucleic acid by the fluorescence intensity before and after the more described double-strandednucleic acid synthesis step;

Perhaps

(IV) nucleic acid detection method, it is characterized in that using the 3rd nucleic acid to detect the formation situation of three chain nucleic acid or nucleic acid analog, described the 3rd nucleic acid by use have described first nucleotide sequence, described second nucleotide sequence or with these sequence complementary sequences or with the sequence of described these sequence complementary sequence similarities, and by marker of the present invention or complex body marker mark or not by its mark.

In addition, test kit of the present invention contains nucleic acid synthesizer, marker and fluorescent strength determining device, and described marker is described marker of the present invention.

Compound of the present invention and nucleic acid can detect the double-stranded marker of nucleic acid owing to have described structure effectively thereby can be used as.More specifically, in described formula (1) for example, (1b), (1c), (16), (16b), (17), (17b), (18) or (18b), Z ¹¹And Z ¹²For compound or the nucleic acid that represents epipolic atomic group is suitable as described marker of the present invention.In addition, Z ¹¹And Z ¹²The synthesis material or the synthetic intermediate that can be used as described marker for the compound or the nucleic acid of hydrogen atom or protecting group.Yet the purposes of compound of the present invention and nucleic acid is not limited thereto, and can be used for any purposes.

Description of drawings

Fig. 1: Fig. 1 is the figure that modeling ground shows the principle of the invention.

Fig. 2: Fig. 2 has shown the embodiment compound ¹H and ¹³C NMR spectrogram.

Fig. 3: Fig. 3 has shown other compounds of embodiment ¹H and ¹³C NMR spectrogram.

Fig. 4: Fig. 4 has shown the MALDI TOF mass spectrum of purified DNA oligomer 5 '-d (CGCAATXTAACGC)-3 '.Arrow is the mass peak (4101.9) of purified resultant.By molecular weight calculated value 4102.8 (C ₁₃₄H ₁₇₆N ₅₂O ₇₆P ₁₂) [M-H] that obtain ^-Calculated value is 4101.8, and it is consistent.

Fig. 5: Fig. 5 has shown the MALDI TOF mass spectrum of DNA oligomer 5 '-d (CGCAATXTAACGC)-3 ' with the reaction product of biotin derivative.Arrow is the mass peak (4554.3) of purified resultant.By molecular weight calculated value 4555.4 (C ₁₃₄H ₁₇₆N ₅₂O ₇₆P ₁₂) [M-H] that obtain ^-Calculated value is 4554.4, and it is consistent.

Fig. 6: Fig. 6 has shown embodiment compound (with the DNA of dye marker) ¹H NMR spectrogram (DMSO-d6).

Fig. 7: Fig. 7 has shown the reversed-phase HPLC figure of Fig. 6 compound (with the DNA of dye marker).

Fig. 8: Fig. 8 has shown the MALDI TOF mass spectrum of Fig. 6 compound (with the DNA of dye marker).

Fig. 9: Fig. 9 has shown when the fluorescent probe of embodiment is the strand state, during the DNA-DNA duplex and the UV spectrum of three samples during the DNA-RNA duplex.

Figure 10: Figure 10 shown when using the exciting light of 488nm, when the fluorescent probe of Fig. 9 is the strand state, during the DNA-DNA duplex and the fluorescence Spectra of three samples during the DNA-RNA duplex.

Figure 11: Figure 11 shown when using the exciting light of 510nm, when the fluorescent probe of Fig. 9 is the strand state, during the DNA-DNA duplex and the fluorescence Spectra of three samples during the DNA-RNA duplex.

Figure 12: Figure 12 has shown when the fluorescent probe of another embodiment is the strand state, during the DNA-DNA duplex and the UV spectrum of three samples during the DNA-RNA duplex.

Figure 13: Figure 13 has shown when the fluorescent probe of Figure 12 is the strand state, during the DNA-DNA duplex and the fluorescence Spectra of three samples during the DNA-RNA duplex.

Figure 14: Figure 14 has shown when the fluorescent probe of an embodiment is the strand state again, during the DNA-DNA duplex and the UV spectrum of three samples during the DNA-RNA duplex.

Figure 15: Figure 15 has shown when the fluorescent probe of Figure 14 is the strand state, during the DNA-DNA duplex and the fluorescence Spectra of three samples during the DNA-RNA duplex.

Figure 16: Figure 16 has shown when the fluorescent probe of another embodiment is the strand state, during the DNA-DNA duplex and the UV spectrum of three samples during the DNA-RNA duplex.

Figure 17: Figure 17 has shown when the fluorescent probe of Figure 16 is the strand state, during the DNA-DNA duplex and the UV spectrum of three samples during the DNA-RNA duplex.

Figure 18: Figure 18 is the figure of absorption spectrum, excitation spectrum and the emission spectrum of several fluorescent probes among the demonstration embodiment.

Figure 19: Figure 19 is the figure of absorption spectrum, excitation spectrum and the emission spectrum of other fluorescent probes among the demonstration embodiment.

Figure 20: Figure 20 is the absorption spectrogram of the absorption spectrum gained of the fluorescent probe of mensuration embodiment under all temps and concentration.

Figure 21: Figure 21 is for hybridizing the fluorescent probe of embodiment the CD spectrogram of the two strands of gained.

Figure 22: Figure 22 is for showing the figure of absorption spectrum, excitation spectrum and the emission spectrum of other fluorescent probes among the embodiment.

Figure 23: Figure 23 is for showing the figure of other fluorescent probes of embodiment being hybridized the fluorescence radiation when obtaining two strands.

Figure 24: Figure 24 is the absorption spectrum of some fluorescent probes again of demonstration embodiment and the figure of emission spectrum.

The figure of the change in fluorescence when Figure 25: Figure 25 is digested by RNase H for showing RNA chain that fluorescent probe with embodiment has carried out hybridization.

The variation of Figure 26: Figure 26 fluorescence radiation intensity during for the concentration ratio of the change complementary dna chain of observation and the fluorescent probe of embodiment.

Figure 27: Figure 27 is the figure of the fluorescence radiation state during the trace of demonstration embodiment detects.

Figure 28: Figure 28 is that the differential interference during with the fluorescent probe transfered cell of embodiment is measured photo.

Figure 29: Figure 29 observes the captured photo of fluorescence during with the fluorescent probe transfered cell of embodiment.

Figure 30: Figure 30 is for showing Figure 28 and Figure 29 eclipsed photo.

Figure 31 A: Figure 31 A observes the captured photo of fluorescence during with other fluorescent probe transfered cells of embodiment.

Figure 31 B: Figure 31 B observes the captured photo of fluorescence during with some fluorescent probe transfered cells again of embodiment.

Figure 32: Figure 32 is fluorescence figure over time behind the probe injection nucleus that demonstration will be identical with Figure 28-30.

Figure 33: Figure 33 observes the captured photo of fluorescence during with the other fluorescent probe transfered cell of embodiment.

Embodiment

Below, be described more specifically embodiment of the present invention.

Compound of the present invention, nucleic acid and marker

Compound of the present invention and nucleic acid have no particular limits except with the described chemical formulation.As previously mentioned, its purposes is also had no particular limits, for example, can be used as described marker of the present invention or its synthesis material or synthetic intermediate.About compound of the present invention, nucleic acid and marker, more detailed description for example hereinafter.

In the compound of the present invention, in described formula (1), (1b) with (1c),

E be preferably for example have DNA, the atomic group of the backbone structure of modifying DNA, RNA, modification RNA, LNA or PNA (peptide nucleic acid(PNA)).

In addition, in described formula (1) with (1c),

[changing 27]

Shown atomic group is preferably any represented atomic group in following formula (2)-(4),

[changing 28]

In the described formula (1b),

[changing 29]

Shown atomic group is preferably any represented atomic group in the following formula (2b)-(4b).

[changing 30]

Described formula (2)-(4) and (2b)-(4b) in,

A is hydrogen atom, hydroxyl, alkyl or electron withdrawing group,

M and the J CH that respectively does for oneself ₂, NH, O or S, can be identical or different,

B, X and Y be separately with described formula (1), (1b) or identical (1c),

Described formula (2), (3), (2b) and (3b) in, more than one O atom can be substituted by the S atom in the phosphoric acid bridging.

Consider aspects such as easily synthetic, E be preferably for example have DNA, modifying DNA, RNA or modify the atomic group of the backbone structure of RNA, but also can be the atomic group of backbone structure with LNA or PNA (peptide nucleic acid(PNA)).

Described formula (2) and (2b) in,

Among the A, preference alkyl as described is a methoxyl group, and described electron withdrawing group is a halogen.

Described formula (1), (1b) or (1c) in,

L ¹, L ²And L ³Main chain long (backbone atoms number) be preferably the integer more than 2 separately.L ¹, L ²And L ³The upper limit of main chain long (backbone atoms number) be not particularly limited, for example be below 100, more preferably below 30, be preferably below 10 especially.

Compound of the present invention for example be preferably following formula (5), (6), (6b) or (6c) shown in compound, its tautomer or steric isomer, or its salt.

[changing 31]

Described formula (5), (6), (6b) and (6c) in,

L, m and n are arbitrary value, can be identical or different,

B, E, Z ¹¹, Z ¹², X, Y and T be with described formula (1) with identical (1b).

Described formula (5), (6), (6b) and (6c) in,

L, m and n are preferably the integer more than 2 separately.The upper limit of l, m and n is not particularly limited, and for example is below 100, more preferably below 30, is preferably below 10 especially.

In the compound of the present invention, preferred Z ¹¹And Z ¹²It is the atomic group that shows exciton effect.Thus, for example the increase of fluorescence becomes big when forming double-spiral structure, can detect double-spiral structure more effectively.Yet, in compound of the present invention, even Z ¹¹And Z ¹²Not the atomic group that shows exciton effect, perhaps only import 1 in 1 molecule and show epipolic atomic group (dyestuff), still can detect double-spiral structure effectively.

Z ¹¹And Z ¹²For example be preferably as previously mentioned and have epipolic atomic group.Have epipolic atomic group and be not particularly limited described.Z ¹¹And Z ¹²For example independently of one another more preferably by thiazole orange, oxazole Huang, Hua Jing, half group of spending cyanines (hemicyanine), other cyanine dyes, methyl red, azoic dyestuff or derivatives thereof to derive and form.In addition, also be fit to use by other known dyestuff deutero-groups.Thereby reported multiple fluorescence dye by fluorescence intensity being changed with nucleic acid bonding such as DNA.Typical example is that known ethidium bromide shows intense fluorescence by inserting the dna double spirane structure, is used for DNA detection more.In addition, also known pyrene methane amide (ピレ Application カ Le ボキシアミ De) and prodan are can be according to the fluorescence dye of very little Polarity Control fluorescence intensity.In addition, described thiazole orange is the fluorescence dye that benzothiazole ring and quinoline are connected by methyne, shows faint fluorescence usually, produces the intensive fluorescence radiation but have double-stranded DNA by insertion.In addition, can enumerate for example other dyestuffs such as fluorescent yellow and Cy3.

In addition, more preferably Z ¹¹And Z ¹²For example be any represented atomic group in the following formula (7) to (9) independently of one another.

[changing 32]

[changing 33]

[changing 34]

In formula (7)-(9),

X ¹And X ²Respectively do for oneself S or O can be identical or different,

N is 0 or positive integer,

R ¹-R ¹⁰, R ¹³-R ²¹Be hydrogen atom, halogen atom, low alkyl group, lower alkoxy, nitro or amino independently of one another,

R ¹¹And R ¹²In, one be described formula (1), (1b) or (1c) in L ¹Or L ², described formula (5), (6), (6b) and (6c) in the linking group of NH bonding, another person is hydrogen atom or low alkyl group,

A plurality of R ¹⁵Be present under the situation in formula (7), (8) or (9), they can be identical or different,

A plurality of R ¹⁶Be present under the situation in formula (7), (8) or (9), they can be identical or different,

Z ¹¹In X ¹, X ²And R ¹-R ²¹With Z ¹²In X ¹, X ²And R ¹-R ²¹Each other can be identical or different.

In formula (7)-(9),

R ¹-R ²¹In, more preferably described low alkyl group is that carbonatoms is the straight or branched alkyl of 1-6, described lower alkoxy is that carbonatoms is the straight or branched alkoxyl group of 1-6.

In formula (7)-(9),

R ¹¹And R ¹²In, more preferably described linking group is that carbonatoms is the polymethylene carbonyl more than 2, by carbonyl moiety and described formula (1), (1b) or the L (1c) ¹Or L ², described formula (5), (6), (6b) and (6c) in the NH bonding.The upper limit of the carbonatoms of described polymethylene carbonyl is not particularly limited, and for example is below 100, is preferably below 50, more preferably below 30, is preferably below 10 especially.

Z ¹¹And Z ¹²When representing, more preferably be the group shown in formula (19) or (20) for example independently of one another by described formula (7)-(9).

[changing 35]

[changing 36]

In formula (19) and (20), X ¹Expression-S-or-O-.R ¹-R ¹⁰, R ¹³And R ¹⁴Represent hydrogen atom, halogen atom, low alkyl group, lower alkoxy, nitro or amino independently of one another.R ¹¹And R ¹²In an expression be bonded to described formula (1), (1b) or (1c) in L ¹Or L ², described formula (5), (6), (6b) and (6c) in NH on linking group, R ¹¹And R ¹²In another expression hydrogen atom or low alkyl group.

Compound of the present invention can be compound, its tautomer or the steric isomer that for example has the structure shown in the following formula (10), or its salt.

[changing 37]

In the formula (10),

E, Z ¹¹, Z ¹², identical in Q, X and Y and the described formula (1).

Described formula (1), (1b) and (1c) in, B can have natural acid base skeleton, but as previously mentioned, also can have artificial nucleic acid base skeleton.

For example, B is preferably the structure shown in Py, Py der., Pu or the Pu der.,

Wherein,

Described Py has the atomic group that the covalent linkage of bonding partly takes place with linker for having with the covalent linkage of E bonding and at 5 at 1 in the six-ring of following formula (11) expression,

Described Py der. is for having at least one to substitute the atomic group of gained by N, C, S or O atom in the whole atoms by the six-ring of described Py, described N, C, S or O atom can suitably have electric charge, hydrogen atom or substituting group,

Described Pu has the atomic group that the covalent linkage of bonding partly takes place with linker for having with the covalent linkage of E bonding and at 8 at 9 in the condensed ring shown in the following formula (12),

Described Pu der. has at least one to substitute the atomic group of gained by N, C, S or O atom in pentacyclic whole atoms of described Pu, described N, C, S or O atom can suitably have electric charge, hydrogen atom or substituting group,

[changing 38]

Compound of the present invention for example can be the compound shown in following formula (13) or (14), its tautomer or steric isomer, or its salt.

[changing 39]

[changing 40]

In described formula (13) and (14), E, Z ¹¹, Z ¹², identical in Q, X and Y and the described formula (1).Py, Py der., Pu and Pu der. define as mentioned.

When compound of the present invention had the phosphoramidite base, described phosphoramidite base was for example preferably represented with following formula (15).

-P(OR ²²)N(R ²³)(R ²⁴)(15)

In the formula (15), R ²²Be the protecting group of phosphate group, R ²³And R ²⁴Be alkyl or aryl.

More preferably, in the described formula (15), R ¹⁵Be cyanoethyl, R ¹⁶And R ¹⁷In, described alkyl is a sec.-propyl, described aryl is a phenyl.

In the The compounds of this invention, compound shown in for example described formula (1) can be compound shown in the following formula (21).

[changing 41]

In the formula (21), A represents hydrogen atom or hydroxyl.Preferred A is a hydrogen atom.B represents the residue of VITAMIN B4, guanine, cytosine(Cyt), thymus pyrimidine or uridylic.For example, VITAMIN B4 and guanine on 8 with two key bondings, cytosine(Cyt), thymus pyrimidine or uridylic on 5 with two key bondings.Z ¹¹And Z ¹²Expression independently of one another shows epipolic atomic group, hydrogen atom or amino protecting group, the residue of the yellow derivative of preferred especially thiazole orange derivative Huo oxazole.X represents hydrogen atom, the de-protected hydroxyl protecting group of usable acid, perhaps phosplate base, bisphosphate ester group or triphosphoric acid ester group.Y is hydrogen atom, hydroxyl protecting group or phosphoramidite base.

Compound shown in the described formula (21) is compound shown in the following formula (22) for example more preferably.

[changing 42]

In the formula (22), A represents hydrogen atom or hydroxyl.Z ¹¹And Z ¹²Expression independently of one another shows epipolic atomic group, hydrogen atom or amino protecting group, the residue of the yellow derivative of preferred especially thiazole orange derivative Huo oxazole.X represents hydrogen atom, the de-protected hydroxyl protecting group of usable acid, perhaps phosplate base, bisphosphate ester group or triphosphoric acid ester group.Y is hydrogen atom, hydroxyl protecting group or phosphoramidite base.

In the compound of described formula (21) or (22), Z ¹¹And Z ¹²During for hydrogen atom or amino protecting group,, therefore can utilize described amino in a molecule, to import the tagged molecule of 2 molecules owing to have two amino (perhaps protected amino) in a molecule.For example, make labeling nucleic acid by combined with fluorescent material, chemiluminescent substance etc., thereby can improve the sensitivity that nucleic acid detects.And at Z ¹¹And Z ¹²When showing epipolic atomic group,, can carry out the detection of nucleic acid simply by with specific fluorescent substance mark.

In addition, in the compound of described formula (21) or (22), Z ¹¹And Z ¹²For the compound that shows epipolic atomic group for the 2 molecular fluorescence molecules Nucleotide of the yellow derivative modification of thiazole orange derivative Huo oxazole for example.The probe that is formed by the single-chain nucleic acid that contains such compound is by causing cancellation by exciton coupling (exciton coupling), having only under the state of probe fluorescence very faint, but by showing the intensive fluorescence radiation with DNA or RNA hybridization.Promptly, for example the fluorescence of the yellow derivative of thiazole orange derivative Huo oxazole is suppressed consumingly by the structure of reversing like this, but the yellow derivative of thiazole orange derivative Huo oxazole is by being bonded on the DNA, and reversing of structure is eliminated and immobilization, thereby demonstrates intensive fluorescence.Fluorescence can detect by exciting with for example Ar laser of 488nm, 514nm, but is not limited thereto.

Described formula (1), (1b) or (1c) shown in The compounds of this invention for example can be used in nucleic acid (polynucleotide) synthetic.That is, compound of the present invention can be used as the marker (nucleic acid marking reagent) of nucleic acid.For example, by with described formula (1), (1b) or the The compounds of this invention (1c) as the Nucleotide substrate, use single-chain nucleic acid to carry out the nucleic acid building-up reactions as template, perhaps by use described formula (1), (1b) or (1c) shown in The compounds of this invention chemosynthesis single-chain nucleic acid (for example using the chemical synthesiss such as phosphoramidite method of nucleic acid automatic DNA synthesizer DNA), can be manufactured on the nucleic acid that contains the above The compounds of this invention of at least one molecule in the molecule.At this moment, described atomic group Z ¹¹And Z ¹²Can be separately and show epipolic atomic group, also can be hydrogen atom or protecting group.

The structure of nucleic acid of the present invention as previously mentioned, for contain at least a following formula (16), (16b), (17), (17b), (18) or (18b) shown in the structure of structure.In addition, nucleic acid of the present invention can contain the tautomer or the steric isomer of these structures, or its salt.

[changing 43]

[changing 44]

[changing 45]

[changing 46]

[changing 47]

[changing 48]

Formula (16), (16b), (17), (17b), (18) and (18b) in,

B, E, Z ¹¹, Z ¹², L ¹, L ², L ³, D and b respectively do for oneself described formula (1), (1b) or (1c) shown in structure,

In formula (16), (17) and (18), E be described formula (1), (1b) or (1c) described in the atomic group of (i), more than one O atom can be substituted by the S atom in the phosphoric acid bridging,

Formula (16b), (17b) and (18b) in, E be described formula (1), (1b) or (1c) described in (ii) atomic group.

Described formula (16), (17), (16b), (17b), (18) and (18b) in,

Z ¹¹And Z ¹²Respectively doing for oneself shows epipolic atomic group, can be identical or different.

The basic framework of nucleic acid of the present invention is not particularly limited, and for example can be among DNA, modifying DNA, RNA, modification RNA, LNA or the PNA (peptide nucleic acid(PNA)) any, also can be other structures.In addition, the base number of nucleic acid of the present invention is not particularly limited, and for example is about 10bp to 10kb, is preferably about 10bp to 1kb.In addition, nucleic acid of the present invention is under the situation of oligonucleotide, and its length is not particularly limited, and for example is about 10-100bp, more preferably about 10-50bp, more preferably about 10-30bp.

The quantity that is included in described formula (1), (1b) or compound (1c) in the nucleic acid of the present invention is not particularly limited, and can be about 1-100, is preferably about 1 to 20.

Compound of the present invention or nucleic acid for example can have the structure shown in any in following formula (23)-(25).Thus, it can be advantageously used for and import the fluorescent probe that dyestuff is arranged.But the The compounds of this invention that is suitable as fluorescent probe is not limited thereto.

[changing 49]

In the formula (23), be connected with 2 dyestuffs (Fluo) on the base B.The position of base B and linker bonding is not particularly limited, and for example a position in 4,5 of pyrimidine or 6, purine 2,3,6,7 or 8 is connected with linker.Linker has a base connecting portion, and it is divided into 2 on the way with top set, and end is connected with dyestuff.The method that is connected with base or dyestuff be except using by the key that forms at two keys or triple-linked metal catalysed reaction, cyclic condensation reaction or Michael addition reaction etc., also can use amido linkage, ester bond, disulfide linkage, form the key that reaction etc. generates by imines.For linker, its length (l, m, n) is freely chosen, and can contain singly-bound, two key, triple bond, amido linkage, ester bond, disulfide linkage, amine, imines, ehter bond, thioether bond, thioester bond etc.In addition, preferably do not influence the exciton effect that causes by dimerization.Component (X) is carbon, silicon, nitrogen, phosphorus, each atom of boron, and protonated (NH for example also can take place ⁺) or oxidation (for example P=O).Preferred coloring agent is for utilizing the material that shows exciton effect by dimerization, and the position that is connected with linker can be any part of dyestuff.In the formula (23), though shown thymus nucleic acid as the DNA part-structure, but as an alternative, nucleic acid backbone also can be nucleic acid, PNA or the LNA functional nucleic acids such as (BNA) that phosphoric acid such as sugar-modified nucleic acid such as 2 '-O-methyl RNA or 2 '-fluorine DNA, thiophosphatephosphorothioate (phosphorothioate) nucleic acid are modified except being the Yeast Nucleic Acid (RNA).

[changing 50]

In the formula (24), be connected with 2 dyestuffs (Fluo) on the base B.The position of base B and linker bonding is not particularly limited, and for example two positions in 4,5 of pyrimidine or 6, purine 2,3,6,7 or 8 are connected with linker.Two linkers have a base connecting portion separately, and are connected with dyestuff at another end.The method that is connected with base or dyestuff be except using by the key that forms at two keys or triple-linked metal catalysed reaction, cyclic condensation reaction or Michael addition reaction etc., also can use amido linkage, ester bond, disulfide linkage, form the key that reaction etc. generates by imines.For linker, its length (l, m) is freely chosen, and can contain singly-bound, two key, triple bond, amido linkage, ester bond, disulfide linkage, amine, imines, ehter bond, thioether bond, thioester bond etc.In addition, preferably do not influence the exciton effect that causes by dimerization.Preferred coloring agent is for utilizing the material that shows exciton effect by dimerization, and the position that is connected with linker can be any part of dyestuff.In the formula (24), though shown thymus nucleic acid as the DNA part-structure, but as an alternative, nucleic acid backbone also can be nucleic acid, PNA or the LNA functional nucleic acids such as (BNA) that phosphoric acid such as sugar-modified nucleic acid such as 2 '-O-methyl RNA or 2 '-fluorine DNA, thiophosphatephosphorothioate (phosphorothioate) nucleic acid are modified except being the Yeast Nucleic Acid (RNA).

[changing 51]

In the formula (25), each base (B of successive Nucleotide ¹, B ²) on be connected with a dyestuff (Fluo) separately.Position to each base and linker bonding is not particularly limited, and for example a position in 4,5 of pyrimidine or 6, purine 2,3,6,7 or 8 is connected with linker.Two linkers have a base connecting portion separately, and are connected with dyestuff at another end.The method that is connected with base or dyestuff be except using by the key that forms at two keys or triple-linked metal catalysed reaction, cyclic condensation reaction or Michael addition reaction etc., also can use amido linkage, ester bond, disulfide linkage, form the key that reaction etc. generates by imines.For linker, its length (l, m) is freely chosen, and can contain singly-bound, two key, triple bond, amido linkage, ester bond, disulfide linkage, amine, imines, ehter bond, thioether bond, thioester bond etc.In addition, preferably do not influence the exciton effect that causes by dimerization.Preferred coloring agent is for using the material that shows exciton effect by dimerization, and the position that is connected with linker can be any part of dyestuff.In the formula (25), though shown thymus nucleic acid as the DNA part-structure, but as an alternative, nucleic acid backbone also can be nucleic acid, PNA or the LNA functional nucleic acids such as (BNA) that phosphoric acid such as sugar-modified nucleic acid such as 2 '-O-methyl RNA or 2 '-fluorine DNA, thiophosphatephosphorothioate (phosphorothioate) nucleic acid are modified except being the Yeast Nucleic Acid (RNA).

In addition, The compounds of this invention or nucleic acid exist under the situation of tautomer or steric isomer isomer such as (for example: geometrical isomer, conformer and optical isomer), and any isomer all can be used for the present invention.In addition, the salt of The compounds of this invention or nucleic acid can be acid salt and also can be base addition salt.And the acid that forms described acid salt can be mineral acid and also can be organic acid, and the alkali that forms described base addition salt can be mineral alkali and also can be organic bases.Described mineral acid is not particularly limited, can enumerates for example sulfuric acid, phosphoric acid, hydrofluoric acid, hydrochloric acid, Hydrogen bromide, hydroiodic acid HI, Hydroxyl fluoride, hypochlorous acid, hypobromous acid, hypoiodous acid, inferior fluoric acid, chlorous acid, bromous acid, iodous acid, fluoric acid, chloric acid, bromic acid, acid iodide, high fluoric acid, perchloric acid, hyperbromic acid and Periodic acid etc.Described organic acid also is not particularly limited, for example can enumerates tosic acid, methylsulfonic acid, oxalic acid, bromo-benzene sulfonic acid, carbonic acid, succsinic acid, citric acid, phenylformic acid and acetate etc.Described mineral alkali is not particularly limited, can enumerate for example ammonium hydroxide, alkali metal hydroxide, alkaline earth metal hydroxides, carbonate and supercarbonate etc., more specifically, can enumerate for example sodium hydroxide, potassium hydroxide, salt of wormwood, yellow soda ash, sodium bicarbonate, saleratus, calcium hydroxide and lime carbonate etc.Described organic bases also is not particularly limited, can enumerates for example thanomin, triethylamine and three (methylol) aminomethane etc.Manufacture method to described salt also is not particularly limited, and for example, by known method described acid or alkali is added on described electron donor/acceptor link molecule aptly and to make.In addition, exist under the situation of isomer, can use any isomer, for example, under the situation of " naphthyl ", can be 1-naphthyl or 2-naphthyl at substituting group etc.

In addition, in the present invention, alkyl is not particularly limited, can enumerates for example methyl, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-, sec-butyl and the tertiary butyl etc., also can be the group (alkylamino, alkoxyl group etc.) that contains alkyl in the structure.In addition; perfluoroalkyl is not particularly limited; for example can enumerate by deutero-perfluoroalkyls such as methyl, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-, sec-butyl and the tertiary butyls, also can be the group (perfluoroalkyl group sulfonyl, perfluoro acidyl etc.) that contains perfluoroalkyl in the structure.Among the present invention; acyl group is not particularly limited; can enumerate for example formyl radical, ethanoyl, propionyl, isobutyryl, pentanoyl, isovaleryl, valeryl, caproyl, hexamethylene acyl group, benzoyl, ethoxy carbonyl etc., also can be the group (acyloxy, alkanoyloxy etc.) that contains acyl group in the structure.In addition, in the present invention, the carbonatoms of carbonyl is included in the carbonatoms of acyl group, and for example, carbonatoms is that 1 alkanoyloxy (acyl group) refers to formyl radical.And in the present invention, " halogen " refers to any haloid element, for example can enumerate fluorine, chlorine, bromine and iodine.In addition; in the present invention; amino protecting group is not particularly limited, for example can uses trifluoroacetyl group; formyl radical; C1-6 alkyl-carbonyl (ethanoyl for example; ethyl carbonyl etc.); C1-6 alkyl-alkylsulfonyl; tert-butoxycarbonyl (hereinafter referred to as Boc); benzyloxycarbonyl; allyloxy carbonyl; the fluorenyl methoxy carbonyl; aryl carbonyl (phenylcarbonyl group for example; naphthyl carbonyl etc.); aryl sulfonyl (phenyl sulfonyl for example; naphthyl alkylsulfonyl etc.); C1-6 alkoxy carbonyl (methoxycarbonyl for example; ethoxy carbonyl etc.); C7-10 aromatic alkyl carbonyl (for example benzyloxycarbonyl group etc.); methyl; aralkyl (benzyl for example; diphenyl methyl; trityl etc.) etc.Described group can be by replacements such as 1 to 3 halogen atom (for example fluorine, chlorine, bromine etc.), nitros, and its specific examples can be enumerated to the nitro benzyloxycarbonyl, to chlorine benzyloxycarbonyl, m-chloro benzyloxycarbonyl, to methoxyl group benzyloxy base carbonyl etc.In addition, in the present invention, hydroxyl protecting group (comprise can enough acid carry out de-protected material) is had no particular limits, can enumerate for example dimethoxytrityl, mono methoxy trityl, 9-(9-phenyl) xanthenyl (pixyl) etc.

As compound of the present invention or nucleic acid, particularly preferred geometrical isomer, steric isomer and salt for compound or nucleic acid, particularly compound (nucleic acid) 102-106,110,113,114,116-118,120,121,122,123,124, ODN1, ODN2, ODN3, ODN4, ODN5, ODN6, ODN7, ODN8, ODN9, ODN10, ODN (anti4.5S) and ODN (antiB1) and these materials put down in writing among hereinafter the embodiment for example.Especially, compound 110,113,114,116-118,120,121,122,123,124, ODN1, ODN2, ODN3, ODN4, ODN5, ODN6, ODN7, ODN8, ODN9, ODN10, ODN (anti4.5S) and ODN (antiB1) since thiazole orange and DNA by particular structure and covalent bonding, so nucleic acid to detect sensitivity good especially.And, the compound 110,113,117,118,120,121,122,123,124, ODN1, ODN2, ODN3, ODN4, ODN5, ODN9, ODN (anti4.5S) and the ODN (antiB1) that contain 2 thiazole orange structures in 1 molecule are as the fluorescence that can suppress the strand state, and, can more effectively use by forming the fluorescent probe that duplex increases the single stranded DNA of fluorescence intensity with complementary DNA or RNA.

Next, marker of the present invention is as indicated above to be,

A (iii) species complex marker, it is the characteristic chemical structure with the chemical structure that has two above dye molecules at same intramolecularly, wherein, though because the exciton effect that the parallel gathering of plural dye molecule is produced can not show fluorescence radiation, but these molecules are inserting or ditch when being attached in the nucleic acid, and the releasing by described state of aggregation can produce fluorescence radiation.

Under (ii) described or (iii) situation, described dye molecule is preferably the molecule of described (i) record.In addition, under described situation (iii), preferably has the structure that two above dye molecules are bonded to and should be labeled the linker molecule of nucleic acid bonding, the bonding of described dye molecule and described linker molecule by means of extra linker molecule to form apparatus derivatorius, perhaps Direct Bonding not by means of extra linker molecule.

Marker of the present invention is preferably wherein said atomic group Z ¹¹And Z ¹²Be described The compounds of this invention, its tautomer or the stereoisomerism individuality that shows epipolic atomic group, or its salt, perhaps Z wherein ¹¹And Z ¹²Be nucleic acid described of the present invention, its tautomer or the steric isomer that represents epipolic atomic group, or its salt.For example, in compound of the present invention or nucleic acid, because Z ¹¹And Z ¹²For showing the atomic group of exciton effect, therefore the increase of fluorescence becomes big when forming double-spiral structure, can more effectively detect double-spiral structure.Yet, in The compounds of this invention or nucleic acid, even Z ¹¹And Z ¹²Not the atomic group that shows exciton effect, perhaps only import 1 in 1 molecule and show epipolic atomic group (dyestuff), still can detect double-spiral structure effectively as the marker of nucleic acid etc.The form of marker of the present invention for example is the form as the fluorescent probe of single-chain nucleic acid, but is not limited thereto, and any forms such as mark mononucleotide, labeled oligonucleotide, double-strandednucleic acid all can.

In addition, marker of the present invention for example,

Be mark mononucleotide, labeled oligonucleotide, labeling nucleic acid or labeling nucleic acid analogue,

Wherein said marker is by each marker of putting down in writing or Z in described (i)-(iii) ¹¹And Z ¹²Be the described The compounds of this invention, its tautomer or the steric isomer that represent epipolic atomic group or its salt or Z wherein ¹¹And Z ¹²Be nucleic acid described of the present invention, its tautomer or steric isomer or its salt mark that represents epipolic atomic group.

Perhaps, marker of the present invention for example,

Wherein said marker by means of with mononucleotide, oligonucleotide, nucleic acid or nucleic acid analog in one or more base molecule or the main chain linker molecule that constitutes molecular linkage, by each marker of putting down in writing or Z in described (i)-(iii) ¹¹And Z ¹²Be described The compounds of this invention, its tautomer or steric isomer or its salt or the Z that shows epipolic atomic group ¹¹And Z ¹²Be nucleic acid described of the present invention, its tautomer or steric isomer or its salt mark that shows epipolic atomic group.

Perhaps, marker of the present invention for example

Wherein said marker by means of with mononucleotide, oligonucleotide, nucleic acid or nucleic acid analog in 5 carbon atoms of pyrimidine nuclear of one or more base molecule or the linker molecule of 8 carbon atom bondings of purine nuclear, by each marker of putting down in writing or Z in described (i)-(iii) ¹¹And Z ¹²Be described The compounds of this invention, its tautomer or steric isomer or its salt or the Z that shows epipolic atomic group ¹¹And Z ¹²Be nucleic acid described of the present invention, its tautomer or steric isomer or its salt mark that shows epipolic atomic group.

The manufacture method of compound of the present invention and nucleic acid

The manufacture method of compound of the present invention and nucleic acid has no particular limits, and can use known synthetic method (manufacture method) aptly.For example, under the situation of compound shown in the described formula (21), can make: behind the activated carboxylic with compound shown in the following formula (26), itself and three (2-amino-ethyl) amine are reacted by the manufacture method that may further comprise the steps; Protection is amino; And the hydroxyl that exists in the compound with above-mentioned gained is with the reaction of protecting group protection, and the reaction of addition phosphoric acid or phosphoramidite group on the hydroxyl that exists in the compound of gained.

[changing 52]

In the formula (26), A represents hydrogen atom or hydroxyl.B represents the residue of VITAMIN B4, guanine, cytosine(Cyt), thymus pyrimidine or uridylic.

The for example following method of spendable manufacture method (synthetic method) in the manufacturing of compound of the present invention or nucleic acid.That is, at first, as the method for marker DNA simply, the method that the carboxyl that is activated in active amino among the DNA and the marking agent is reacted in buffered soln.This method also can be used in The compounds of this invention or the nucleic acid being particularly useful for the importing of linker or dyestuff in the manufacturing of any.Amino introductory technique can be the method for the Amino modifier phosphoramidite that uses the sale of GLEN RESEARCH company.

Described atomic group Z ¹¹And Z ¹²Can for example become hydrogen atom (removal protecting group) by protecting group, and then, the fluorescent atomic group of hydrogen atom apparatus (dyestuff) is replaced.The method of removing protecting group is not particularly limited, can uses known method aptly.The method that the fluorescent atomic group of apparatus (dyestuff) is replaced is not particularly limited, and for example makes Z ¹¹And Z ¹²For reacting aptly, the The compounds of this invention of hydrogen atom or nucleic acid and fluorescence molecule (dyestuff) get final product.For example, Z ¹¹And Z ¹²In at least one when being active amino, easily with fluorescence molecule (dyestuff) reaction, therefore be preferably, more preferably Z ¹¹And Z ¹²The two is active amino.Fluorescence molecule (dyestuff) is also had no particular limits, can be compound (wherein, the R shown in any in for example described formula (7)-(9) ¹¹And R ¹²In any all can be hydrogen atom or low alkyl group or carboxyl polymethylene).In addition; situation for nucleic acid (polynucleotide, poly-nucleosides, oligonucleotide or oligonucleoside); removing the step of protecting group and the step of the fluorescent atomic group of apparatus (dyestuff) replacement can also can carry out thereafter preceding the carrying out of polymerization (nucleic acid is synthetic).For example, consider to prevent that dyestuff is partially damaged in the synthesis step preferably have epipolic atomic group (dyestuff) in polymerization (nucleic acid is synthetic) back importing.

Dyestuff has no particular limits as previously mentioned, can use all dyestuffs, but preference such as cyanine dye, preferred especially thiazole orange.Cyanine dye is for example for having the chemical structure that heteroatomic two heterocycles connect by the methyne linker.By changing the length of heterocyclic kind and methyne linker, perhaps on heterocycle, import substituting group etc., can synthesize fluorescence dye with various excitation/emission wavelength.In addition, the linker that carries out in order to import DNA imports also than being easier to.In addition, thiazole orange does not send fluorescence substantially in water, but sends intensive fluorescence by interacting with DNA or RNA.Think that now the interaction between the dye molecule is suppressed by the interaction with nucleic acid, and then make around the rotation of the methyne linker between two heterocycles of dye molecule and also be suppressed, thereby cause the increase of fluorescence intensity.In addition, using method about the thiazole orange dyestuff is known, but reference example such as following document use: H.S.Rye, M.A.Quesada, K.Peck, R.A.Mathies and A.N.Glazer, High-sensitivity two-color detection ofdouble-stranded DNA with a confocal fluorescence gel scanner usingethidium homodimer and thiazole orange, Nucleic Acids Res., 1991,19,327-33; With L. G. Lee, C.H.Chen and L. A.Chiu, Thiazole orange:a newdye for reticulocyte analysis, Cytometry, 1986,7,508-17.

The basic framework of The compounds of this invention or nucleic acid is not particularly limited as previously mentioned, for example can be among DNA, modifying DNA, RNA, modification RNA, LNA or the PNA (peptide nucleic acid(PNA)) any, also can be other structures.With DNA, modifying DNA, RNA or synthetic easily when modifying RNA, replace (importing of dye molecule) with dyestuff and wait and also be easy to, so be preferred as basic framework.The method that imports dye molecule in LNA or PNA is not particularly limited, and can use known method aptly.Particularly, but reference example such as following document etc.: AnalyticalBiochemistry 2000,281,26-35.Svanvik, N., Westman, G., Wang, D., Kubista, M. (2000) Anal Biochem.281,26-35.Hrdlicka, P. J., Babu, B.R., Sorensen, M.D., Harrit, N., Wengel, J. (2005) J.Am.Chem.Soc.127,13293-13299.

With DNA, modifying DNA, RNA or modify RNA and know, for example can synthesize by so-called phosphoramidite method etc. as the synthetic method of the nucleic acid of basic framework.Phosphoramidite reagent as its raw material also can be synthetic simply by known method.At nucleic acid of the present invention is under the situation of DNA, particularly short oligo DNA, for example can use automatic dna synthesizer etc. synthetic simply.In addition, for example, also can synthesize long catenate nucleic acid (DNA) etc. by PCR etc.The bonding position of DNA and dye molecule is not particularly limited as previously mentioned, but particularly preferred example such as thymidine 5.Known 5 triphosphoric acids that stretch out various substituent nucleotide derivatives from thymidine are higher by the efficient that archaeal dna polymerase imports.Therefore, for example not only synthesizing simply under the situation of nucleic acid of the present invention for short oligo DNA, is also can synthesize simply under the situation of long-chain DNA at it.

Especially, fluorescent probe of the present invention (marker) for example uses, and the single stranded DNA of thiazole orange for example has such as following advantage: (1) can be only be prepared synthetic being easier to by in buffered soln dyestuff being added among the automatic dna synthesizer synthetic DNA; (2) by making long-chain DNA and dyestuff reaction, can prepare the long-chain fluorescent probe via the enzyme process preparation.In addition, the light of longer wavelength excites near the available for example 500nm.

The detection method of nucleic acid and test kit

Nucleic acid detection method of the present invention as previously mentioned, for

(I) nucleic acid detection method that may further comprise the steps:

(II) nucleic acid detection method that may further comprise the steps:

With marker of the present invention---single-chain nucleic acid is as the-nucleic acid, with its with have that to carry out nucleic acid synthetic with described the-nucleic acid complementary sequence or with second nucleic acid hybridization of the similar sequence of described complementary sequence, thereby synthetic be inserted with or ditch is combined with the described double-strandednucleic acid that shows epipolic atomic group or molecular structure of dye;

(III) nucleic acid detection method that may further comprise the steps:

With marker of the present invention---single-chain nucleic acid is as first nucleic acid, with its with have that to carry out nucleic acid synthetic with the described first nucleic acid complementary sequence or with second nucleic acid hybridization of the similar sequence of described complementary sequence, thereby synthetic be inserted with or ditch is combined with the described double-strandednucleic acid that shows epipolic atomic group or molecular structure of dye;

Perhaps

(IV) nucleic acid detection method, it is characterized in that using the 3rd nucleic acid to detect the formation situation of three chain nucleic acid or nucleic acid analog, described the 3rd nucleic acid have described first nucleotide sequence, described second nucleotide sequence or with these sequence complementary sequences or with described and sequences these sequence complementary sequence similarities, and by marker of the present invention or complex body marker mark or not by its mark.

Preferably, (a) the above dye molecule of 2 molecules is bonded on the base of 1 molecule in described first nucleic acid by a linker, (b) the above dye molecule of 2 molecules is bonded to by 2 above linkers on the base of 1 molecule in described first nucleic acid, and perhaps the above dye molecule of (c) 2 molecules is bonded on the base of 2 adjacent in described first nucleic acid molecules by 1 above linker.

Described nucleic acid is synthetic preferably to be undertaken by for example enzyme process, but also can be undertaken by additive method.In addition, described nucleic acid detection method of the present invention preferably uses Z ¹¹And Z ¹²Be described The compounds of this invention, its tautomer or the steric isomer that shows epipolic atomic group, or its salt, perhaps have the labeling nucleic acid of a part of the structure of described nucleic acid of the present invention, detect two strands or three chain nucleic acid.

Secondly, test kit of the present invention comprises nucleic acid synthesizer, marker and fluorescent strength determining device as previously mentioned, and wherein said marker is described marker of the present invention.That is, test kit of the present invention by with described marker of the present invention as described marker, can be with high-sensitivity detection of nucleic acids.In addition, test kit of the present invention is not particularly limited.For example, described nucleic acid synthesizer is not particularly limited, for example can be known automatic nucleic acid synthesizer etc.In addition, described fluorescent strength determining device also is not particularly limited, for example can be known fluor tester etc.

Test kit of the present invention is preferred for described nucleic acid detection method of the present invention, but is not limited thereto, and can be used for any purposes.In addition, test kit of the present invention for example is preferably used as research with, clinical usefulness or diagnosis test kit.

Below, nucleic acid detection method of the present invention or test kit are carried out more specific description.Yet nucleic acid detection method of the present invention and test kit are not limited to following explanation.

Use marker of the present invention in the nucleic acid detection method of the present invention as previously mentioned.In this case, marker of the present invention can per 1 intramolecularly only has 1 but preferably have and have epipolic atomic group (dyestuff) more than 2.In view of the above, for example described have epipolic atomic group (dyestuff) and had exciton effect.By exciton effect, for example, can suppress the fluorescence intensity under the strand state, thereby can detect double-spiral structure more effectively.In addition, so-called exciton effect (excitoncoupling) for example is meant and forms H aggregate (H-aggregate) by the parallel gathering of a plurality of dyestuffs, sends the effect of fluorescence hardly.This effect is considered to because following former thereby produce: the excited state of dyestuff is to be split into two energy levels by Davydov splitting, excites → is under an embargo by the thermodynamics mode to the internal conversion of carrying out than low-lying level (internal conversion) → luminous to higher energy level.Yet the invention is not restricted to above-mentioned explanation.Exciton effect takes place can be confirmed based on the following fact: the absorption band that forms the dyestuff of H aggregate occurs at the wavelength place shorter than the absorption band of single dyestuff.As the dyestuff that shows this effect, can enumerate for example described thiazole orange and derivative, oxazole Huang thereof and derivative thereof, flower cyanines and derivative thereof, half flower cyanines and derivative thereof, methyl red and derivative thereof, other are commonly referred to as the dyestuff of cyanine dye, azoic dyestuff.

These dyestuffs are bonded to the two strands that forms double-helical DNA-DNA two strands or DNA-RNA two strands or thiophosphatephosphorothioate nucleic acid, PNA (peptide nucleic acid(PNA)) or these artificial nucleic acid of LNA (BNA) and DNA or RNA formation by insertion easily.When a plurality of such dyestuffs were imported probe, common strand state (state that promptly has only probe before the hybridization) was because exciton effect and by cancellation consumingly, but during with target DNA or RNA hybridization, aggregate is removed, and each dyestuff inserts in the two strands one after another.Therefore do not produce exciton effect owing to do not have interaction of electrons between dyestuff this moment, sends intensive fluorescence.This moment, the absorption band of dyestuff was identical with the absorption band of single dyestuff, demonstrated and did not produce exciton effect between dyestuff.In addition, when dyestuff inserted in the two strands, dyestuff had originally structurally reversed elimination, and it is stronger that fluorescence radiation becomes.

Thereby, for example by design because a plurality of dyestuffs show the probe of exciton effect, thereby can make the opening and closing of fluorescence very clear and definite by hybridizing to target sequence.In addition, during only in conjunction with 1 molecular dye, do not show exciton effect on the probe sequence.For example, dyestuff inserts the reasons such as structure planarization that make dyestuff due to forming by two strands, stronger fluorescence in the time of can producing than strand.In addition, though the above dyestuff bonding of 2 molecules, each dyestuff at a distance of do not show electronics interactional apart from the time, do not show exciton effect yet.That is, in order to bring into play exciton effect, the dyestuff more than 2 molecules must be bonded on the molecule of The compounds of this invention or nucleic acid in the following manner, promptly described dyestuff is set to enough approaching distance.That is, The compounds of this invention or nucleic acid preferably are bonded to 2 above dyestuffs a Nucleotide in the probe as under the situation of fluorescent probe, perhaps a dyestuff are bonded to per 2 above successive Nucleotide.

Nucleic acid detection method of the present invention can show by for example Fig. 1 modeling ground.This figure (A) (left side figure be the figure of " non-heterozygote ") shown by exciton effect and the probe of cancellation, and this figure (B) (right figure is the figure of " heterozygote ") has shown by two strands formation and carried out insertion and sent the probe of fluorescence.Among the figure, symbol 1 expression nucleic acid of the present invention (fluorescent probe).2 expressions show epipolic atomic group (dyestuff).The complementary strand of 1 ' expression nucleic acid (fluorescent probe) 1.3 expressions are by the 1 and 1 ' double-strandednucleic acid that forms.In addition, the top of figure is transfer transport figure." permission " expression allows to shift." forbid " representing to forbid shifting." can launch " expression and can send fluorescence." can not launch " on the representation theory and can not send fluorescence.That is, think that the dyestuff 2 of ground state is assembled under strand state (Fig. 1 (A)), thereby interact that the excited state of described dyestuff aggregate is separated into 2 energy levels, thereby suppresses luminous according to the exciton coupled wave theory.Owing to be under an embargo on the luminescence theory from low-lying level, so the substance excited state of aggregate is retained in low emission state.On the other hand, when thinking by hybridization formation two strands (Fig. 1 (B)), dyestuff 2 inserts or ditch is incorporated into double-strandednucleic acid 3, thereby eliminates the exciton coupling, so produces fluorescence.Yet Fig. 1 is the synoptic diagram that modeling ground shows an example of detection of nucleic acids mechanism of the present invention, the invention is not restricted to Fig. 1 and above-mentioned explanation.In the exciton effect, by controlling 2 distances between dyestuff, thereby can control fluorescence radiation.By this system is connected with the DNA that is used for distinguishing sequence, can obtain the fluorescence radiation of sequence selective.In nucleic acid detection method of the present invention or the test kit, can also can judge clearly by range estimation by the detection of for example hybridizing from sample below irradiation sample with visible light.In addition, in nucleic acid detection method of the present invention or the test kit, can for example observe hybridization in the containers such as fluorescent ventricle, micro plate, gel, kapillary, plastics tubing.And, in nucleic acid detection method of the present invention or the test kit, for example can with observation hybridization at once after target nucleic acid mixes.

By marker of the present invention, nucleic acid detection method or test kit, even under the environment that for example in PCR in real time or cell, is difficult to like this wash, also be easy to carry out the fluoroscopic examination of sequence-specific nucleic acid.More specifically, can carry out for example application of following (1)-(7).In addition, hereinafter, " probe of the present invention " is meant as a kind of fluorescent probe in the marker of the invention described above.As previously mentioned, in nucleic acid detection method of the present invention and test kit, use marker of the present invention.In addition, below (1)-(7) be example, marker of the present invention, nucleic acid detection method or test kit are not limited to these explanations.

(1) probe of the present invention can be used for liquid phase homogeneous phase detection (using 96 hole micro plates or kapillary etc.).

(2) probe of the present invention can be used as the PCR probe.Can be used as the detection (PCR in real time) of amplification curve in the dna amplification reaction, the inexpensive method of replacement TaqMan probe.Can be used as primer mark or inner marker probe.

(3) probe of the present invention can be used as capturing probe or the label probe in the DNA chip.Be the high-throughput system that does not need reagent, do not need labeling process, washing process.Can greatly avoid the artificial error that produces.Can carry out a plurality of (high-throughput) on glass or the solid support material that replaces (substrate of gold, ITO, copper etc., diamond or plastics etc. can adhere to the material of a plurality of samples) simultaneously analyzes.

(4) probe of the present invention can be fixed in pearl, fiber or hydrogel.Can under semiliquid/semisolid environment, detect gene.When having the liquid testing environment, also can carry with solid form.

(5) probe of the present invention can be used as trace (southern blotting technique, RNA trace, Dot blot etc.) and uses probe.Can only make the target gene fragment luminous and detect.By method of the present invention, after hybridization, do not need washing.

(6) probe of the present invention can be used as the detection and the tracking probe of nucleic acid in the nucleus.Thus, can carry out the space-time analysis of DNA/RNA in the cell.Can use fluorescent microscope or cell sorter.Can be applicable to dna marker, to the tracking of rna transcription/montage, the functional analysis of RNAi etc.Do not need washing in the method for the present invention, therefore the function that is suitable for following the trail of viable cell.

(7) probe of the present invention can be used as the probe of fluorescence in situ hybridization (FISH).By method of the present invention, can carry out tissue staining etc.Do not need washing in the method for the present invention, the therefore artificial error that produces is little.Therefore that is, probe of the present invention can be used as not fluorescent fluorescence dye when unidentified target biological molecules, can set up the biological videograph process that does not need complicated washing step when using described probe.This makes it possible to carry out the real-time fluorescence observation of high reliability, low workload.

In addition, the effect of fluorescent probe of the present invention (marker) is, compares with existing strand state cancellation type fluorescent probe (molecular beacon etc.), can enumerate for example following advantage.Yet these also are exemplary, the invention is not restricted to this.

(1) under the situation of only using a kind of dyestuff, synthetic easily.

(2) end at dna probe of the present invention (marker) is under the free-ended situation, is easy to as the PCR probe.

(3) do not need to form special higher structure such as hairpin structure, therefore do not need stem sequence etc. and the irrelevant sequence (not having useless sequence, yet without limits) of recognition sequence sequence.

(4) can import fluorescence dye in a plurality of positions (desirable position) of probe.

(5) contain in 1 molecule under the situation of 2 above dye structures, the position relation between dyestuff is restricted, so S/N is bigger than (fluorescence intensity ratio before and after the hybridization).

For example control by the dyestuff exciton interaction partly of para-linkage, the fluorescence intensity of probe of the present invention can change effectively.In the present invention, particularly by in the method for utilizing exciton interaction, owing to can play a role as the on-off probe, therefore can obtain sufficiently high cancellation performance, in addition, for example as previously mentioned, compare with existing detection, can obtain a plurality of visibly different advantages.The design of such on-off fluorescent nucleotide can be set up does not need the biological visualization method that for example washs, therefore extremely important.The photophysical property that utilizes the probe of exciton effect to show not only has characteristics very much, and is adapted at the novel fluorescence dna probe design used in the monitoring of dna sequencing (sequence is determined), gene type (gene type assay), dna structure conversion and the genetic expression observation.

In addition, if use probe of the present invention (nucleic acid),, when phenomenons such as the amplification that detects this sequence immediately, decomposition, protein bonding produce, also can carry out quantitatively the amount of these phenomenons by for example target nucleic acid sequence is carried out quantitatively.Described detection and quantitatively can be by hereinafter explanation, but these explanations are exemplary, do not limit the present invention.That is, at first, probe of the present invention (nucleic acid) is hybridized with certain amount ratio with above-mentioned target nucleic acid sequence, forms double-stranded.The amount of the two strands that forms is directly proportional with the amount of described target nucleic acid sequence, therefore can detect the target nucleic acid sequence by the fluorescence intensity of measuring described two strands, can carry out quantitatively its amount simultaneously.In this case, the fluorescence radiation of probe of the present invention (nucleic acid) is suppressed, and does not therefore hinder the fluorescent strength determining of described two strands, can correctly measure.

Embodiment

By following examples the present invention is carried out more specific description, yet the invention is not restricted to following examples.In addition, the implication of " ODN " hereinafter is oligo DNA (a DNA oligomer).

Condition determination etc.

Use conventional commercially available reagent, solvent.The N-hydroxy-succinamide ester of employed vitamin H is produced by PIERCE company.Be used for the silica gel use Wako gel C-200 (with the pure medicine of light) that compound is purified. ¹H, ¹³C and ³¹P NMR spectrum is measured by the JNM-α 400 (trade(brand)name) of JEOL (NEC company).Coupling constant (J value) is represented with hertz (Hz).Chemical shift represents with ppm, the internal standard product use methyl-sulphoxide ( ¹δ among the HNMR=2.48, ¹³δ among the CNMR=39.5) and methyl alcohol ( ¹δ among the HNMR=3.30, ¹³δ among the CNMR=49.0). ³¹In the mensuration of P NMR, use H ₃PO ₄(δ=0.00) is as the external perimysium reference product.The ESI mass spectrum uses the Bruker Daltonics APEC-II (trade(brand)name) of Bruker company to measure.Automatic dna synthesizer uses the 392DNA/RNA synthesizer (trade(brand)name) of Applied Biosystem company.Reversed-phase HPLC uses the device Gilson Chromatograph of Gilson company, the CHEMCOBOND 5-ODS-H preparative scale chromatography post (trade(brand)name of Model 305 (trade(brand)name) and Chemco company, 10 * 150mm) separate, and detect at the 260nm wavelength by UV detector Model 118 (trade(brand)name).The DNA quality is measured by MALDI-TOF MS.MALDI-TOF MS uses the PerSeptive VoyagerElite (trade(brand)name) of Applied Biosystems company, under acceleration voltage 21kV, negative electricity condition, measure, use 2 ', 3 ', 4 '-trihydroxy-acetophenone uses T8 ([M.H] .2370.61) and T17 ([M.H] .5108.37) as the internal standard product as matrix.UV and fluorescence Spectra use ShimadzuUV-2550 (trade(brand)name) spectrophotometer of company of Shimadzu Seisakusho Ltd. and RF-5300PC (trade(brand)name) spectrophotofluorometer to measure separately.Fluorescence lifetime is measured by the minitype high-performance fluorescence lifetime determinator HORIBA JOBIN YVONFluoroCube (trade(brand)name) that is made company of institute by the hole field that is equipped with NanoLED-05A (trade(brand)name).Being determined in the 50mM sodium phosphate buffer (pH=7.0) that contains 100mM sodium-chlor of the fusing point of double-strandednucleic acid (Tm) carried out under the final double-stranded concentration of 2.5 μ M.The absorbancy of sample is measured at 260nm wavelength place, in 10 ℃ to 90 ℃ scope, follows the trail of simultaneously with the speed heating of 0.5 ℃/min.According to the characteristic of observation thus, with the temperature that changes at first as fusing point Tm.

The mensuration of absorption spectrum, fluorescence Spectra and CD spectrum unless stated otherwise, otherwise all under the chain concentration (strand or two strands) of 2.5 μ M, in containing the 50mM sodium phosphate buffer (pH=7.0) of 100mM sodium-chlor, the measuring cell of use optical path length 1cm carries out.Exciting the bandwidth with fluorescence radiation is 1.5nm.Use 9, the 10-diphenylanthrancene is material in contrast, with in ethanol 9, and the quantum yield Φ of 10-diphenylanthrancene _F=0.95 is benchmark, calculates fluorescent quantum yield (Φ _F).The luminous spectrum area uses device software to calculate by integration.Quantum yield (Φ _F) calculate by following formula (1).

Φ _F(S)/Φ _F(R)＝[A _(S)/A _(R)]×[(Abs) _(R)/(Abs) _(S)]×[n _(S) ²/n _(R) ²](1)

In the following formula (1), Φ _{F (S)}Be the fluorescent quantum yield of sample, Φ _{F (R)}Fluorescent quantum yield for the contrast material.A _(S)Be the fluorescence Spectra area of sample, A _(R)Fluorescence Spectra area for the contrast material.(Abs) _(S)Be the optical density(OD) of sample solution under the excitation wavelength, (Abs) _(R)Optical density(OD) for contrast substance solution under the excitation wavelength.n _(S)Be the specific refractory power of sample solution, n _(R)For the specific refractory power of contrast substance solution, with n _(S)=1.333, n _(R)=1.383 calculate.

Embodiment 1-3

According to following scheme 1, synthetic (manufacturing) 2 compounds 102 and 103 that active amino is protected by trifluoroacetyl group separately, and then, synthesized phosphoramidite 104.

[changing 53]

Scheme 1

Reaction reagent and reaction conditions (a) be N-hydroxy-succinamide (i), EDC/DMF, (ii) three (2-aminoethyl)-amine/CH ₃CN, (iii) CF ₃COOEt, Et ₃N; (b) DMTrCl/ pyridine; (c) 2-cyanoethyl-N, N, N ', N '-tetra isopropyl phosphoramidite, 1H-tetrazolium/CH ₃CN.

About such scheme 1, as described in more detail below.

Embodiment 1:2-[2-[N, N-two (2-trifluoroacetamido ethyl)]-aminoethyl] formamyl-(E)-and vinyl]-2 '-deoxyuridine

(2-[2-[N, N-bis (2-trifluoroacetamidoethyl)]-aminoethyl] carbamoyl-(E)-vinyl)-2 '-deoxyuridine, compound 102) synthetic

Starting raw material (E)-5-(2-carboxy vinyl)-2 '-deoxyuridine ((E)-5-(2-carboxyvinyl)-2 '-deoxyuridine, compound 101) according to Tetrahedron1987,43,20,4601-4607 is synthetic.That is, at first, to 430mg acid chloride (II) (FW224.51) and 1.05g triphenylphosphine (FW262.29) in the interpolation 71mL 1, the 4-diox, add again the 7.1mL triethylamine (FW 101.19, d=0.726), 70 ℃ of heated and stirred.When reaction soln changed to chocolate from sorrel, (FW 86.09, and d=0.956) 1, the suspension liquid in the 4-diox was 125 ℃ of reflux 1 hour to add 14.2g 2 '-deoxidation-5-ioduria glycosides (FW354.10) and 7.0mL methyl acrylate.Afterwards, when still hot, filter, use the methanol wash residuum, recovery filtrate.After the solvent of this filtrate removed by underpressure distillation, with silicagel column purifying resultant (5-10% ethanol/methylene).The solvent of the fraction of collecting is removed in underpressure distillation, with remaining white solid drying under reduced pressure.In this exsiccant solid, add the ultrapure water of about 100mL, add 3.21g sodium hydroxide (FW40.00), spend the night 25 ℃ of stirrings.Then, add the concentrated hydrochloric acid souring soln, leach the precipitation of generation, with ultrapure water washing, drying under reduced pressure.Obtain 8.10g (productive rate 68%) target compound (compound 101) thus as white powder.In addition, by ¹Consistent this fact with reference value of H NMR measured value has confirmed that described white powder is a target compound 101.In addition, ¹³The following record of C NMR measured value.

(E)-5-(2-carboxy vinyl)-2 '-deoxyuridine (compound 101):

¹³CNMR(DMSO-d6)：δ168.1，161.8，149.3，143.5，137.5，117.8，108.4，87.6，84.8，69.7，60.8，40.1.

Then, 1.20g (E)-5-(2-carboxy vinyl)-2 '-deoxyuridine 101 (molecular weight 298.25), 925mg N-hydroxy-succinamide (molecular weight 115.09) and 1.54g 1-ethyl-3-(3-dimethyl aminopropyl) carbodiimide (molecular weight 191.70) are added the recovery flask (Na ス Off ラスコ) of having put into stirrer, add 20mL DMF, stirred 16 hours at 25 ℃.Add about 1mL acetate, add 300mL methylene dichloride and 100mL ultrapure water, vigorous stirring.Remove water layer, add the 100mL ultrapure water again, in the same way washed twice.Leach the precipitation of generation, use washed with dichloromethane, drying under reduced pressure.The solvent in the filtrate is removed in distillation, adds methylene dichloride in the precipitation that generates, and reclaims precipitation same as abovely.The precipitation that merges all recovery is suspended in it in 80mL acetonitrile vigorous stirring.To disposable adding 3.0mL three (2-aminoethyl) amine wherein (molecular weight 146.23, d=0.976), 25 ℃ of restir 10 minutes.Then, (molecular weight 142.08, d=1.194), (molecular weight 101.19 d=0.726), stirred 3 hours at 25 ℃ to add the 5.6mL triethylamine again to add the 4.8mL Trifluoroacetic Acid Ethyl Ester.Solvent is removed in distillation, with silicagel column purifying (5-10%MeOH/CH ₂Cl ₂).Solvent is removed in distillation, with the small amount of acetone dissolving, adds ether and promptly generates white precipitate, filters, and after the ether washing, drying under reduced pressure obtains 884mg (33.5%) target substance (compound 102).

In addition, except the usage quantity with raw material, solvent etc., reaction times and step are carried out beyond some change, and when synthesizing with the method identical with aforesaid method, productive rate can be increased to 37%.Promptly, with 597mg (2.0mmol) (E)-5-(2-carboxy vinyl)-2 '-deoxyuridine 101 (molecular weight 298.25), 460mg (4.0mmol) N-hydroxy-succinamide (molecular weight 115.09) and 767mg (4.0mmol) 1-ethyl-3-(3-dimethyl aminopropyl) carbodiimide (molecular weight 191.70) add the flask of having put into stirrer, add 5.0mLDMF, stirred 3 hours at 25 ℃.Add about 0.5mL acetate, add 100mL methylene dichloride and 100mL ultrapure water, vigorous stirring.Leach the precipitation of generation, wash with water, drying under reduced pressure spends the night.The white residuum that obtains is suspended in the 50mL acetonitrile vigorous stirring.To disposable adding 3.0mL (20mmol) three (2-aminoethyl) amine wherein (molecular weight 146.23, d=0.976), 25 ℃ of restir 10 minutes.Then, (molecular weight 142.08, d=1.194), (molecular weight 101.19 d=0.726), stirred 16 hours at 25 ℃ to add 5.6mL (40mmol) triethylamine again to add the 4.8mL Trifluoroacetic Acid Ethyl Ester.Solvent is removed in distillation, with silicagel column purifying (5-10%MeOH/CH ₂Cl ₂).Solvent is removed in distillation, with the small amount of acetone dissolving, adds ether and promptly generates white precipitate, filters, and after the ether washing, drying under reduced pressure obtains 453mg (37%) target substance (compound 102) as white powder.Below shown the instrumental analysis value of compound 102, in addition, shown among Fig. 2 ¹H NMR spectrogram.

2-[2-[N, N-two (2-trifluoroacetamido ethyl)]-aminoethyl] formamyl-(E)-and vinyl]-2 '-deoxyuridine (compound 102):

¹HNMR (CD ₃OD): δ 8.35 (s, 1H), 7.22 (d, J=15.6Hz, 1H), 7.04 (d, J=15.6Hz, 1H), 6.26 (t, J=6.6Hz, 1H), and 4.44-4.41 (m, 1H), 3.96-3.94 (m, 1H), 3.84 (dd, J=12.2,2.9Hz, 1H), 3.76 (dd, J=12.2,3.4Hz, 1H), 3.37-3.30 (m, 6H), 2.72-2.66 (m, 6H), 2.38-2.23 (m, 2H). ¹³CNMR (CD ₃OD): δ 169.3,163.7,159.1 (q, J=36.4Hz), 151.2,143.8,134.3,122.0,117.5 (q, J=286Hz), 110.9,89.1,87.0,71.9,62.5,54.4,53.9,41.7,38.9,38.7.C ₂₂H ₂₉F ₆N ₆O ₈([M+H] ⁺) HRMS (ESI) calculated value be 619.1951, measured value is 619.1943.

Embodiment 2:5 '-O-dimethoxytrityl-(2-[2-[N; N-two (2-trifluoroacetamido ethyl)]-aminoethyl] formamyl-(E)-vinyl)-2 '-deoxyuridine (5 '-O-DMTr-(2-[2-[N; N-bis (2-trifluoroacetamidoethyl)]-aminoethyl] carbamoyl-(E)-vinyl)-2 '-deoxyuridine, compound 103) synthetic

5 '-hydroxyl of compound 102 is protected with dimethoxytrityl (DMTr) base, obtained compound 103.That is, at first, with 618mg compound 102 (molecular weight 618.48) and 373mg chlorination 4,4 '-dimethoxytrityl (molecular weight 338.83) adds the flask of having put into stirrer, adds the 10mL pyridine, stirs 16 hours at 25 ℃.Add less water, solvent is removed in distillation, carries out purifying (2-4%MeOH, 1%Et with silicagel column ₃N/CH ₂Cl ₂).The solvent in the fraction that contains target compound 103 is removed in distillation, obtains 735.2mg (79.8%) target substance (compound 103).Below shown the instrumental analysis value of compound 103, in addition, shown among Fig. 3 ¹H NMR spectrogram.

5 '-O-dimethoxytrityl-(2-[2-[N, N-two (2-trifluoroacetamido ethyl)]-aminoethyl] formamyl-(E)-and vinyl)-2 '-deoxyuridine (compound 103):

¹HNMR (CD ₃OD): δ 7.91 (s, 1H), 7.39-7.11 (m, 9H), 7.02 (d, J=15.6Hz, 1H), 6.93 (d, J=15.6Hz, 1H), 6.80-6.78 (m, 4H), 6.17 (t, J=6.6Hz, 1H), 4.38-4.35 (m, 1H), 4.06-4.04 (m, 1H), 3.68 (s, 6H), 3.32-3.22 (m, 8H), and 2.66-2.55 (m, 6H), 2.40 (ddd, J=13.7,5.9,2.9Hz, 1H), 2.33-2.26 (m, 1H). ¹³CNMR (CD ₃OD): δ 168.9,163.7,160.1,159.1 (q, J=36.9Hz), 151.0,146.1,143.0,137.0,136.9,134.1,131.24,131.16,129.2,128.9,128.0,122.5,117.5 (q, J=286.7Hz), 114.2,110.9,88.1,87.9,87.6,72.6,65.0,55.7,54.2,53.9,41.7,38.9,38.6.C ₄₃H ₄₇F ₆N ₆O ₁₀([M+H] ⁺) HRMS (ESI) calculated value be 921.3258, measured value is 921.3265.

Embodiment 3: '-O-(dimethoxytrityl)-(2-[2-[N, N-two (2-trifluoroacetamido ethyl)]-aminoethyl] formamyl-(E)-and vinyl)-2 '-deoxyuridine, 3 '-[(2-cyanoethyl)-(N, N-di-isopropyl)]-phosphoramidite (

5′-O-DMTr-(2-[2-[N，N-bis(2-trifluoroacetamidoethyl)]-aminoethyl]carbamoyl-(E)-vinyl)-2′-deoxyuridine，

3 '-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoramidite, compound 104) synthetic

With 188mg (0.20mmol) compound 103 (molecular weight 920.85) and CH ₃The CN azeotropic adds 28.6mg (0.40mmol) 1H-tetrazolium (molecular weight 70.05), with the air-breathing dried overnight of vacuum pump.Add 5.1mL CH ₃CN stirs behind the solubilising reagent, disposable adding 194 μ L (0.60mmol) 2-cyanoethyl-N, and N, N ', (molecular weight 301.41 d=0.949), stirred 2 hours at 25 ℃ N '-tetra isopropyl phosphoramidite.The mixture that adds 50mL ethyl acetate and 50mL saturated sodium bicarbonate aqueous solution, separatory after the water washing of organic layer usefulness saturated common salt, is used dried over mgso.After filtration removal sal epsom, solvent is removed in distillation.With this crude product and CH that obtains by separatory ₃Behind the CN azeotropic, suppose that the productive rate of the resultant that obtains (compound 104) is 100%, thus the CH of preparation 0.1M ₃CN solution, it is synthetic to be used for DNA.In addition, according to described crude product ³¹PNMR (CDCl ₃) and HRMS (ESI) confirm to have obtained compound 104.Its value is as follows.

Compound 104:

³¹PNMR (CDCl ₃) δ 149.686,149.430; C ₅₂H ₆₄F ₆N ₈O ₁₁P ([M+H] ⁺) HRMS (ESI) calculated value be 1121.4336, measured value is 1121.4342.

Synthesizing of embodiment 4:DNA oligomer

[changing 54]

Scheme 2

Use compound 104 to carry out by means of the synthetic conventional phosphoramidite method (DMTr OFF) of the oligo DNA of automatic dna synthesizer with 1 μ mol scale, the DNA oligomer that has synthesized the sequence (SEQ ID NO.1) that is called 5 '-d (CGCAATXTAACGC)-3 ' (13 polymers, the structure of X is shown in Chemical formula 1 05).Go protection to carry out 16 hours at 55 ℃ by strong aqua (28 quality %).With Speed Vac volatilization ammonia, behind 0.45 μ m strainer, the DNA oligomer of holding back out to be analyzed by reverse-phase chromatography, the peak that about 10.5 timesharing are occurred carries out purifying (CHEMCOBOND 5-ODS-H (trade(brand)name); 10 * 150mm, 3mL/min, 5-30%CH ₃CN/50mM TEAA pH of buffer 7 (20 minutes) detects at the 260nm place).The resultant of purifying is with the mass spectral negative mode determining molecular weight of MALDI TOF, confirms to have molecular weight by described 5 '-d (CGCAATXTAACGC)-3 ' sequence (13 polymers, the structure of X is shown in Chemical formula 1 05) expection (based on C ₁₃₄H ₁₇₆N ₅₂O ₇₆P ₁₂, calculated value 4102.8) and ([M-H] ^-Measured value is 4101.9, and calculated value is 4101.8).Shown MALDI TOF mass spectrum among Fig. 4.

In addition; can synthesize 5 '-d (CGCAATXTAACGC)-3 ' sequence (13 polymers with the method identical with aforesaid method; the structure of X is shown in Chemical formula 1 05); different is goes protection or carried out 16 hours at 25 ℃ after carrying out 4 hours at 55 ℃ again with strong aqua; the concentration of (triethylamine acetic ester) damping fluid of TEAA in reversed-phase HPLC (pH7) is 0.1M, and to make developing time in reversed-phase HPLC be more than 30 minutes.And, use the same method, can synthesize shown in the table 1 DNA (Nucleotide that contains Chemical formula 1 05 expression) as each ODN raw material.

In order to measure the concentration of each DNA of synthetic, with each DNA of purifying with calf intestinal alkaline phosphatase (50U/mL), snake venom phosphodiesterase (0.15U/mL) and P1 nuclease (50U/mL) at 25 ℃ with complete digestion in 16 hours.With Digestive system CHEMCOBOND5-ODS-H (trade(brand)name) post (4.6 * 150mm) the HPLC analysis that obtains.At this moment, use 0.1MTEAA (pH7.0) as developping solution, flow velocity is 1.0mL/min.The concentration of described synthetic DNA compares by the peak area with the standardized solution of dA, the dC, dG and the dT that contain the 0.1mM concentration of respectively doing for oneself to be determined.And described synthetic DNA also determines by MALDI TOF mass spectrum.Below show this mass analysis value.In addition, [105] are illustrated in this position and are inserted with the Nucleotide shown in the Chemical formula 1 05.

CGCAAT[105] TAACGC, C ₁₃₄H ₁₇₇N ₅₂O ₇₆P ₁₂([M+H] ⁺) calculated value 4103.8, measured value 4107.0;

TTTTTT[105] TTTTTT, C ₁₃₈H ₁₈₇N ₃₀O ₉₀P ₁₂([M+H] ⁺) calculated value 4077.8, measured value 4076.9;

TGAAGGGCTT[105] TGAACTCTG, C ₂₀₅H ₂₆₅N ₇₇O ₁₂₂P ₁₉([M+H] ⁺) calculated value 6348.2, measured value 6348.7;

GCCTCCT[105] CAGCAAATCC[105] ACCGGCGTG, C ₂₈₅H ₃₇₆N ₁₀₈O ₁₆₉P ₂₇([M+H] ⁺) calculated value 8855.0, measured value 8854.8;

CCTCCCAAG[105] GCTGGGAT[105] AAAGGCGTG, C ₂₈₉H ₃₇₆N ₁₁₆O ₁₆₈P ₂₇([M+H] ⁺) calculated value 8999.1, measured value 9002.2.

Embodiment 5: the biotin modification that contains the DNA oligomer of the Nucleotide with 2 amino

[changing 55]

Scheme 3

By making the N-hydroxy-succinamide ester reaction of synthetic DNA oligomer 5 '-d (CGCAATXTAACGC)-3 ' (compound 105 uses described compound 4 as X) and vitamin H, thus make 2 amino with 2 biotin labelings (such scheme 3).That is, at first, with 30 μ L5 '-d (CGCAATXTAACGC)-3 ' (compound 105, chain concentration 320 μ M), 10 μ LNa ₂CO ₃/ NaHCO ₃(1M is pH9.0) with 60 μ L H for damping fluid ₂O mixes, and adds the DMF solution (20mM) of the N-hydroxy-succinamide ester of 100 μ L vitamin Hs, thorough mixing.25 ℃ leave standstill 16 hours after, add 800 μ L H ₂O by the strainer of 0.45 μ m, will carry out purifying (CHEMCOBOND 5-ODS-H at the about peak of locating to occur in 14 minutes of reversed-phase HPLC; 10 * 150mm, 3mL/min, 5-30%CH ₃CN/50mM TEAA cushions (20 minutes), detects at the 260nm place).To measure by MALDI TOF mass spectrum by the resultant that this HPLC purifying obtains, the result observes the peak at 4554.3 places.This peak value with react the molecular weight 4555.4 of the target resultant 6 that obtains (by C by 2 amino and 2 biotin molecules ₁₅₄H ₂₀₄N ₅₆O ₈₀P ₁₂S ₂The calculated value that obtains) [M-H] that tries to achieve ^-Calculated value 4554.4 conforms to.Shown MALDI TOF mass spectrum among Fig. 5.

Use this compound 6 (strand state) to synthesize double-stranded DNA and RNA, and compared the fluorescence intensity of strand state and double-stranded state.Results verification is suppressed at the fluorescence radiation of the DNA of strand state fluorescent probe (compound 6), and sends intensive fluorescence when forming duplex with complementary nucleic acid.

Among following examples 6-13, the thiazole orange derivative that has synthesized the carboxyl methylene radical linker that has shown in following chemical formula b and the c, and with its activation for N-hydroxy succinic acid ester, by making itself and DNA oligomer (oligonucleotide) reaction, the various epipolic oligonucleotide (fluorescent DNA probe) that have have been prepared with active amino.That is, made from the length of the extended methylene radical linker of dyestuff with contain from having the various oligonucleotide (fluorescent DNA probe) of various changes aspect the linker of 5 extended amino of thymidine.The result is that in arbitrary described various fluorescent DNA probes, the fluorescence radiation of the DNA fluorescent probe of strand state all can be suppressed, and can send intense fluorescence when forming duplex with complementary nucleic acid.In addition, among following chemical formula b and the c, n represents linker length (bridge formation atom number).

[changing 56]

Embodiment 6: compound synthetic that has thiazole orange deutero-structure in 1 molecule on 2 positions

[changing 57]

Scheme 4

As above-mentioned scheme 4, synthesized the DNA oligomer (oligonucleotide) 110 that has thiazole orange deutero-structure on 2 positions in 1 molecule.As mentioned below in more detail.

The synthesized

reference Organic Letters

2000,6 of thiazole orange derivative 107,517-519 carries out as described in following scheme 5.

[changing 58]

Scheme 5

(1) iodate N-toluquinoline (compound 111) is synthetic

At first, synthesized iodate N-toluquinoline (compound 111) according to the record of above-mentioned document.Particularly, in the no Shui diox of 42mL, add quinoline 2.4mL and methyl iodide 4mL, after 1 hour,,, obtain iodate N-toluquinoline (compound 111) with ether and petroleum ether, drying by filtering the collecting precipitation thing 150 ℃ of stirrings.

(2) bromination 3-(4-carboxylic butyl)-2-methylbenzothiazole (compound 112) is synthetic

(FW149.21 d=1.173) stirred 16 hours at 110 ℃ with 9.4g 5-bromine valeric acid (FW181.03) with 8mL 2-methylbenzothiazole.Crude product is cooled to room temperature, the solid suspension that generates in 20mL methyl alcohol, is added the 40mL ether again.Leach the precipitation of generation, the smell that the Yong diox washs until the 2-methylbenzothiazole disappears, and with the ether washing, drying under reduced pressure obtains the 9.8g white powder again.Measure this white powder ¹H NMR, result be 2 by alkylating target compound bromination 3-(4-carboxylic butyl)-2-methylbenzothiazole (compound 112) and 2 not by the mixture of alkylating bromination 3-(4-carboxylic butyl)-benzothiazole.The ratio of proton peak is: not alkylating material: alkylating material=10: 3.This crude product is directly used in subsequent reactions.

(3) the inferior thiazolyl of bromination 1-methyl-4-[{3-(4-carboxylic butyl)-2 (3H)-benzos } methyl] quinoline (compound 107) synthetic

At 3.6ml triethylamine (FW101.19, d=0.726) under the existence, crude product 2.18g that contains bromination 3-(4-carboxylic butyl)-2-methylbenzothiazole (compound 112) that will obtain in above-mentioned (2) and the iodate N-toluquinoline (compound 111) of 700mg (FW271.10) stirred 2 hours in 25 ℃ in the methylene dichloride at 10mL.Subsequently, add the 50ml ether, filter the precipitation that generates, ether washing, drying under reduced pressure.With this precipitation be suspended in the 50mL ultrapure water, the washing of filtration, ultrapure water, drying under reduced pressure.Again above-mentioned precipitation is suspended in the 50mL acetonitrile, filter, wash, thereby drying under reduced pressure obtains the red powder (productive rate is 25.3%) of 307.5mg with acetonitrile.Will ¹HNMR spectrum and reference value compare definite, and this red powder is purpose product (compound 107).

In addition, the inferior thiazolyl of bromination 3-(4-carboxylic butyl)-2-methylbenzothiazole (compound 112) and bromination 1-methyl-4-[{3-(4-carboxylic butyl)-2 (3H)-benzos } methyl] quinoline (compound 107) can also synthesize in the following manner.That is, at first, with the 2-methylbenzothiazole of 11.7mL (92mmol) (FW149.21, d=1.173) and the 5-bromine valeric acid (FW181.03) of 13.7g (76mmol) stirred 1 hour down at 150 ℃.At room temperature cool off crude product, the solid suspension that generates in 50ml methyl alcohol, is added the 200ml ether again.The precipitation that generates after filtration, thereby ether washing, drying under reduced pressure obtain 19.2g lavender powder.This powder is the mixture of purpose compound 112 (bromination 3-(4-carboxylic butyl)-2-methylbenzothiazole) and bromination 2-methylbenzothiazole. ¹H NMR (in DMSO-d6) measures this mixture, the output that is calculated purpose compound 112 by the peak area ratio at the peak (coming from bromination 2-methylbenzothiazole) at the peak (coming from purpose compound 112) at 8.5ppm place and 8.0ppm place is 9.82g (14mmol, 32%).This mixture (crude product) need not to purify and can use in subsequent reaction.In addition, change 5-bromine valeric acid into the 4-bromo-butyric acid, with synthetic bromination 3-(4-carboxylic the propyl group)-2-methylbenzothiazole with linker (being connected in the polymethylene chain of carboxyl) of carbonatoms n=3 of identical method, the gained productive rate is 4%.In addition, change 5-bromine valeric acid into the 6-bromocaproic acid, with synthetic bromination 3-(4-carboxylic the amyl group)-2-methylbenzothiazole with linker (being connected in the polymethylene chain of carboxyl) of carbonatoms n=5 of identical method, the gained productive rate is 35%.Moreover, change 5-bromine valeric acid into 7-bromine enanthic acid, with synthetic bromination 3-(4-carboxylic the hexyl)-2-methylbenzothiazole with linker (being connected in the polymethylene chain of carboxyl) of carbonatoms n=6 of identical method, the gained productive rate is 22%.

Subsequently, to 3.24g contain add 1.36g (5.0mmol) in the said mixture (crude product) of compound 112 (bromination 3-(4-carboxylic butyl)-2-methylbenzothiazole) and bromination 2-methylbenzothiazole iodate N-toluquinoline (compound 111) (FW271.10), the triethylamine (FW101.19 of 7.0mL (50mmol), d=0.726) and the methylene dichloride of 100mL, thus obtain transparent solution.In 25 ℃ with this solution stirring 16 hours.Subsequently, underpressure distillation removes and desolvates.In residue, add acetone (200mL), filter the gained precipitation, subsequently washing with acetone.The thus obtained residue of drying under reduced pressure is with the dried red residue of distilled water (50mL) washing.Filter this residue once more, distilled water wash, drying under reduced pressure has obtained red powder shape purpose product (compound 107) (654mg, 1.39mmol, 28%).Will ¹H NMR spectrum is compared with reference value and has been confirmed that this red powder is purpose product (compound 107).Hereinafter show ¹H NMR and ¹³The observed value of the peak value of C NMR (DMSO-d6) and HRMS (ESI).In addition, Fig. 6 shows compound 107 ¹HNMR composes (DMSO-d6).

Compound 107: ¹HNMR (DMSO-d6): δ 8.74 (d, J=8.3Hz, 1H), 8.51 (d, J=7.3Hz, 1H), 7.94-7.89 (m, 3H), 7.74-7.70 (m, 1H), 7.65 (d, J=8.3Hz, 1H), and 7.55-7.51 (m, 1H), 7.36-7.32 (m, 1H), 7.21 (d, J=7.3Hz, 1H), 6.83 (s, 1H), 4.47 (t, J=7.1Hz, 2H), 4.07 (s, 3H), 2.22 (t, J=6.6Hz, 1H), 1.77-1.63 (m, 4H); ¹³CNMR (DMSO-d6,60 ℃) δ 174.6,158.8,148.4,144.5,139.5,137.6,132.7,127.9,126.8,125.5,124.1,123.7,123.6,122.4,117.5,112.6,107.6,87.4,45.6,42.0,35.5,26.2,22.3; C ₂₃H ₂₃N ₂O ₂S ([M.Br] ⁺) HRMS (ESI) calculated value be 391.1480, measured value is 391.1475.

In addition, adopt the method identical with preparing above-claimed cpd 107, synthesized bromination 4-((3-(3-carboxylic propyl group) benzo [d] thiazole-2 (3H)-subunit) the methyl)-1-toluquinoline of the linker (being connected in the polymethylene chain of carboxyl) with carbonatoms n=3 by the mixture of above-mentioned bromination 3-(4-carboxylic propyl group)-2-methylbenzothiazole and bromination 2-methylbenzothiazole, the gained productive rate is 43%.Hereinafter show the instrumental analysis value.

Bromination 4-((3-(3-carboxylic propyl group) benzo [d] thiazole-2 (3H)-subunit) methyl)-1-toluquinoline: ¹HNMR (DMSO-d6) δ 8.85 (d, J=8.3Hz, 1H), 8.59 (d, J=7.3Hz, 1H), and 8.02.7.93 (m, 3H), 7.78.7.70 (m, 2H), 7.61.7.57 (m, 1H), 7.42.7.38 (m, 1H), 7.31 (d, J=6.8Hz, 1H), 7.04 (s, 1H), 4.47 (t, J=8.1Hz, 2H), 4.13 (s, 3H), 2.52.2.48 (m, 2H), 1.99.1.92 (m, 2H); ¹³CNMR (DMSO-d6,60 ℃) δ 174.3,158.9,148.6,144.5,139.5,137.7,132.7,127.9,126.7,125.6,124.1,124.0,123.7,122.5,117.5,112.5,107.6,87.7,45.6,42.0,31.6,22.4; C ₂₂H ₂₁N ₂O ₂S ([M.Br] ⁺) HRMS (ESI) calculated value be 377.1324, measured value is 377.1316.

In addition, adopt the method identical with preparing above-claimed cpd 107, synthesized bromination 4-((3-(3-carboxylic amyl group) benzo [d] thiazole-2 (3H)-subunit) the methyl)-1-toluquinoline of the linker (being connected in the polymethylene chain of carboxyl) with carbonatoms n=5 by the mixture of above-mentioned bromination 3-(4-carboxylic amyl group)-2-methylbenzothiazole and bromination 2-methylbenzothiazole, the gained productive rate is 26%.Hereinafter show the instrumental analysis value.

Bromination 4-((3-(3-carboxylic amyl group) benzo [d] thiazole-2 (3H)-subunit) methyl)-1-toluquinoline: ¹HNMR (DMSO-d6) δ 8.70 (d, J=8.3Hz, 1H), 8.61 (d, J=6.8Hz, 1H), and 8.05.8.00 (m, 3H), 7.80.7.73 (m, 2H), 7.60.7.56 (m, 1H), 7.41.7.35 (m, 2H), 6.89 (s, 1H), 4.59 (t, J=7.3Hz, 2H), 4.16 (s, 3H), 2.19 (t, J=7.3Hz, 1H), 1.82.1.75 (m, 2H), 1.62.1.43 (m, 4H); ¹³CNMR (DMSO-d6,60 ℃) δ 174.5,159.0,148.6,144.7,139.7,137.8,132.9,127.9,126.9,125.2,124.2,123.8,123.6,122.6,117.8,112.6,107.7,87.4,45.6,42.1,36.0,26.3,25.9,24.9; C ₂₄H ₂₅N ₂O ₂HRMS (ESI) calculated value of S ([M.Br]+) is 405.1637, and measured value is 405.1632.

In addition, adopt the method identical with preparing above-claimed cpd 107, synthesized bromination 4-((3-(3-carboxylic hexyl) benzo [d] thiazole-2 (3H)-subunit) the methyl)-1-toluquinoline of the linker (being connected in the polymethylene chain of carboxyl) with carbonatoms n=6 by the mixture of above-mentioned bromination 3-(4-carboxylic hexyl)-2-methylbenzothiazole and bromination 2-methylbenzothiazole, the gained productive rate is 22%.Hereinafter show the instrumental analysis value.

Bromination 4-((3-(3-carboxylic hexyl) benzo [d] thiazole-2 (3H)-subunit) methyl)-1-toluquinoline: ¹HNMR (DMSO-d6) δ 8.72 (d, J=8.3Hz, 1H), 8.62 (d, J=6.8Hz, 1H), and 8.07.8.01 (m, 3H), 7.81.7.75 (m, 2H), 7.62.7.58 (m, 1H), 7.42.7.38 (m, 2H), 6.92 (s, 1H), 4.61 (t, J=7.3Hz, 2H), 4.17 (s, 3H), 2.18 (t, J=7.3Hz, 1H), 1.82.1.75 (m, 2H), 1.51.1.32 (m, 6H); ¹³CNMR (DMSO-d6,60 ℃) δ 174.0,159.1,148.6,144.7,139.8,137.8,132.9,127.9,126.8,125.0,124.2,123.8,123.6,122.6,118.0,112.7,107.8,87.4,45.5,42.1,33.4,27.9,26.4,25.5,24.1; C ₂₅H ₂₇N ₂O ₂HRMS (ESI) calculated value of S ([M.Br]+) is 419.1793, and measured value is 419.1788.

(4) N-hydroxy-succinamide ester 109 is synthetic

With the inferior thiazolyl of bromination 1-methyl-4-[{3-(4-carboxylic butyl)-2 (3H)-benzos of 9.4mg (20 μ mol) } methyl] quinoline (compound 107) (FW471.41), the N-hydroxy-succinamide (compound 108) of 4.6mg (40 μ mol) (FW115.09) and the EDC of 7.6mg (40 μ mol) (1-ethyl-3-(3-dimethyl aminopropyl) carbodiimide hydrochloride) (FW191.70) in the DMF of 1mL in 25 ℃ of stirrings 16 hours, obtained the N-hydroxy-succinamide ester (compound 109) that the carboxyl of dyestuff (compound 107) is activated.This reaction product need not purifying, and reaction soln (dyestuff 20mM) is directly used in reaction with oligo DNA (oligonucleotide).

In addition, except use has the compound alternative compounds 107 of the different linker of carbonatoms (polymethylene chain) as the raw material, adopt with prepare the identical method of compound 109, synthesize bromination 4-((3-(4-(succinimide oxygen base)-4-oxo butyl) benzo [d] thiazole-2 (3H)-subunit) the methyl)-1-toluquinoline of linker (polymethylene chain) with carbonatoms n=3.In addition, bromination 4-((3-(4-(succinimide oxygen base)-4-oxo-hexyl) benzo [d] thiazole-2 (3H)-subunit) the methyl)-1-toluquinoline and bromination 4-((3-(4-(succinimide oxygen base)-4-oxo heptyl) benzo [d] thiazole-2 (3H)-subunit) methyl)-1-toluquinoline that have also synthesized linker (polymethylene chain) in the same way with linker (polymethylene chain) of carbonatoms n=6 with carbonatoms n=5.

(5) synthetic with the DNA oligomer (oligonucleotide 110) of 2 thiazole orange molecular modifications

Employing has been synthesized the DNA oligomer (oligonucleotide) 105 with two active aminos with above-mentioned embodiment 4 the same ordinary methods by means of automatic dna synthesizer.The sequence of compound 105 for identical with embodiment 45 '-d (CGCAATXTAACGC)-3 ' (X is an aforesaid compound 104).Subsequently, make this DNA oligomer (oligonucleotide) 105 and N-hydroxy-succinamide ester (compound 109) reaction, synthesized the DNA oligomer (oligonucleotide) 110 that has in two positions of a molecule by thiazole orange deutero-structure.That is, at first, with the Na of 5 of 30 μ L '-d (CGCAATXTAACGC)-3 ' (compound 105, chain concentration are 320 μ M), 10 μ L ₂CO ₃/ NaHCO ₃(1M is pH9.0) with the H of 60 μ L for damping fluid ₂O mixes, and adds the DMF solution (20mM) of 100 μ LN-hydroxysuccinimide eaters (compound 109) then, thorough mixing.Left standstill 16 hours in 25 ℃, add 800 μ L H then ₂O, by the filter of 0.45 μ m, and the peak (CHEMCOBOND 5-ODS-H 10 * 150mm, 3mL/min, the 5-30%CH that occurred in about 14.5 minutes in the purifying reverse chromatograms ₃CN/50mM TEAA damping fluid (20 minutes) detects in 260nm).Fig. 7 shows reverse hplc figure.Isolate and the fraction represented with peak shown in the arrow of purifying.Measure this HPLC purifying gained resultant by the mass spectral negative mode of MALDI TOF, find to determine that it is DNA oligomer (oligonucleotide) 110 at the peak at 4848.8 places.Fig. 8 shows the MALDI TOF MASS spectrum of DNA oligomer (oligonucleotide) 110.In the figure, arrow illustrates the mass peak (4848.8) that is produced by above-mentioned purifying gained resultant.This peak value and [M ²⁺-3H ⁺] ^-Calculated value 4848.8 consistent, described [M ²⁺-3H ⁺] ^-Molecule M (C by DNA oligomer (oligonucleotide) 110 with 2 positive charges ₁₈₀H ₂₂₀N ₅₆O ₇₈P ₁₂S ₂) remove 3 protons and obtain.In addition, serve as reasons as the DNA T8 aggressiveness of standard substance adding and the peak of T18 aggressiveness generation in the peak of the left and right sides.

Embodiment 7:DNA oligomer (oligonucleotide) 110 is as the use of fluorescent probe

DNA oligomer (oligonucleotide) 110 (DNA with 2 dye molecules) desalination, lyophilize with embodiment 6 purifying obtain are prepared as the aqueous solution subsequently, by UV absorption measurement concentration (X and T are approximate).After this, in chain concentration is that 2.5 μ M, phosphoric acid buffer are that 50mM (pH7.0) and NaCl are under the condition of 100mM, during during at fluorescent probe (DNA oligomer 110) when being the strand state, for the DNA-DNA duplex and for the DNA-RNA duplex, carry out UV respectively and measure.Fig. 9 shows the spectrum of these three samples.In the figure, dotted line represents that fluorescent probe is the spectrum of strand state, and thick line is represented the double-helical spectrum of DNA-DNA, and fine rule is represented the double-helical spectrum of DNA-RNA.By diagram as can be known, owing to formed duplex, thereby the maximum wavelength that near the UV the 500nm absorbs has taken place to move.In addition, Fig. 9 and all other UV absorb in collection of illustrative plates, transverse axis is represented wavelength (nm), the longitudinal axis is represented absorbancy.

Subsequently, be that 2.5 μ M, phosphoric acid buffer are that 50mM (pH7.0) and NaCl are under the condition of 100mM in chain concentration equally, the exciting light (bandwidth 1.5nm) by 488nm excites, and carries out fluorescence measurement subsequently.Figure 10 shows the spectrum that fluorescent probe is three samples of strand state (dotted line), DNA-DNA duplex (thick line) and DNA-RNA duplex (fine rule) respectively.By the diagram as can be known, compare in the fluorescence intensity of 530nm with the fluorescent probe of strand state, the fluorescence intensity of DNA-DNA has increased by 15 times, the increase of DNA-RNA 22 times.In addition, Figure 10 and whole other fluorescence radiation collection of illustrative plates and exciting in the collection of illustrative plates, transverse axis is represented wavelength (nm), the longitudinal axis is represented luminous intensity.

In addition, the exciting light of employing 510nm replaces the exciting light of 488nm, has also obtained identical result.Figure 11 illustrates its spectrum.

Embodiment 8: have length generation many variations linker compound synthetic and as the use of fluorescent probe

The compound (DNA oligomer) that has synthesized following Chemical formula 1 13 expressions of linker length n generation many variations.Synthetic with above-mentioned embodiment 1-4 and 6, different is for satisfying the length of linker, and changes raw material 5-bromine valeric acid into compound that carbonatoms (chain length) changes.In the present embodiment, the sequence of following compound 113 be 5 '-d (CGCAATXTAACGC)-3 ' (X is that dyestuff is introduced part).In addition, the same with embodiment 7, they are used separately as fluorescent probe, come assess performance by fluorometric assay.The result confirms, if hereinafter in the length range of linker, then compare with single-stranded probe, by with target nucleic acid hybridization, fluorescence increases about more than 10 times or 10 times.In addition, compare with the two strands of native sequences by probe and target nucleic acid hybridization gained two strands and have higher thermostability.

Change 59

Table 1

5′-d(CGCAATTTAACGC)-3′/5′-d(GCGTTAAATTGCG)-3′Tm(℃)585′-d(CGCAATTTAACGC)-3′/5′-r(GCGUUAAAUUGCG)-3′Tm(℃)46

Condition determination: probe (compound 113) 2.5 μ M, phosphoric acid buffer 50mM (pH7.0), NaCl100mM, complementary strand 2.5 μ M

The maximum wavelength of fluorescence be with 488nm (bandwidth 1.5nm) optical excitation the time value.

Quantum yield is with 9, and the 10-diphenylanthrancene calculates as object of reference.

Absorption spectrum when Figure 12 shows linker length n=4 among the embodiment 8.Dotted line is the spectrum of strand, and solid line is the spectrum of DNA-DNA chain, and long and short dash line is the spectrum of DNA-RNA chain.Observe when the absorption of 400-600nm, the absorption band during the strand state is compared with the absorption band after the hybridization and is appeared at short wavelength side, shows that clearly the dyestuff dimer by the strand state has formed the H-aggregate.

Excitation spectrum and fluorescence when in addition, Figure 13 shows linker length n=4 among the embodiment 8 are in the lump sent out spectrum.In the figure, the curve representation excitation spectrum of left side (short wavelength side), the curve representation fluorescence radiation spectrum of right side (long wavelength side).In addition, in the figure, represent (the λ of fluorescence of the wavelength with reference to fluorescence radiation in the excitation spectrum in the bracket of legend respectively _Max), the excitation wavelength in the fluorescence radiation spectrum.In excitation spectrum and fluorescence radiation spectrum, the luminous intensity of strand is the most weak, DNA-DNA chain strong slightly by comparison, DNA-RNA chain the strongest.By excitation spectrum as can be known, the absorption relevant with fluorescence radiation has only the absorption band of the long wavelength side among Figure 12, and the absorption of short wavelength side is not relevant with fluorescence radiation.In other words, clearly show,, can control fluorescence radiation by exciton effect.Therefore, fluorescence radiation strengthens after hybridization, and next extremely faint at the strand state.Therefore, can clearly distinguish the state of hybridization front and back.

Embodiment 9

Synthesized the compound (DNA oligomer) that only contains a dye structure in the molecule that many variations takes place linker length n with following Chemical formula 1 14 expressions.Synthetic with above-mentioned embodiment 1-4 and 6, different is for satisfying the length of linker, change raw material 5-bromine valeric acid into compound that carbonatoms (chain length) changes, and in compound 102 synthetic, use two (2-aminoethyl) methylamines to replace three (2-aminoethyl) amine.Can be in the same way synthetic respectively n=3,4,5,6 compound.

Change 60

More specifically, synthetic according to following proposal.Though following proposal is the situation of n=4, still equally also can synthesize under the situation of other numerical value at n.

Change 61

(E)-((((2-(2 for N-methyl-N-for 2-for 3-for 5-, 2, the 2-trifluoroacetamido) ethylamino amino ethyl)))-3-oxo third-1-thiazolinyl)-2 '-(((((2-(2 for N-Methyl-N-for 2-for 3-for (E)-5-for deoxyuridine, 2,2-trifluoroacetamido) ethyl) amino) ethylamino)-3-oxoprop-1-enyl)-2 '-deoxyuridine) (102 ') is synthetic

The N-hydroxy-succinamide (molecular weight 115.09) of (E)-5-(2-carboxy vinyl)-2 '-deoxyuridine 101 (molecular weight 298.25) of 1.19g (4.0mmol) and 921mg (8.0mmol) and 1-ethyl-3-(3-dimethyl aminopropyl) carbodiimide (molecular weight 191.70) of 1.53g (8.0mmol) are added the recovery flask of having put into stirrer, the DMF that adds 1.0mL again stirred 8 hours in 25 ℃.The acetate that adds about 1mL, and methylene dichloride and the ultrapure water of 250mL, the vigorous stirring subsequently of adding 250mL.Filter the precipitation that is generated, and wash dried overnight under the reduced pressure with water.The gained white residue is suspended in the acetonitrile of 100mL and vigorous stirring.To the N-methyl-2,2 of disposable adding 2.34g (20mmol) wherein '-the diamino diethylamine (molecular weight 146.23, d=0.976), and in 25 ℃ of restir 10 minutes.After this, add 4.8mL (40mmol) Trifluoroacetic Acid Ethyl Ester (molecular weight 142.08, d=1.194), (molecular weight 101.19 d=0.726) and the ethanol of 50mL, and stirred 16 hours in 25 ℃ for the triethylamine of 5.6mL (40mmol).Underpressure distillation removes and to desolvate from the gained mixture, and with silicagel column purifying (10-20%MeOH/CH ₂Cl ₂).Underpressure distillation removes and desolvates from the fraction that contains the purpose product, makes it be dissolved in a spot of acetone, has generated white precipitate once adding ether.Carry out drying under reduced pressure after filtration, the ether washing, thereby obtained the purpose product (compound 102 ') of white powder 750mg (76%).Hereinafter show the instrumental analysis value.

Compound 102 ':

¹HNMR (CD ₃OD) δ 8.29 (s, 1H), 7.17 (d, J=15.6Hz, 1H), 6.97 (d, J=15.6Hz, 1H), 6.21 (t, J=6.3Hz, 1H), and 4.40.4.36 (m, 1H), 3.92.3.90 (m, 1H), 3.80 (dd, J=11.7,2.9Hz, 1H), 3.72 (dd, J=11.7,3.4Hz, 1H), 3.37.3.25 (m, 5H), 2.60.2.53 (m, 5H), 2.33.2.19 (m, 5H); ¹³CNMR (CD ₃OD) δ 169.2,158.7 (q, J=36.4Hz), 151.2,143.7,143.6,134.1,122.2,117.5 (q, J=286.2Hz), 111.0,89.2,87.0,72.1,62.6,57.4,56.7,42.4,41.8,38.5,38.3; C ₁₉H ₂₇F ₃N ₅O ₇([M+H] ⁺) HRMS (ESI) calculated value be 494.1863, measured value is 494.1854.

(E)-((((2-(2 for N-methyl-N-for 2-for 3-for 5-, 2, the 2-trifluoroacetamido) ethylamino amino ethyl)))-3-oxo third-1-thiazolinyl)-5 ' O-(4,4 '-dimethoxytrityl)-2 '-deoxyuridine 3 ' O-(2-cyanoethyl)-N, the N-diisopropylphosphoramidite (

(E)-((((2-(2 for N-Methyl-N-for 2-for 3-for 5-, 2,2-trifluoroacetamido) ethyl) ethylamino amino))-3-oxoprop-1-enyl)-5 ' O-(4,4 '-dimethoxytrityl)-2 '-deoxyuridine3 ' O-(2-cyanoethyl)-N, N-diisopropylphosphoramidite) (compound 104 ') is synthetic

At first, with 4 of the compound 102 ' (molecular weight 494.19) of 296mg (0.60mmol) and 224mg (0.66mmol), 4 '-dimethoxytrityl muriate (molecular weight 338.83) adds the recovery flask put into stirrer, adds the pyridine of 4mL, and stirred 2 hours in 25 ℃.The water that adds 1ml, underpressure distillation removes and desolvates, and with silicagel column purifying (1.5%MeOH and 1%Et ₃N/CH ₂Cl ₂).The fraction that will contain the triphenyl thing (intermediate of compound 104 ') of purpose compound 102 ' concentrates, and adds saturated sodium bicarbonate aqueous solution in residue.With this mixture of ethyl acetate extraction, with saturated brine washing, and the drying of pressurizeing, thereby obtain the triphenyl thing (366mg, 77%) of white blister.

¹HNMR (CD ₃OD) δ 7.94 (s, 1H), 7.42.7.17 (m, 9H), 7.01 (d, J=15.6Hz, 1H), 6.95 (d, J=15.6Hz, 1H), 6.86.6.83 (m, 4H), 6.21 (t, J=6.3Hz, 1H), 4.41.4.38 (m, 1H), 4.09.4.06 (m, 1H), 3.75 (s, 6H), 3.40.3.30 (m, 6H), 2.59 (t, J=6.8Hz, 2H), 2.53 (t, J=6.8Hz, 2H), 2.46.2.31 (m, 5H); ¹³CNMR (CD ₃OD) δ 169.2,158.7 (q, J=36.4Hz), 151.2,143.7,143.6,134.1,122.2,117.5 (q, J=286.2Hz), 111.0,89.2,87.0,72.1,62.6,57.4,56.7,42.4,41.8,38.5,38.3; C ₄₀H ₄₅F ₃N ₅O ₉([M+H ⁺) HRMS (ESI) calculated value be 796.3169, measured value is 796.3166.

The triphenyl thing (molecular weight 920.85) and 28.6mg (0.40mmol) the 1H-tetrazolium (molecular weight 70.05) of 159mg (0.20mmol) aforesaid compound 102 ' are put into round-bottomed flask, and with the vacuum pump vacuum-drying of spending the night.At this moment the CH that adds 4.0mL ₃The CN solubilising reagent stirs subsequently, and 2-cyanoethyl-N of disposable adding 191 μ L (0.60mmol), N, and N ', N '-tetra isopropyl phosphoramidite (molecular weight 301.41, d=0.949), and 25 ℃ of stirrings 2 hours.After the definite reaction end of TLC, add saturated sodium bicarbonate aqueous solution, use ethyl acetate extraction, and wash organic layer with saturated brine, use dried over mgso subsequently.After removing by filter sal epsom, underpressure distillation removes and desolvates, thereby obtains containing the crude product of purpose compound 104 '.Said composition need not purifying, and can be directly used in DNA synthetic.What in addition, the acquisition of compound 104 ' can be by the aforementioned crude product ³¹PNMR (CDCl ₃) and HRMS (ESI) determine.Hereinafter show these numerical value.

Compound 104 ':

³¹PNMR (CDCl ₃) δ 149.686,149.393; C ₄₉H ₆₁F ₃N ₇O ₁₀P ([M+H] ⁺) HRMS (ESI) calculated value be 996.4248, measured value is 996.4243.

Carry out the synthetic of DNA105 ' like that with aforementioned compound 105.Hereinafter show the instrumental analysis value.DNA105’：

CGCAAT[105 '] TAACGC, C ₁₃₃H ₁₇₄N ₅₁O ₇₆P ₁₂([M+H] ⁺) calculated value be 4074.8, measured value is 4072.0; CGCAAT[105 '] [105 '] AACGC, C ₁₄₀H ₁₈₇N ₅₄O ₇₇P ₁₂([M+H] ⁺) calculated value be 4230.0, measured value is 4228.9.

Introduce DNA 114 synthetic of thiazole orange like that with aforementioned compound 113.Hereinafter show the instrumental analysis value.

CGCAAT[114] ₍₄₎TAACGC, C ₁₅₆H ₁₉₄N ₅₃O ₇₇P ₁₂S (M ⁺) calculated value be 4447.3, measured value is 4445.6; CGCAAT[114] ₍₄₎[114] ₍₄₎AACGC, C ₁₈₆H ₂₂₈N ₅₈O ₇₉P ₁₂S ₂([M.H] ⁺) calculated value be 4976.0, measured value is 4976.9.

In synthetic DNA oligomer (ODN), for have 5 '-d (CGCAAT[114] _(n)TAACGC)-and the ODN (probe that only contains a dyestuff) of 3 ' sequence, observed the change in fluorescence situation like that with embodiment 7 and 8.Following table 2, Figure 14 and 15 illustrate its result.Figure 14 illustrates absorption spectrum (dotted line is the spectrum of strand, and solid line is the spectrum of DNA-DNA chain, and long and short dash line is the spectrum of DNA-RNA chain), and Figure 15 illustrates excitation spectrum and luminous spectrum.In Figure 15, the curve representation excitation spectrum of left side (short wavelength side), the curve representation fluorescence radiation spectrum of right side (long wavelength side).In addition, in the figure, the wavelength in the legend is represented the (λ of fluorescence of the wavelength with reference to fluorescence radiation in the excitation spectrum respectively _Max), the excitation wavelength in the fluorescence radiation spectrum.In excitation spectrum and fluorescence radiation spectrum, the luminous intensity of strand is the most weak, DNA-DNA chain strong slightly by comparison, DNA-RNA chain the strongest.As seen from the figure, compound 114 only has a dye structure in 1 molecule, can not form the H aggregate, thereby exciton effect can not occur (in absorption spectrum, not observing the displacement to short wavelength side).Therefore, compare with compound with 2 dye structures, a little less than the fluorescent quenching of strand state, the fluorescence intensity ratio I of two strands and strand _Ds/ I _SsLess relatively.But, because the dyestuff insertion makes the dye structure planarization due to double-stranded the formation, thus just as shown in table 2 below, to compare with strand, double-stranded state has obtained bigger fluorescence intensity.In addition, in strand, the excitation wavelength in the UV absorption spectrum is changed into λ from 488nm _Max(λ _MaxRefer to long wavelength side when being 2), the result obtained quantum yield Φ _F=0.120 measuring result.In addition, in the DNA-DNA two strands, the excitation wavelength in the UV absorption spectrum is changed into λ from 488nm _Max(λ _MaxRefer to long wavelength side when being 2), the result obtained quantum yield Φ _F=0.307, the fluorescence intensity ratio I of two strands and strand _Ds/ I _Ss=3.4 measurement result

Table 2

Condition determination: probe 2.5 μ M, phosphoric acid buffer 50mM (pH 7.0), NaCl 100mM, complementary strand 2.5 μ M

Embodiment 10

Employing is synthesized the compound (DNA oligomer) that only contains 1 dye structure in 1 molecule with the identical method of embodiment 9, and different is the compound that will replace with following Chemical formula 1 15 expressions as the aforesaid compound 107 of dyestuff.Making linker length n carry out many variations between 1-4 synthesizes.Sequence for identical with aforesaid compound 105 5 '-d (CGCAATXTAACGC)-3 ' (X is that dyestuff is introduced part).

Change 62

Following compound 116 is the situation of n=2.For compound 116, adopt and estimate fluorescence intensity with the identical mode of embodiment 7-9, found that compare with strand, the fluorescence intensity of DNA-RNA two strands increases to some extent.

Change 63

Fluorescence lifetime is measured

For the DNA oligomer (oligonucleotide) of embodiment 8 (2 dyestuffs) and embodiment 9 (1 dyestuff), under the situation of strand and under the situation of double-stranded DNA its fluorescence lifetime is being measured respectively.The dyestuff of measuring among the position X that contrast DNA oligomer is included in following sequence is introduced Nucleotide.

5′-d(CGCAATXTAACGC)-3′(SEQ?ID?NO.1)

5′-d(GCGTTAAATTGCG)-3′(SEQ?ID?NO.2)

Following table 3 shows the result that aforementioned fluorescence lifetime is measured.In the table, T is fluorescence lifetime (ns).CHISQ is an error at measurment.T1 represents from exciting firm end elapsed time immediately.For the probe that contains 2 dyestuffs of embodiment 8, T2 is illustrated in after the elapsed time T1 elapsed time again, and for the probe that contains 1 dyestuff of embodiment 9, T2 then represents from exciting firm end elapsed time immediately.T3 represents behind the elapsed time T2 elapsed time again.In the table, the numerical value of representing with " % " is the fluorescence decay rate during difference elapsed time T1, T2 or T3 (fluorescence intensity in the time of will exciting firm the end is used as 100%), and for each probe (DNA oligomer), total amount is 100%.As shown in table 3, the probe (embodiment 8) that contains 2 dyestuffs has extremely of short duration cancellation process (excite back 0.0210ns, the fluorescence decay rate is 81.54%) under the strand state, show to have exciton effect.Do not observe this phenomenon in other cases.In this strand state with the ODN of 2 dye markers, fluorescent quenching plays an important role in the hybridization specificity of fluorescence intensity and in rapidly changing.In addition, as shown in Table 3, the fluorescent quenching characteristic is consistent with secondary or cubic function characteristic.In addition, for the two strands that contains 2 dyestuffs in the following table 3, carried out under the same conditions once again measuring (still, omitted T1 mensuration), found that the fluorescence decay rate is 44% when T2=2.05, the fluorescence decay rate is 56% during T3=4.38, T=3.33 (ns), CHISQ=1.09 has obtained the numerical value extremely approaching with following table 3.That is, the probe of present embodiment has good reproducibility in this fluorescence lifetime is measured.

Table 3

	A dyestuff strand	A dyestuff two strands	Two dyestuff strands	Two dyestuff two strandss
	A dyestuff strand	A dyestuff two strands	Two dyestuff strands	Two dyestuff two strandss	??T1	???????_	???????_	??0.0210ns ??(81.54％)	??0.551ns ??(2.73％)
??T2	??0.934ns ??(39.19％)	??1.58ns ??(24.63％)	??1.28ns(8.99％)	??2.33ns ??(50.30％)	??T1	???????_	???????_	??0.0210ns ??(81.54％)	??0.551ns ??(2.73％)
??T2	??0.934ns ??(39.19％)	??1.58ns ??(24.63％)	??1.28ns(8.99％)	??2.33ns ??(50.30％)	??T3	??3.12ns ??(60.81％)	??3.60ns ??(75.37％)	??3.76ns(9.48％)	??4.57ns ??(46.97％)
??T	??2.26	??3.10	??0.489	??3.33	??T3	??3.12ns ??(60.81％)	??3.60ns ??(75.37％)	??3.76ns(9.48％)	??4.57ns ??(46.97％)
??T	??2.26	??3.10	??0.489	??3.33	??CHISQ	??1.32	??0.96	??1.11	??1.04

Chain 2.5 μ M

Phosphoric acid buffer 50mM (pH7.0)

NaCl?100mM

Measure at 455nm (enhancing) and 600nm (decay).

Embodiment 11

Employing is with the identical method of embodiment 8, the DNA oligomer of synthetic following Chemical formula 1 17 expressions, and different is to replace with compound shown in the following Chemical formula 1 15 ' as the aforesaid compound 107 of dyestuff.Can be in an identical manner synthetic respectively n=3,4,5,6 compound.In addition, the same with embodiment 8, used as fluorescent probe, come assess performance by fluorometric assay.Following table 4 illustrates its result.As shown in Table 4, compound 117 is compared with the DNA oligomer (compound 113) of embodiment 8 different absorption bands, but shows same good exciton effect.This shows, in the present invention, can use the different fluorescent probe of absorption band to carry out polychrome and detect.

Change 64

Change 65

Table 4

Embodiment 12

Synthesized the DNA oligomer (compound 118) that shows with following sequence table.X is the Nucleotide (following formula: be Chemical formula 1 18) that has with the same dye structure of embodiment 9.Shown in following sequence, this DNA oligomer is introduced Nucleotide with 2 dyestuffs and is arranged in together continuously.The synthetic of the introducing of dyestuff and DNA oligomer undertaken by the mode identical with aforementioned each embodiment.

5′-d(TTTTTTXXTTTTT)-3′(SEQ?ID?NO.3)

Change 66

In addition, the same with aforementioned each embodiment, this DNA oligomer is used as fluorescent probe, and by the fluorometric assay assess performance.

Probe 2.5 μ M (chain concentration)

Phosphoric acid buffer 50mM (pH7.0)

NaCl?100mM

Complementary strand 2.5 μ M (chain concentration)

Figure 16 and 17 illustrates its result.Figure 16 is the figure (dotted line is the spectrum of strand, and solid line is the spectrum of DNA-DNA chain, and long and short dash line is the spectrum of DNA-RNA chain) that absorption spectrum is shown, and Figure 17 is for illustrating the figure of excitation spectrum and fluorescence radiation spectrum in the lump.In Figure 17, left side (short wavelength side) curve representation excitation spectrum, right side (long wavelength side) curve representation fluorescence radiation spectrum.In excitation spectrum and fluorescence radiation spectrum, the luminous intensity of strand is the most weak, DNA-RNA chain strong slightly by comparison, DNA-DNA chain the strongest.As shown in the figure, even if,, thereby also can show exciton effect, can clearly distinguish the state of purpose nucleic acid hybridization front and back by this by fluorescence intensity owing to the distance between dyestuff is shortened in this way 2 dyestuffs introducing Nucleotide being arranged in a time-out continuously.

Embodiment 13

The compound (DNA oligomer) that has synthesized linker length n and nucleotide sequence generation many variations, i.e. each ODN shown in the following table 5 with aforementioned Chemical formula 1 13 or 114 expressions.In addition, " ODN " means oligo DNA (DNA oligomer) as previously mentioned.Synthesize like that with aforementioned embodiment 1-4,6,8,9 or 12, different is for satisfying the length of linker, change raw material 5-bromine valeric acid into compound that carbonatoms (chain length) changes, and in oligo DNA is synthetic the appropriate change sequence.In addition, ODN1 is identical with synthetic oligo DNA (DNA oligomer) among the embodiment 8, and ODN4 is identical with synthetic oligo DNA (DNA oligomer) among the embodiment 9 with ODN5.In synthetic, use the N-hydroxy-succinamide ester (compound 109) of active amino at 50 equivalents or the thiazole orange more than 50 equivalents.After synthetic, the developing time in reverse hplc is more than 20-30 minute or 20-30 minute as required.In addition, in following table 5, for example, [113] _(n)Perhaps [114] _(n)Be illustrated in this position and insert with Chemical formula 1 13 or 114 Nucleotide of representing, n is a linker length.In addition, in following table 5, ODN1 ' expression and ODN1 complementary DNA chain.Similarly, ODN2 ' expression and ODN2 complementary DNA chain, ODN3 ' expression and ODN3 complementary DNA chain.

Table 5

The same with aforementioned embodiment 4, measure the concentration of each ODN of synthetic by enzymic digestion.In addition, identify each ODN of synthetic by MALDI TOF mass spectrum.Hereinafter show its mass analysis value ODN1 (n=3), CGCAAT[113] ₍₃₎TAACGC, C ₁₇₈H ₂₁₃N ₅₆O ₇₈P ₁₂S ₂([M.H] ⁺) calculated value be 4820.7, measured value is 4818.9; ODN1 (n=4), CGCAAT[113] ₍₄₎TAACGC, C ₁₈₀H ₂₁₇N ₅₆O ₇₈P ₁₂S ₂([M.H] ⁺) calculated value be 4848.8, measured value is 4751.4;

ODN1 (n=5), CGCAAT[113] ₍₅₎TAACGC, C ₁₈₂H ₂₂₁N ₅₆O ₇₈P ₁₂S ₂([M.H] ⁺) calculated value be 4876.8, measured value is 4875.6;

ODN1 (n=6), CGCAAT[113] ₍₆₎TAACGC, C ₁₈₄H ₂₂₅N ₅₆O ₇₈P ₁₂S ₂(([M.H] ⁺) calculated value be 4904.9, measured value is 4903.6;

ODN2, TTTTTT[113] ₍₄₎TTTTTT, C ₁₈₄H ₂₂₇N ₃₄O ₉₂P ₁₂S ₂([M.H] ⁺) calculated value be 4822.8, measured value is 4821.4;

ODN3, TGAAGGGCTT[113] ₍₄₎TGAACTCTG, C ₂₅₁H ₃₀₅N ₈₁O ₁₂₄P ₁₉S ₂([M.H] ⁺) calculated value be 7093.2, measured value is 7092.3;

ODN(anti4.5S)，

GCCTCCT[113] ₍₄₎CAGCAAATCC[113] ₍₄₎ACCGGCGTG, C ₃₇₇H ₄₅₆N ₁₁₆O ₁₇₃P ₂₇S ₄([M.3H] ⁺) calculated value be 10344.9, measured value is 10342.7; ODN (antiB1), CCTCCCAAG[113] ₍₄₎GCTGGGAT[113] ₍₄₎AAAGGCGTG, C ₃₈₁H ₄₅₆N ₁₂₄O ₁₇₂P ₂₇S ₄([M.3H] ⁺) calculated value be 10489.0, measured value is 10489.8.

In the ODN of aforementioned table 5,, before and after hybridizing, measure its extinction spectrum, excitation spectrum and luminous spectrum respectively with complementary strand for [113] of containing sequence and linker length generation many variations ODN (ODN1, ODN2, ODN3) (n).The result is shown in following table 6, Figure 18 and Figure 19 in the lump.

Table 6

Condition determination: 2.5 μ M DNA, 50mM sodium phosphate buffer (pH=7.0), 100mM sodium-chlor

^bExcite with 488nm

^cUse λ _MaxExcite (λ _MaxWhen having two, with the λ of long wavelength side _MaxExcite)

^dDouble-stranded state and strand state are at λ _EmThe fluorescence intensity ratio at place

In addition, in table 6, the oligo DNA of ODN1 (n=3-6) and previous embodiment 8 (5 '-d (CGCAATXTAACGC)-3 ', X is that dyestuff 113 is introduced parts) identical structure arranged.But, in embodiment 8, fluorescent quantum yield Φ _FAnd the fluorescence intensity ratio (I of double-stranded state and strand state _Ds/ I _Ss) excite with wavelength 488nm and to measure, and in present embodiment (embodiment 13), as mentioned above, with the λ in the UV absorption spectrum _MaxExcite and measure.Therefore, in aforementioned table 1 (embodiment 8) and aforementioned table 6 (embodiment 13), even if the identical Φ of material _FAnd I _Ds/ I _SsAlso different.

Figure 18 contains [113] for illustrating ₍₄₎The figure of absorption spectrum, excitation spectrum and luminous spectrum of ODN.Figure (a) and (b) and (c) among each figure, left figure all represents absorption spectrum, and transverse axis is a wavelength, and the longitudinal axis is an absorbancy.Right figure all represents excitation spectrum and luminous spectrum, and transverse axis is represented wavelength, and the longitudinal axis is represented luminous intensity.To contain contain [113] in the 50mM sodium phosphate buffer (pH=7.0) of 100mM sodium-chlor ₍₄₎ODN as sample, carry out each mensuration in 25 ℃.In each figure of Figure 18, black line is represented the measurement result of strand ODN (ss), and gray line is represented the measurement result with the ODN (ds) of respective complementary chain DNA hybridization.

Figure 18 (a) illustrates the measurement result of ODN1 (n=4) (2.5 μ M).Measure excitation spectrum,, measure luminous intensity,, measure luminous intensity at wavelength 528nm place for ds at wavelength 534nm place for ss.Measure luminous spectrum, excite with wavelength 519nm, then excite with wavelength 514nm for ds for ss.

Figure 18 (b) illustrates the measurement result of ODN2.Left figure medium chain concentration is 2.5 μ M, and right figure medium chain concentration is 1 μ M.Measure excitation spectrum,, measure luminous intensity,, measure luminous intensity at wavelength 537nm place for ds at wavelength 534nm place for ss.Measure luminous spectrum, excite with wavelength 517nm, excite with wavelength 519nm for ds for ss.

Figure 18 (c) illustrates the measurement result of ODN3.Chain concentration is 2.5 μ M.Measure excitation spectrum,, measure luminous intensity,, measure luminous intensity at wavelength 530nm place for ds at wavelength 535nm place for ss.Measure luminous spectrum, excite with wavelength 518nm, excite with wavelength 516nm for ds for ss.

Figure 19 is the figure that absorption spectrum, excitation spectrum and the luminous spectrum of ODN1 (n=3,5 and 6) are shown.Figure (a) and (b) and (c) among each figure, left figure all illustrates absorption spectrum, and transverse axis is a wavelength, and the longitudinal axis is an absorbancy.Right figure all illustrates excitation spectrum and luminous spectrum, and transverse axis is a wavelength, and the longitudinal axis is a luminous intensity.The ODN1 (n=3,5 or 6) that will contain in the 50mM sodium phosphate buffer (pH=7.0) of 100mM sodium-chlor as sample, carries out each mensuration in 25 ℃.In each figure of Figure 19, black line is represented the measurement result of strand ODN (ss), and gray line is represented the measurement result with the ODN (ds) of respective complementary chain DNA hybridization.

Figure 19 (a) illustrates the measurement result of ODN1 (n=3) (2.5 μ M).Measure excitation spectrum,, measure luminous intensity,, measure luminous intensity at wavelength 529nm place for ds at wavelength 537nm place for ss.Measure luminous spectrum, excite with wavelength 521nm, excite with wavelength 511nm for ds for ss.

Figure 19 (b) illustrates the measurement result of ODN1 (n=5) (2.5 μ M).Measure excitation spectrum,, measure luminous intensity,, measure luminous intensity at wavelength 529nm place for ds at wavelength 538nm place for ss.Measure luminous spectrum, excite with wavelength 520nm, excite with wavelength 512nm for ds for ss.

Figure 19 (c) illustrates the measurement result of ODN1 (n=6).Chain concentration is 2.5 μ M.Measure excitation spectrum,, measure luminous intensity,, measure luminous intensity at wavelength 528nm place for ds at wavelength 536nm place for ss.Measure luminous spectrum, excite with wavelength 523nm, excite with wavelength 514nm for ds for ss.

As table 6, Figure 18 and shown in Figure 19, for respectively containing [113] _(n)The ODN sample, in the scope of 400-550nm, observe two absorption bands.When the ODN sample that contains 1 (n) was the strand state, (～480nm) absorption band was strong slightly, and when ODN sample that contains 1 (n) and complementary strand hybridization, and (～510nm) absorption band significantly (obviously) manifests long wavelength side for short wavelength side.(～510nm) absorption band is the monomeric typical absorption band of thiazole orange to long wavelength side.In luminous spectrum ,～the 530nm place observes single broad absorption band.Contain [113] _(n)The ODN sample by with complementary strand hybridization, obvious variation has taken place in luminous intensity.That is, with contain [113] of target DNA chain hybridization _(n)The ODN sample show strong fluorescence, and contain [113] before the hybridization _(n)ODN sample and hybridization after compare and show extremely faint fluorescence.Particularly fluorescence almost completely cancellation under the strand state of the ODN2 that forms by poly pyrimidine sequence.During the maximum emission wavelength, two heavy chains (two strands) state of ODN2 and the fluorescence intensity ratio (I of strand state _Ds/ I _Ss) reach 160.Under the situation of ODN3 ' with the ODN3 hybridization of general sequence as the ODN chain of 20 aggressiveness, luminous intensity is obviously different before and after the hybridization.In addition, by table 6, Figure 18 (a) and Figure 19 as can be known, in the ODN1 of present embodiment, with linker length under situation about changing between the 3-6, whichever linker length all can obtain big I _Ds/ I _SsValue.As mentioned above, although ODN shown in the table 6 causes cancellation performance difference to some extent because of probe sequence and linker length, whichsoever all show good cancellation performance.

In addition, as described above shown in the table 6, the melting point (T of ODN1 (n=4)/ODN1 ' _m) with natural double-stranded 5 '-CGCAATTTAACGC-3 '/ODN1 ' compares rising 7-9 ℃.This T _mValue rises and shows, 2 cationic dyestuffs in the probe combine effectively with the two strands that forms with aim sequence.In addition, from Figure 18 and 19 as can be known, the structure-irrelevant of excitation spectrum and compound, and show near the single broad peak 510nm.It is identical well together with a wavelength of absorption band to demonstrate this wavelength.Think that promptly the absorption relevant with fluorescence radiation is near the absorption band the 510nm, near the absorption band the 480nm is to luminous almost not influence.In addition, make absorption band from moving near the 510nm near the 480nm, therefore to estimate that the exciton coupling energy is 1230cm owing to assemble because of dyestuff ^-1This equates the coupling energy of being reported at the H aggregate of cyanine dye.But this class theoretic knowledge does not limit the invention.

Absorption spectrum

Under each temperature and concentration, measure the absorption spectrum of aforementioned ODN1 (n=4), determine the influence of temperature and concentration absorption band.The absorption spectrum of Figure 20 illustrates its result.Figure (a) and (b) among each figure, transverse axis is a wavelength, the longitudinal axis is an absorbancy.To contain ODN1 (n=4) in the 50mM sodium phosphate buffer (pH=7.0) of 100mM sodium-chlor as sample, carry out each mensuration.

Figure 20 (a) illustrates the absorption spectrum changing conditions when changing solution temperature.ODN concentration is 2.5 μ M.Spectrum between 10 ℃-90 ℃ with 10 ℃ of measuring spaces.

Figure 20 (b) illustrates the absorption spectrum changing conditions when changing strength of solution.Measuring temperature is 25 ℃.ODN concentration is 0.5,0.75,1.0,1.2,1.5,2.0,2.5,3.0,4.0 and 5.0 μ M.

In addition, illustration is the figure of relation of the logarithm (transverse axis) of logarithm (longitudinal axis) co-wavelength of the absorbancy when wavelength being shown the being 479nm absorbancy when being 509nm.

Shown in Figure 20 (a), change sample temperature and measure, the absorbancy that found that 2 absorption bands is than some variation slightly.That is, along with the rising of sample temperature, the absorption band of 479nm reduces gradually, and the absorption band of 509nm increases.But as seen from the figure, this variation is extremely faint.This shows that the temperature variant variation of structure of probe ODN1 of the present invention (n=4) is very faint, thereby can use and be subjected to Temperature Influence hardly.In addition, as shown in the figure,, observe the isobestic point that there are 2 spectrum integrants in indication at the 487nm place.

On the other hand, shown in Figure 20 (b), when increasing the concentration of specimens of ODN1 (n=4), the absorbancy that can be observed the both sides absorption band increases.In addition, shown in illustration, log (Abs ₄₇₉) to log (Abs ₅₀₉) figure be that the logarithmic ratio of the absorbancy of each absorption band shows as straight line.This ratio and ODN concentration that demonstrates the integrant of 2 spectrums of expression has nothing to do, and almost is constant.That is, even if change concentration in the solution, the structure of probe ODN1 of the present invention (n=4) also changes hardly, thereby can use and can not be subjected to the influence of concentration.

In addition, Figure 20 (a) and (b) reason that changes of spectrum is soluble as follows, but these explanations are examples of theoretic knowledge, rather than the present invention is made restriction.That is, at first, ODN1 (n=4) forms intramolecularly H aggregate by the dichroism system.By inference, the spectrum among Figure 20 (a) change be the structure of the H aggregate that causes because Yin Wendu rises loose slightly due to.In addition, think that the intramolecularly that is formed on of aforementioned intramolecularly H aggregate finishes, even if therefore concentration rises, caused structural changes such as molecular interaction does not almost have yet, so shown in Figure 20 (b) and illustration, the ratio of 2 spectrum integrants almost is a constant.In addition, think in the sample solution of ODN1 (n=4), have intramolecularly H aggregate and dye monomer 2 conformation models of (the dyestuff part is not assembled).The absorption band of inferring short wavelength side (479nm) comes from intramolecularly H aggregate.The absorption band of long wavelength side (509nm) can increase because of heating, therefore infers to come from dye monomer.

The CD spectrum

Measured the CD spectrum of ODN1 (n=4)/ODN1 '.Chain concentration is 2.5 μ M, in containing the 50mM sodium phosphate buffer (pH=7.0) of 100mM sodium-chlor in 25 ℃ of mensuration.The CD spectrogram of Figure 21 illustrates its measurement result.In this figure, transverse axis is wavelength (nm), and the longitudinal axis is angle θ.As shown in the figure, ODN1 (n=4)/ODN1 ' two strands shows Schizoid Cotton effect (split-Cotton effect) between 450-550nm.That is, the CD that is measured shows typical pattern when being inserted in the dna double chain at the thiazole orange dyestuff.That is, think that the dyestuff of ODN1 (n=4) partly is inserted in the formed double-stranded DNA, thereby hindered the formation of dichroism aggregate (H aggregate) widely.This CD measurement result and aforementioned T _mMeasurement result shows that together when the dyestuff part among the ODN1 (n=4) combined with double-stranded DNA, 2 dyestuff parts were all inserted in the major groove, thereby form heat-staple duplex structure.But this theoretic knowledge does not limit the invention.Formed double-stranded result has thermostability, and this shows that probe of the present invention (nucleic acid) can use effectively in the detection of complementary sequence.

Embodiment 14

At aforementioned ODN5 (CGCAAT[114] ₍₄₎[114] ₍₄₎AACGC), absorption spectrum, excitation spectrum and the luminous spectrum of double-stranded state and strand state have been measured.Following table 7 and Figure 22 illustrate its result.

Table 7

^bExcite with 488nm

^cUse λ _MaxExcite λ _MaxWhen having 2, with the λ of long wavelength side _MaxExcite)

Figure 22 promptly contains [114] for ODN5 is shown ₍₄₎The figure of absorption spectrum, excitation spectrum and luminous spectrum of ODN.The chain concentration of ODN5 is 2.5 μ M, measures in 25 ℃ in containing the 50mM sodium phosphate buffer (pH=7.0) of 100mM sodium-chlor.Black line is represented the measurement result of strand ODN5 (ss), and gray line is represented the measurement result with the ODN5 (ds) of the two strands of ODN1 ' hybridization.(a) be absorption spectrum, transverse axis is a wavelength, and the longitudinal axis is an absorbancy.(b) be excitation spectrum (curve of short wavelength side) and luminous spectrum (curve of long wavelength side), transverse axis is a wavelength, and the longitudinal axis is a luminous intensity.Measure excitation spectrum,, measure luminous intensity,, measure luminous intensity at wavelength 514nm place for ds at wavelength 534nm place for ss.Measure luminous spectrum, excite with wavelength 528nm, excite with wavelength 519nm for ds for ss.

Table 7 and shown in Figure 22 only contains together one [114] as described above ₍₄₎The luminous inhibition of the strand ODN4 of Nucleotide (table 2 of previous embodiment 9) is compared, 2 [114] ₍₄₎The sequence ODN5 that Nucleotide links together shows more efficiently fluorescent quenching.In the absorption spectrum of the ODN5 of strand state, its absorption band moves towards short wavelength side.This shows contained 2 [114] among the ODN5 ₍₄₎Nucleotide has formed intramolecularly H aggregate.Coexist and contain [113] _(n)ODN in viewed the same, this gathering has caused the cancellation of strand ODN5.That is to say, think because 2 [114] in the ODN5 ₍₄₎The H gathering has partly taken place in the dyestuff of Nucleotide, thereby the exciton coupling takes place between aforementioned dyestuff, and this is the reason place of fluorescence radiation inhibition (cancellation) just.This shows, with containing [113] _(n)ODN the same, contain 2 [114] ₍₄₎The ODN5 of Nucleotide can be used in the complementary strand detection.

Embodiment 15

Fluorescence when measuring ODN1 (n=4) with complementary ODN1 ' hybridization by naked eyes.Figure 23 shows its measurement result.In the figure, the left samples groove is for being equipped with the sample slot of ODN1 (n=4) strand, and in the figure, the right side sample slot is illustrated in the postradiation state of 150W halogen lamp respectively for the sample slot of ODN1 (n=4)/ODN1 ' two strands is housed.Chain concentration in each sample slot is 2.5 μ M, 50mM phosphoric acid buffer (sodium phosphate buffer) is housed (pH7.0) and 100mM NaCl.As shown in the figure, after 150W halogen lamp irradiation, the figure left samples groove that ODN1 (n=4) strand is housed does not almost have fluorescence radiation, and the figure right side sample slot that ODN1 (n=4)/ODN1 ' two strands be housed shows extremely tangible light green fluorescence.In addition, complementary dna chain ODN1 ' is replaced with respective complementary RNA chain and also obtained same result.In addition, in ODN2 and ODN2 ', also obtained identical result.In addition, for ODN2 and ODN2 ', ODN2 ' is replaced with respective complementary RNA (A13 aggressiveness) also obtained identical result.In addition, under these situations, chain concentration is 5 μ M.In addition, also obtained identical result for whole other ODN in the aforementioned table 6.Therefore, by the ODN of present embodiment, obvious variation takes place because of hybridization in fluorescence intensity, thereby, can simply judge by naked eyes for the target sequence that might hybridize.This shows that these ODN can be used for genetic analysis intuitively.

Embodiment 16

The same with embodiment 8, synthesized the DNA oligomer of following Chemical formula 1 20 expressions, different is to replace with the compound of following Chemical formula 1 19 expressions as the aforesaid compound 107 of dyestuff.

Change 67

Change 68

Can be with n=3,4 in the synthetic respectively above-mentioned formula 120 of same method, 5 and 6 compound (oligo DNA).In addition, use sequence 5 '-d (CGCAAT[120] ₍₅₎TAACGC)-3 ' ODN (be ODN6 (n=5)) of expression measures also assess performance of absorption spectrum and fluorescence radiation spectrum as fluorescent probe.Condition determination is with embodiment 7.Figure 24 illustrates its measurement result.Figure 24 (a) is an absorption spectrum, and transverse axis is wavelength (nm), and the longitudinal axis is an absorbancy.Figure 24 (b) is the fluorescence radiation spectrum, and transverse axis is wavelength (nm), and the longitudinal axis is a luminous intensity.Among each width of cloth figure, black line is all represented the spectrum of strand ODN, and gray line is all represented the spectrum with the double-stranded ODN of complementary ODN hybridization.Shown in Figure 24 (a), in double-stranded ODN, owing to formed duplex, thereby the maximum wavelength that near the UV the 600nm absorbs moves towards long wavelength side.In addition, shown in Figure 24 (b), in double-stranded ODN, compare with strand, its fluorescence intensity significantly increases.Therefore, think and reveal exciton effect at the strand state table.That is to say, different absorption bands is arranged, also can show good exciton effect though the ODN of present embodiment (compound 120) compares with the ODN (compound 113) of embodiment 8 and the ODN (compound 117) of embodiment 11.This shows, in the present invention, uses the different fluorescent probe of absorption band can carry out polychrome and detects.

Embodiment 17: form two strands with RNA

In cuvette, make aforementioned ODN2 (sequence 5 '-d (TTTTTT[113] ₍₄₎TTTTTT)-3 ') and complementary RNA chain correspondingly (RNA A13 aggressiveness) form double-stranded ODN, and measure the fluorescence radiation spectrum.In addition, to wherein adding RNase H, and observe the changing conditions of spectrum.Figure 25 illustrates its result.In the figure, transverse axis is the time, and the longitudinal axis is a fluorescence intensity.Among the figure, black line represents to add the spectrum changing conditions of the aforementioned double-stranded ODN of RNase H midway, and gray line represents to contrast the spectrum changing conditions of the aforementioned double-stranded ODN that does not promptly add RNaseH.In 37 ℃ of stirrings, use aforementioned spectrophotofluorometer to measure.As shown in the figure, if add RNase H, then the RNA with aforementioned ODN2 hybridization can be fallen by digestion, and aforementioned ODN2 can revert to strand, thereby fluorescence intensity reduces gradually.This fact shows that also probe of the present invention (nucleic acid) can be used for by the fluoroscopic examination complementary RNA.

Embodiment 18

Change aforementioned ODN1 (n=4) (sequence 5 '-d (CGCAAT[113] ₍₄₎TAACGC)-3 ') the concentration of complementary dna chain ODN1 ' (sequence 5 '-d (GCGTTAAATTGCG)-3 ') recently observe the changing conditions of fluorescence radiation intensity.Condition determination is 1.0 μ M for the chain concentration fixed with ODN1 (n=4), and phosphoric acid buffer is 50mM (pH7.0), and NaCl is 100mM, and excitation wavelength is 488nm (bandwidth is 1.5nm).Under being each concentration of 0,0.2,0.4,0.6,0.8,1.0,1.5,2.0 or 3.0 μ M, the concentration of complementary strand ODN1 ' measures respectively.Figure 26 illustrates its measurement result.In the figure, transverse axis is represented the equivalents with respect to the ODN1 ' of ODN1 (n=4).The longitudinal axis is represented fluorescence λ _MaxThe fluorescence radiation intensity of (529nm) locating (relative value).As shown in the figure, 1 when following, fluorescence radiation intensity presents proportional relation with respect to aforementioned equivalents with high accuracy at the equivalents of ODN1 ', yet aforementioned equivalents surpasses at 1 o'clock, does not but change.This show ODN1 (n=4) and ODN1 ' with 1: 1 amount than (molecule number than) correct hybridization.

As mentioned above, the amount of the amount of ODN1 ' (target DNA) and ODN1 (n=4) (probe) is identical or still less the time, the proportional increase of the concentration of fluorescence intensity and target DNA.That is to say, in the system that ODN1 ' (target DNA) exists,, then can come aforementioned target DNA is carried out quantitatively by fluorescent strength determining if add excessive ODN1 (n=4) (probe).In addition, by the increase and decrease situation of the aforementioned fluorescence intensity of spike, also can measure the increase and decrease situation of aforementioned target DNA.

For the aforementioned target DNA in the system is carried out quantitatively, for example as shown in Figure 26, also can make typical curve in advance.For example, the fluorescence intensity when measuring under the condition identical with present embodiment as if the sample of ODN1 ' (target DNA) concentration the unknown is 80, and so as shown in Figure 26, the concentration of aforementioned ODN1 ' (target DNA) is about 0.55 μ M.

In fact, the ODN1 ' in the nucleic acid (target DNA) sequence is carried out quantitatively, when a situation arises, also can carry out quantitatively the amount of these phenomenons in phenomenons such as the amplification that detects this target sequence immediately, decomposition and protein binding by aforesaid method.

Embodiment 19: the dot blotting analysis

In order to observe the new probe of synthetic this moment (nucleic acid), DNA is analyzed by the dot blotting that uses aforementioned ODN (antiB1) and ODN (anti4.5S) because of the changing conditions of photoluminescent property due to the hybridization.Employed target DNA sequence is the short chain dna fragmentation that contains the B1RNA sequence.This sequence is one of interior repeated nucleotide sequence of short decentralized nuclear in the rodents genome.In addition, aforementioned short chain dna fragmentation contains 4.5S RNA sequence.This sequence is for separating from one of low molecule nuclear RNA of rodents cell, and has homology widely with B1 family.In the present embodiment, by preparation trace probe ODN (antiB1) and ODN (anti4.5S), and to wherein introducing 2 [113] ₍₄₎Nucleotide can be given high susceptibility and high fluorescence intensity.In addition, the table 5 among the embodiment 13 is described as described above for the structure of ODN (antiB1) and ODN (anti4.5S).

More specifically, the dot blotting analysis of present embodiment carry out as follows.That is, at first, prepare following (1) and (2) two dna fragmentations by aforementioned automatic dna synthesizer.

(1) the following dna double chain that contains 4.5S RNA sequence and complementary DNA thereof.

5′-d(GCCGGTAGTGGTGGCGCACGCCGGTAGGATTTGCTGAAGGAGGCAGAGGCAGGAGGATCACGAGTTCGAGGCCAGCCTGGGCTACACATTTTTTT)-3′(SEQ?ID?NO.11)

(2) the following dna double chain that contains B1RNA sequence and complementary DNA thereof.

5′-d(GCCGGGCATGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAG)-3′(SEQ?ID?NO.12)

Make the sex change in the aqueous solution that contains 0.5M sodium hydroxide and 1M sodium-chlor of aforementioned dna double chain.The five equilibrium style of this denatured DNA is carried out point (spot) trace on positive charge nylon membrane (Roche society).With this positive charge nylon membrane with the aqueous solution that contains 0.5M sodium phosphate and 1M sodium-chlor wetting after, in the aqueous solution that contains 0.5M sodium phosphate, 1M sodium-chlor and 100 μ g/mL salmon sperm DNAs, hatched 30 minutes in 50 ℃.Subsequently, aforementioned positive charge nylon membrane was hatched 1 hour in 50 ℃ in the probe aqueous solution that contains 0.5M sodium phosphate and 1M sodium-chlor (probe is ODN (anti4.5S) or the ODN (antiB1) of 150pmol).After it is at room temperature cooled off, remove hybridization buffer, add new phosphoric acid buffer, and observe the fluorescence that aforementioned positive charge nylon membrane is sent by the VersaDoc imaging system (trade(brand)name) of BioRad company.Employed exciting light is that the light that oneself and the UV transilluminator Model-2270 (trade(brand)name) that grinds medicine Co., Ltd. are sent changes the light that obtains by UV/ cyan light change-over panel (UVP).

Figure 27 illustrates measurement result.

Figure 27 (a) is for illustrating on the nylon membrane the not mode chart of the state of homotactic southern blotting technique.4 points of last row represent to contain the DNA of 4.5S RNA sequence, and 4 points of following row represent to contain the DNA of B1RNA.

Figure 27 (b) is for being illustrated in the figure of the fluorescence radiation after hatching in the solution that contains ODN (anti4.5S).

Figure 27 (c) is for being illustrated in the figure of the fluorescence radiation after hatching in the solution that contains ODN (antiB1).

As shown in figure 27, the fluorescence of trace spot is after engram analysis, and need not repetitive scrubbing can at room temperature read with the fluorescence imaging device.If add ODN (anti4.5S), then the result of hatching with aforementioned probe is, it is luminous to have obtained the hyperfluorescence that the spot by the 4.5S sequence sends, and still the fluorescence radiation that is sent by the spot of B1 sequence can be ignored.By contrast, if add ODN (antiB1), then the B1 spot shows strong fluorescence, and only observes extremely faint fluorescence at the 4.5S spot.Therefore, probe of the present invention can be realized the analysis that the marking obviously different from the past is analyzed, and needn't carry out loaded down with trivial details multistep carrying out washing treatment after the marking, also need not antibody or enzyme and handles.In addition, different with on-off probe such as molecular beacon, probe of the present invention is introduced a plurality of fluorochrome label parts easily, thereby can further strengthen fluorescence intensity.This be the present invention very favourable a bit.Aforementioned fluorochrome label part also can for example be included in [113] as described in present embodiment ₍₄₎In the Nucleotide.

Embodiment 20

The poly T probe (aforementioned ODN2) that will contain the dyestuff of the linker length n=4 among the embodiment 8 by the microinjection that uses the glass microtubule is introduced cell, and measures fluorescence radiation by the inverted microscope of being furnished with mercuryvapour lamp, cooling CCD photographic camera and fluorescence filter device (being used for YFP).Figure 28～30 show its result.Photo when Figure 28 is differential interferometry, the photo when Figure 29 is Fluirescence observation, Figure 30 are the stacking diagram of Figure 28 and Figure 29.As shown in the figure, the poly A end sequence of the mRNA of performance combines and luminous in fluorescent probe of the present invention (marker) and the cell.In other words, fluorescent probe of the present invention (marker) can not only also can detect gene effectively in vivo effectively at the vitro detection gene.

Embodiment 21

In addition, by ordinary method with common fluorescence dye Cy5 and aforementioned ODN2 (sequence 5 '-d (TTTTTT[113] ₍₄₎TTTTTT)-3 ') combine, be introduced into cell by preceding method again.Herein, Cy5 in the process of synthetic aforementioned ODN2, by automatic dna synthesizer by be added to 5 of aforementioned ODN2 ' terminal and combine with it (sequence 5 '-Cy5-d (TTTTTT[113] ₍₄₎TTTTTT)-3 ').Fluorescence radiation is measured by laser scanning co-focusing microscope.Figure 31 illustrates its result.Figure 31 A illustrates with 633nm and excites fluorescence more than the 650nm that is obtained, the fluorescence that sends for Cy5.Figure 31 B illustrates the fluorescence that excites the 505-550nm that is obtained with 488nm, is 2 fluorescence that thiazole orange partly sends.As shown in the figure, ODN2 combines with the poly A end sequence of the mRNA of cell inner expression and is luminous.Therefore, the distribution of mRNA in can the spike cell.Also can in compound of the present invention or nucleic acid, introduce the dyestuff (showing epipolic atomic group) of a plurality of kinds in this way.So talk about, for example because the fluorescence λ of each dyestuff _MaxDifference can be carried out polychrome and be detected.

Embodiment 22

By preceding method with aforementioned ODN2 (sequence 5 '-d (TTTTTT[113] ₍₄₎TTTTTT)-3 ') introduce in the nucleus, injection one finishes (after 0 second) to after about 4 minutes half, with aforementioned laser scanning confocal microscope spike fluorescence radiation (488nm excites, and 505-550nm obtains fluorescence).Figure 32 illustrates its result.In the figure, be divided into 11 width of cloth figure, from left to right, and, the process after ODN2 injects be shown from being discharged to down row.In each figure, the elapsed time (ODN2 injects the back) is as shown in table 8 below.As shown in the figure, show that probe ODN2 concentrates in the nucleus immediately after injection, but when hybridizing, be dispersed in gradually in the whole cell with mRNA (poly A).By the present invention spike mRNA in this way.

[table 8]

0 second	8 seconds	38 seconds	68 seconds
0 second	8 seconds	38 seconds	68 seconds	98 seconds	128 seconds	158 seconds	188 seconds
218 seconds	248 seconds	278 seconds	????_	98 seconds	128 seconds	158 seconds	188 seconds

Embodiment 23

Having synthesized will be in aforementioned ODN2 [113] ₍₄₎The T of both sides increases to 24 ODN respectively.Be referred to as ODN7.Synthesize and equally carry out with the synthetic method of ODN2.In addition, the sequence of ODN7 be 5 '-d (TTTTTTTTTTTTTTTTTTTTTTTT[113] ₍₄₎TTTTTTTTTTTTTTTTTTTTTTTT)-3 ') (SEQ ID NO.13).Being injected in the nucleus, and measure fluorescence intensity with embodiment 22 the same methods.Figure 33 illustrates through the fluorescence photo behind the certain hour.ODN7 concentrates on after injection in the nucleus immediately, but the same with embodiment 22, when hybridizing with mRNA (poly A), is dispersed in gradually in the whole cell, finally as shown in figure 33, presents the perinuclear state that is dispersed in.

Embodiment 24: polychrome detects

As described in embodiment 11,16 etc., by changing absorbing wavelength, emission wavelength etc., fluorescent probe of the present invention can carry out the polychrome complementary strand and detect.This polychrome test example changes the structure of dyestuff (showing epipolic atomic group) part and reaches as compound 113,117 and 120 as described above.In the present embodiment, the fluorescent probe of a plurality of kinds of resynthesis (manufacturing), and carry out the polychrome complementary strand and detect.

At first, make the structure of dyestuff (showing epipolic atomic group) part that the DNA chain (probe) that the nucleotide structure that contains following formula (121) expression is synthesized in all changes take place.In the following formula (121), " Dye " expression dyestuff part.

Change 69

Particularly, synthesized the compound (DNA chain) 113,120,122,123 and 124 that " Dye " part is represented by following formula respectively in aforementioned formula (121).N is respectively linker length (carbonatoms).For compound 113,120,122,123 and 124, n=3,4,5 and 6 compound have been synthesized respectively.Synthetic method is with aforementioned embodiment 1～4,6,8,9,12,13 or 16, and different is to use the dyestuff with corresponding construction to substitute aforementioned dyestuff 107.Also can be with the synthesizing of the dyestuff that substitute aforementioned dyestuff 107 like that in synthetic (early stage embodiment 6 scheme 5) of aforementioned dyestuff 107, different is the structure of appropriate change raw material.In addition, compound 113 is identical with 120 structure with the compound 113 of aforementioned each embodiment respectively with 120.

Change 70

Change 71

Change 72

Change 73

Change 74

For above-claimed cpd 113,120,122,123 and 124, synthetic respectively usefulness sequence 5 '-d (CGCAATX _(n)TAACGC)-3 ' expression ODN.X is 113,120,122,123 or 124.N is a linker length.Sequence 5 '-d (CGCAAT[113] _(n)TAACGC)-3 ' expression ODN identical with aforementioned ODN1.Sequence 5 '-d (CGCAAT[120] _(n)TAACGC)-3 ' expression ODN identical with aforementioned ODN6.Sequence 5 '-d (CGCAAT[122] _(n)TAACGC)-3 ' expression ODN be ODN8.Sequence 5 '-d (CGCAAT[123] _(n)TAACGC)-3 ' expression ODN be ODN9.Sequence 5 '-d (CGCAAT[124] _(n)TAACGC)-3 ' expression ODN be ODN10.For ODN1, ODN6, ODN8, ODN9 and ODN10, synthetic respectively n=3,4,5 and 6 ODN.

For ODN1 (n=4), ODN6 (n=4), ODN8 (n=4), ODN9 (n=4) and ODN10 (n=4), make it form the double-stranded fluorescence radiation spectrum of measuring afterwards with complementary strand ODN1 ' respectively.Condition determination beyond the excitation wavelength is with aforementioned each embodiment.It the results are shown in following table 9.In the following table 9, E _xThe expression excitation wavelength, E _mThe maximum wavelength of expression fluorescence radiation.In addition, excitation wavelength E _xThe maximum wavelength λ of Xi Shouing no better than _Max

Table 9

As shown in Table 9, in the wide wavelength region of 456nm-654nm, each ODN shows the maximum wavelength E of different fluorescence radiations respectively when forming two strands _mThat is, use present embodiment (embodiment 24) synthetic ODN, can carry out the polychrome complementary chain dna and detect.In addition, compound (DNA chain) 113,120,122,123 and 124, ODN1, ODN6, ODN8, ODN9 and ODN10 for present embodiment, determined and equally to have used with aforementioned each embodiment, all can the polychrome mode carry out complementary strand RNA detection, dot blotting analysis, the interior mRNA detection of cell etc.

The possibility of utilizing on the industry

As from the foregoing, the invention provides effectively test example such as the double-stranded label of nucleic acid. In addition, the invention provides nucleic acid detection method and the kit that uses aforementioned tagging material. Compound of the present invention or nucleic acid, aforementioned the compounds of this invention of the present invention and nucleic acid have aforementioned formula (1), (1b), (1c), (16), (16b), (17), (17b), (18) or (18b) shown in the characteristic structure, thereby can be used as and for example effectively detect the double-stranded label of nucleic acid. Label of the present invention is very outstanding aspect the detection sensitivity of nucleic acid, thereby can be used in the extensive uses such as research usefulness, clinical usefulness, diagnosis usefulness, outer-gene detection, vivo gene detection. In addition, for the purposes of compound of the present invention and nucleic acid without limits, no matter which kind of purposes all can.

＜110〉Physical Chemistry Inst

＜120〉have compound, nucleic acid, marker and detection method and test kit by monokaryon glycosides or mononucleotide deutero-structure

<130>TF07054-01

<150>JP?07/O59921

<151>2007-03-09

<150>JP?07/246253

<151>2007-09-21

<150>JP?07/335352

<151>2007-12-26

<160>13

<170>PatentIn?version?3.1

<210>1

<211>13

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<220>

<221>misc_feature

<222>(7)..(7)

＜223〉the modified pyrimidine of n representative

<400>1

cgcaatntaa?cgc???????????????????????????????????????????????????????????13

<210>2

<211>13

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<400>2

gcgttaaatt?gcg???????????????????????????????????????????????????????????13

<210>3

<211>13

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<220>

<221>misc_feature

<222>(7)..(8)

＜223〉the modified pyrimidine of n representative

<400>3

ttttttnntt?ttt???????????????????????????????????????????????????????????13

<210>4

<211>13

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<220>

<221>misc_feature

<222>(7)..(7)

＜223〉the modified pyrimidine of n representative

<400>4

ttttttnttt?ttt???????????????????????????????????????????????????????????13

<210>5

<211>13

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<400>5

aaaaaaaaaa?aaa???????????????????????????????????????????????????????????13

<210>6

<211>20

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<220>

<221>misc_feature

<222>(11)..(11)

＜223〉the modified pyrimidine of n representative

<400>6

tgaagggctt?ntgaactctg????????????????????????????????????????????????????20

<210>7

<211>20

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<400>7

cagagttcaa?aagcccttca????????????????????????????????????????????????????20

<210>8

<211>13

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<220>

<221>misc_feature

<222>(7)..(8)

＜223〉the modified pyrimidine of n representative

<400>8

cgcaatnnaa?cgc???????????????????????????????????????????????????????????13

<210>9

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<220>

<221>misc_feature

<222>(8)..(8)

＜223〉the modified pyrimidine of n representative

<220>

<221>misc_feature

<222>(19)..(19)

＜223〉the modified pyrimidine of n representative

<400>9

gcctcctnca?gcaaatccna?ccggcgtg???????????????????????????????????????????28

<210>10

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<220>

<221>misc_feature

<222>(10)..(10)

＜223〉the modified pyrimidine of n representative

<220>

<221>misc_feature

<222>(19)..(19)

＜223〉the modified pyrimidine of n representative

<400>10

cctcccaagn?gctgggatna?aaggcgtg???????????????????????????????????????????28

<210>11

<211>95

<212>DNA

＜213〉artificial

<220>

＜223〉dna fragmentation

<400>11

gccggtagtg?gtggcgcacg?ccggtaggat?ttgctgaagg?aggcagaggc?aggaggatca????????60

cgagttcgag?gccagcctgg?gctacacatt?ttttt???????????????????????????????????95

<210>12

<211>95

<212>DNA

＜213〉artificial

<220>

＜223〉dna fragmentation

<400>12

gccgggcatg?gtggcgcacg?cctttaatcc?cagcacttgg?gaggcagagg?caggcggatt????????60

tctgagttcg?aggccagcct?ggtctacaga?gtgag???????????????????????????????????95

<210>13

<211>49

<212>DNA

＜213〉artificial

<220>

＜223〉DNA oligomer

<220>

<221>misc_feature

<222>(25)..(25)

＜223〉the modified pyrimidine of n representative

<400>13

tttttttttt?tttttttttt?ttttnttttt?tttttttttt?ttttttttt????????????????????49

Claims

1. have compound, its tautomer or steric isomer derived from the structure of monokaryon glycosides or mononucleotide, or its salt, wherein said structure is with following formula (1), (1b) or (1c) expression,

[changing 1]

In described formula (1), (1b) with (1c),

E is

The atomic group that (ii) has peptide structure or plan peptide structure,

Q exists

When E is the atomic group of aforementioned (i), be O,

When E is aforementioned (ii) atomic group, be NH,

X exists

When E is the atomic group of aforementioned (i), be hydroxyl protecting group, phosphate-based (phosplate base), bisphosphate ester group or the triphosphoric acid ester group of hydrogen atom, the enough sour deprotections of energy,

Y exists

When E is the atomic group of aforementioned (i), be hydrogen atom, hydroxyl protecting group or phosphoramidite base,

L ¹, L ²And L ³The linker (bridge formation atom or atomic group) of respectively doing for oneself, main chain long (backbone atoms number) is any, in main chain, all can contain or not contain C, N, O, S, P and Si separately, in main chain, all can contain or not contain singly-bound, two key, triple bond, amido linkage, ester bond, disulfide linkage, imido grpup, ehter bond, thioether bond and thioester bond separately

L ¹, L ²And L ³Each other can be identical or different,

B is singly-bound, two key or triple bond,

In the described formula (1b), T exists

When E is aforementioned (ii) atomic group, be NH.

2. the described compound of claim 1, its tautomer or steric isomer, or its salt, wherein in described formula (1), (1b) with (1c), E is the atomic group of backbone structure with DNA, modifying DNA, RNA, modification RNA, LNA or PNA (peptide nucleic acid(PNA)).

3. the described compound of claim 1, its tautomer or steric isomer, or its salt, wherein in described formula (1) with (1c), by

[changing 2]

The atomic group of expression is the atomic group of any expression in following formula (2)-(4),

[changing 3]

In described formula (1b), by

[changing 4]

The atomic group of expression is the atomic group of any expression in the following formula (2b)-(4b),

[changing 5]

In described formula (2)-(4) with (2b)-(4b),

A is hydrogen atom, hydroxyl, alkyl or electron withdrawing group,

B, X and Y be separately with described formula (1), (1b) or identical (1c),

4. the described compound of claim 3, its tautomer or steric isomer, or its salt, wherein in described formula (2) with (2b),

Among the A, described alkyl is a methoxyl group, and described electron withdrawing group is a halogen.

5. the described compound of claim 1, its tautomer or steric isomer, or its salt, wherein in described formula (1), (1b) or (1c),

L ¹, L ²And L ³respectively do for oneself integer more than 2 of main chain long (backbone atoms number).

6. the described compound of claim 1, its tautomer or steric isomer, or its salt, it is with following formula (5), (6), (6b) or (6c) expression,

[changing 6]

In described formula (5), (6), (6b) with (6c),

L, m and n are arbitrary value, can be identical or different,

B, E, Z ¹¹, Z ¹², X, Y and T and described formula (1), (1b) or (1c) in identical.

7. the described compound of claim 6, its tautomer or steric isomer, or its salt, wherein l, m and the n integer more than 2 of respectively doing for oneself.

8. the described compound of claim 1, its tautomer or steric isomer, or its salt, wherein Z ¹¹And Z ¹²For showing the atomic group of exciton effect.

9. the described compound of claim 1, its tautomer or steric isomer, or its salt, wherein Z ¹¹And Z ¹²Be group independently of one another derived from thiazole orange, oxazole Huang, Hua Jing, half flower cyanines, other cyanine dyes, methyl red, azoic dyestuff or derivatives thereof.

10. the described compound of claim 1, its tautomer or steric isomer, or its salt, wherein Z ¹¹And Z ¹²Be the atomic group of any expression in following formula (7)-(9) independently of one another,

[changing 7]

[changing 8]

[changing 9]

In formula (7)-(9),

X ¹And X ²Respectively do for oneself S or O can be identical or different,

N is 0 or positive integer,

R ¹¹And R ¹²In, one is with described formula (1), (1b) or the L (1c) ¹Or L ², described formula (5), (6), (6b) or (6c) in the linking group of NH bonding, another person is hydrogen atom or low alkyl group,

11. the described compound of claim 10, its tautomer or steric isomer, or its salt, wherein in formula (7)-(9),

R ¹～R ²¹In, described low alkyl group is that carbonatoms is the straight or branched alkyl of 1-6, described lower alkoxy is that carbonatoms is the straight or branched alkoxyl group of 1-6.

12. the described compound of claim 10, its tautomer or steric isomer, or its salt, wherein in formula (7)-(9),

R ¹¹And R ¹²In, described linking group is that carbonatoms is the polymethylene carbonyl more than 2, by carbonyl moiety and described formula (1), (1b) or the L (1c) ¹Or L ², described formula (5), (6), (6b) or (6c) in the NH bonding.

13. the described compound of claim 1, its tautomer or steric isomer, or its salt, it has the structure of following formula (10) expression,

[changing 10]

In formula (10),

E, Z ¹¹, Z ¹², identical in Q, X and Y and the described formula (1).

14. the described compound of claim 1, its tautomer or steric isomer, or its salt, wherein, in described formula (1), (1b) with (1c),

B is the structure that Py, Py der., Pu or Pu der. represent,

Wherein,

Described Py der. is for having one at least by N, C, S or O atom alternate atomic group in the whole atoms by the six-ring of described Py, and described N, C, S or O atom can have suitable electric charge, hydrogen atom or substituting group,

Described Pu has the atomic group that the covalent linkage of bonding partly takes place with linker for having with the covalent linkage of E bonding and at 8 at 9 in the condensed ring of following formula (12) expression,

Described Pu der. has one at least in pentacyclic whole atoms of described Pu described N, C, S or O atom can have suitable electric charge, hydrogen atom or substituting group by N, C, S or O atom alternate atomic group,

[changing 11]

15. the described compound of claim 14, its tautomer or steric isomer, or its salt, it is by following formula (13) or (14) expression,

[changing 12]

[changing 13]

In described formula (13) and (14), E, Z ¹¹, Z ¹², identical in Q, X and Y and the described formula (1), Py, Py der., Pu and Pu der. such as claim 14 definition.

16. the described compound of claim 1, its tautomer or steric isomer, or its salt, wherein said phosphoramidite base be with following formula (15) expression,

-P(OR ²²)N(R ²³)(R ²⁴)????(15)

In formula (15), R ²²Be the protecting group of phosphate, R ²³And R ²⁴Be alkyl or aryl.

17. the described compound of claim 16, its tautomer or steric isomer, or its salt, in the wherein said formula (15), R ¹⁵Be cyanoethyl, R ¹⁶And R ¹⁷In, described alkyl is a sec.-propyl, described aryl is a phenyl.

18. a nucleic acid, its tautomer or steric isomer or its salt, the structure that it contains at least one following formula (16), (16b), (17), (17b), (18) or (18b) represents,

[changing 14]

[changing 15]

[changing 16]

[changing 17]

[changing 18]

[changing 19]

In formula (16), (16b), (17), (17b), (18) with (18b), B, E, Z ¹¹, Z ¹², L ¹, L ², L ³, D and b be expressed as the structure shown in the claim 1 separately,

Wherein,

In formula (16), (17) and (18), E is the atomic group of described (i) in the claim 1, at least one O atom can be substituted by the S atom in the phosphoric acid bridging,

Formula (16b), (17b) and (18b) in, E is the described atomic group (ii) in the claim 1,

Formula (17) and (17b) in, each B can be identical or different, each E also can be identical or different.

19. the described nucleic acid of claim 18, its tautomer or steric isomer, or its salt, wherein in described formula (16), (17), (16b), (17b), (18) with (18b), Z ¹¹And Z ¹²Respectively doing for oneself shows epipolic atomic group, can be identical or different.

20. marker, one of them intramolecular two plane chemical structure but exists not in same plane at an angle, but this molecule is inserting or ditch when being bonded in the nucleic acid, described two plane chemical structures alignment arrangements in same plane, thus fluorescence radiation produced.

21. marker, form by plural dye molecule group, wherein, though because the exciton effect that the parallel gathering of plural dye molecule is produced can not show fluorescence radiation, but these molecules are inserting or ditch when being bonded in the nucleic acid, and the releasing by described state of aggregation can produce fluorescence radiation.

22. the described marker of claim 21, wherein said dye molecule are the described molecule of claim 20.

A 23. species complex marker, its with the chemical structure that has two above dye molecules at same intramolecularly as the characteristic chemical structure, wherein, though because the exciton effect that the parallel gathering of plural dye molecule is produced can not show fluorescence radiation, but these molecules are inserting or ditch when being bonded in the nucleic acid, and the releasing by described Set Status can produce fluorescence.

24. the described complex body marker of claim 23, has the structure that plural dye molecule is bonded to and should be labeled the linker molecule of nucleic acid bonding, the bonding of described dye molecule and described linker molecule by means of extra linker molecule to form apparatus derivatorius, perhaps Direct Bonding not by means of extra linker molecule.

25. the marker of claim 23, wherein said dye molecule are the described molecule of claim 20.

26. the described marker of claim 20, wherein said marker are Z ¹¹And Z ¹²Be the described compound of the claim 1 that shows epipolic atomic group, its tautomer or steric isomer or its salt or the described nucleic acid of claim 18, its tautomer or its steric isomer or its salt.

27. a marker is mark mononucleotide, labeled oligonucleotide, labeling nucleic acid or labeling nucleic acid analogue,

Wherein said marker is by described marker of claim 20 or Z ¹¹And Z ¹²Be the described compound of the claim 1 that shows epipolic atomic group, its tautomer or steric isomer or its salt or Z ¹¹And Z ¹²Be the described nucleic acid of the claim 18 that shows epipolic atomic group, its tautomer or steric isomer or its salt mark.

28. a marker is mark mononucleotide, labeled oligonucleotide, labeling nucleic acid or labeling nucleic acid analogue,

Wherein said marker by means of with mononucleotide, oligonucleotide, nucleic acid or nucleic acid analog in one or more base molecule or the main chain linker molecule that constitutes molecular linkage, by the marker or the Z of claim 20 ¹¹And Z ¹²Be the described compound of the claim 1 that shows epipolic atomic group, its tautomer or steric isomer or its salt or Z ¹¹And Z ¹²Be the described nucleic acid of the claim 18 that shows epipolic atomic group, its tautomer or steric isomer or its salt mark.

29. a marker is mark mononucleotide, labeled oligonucleotide, labeling nucleic acid or labeling nucleic acid analogue,

Wherein said marker by means of with mononucleotide, oligonucleotide, nucleic acid or nucleic acid analog in 5 carbon atoms of pyrimidine nuclear of one or more base molecule or the linker molecule of 8 carbon atom bondings of purine nuclear, by described marker of claim 20 or Z ¹¹And Z ¹²Be the described compound of the claim 1 that shows epipolic atomic group, its tautomer or steric isomer or its salt or Z ¹¹And Z ¹²Be the described nucleic acid of the claim 18 that shows epipolic atomic group, its tautomer or steric isomer or its salt mark.

30. a nucleic acid detection method may further comprise the steps:

To carry out nucleic acid as substrate synthetic for mark mononucleotide or labeled oligonucleotide--with each described marker of claim 26-29--, thus synthetic be inserted with or ditch is combined with the described double-strandednucleic acid that represents epipolic atomic group or molecular structure of dye,

---respectively measured the fluorescence intensity before and after the described double-strandednucleic acid synthesis step, and

---detect nucleic acid by the fluorescence intensity before and after the more described double-strandednucleic acid synthesis step is synthetic.

31. the described nucleic acid detection method of claim 30, described nucleic acid is synthetic to be undertaken by enzyme process.

32. a nucleic acid detection method may further comprise the steps:

Single-chain nucleic acid is as first nucleic acid--with each described marker of claim 27-29--, with its with have that to carry out nucleic acid synthetic with the described first nucleic acid complementary sequence or with second nucleic acid hybridization of the similar sequence of described complementary sequence, thereby synthetic be inserted with or ditch is combined with the described double-strandednucleic acid that shows epipolic atomic group or molecular structure of dye

---the detect hybridisation events of described first nucleic acid and described second nucleic acid by the fluorescence intensity before and after the more described double-strandednucleic acid synthesis step.

33. nucleic acid detection method, it is characterized in that using the 3rd nucleic acid to detect the formation situation of three chain nucleic acid or nucleic acid analog, described the 3rd nucleic acid have described first nucleotide sequence of claim 32, described second nucleotide sequence or with these sequence complementary sequences or with described and sequences these sequence complementary sequence similarities, and by the described marker of claim 20 or complex body marker mark or not by its mark.

34. the described method of claim 30 is wherein used to have Z ¹¹And Z ¹²Be the described compound of the claim 1 that shows epipolic atomic group, its tautomer or steric isomer or its salt or Z ¹¹And Z ¹²Labeling nucleic acid for the part of the structure of the described nucleic acid of the claim 18 that shows epipolic atomic group, its tautomer or steric isomer or its salt detects two strands or three chain nucleic acid.

35. the described method of claim 32 is wherein used to have Z ¹¹And Z ¹²Be the described compound of the claim 1 that shows epipolic atomic group, its tautomer or steric isomer or its salt or Z ¹¹And Z ¹²Labeling nucleic acid for the part of the structure of the described nucleic acid of the claim 18 that shows epipolic atomic group, its tautomer or steric isomer or its salt detects two strands or three chain nucleic acid.

36. a test kit contains nucleic acid synthesizer, marker and fluorescent strength determining device, wherein said marker is each described marker of claim 20-29.

37. the described test kit of claim 35 is used for the described method of claim 30.

38. the described test kit of claim 35 is used for the described method of claim 32.

39. the described test kit of claim 35 is used for research, clinical or diagnosis.