CN101580874B - Fluorescent quantitative PCR detection method for transcript of ROR gamma t in peripheral blood of human - Google Patents
Fluorescent quantitative PCR detection method for transcript of ROR gamma t in peripheral blood of human Download PDFInfo
- Publication number
- CN101580874B CN101580874B CN2009100302119A CN200910030211A CN101580874B CN 101580874 B CN101580874 B CN 101580874B CN 2009100302119 A CN2009100302119 A CN 2009100302119A CN 200910030211 A CN200910030211 A CN 200910030211A CN 101580874 B CN101580874 B CN 101580874B
- Authority
- CN
- China
- Prior art keywords
- quantitative pcr
- detection method
- transcript
- peripheral blood
- fluorescent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a fluorescent quantitative PCR detection method for transcript of ROR gamma t in peripheral blood of human, which is characterized by comprising the following steps: firstly, designing a specific fluorescent quantitative primer; then establishing a real-time quantitative PCR reaction system and a reaction procedure, and preparing plasmid containing target fragment ROR gamma t as standard plasmid to draw a standard curve; and finally, simultaneously amplifying a sample to be tested and the standard plasmid, and determining a copy number of a target gene of the sample according to the standard curve. The invention utilizes the characteristics of high sensitivity, strong specificity, no pollution, real-time, accuracy and quickness of the fluorescent quantitative PCR so as to fill up the blank in the aspect of detection methods of the gene and provide a practical method for researching TH17 cell differentiation.
Description
Technical field
The present invention relates to a kind of human peripheral blood single nucleus cell ROR γ t fluorescent quantitative PCR detection method for transcript.Belong to biological technical field.
Background technology
Natural CD4
+The T cell is the heterogeneous cell that comprises many subgroups.Under the effect of microenvironment, can be divided into dissimilar cell masses in vivo with different immunologic functions.Classical viewpoint thinks that it is divided into Th1 and two kinds of cell colonys of Th2 in vivo.The main secretion of gamma-IFN of Th1, IL-2, TNF-β, main mediated cell immunity.And Th2 mainly secretes TGF-β and IL-6, mediation body immunity and anti-parasitic-infectious.A new subgroup had been proposed again afterwards---regulatory T cells (Treg cell), thus this cell is regulated the Th cell in vivo and the Tc cell makes it to be in the immunologic homeostasis that body is safeguarded in running balance..Recently, Harrington etc. has found a kind of new CD4 again according to excretory cytokine difference
+T cell subsets Th17 cell.The effector of this emiocytosis mainly is IL-17.Thereafter induce out other cytokine such as IL-6, TNF-α etc., matrix metal kinases (MMP) and chemokine such as MCP-1, MIP-2, CLCL-1, CXCL5 etc. thus, cause other diseases such as autoimmune disorder, chronic inflammatory diseases, tumour etc. thereby cause inflammation.In the atomization of research Th17 cell, found the lonely nuclear receptor of its idiosyncratic transcription factor (ROR γ t), it time is the key regulatory factor of IL-17 genetic expression that this transcription factor is induced at TGF-β and IL-6 jointly.Therefore, detect this transcription factor level, can reflect IL-17 expression of gene level indirectly, thereby important clinical and scientific research meaning are arranged for studying TH17 cytodifferentiation and the effect in diseases such as autoimmune disorder, chronic inflammatory diseases, tumour thereof.
The detection method of transcription factor mainly contains two kinds with present technique means, and the first is utilized fluorescently-labeled anti-transcription factor antibody, detects from protein level through flow cytometer.Although this method high specificity, because of needing reagent and instruments such as specific antibody, flow cytometer in the operating process, the higher and complex operation of cost is so be difficult to promote.It two is to utilize polymerase chain reaction (PCR) technology to detect from gene level.Conventional PCR can only be qualitative and sensitivity is low, it is strong to pollute, and that quantitative fluorescent PCR has is highly sensitive, high specificity, characteristics such as pollution-free and real-time, quantitative, quick.But fluorescent quantitative PCR technique is had relatively high expectations to specificity, at present, does not also detect the detection method of the lonely nuclear receptor of human peripheral blood single nucleus cell (ROR γ t) real-time, quickly and accurately.
Summary of the invention
In order to fill up the lonely nuclear receptor of human peripheral blood single nucleus cell (ROR γ t) transcription factor in the blank aspect the detection method.The present invention adopt fluorescent quantitative PCR technique provide a kind of can be in real time, accurately, the detection method of the lonely nuclear receptor of rapid detection human peripheral blood single nucleus cell (ROR γ t) transcription factor.
In view of fluorescent quantitative PCR technique specificity in the testing process is had relatively high expectations, the present invention improves detection specificity through following method:
(1) utilize Oligo 6.0 and Primer primer5.0 software design many to primer, the performing PCR of going forward side by side amplification through agarose gel electrophoresis, is chosen the purpose band is single and output is maximum primer as fluorescence quantification PCR primer.
(2) optimize the PCR reaction system,, improve specificity as reducing non-specific amplification through changing methods such as primer concentration, raising annealing temperature.
(3) different according to primer dimer with goal gene Tm value, collect fluorescence according to recommendation quantitative fluorescent PCR four step rules such as tension and relaxation spaces, get rid of primer dimer detected result is disturbed, improve atopic.
The technical scheme that the present invention adopted is following:
A kind of human peripheral blood single nucleus cell ROR γ t fluorescent quantitative PCR detection method for transcript; Be: designs specificity fluorescent quantitation primer at first; Set up real-time quantitative PCR reaction system and response procedures then; Preparation contains the pulsating plasmid of purpose as standard plasmid drawing standard curve, afterwards testing sample and standard plasmid is increased simultaneously, confirms the copy number of goal gene in the sample according to typical curve.
The quantitative primer of specificity fluorescent wherein, its sequence is following:
Forward primer: 5 '-CCTGGGCTCCTCGCCTGACC-3 '
Reverse primer: 5 '-TCTCTCTGCCCTCAGCCTTGCC-3 '
Wherein the contained target gene sequences of standard plasmid is shown in SEQ.ID.NO.1.
In the detection method of the present invention; Said quantitative fluorescent PCR reaction system is made up of following component: 10 μ l, 2 * SYBRMIX, 20 μ M forward primers, each 0.2 μ l of reverse primer, 0.12 μ l Taq enzyme; 1 μ l standard plasmid or sample cDNA replenish aqua sterilisa as for 20 μ l.
In the detection method of the present invention, said PCR response procedures is 94 ℃ of 5min, 94 ℃ of 30sec, and 65 ℃ of 30sec, 72 ℃ of 30sec, 88 ℃ of 10sec collect fluorescence, 40 circulations of increasing, 72 ℃ of 7min.
The present invention utilizes fluorescent quantitative PCR technique that a kind of detection method that can detect the lonely nuclear receptor of human peripheral (ROR γ t) real-time, quickly and accurately is provided, thereby has filled up the blank of this transcription factor aspect detection method.
Description of drawings
Fig. 1 is the melt curve analysis of quantitative fluorescent PCR standard substance amplification
X-coordinate is represented melting temperature(Tm) among the figure
Ordinate zou is represented relative intensity of fluorescence among the figure
Be parallel among the figure ordinate zou straight line the temperature of corresponding X-coordinate for collecting the temperature (88 ℃) of fluorescent signal
It is 10 that curve among the figure is represented the standard substance copy number from top to bottom successively
8, 10
7, 10
6, 10
5, 10
4, 10
3Copies/ μ l reaches with the melt curve analysis of aqua sterilisa as the blank of template
Fig. 2 is the fluorescent signal figure of quantitative fluorescent PCR standard substance amplification
X-coordinate is represented cycle number among the figure
Ordinate zou is represented relative intensity of fluorescence among the figure
The straight line that is parallel to X-coordinate among the figure is represented cycle threshold
It is 10 that curve among the figure is represented the standard substance copy number from left to right successively
8, 10
7, 10
6, 10
5, 10
4, 10
3Copies/ μ l reaches with the fluorescent signal of aqua sterilisa as the blank of template
Fig. 3 is the typical curve y=-3.332log (conc)+34.521 of fluorescent quantitative PCR
X-coordinate is represented the copy number (copies/ μ l) of standard plasmid among the figure
Ordinate zou is represented cycle number among the figure
Annotate: conc is standard plasmid or sample cDNA copies/ μ l
Embodiment
Come further to set forth the present invention below in conjunction with specific embodiment, but be to be understood that these embodiment only to be used to the present invention is described and be not used in the scope of restriction requirement protection of the present invention.
Material:
Ficoll lymphocyte separation medium (Tianjin Hao ocean Bioisystech Co., Ltd); Trizol (invitrogen company); Rt test kit (ToYoBo company), SYBR GreenI Real Time PCR Kit (Hangzhou BIOER company), rTaq enzyme, dNTP, 10 * Buffer, pMD18-T (TakaRa company); Rotor Gene RG6000 quantitative real time PCR Instrument (Australian Corbett company), PMA, Inomycin (Sigma company)
Embodiment 1:
Preparation contains the typical curve of ROR γ t goal gene
1. design of primers is with synthetic
From http://www.ncbi.nlm.nig.gov/GenBank, search earlier people RORC mRNA sequence (NM001001523.1); Utilize Oligo 6.0 and Primer primer5.0 software design primer according to people RORC mRNA conserved sequence (CDS zone) for template then, therefrom selecting best primer through BLAST among the NCBI at last, to serve marine life Engineering Co., Ltd synthetic.Primer, template sequence are following:
Forward primer: 5 '-CCTGGGCTCCTCGCCTGACC-3 ' (SEQ.ID.NO.2)
Reverse primer: 5 '-TCTCTCTGCCCTCAGCCTTGCC-3 ' (SEQ.ID.NO.3)
Template (SEQ.ID.NO.1)
5’-CCTGGGCTCCTCGCCTGACCTGCCTGAGGCTTCTGCCTGTCCCCCTGGCCTCC
TGAAAGCCTCAGGCTCTGGGCCCTCATATTCCAACAACTTGGCCAAGGCAGGGC
TCAATGGGGCCTCATGCCACCTTGAATACAGCCCTGAGCGGGGCAAGGCTGAGG
GCAGAGAGA-3’
2. stimulate culturing human PMNC (PBMC)
Get peripheric venous blood 2ml behind anticoagulant heparin, the lymphocyte separation medium of personnel selection (Ficoll parting liquid) separates mononuclearcell according to the product description operation.This mononuclearcell is 1 * 10 with RPMI1640 substratum (containing final concentration is that 50ng/ml PMA and final concentration are 1 μ g/ml ionomycin) adjustment cell density
6/ ml puts into 24 orifice plates, every hole 1 * 10
6Cell count is in 5%CO
237 ℃ stimulate cultivation, collecting cell behind the 5h.
3. extract the total RNA of human peripheral blood single nucleus cell
Collect above-mentioned through stimulating the PMNC after cultivating.Add cell pyrolysis liquid Trizol, lysing cell extracts total RNA according to the Trizol specification sheets then.
4. the total RNA of rt mononuclearcell
Utilize reversed transcriptive enzyme MMLV that the total RNA rt of above-mentioned human peripheral blood single nucleus cell is become cDNA.The reverse transcription reaction system is: 4 μ l, 5 * RT Buffer, 2 μ l dNTP mixture (each 10mM), 1ul RNase Inhibitor (10U/ μ l), 1 μ l oligo (dT)
20Random primer, 1 μ l reversed transcriptive enzyme (ReverTra Ace), 1 μ g cDNA template, all the other are with Rnase Free H
2O complements to 20 μ l, 42 ℃ of 20min, 99 ℃ of 5min, 4 ℃ of 5min on the PCR appearance.
5. structure standard plasmid
1) PCR condition optimizing: in 20 μ l reaction systems, be template with aforesaid cDNA; Add dNTP, 10 * Buffer, aforementioned specificity upstream and downstream primer, rTaq enzyme and aqua sterilisa with different 30 circulations of annealing temperature amplification; Get 5 μ l products after the PCR reaction finishes and carry out electrophoresis with 2% sepharose; Last EB dyeing is observed on the gel imaging appearance.Get purpose band annealing temperature the brightest and specific band nothing but as optimum annealing temperature.
2) T-A clone: the PCR reaction conditions amplification ROR γ t gene by above-mentioned, after the PCR product is purified, mix according to a certain percentage with pMD18-T carrier (2692bp), in 16 ℃ of connection 30min, should connect product transformed competence colibacillus cell DH5 α bacterium then.According to blue hickie screening picking positive colony.Use alkaline lysis extracting plasmid then, cut evaluation, as identify the positive, then send company's order-checking through PCR and enzyme.
3) dilution standard plasmid: measure the nucleic acid concentration of the correct positive plasmid of above-mentioned order-checking, and calculate its copy number/μ l, then positive plasmid is diluted to 1 * 10 earlier
10Copies/ μ l, then by 10 times successively doubling dilution become 1 * 10
9, 1 * 10
8, 1 * 10
7, 1 * 10
6, 1 * 10
5, 1 * 10
4, 1 * 10
3Copies/ μ l.
6. formulation typical curve
As template, utilize SYBR GrrenI can be fitted to double-stranded DNA with the standard plasmid of above-mentioned dilution, the combined with fluorescent quantitative PCR appearance characteristics of fluorescence intensity is in real time formulated typical curve.The quantitative fluorescent PCR reaction system is following: each 0.2 μ l of thing (20 μ M), Taq enzyme 0.12 μ l are arrived in each the 1 μ l of standard plasmid, 10 μ l, 2 * SYBR MIX, the specificity upstream and downstream that in 20 μ l reaction systems, add dilution; All the other complement to 20 μ l with aqua sterilisa; 94 ℃ of 5min, 94 ℃ of 30sec, 65 ℃ of 30sec, 72 ℃ of 30sec, 88 ℃ of 10sec on quantitative real time PCR Instrument (collect that fluorescence--this step is the four step rule based on the fluorescence quantitative PCR detection of SYBR GrrenI; Promptly, general three-step approach increases an of short duration phosphor collection step after extending to eliminate the interference of primer dimer) to detected result; 40 circulations of increasing; 72 ℃ of 7min carry out the melt curve analysis analysis at last to confirm the specificity of PCR reaction.
The melt curve analysis figure of standard substance is referring to Fig. 1, and the fluorescent signal figure of standard substance is referring to Fig. 2, and the canonical plotting of standard substance is referring to Fig. 3.
The detection of sample PMNC ROR γ t transcript:
PMNC is prepared into cDNA by aforesaid method, carries out the PCR reaction simultaneously with standard plasmid then, confirms the copy number of ROR γ t transcript in the sample at last according to typical curve.
The detection of normal people (ND) and patients with gastric cancer (GC) PMNC ROR γ t transcript
10 routine normal peoples and 10 examples are transcribed through the patients with gastric cancer PMNC ROR of gastroscope or operation and pathology γ t
This relative expression's (with β-actin as the internal reference gene) detected result is following:
SEQUENCE?LISTING
< 110>Jiangsu University
< 120>a kind of transcript of ROR gamma t in peripheral blood of human fluorescent quantitative PCR detection method
<160>3
<210>1
<211>170
<212>DNA
< 213>people (Homo)
<400>1
cctgggctcc?tcgcctgacc?tgcctgaggc?ttctgcctgt?ccccctggcc?tcctgaaagc 60
ctcaggctct?gggccctcat?attccaacaa?cttggccaag?gcagggctca?atggggcctc 120
atgccacctt?gaatacagcc?ctgagcgggg?caaggctgag?ggcagagaga 170
<210>2
<211>20
<212>DNA
< 213>artificial sequence
<400>2
cctgggctcc?tcgcctgacc 20
<210>3
<211>22
<212>DNA
< 213>artificial sequence
<400>3
tctctctgcc?ctcagccttg?cc 22
Claims (3)
1. transcript of ROR gamma t in peripheral blood of human fluorescent quantitative PCR detection method; It is characterized in that; At first designs specificity fluorescent quantitation primer is set up real-time quantitative PCR reaction system and response procedures then, and the plasmid that preparation contains purpose segment ROR γ t is as standard plasmid drawing standard curve; Last testing sample and standard plasmid increase simultaneously, confirm the copy number of sample goal gene according to typical curve; The quantitative primer sequence of described specificity fluorescent is following:
Forward primer: 5 '-CCTGGGCTCCTCGCCTGACC-3 '
Reverse primer: 5 '-TCTCTCTGCCCTCAGCCTTGCC-3 '
The contained target gene sequences of said standard plasmid is shown in SEQ.ID.NO.1;
Described detection method is got rid of the medical diagnosis on disease purpose.
2. a kind of transcript of ROR gamma t in peripheral blood of human fluorescent quantitative PCR detection method according to claim 1; It is characterized in that; Above-mentioned quantitative fluorescent PCR reaction system is made up of following component: 10 μ l, 2 * SYBR MIX, 20 μ M forward primers, each 0.2 μ l of reverse primer, 0.12 μ l Taq enzyme; 1 μ l standard plasmid or sample cDNA replenish aqua sterilisa as for 20 μ l.
3. a kind of transcript of ROR gamma t in peripheral blood of human fluorescent quantitative PCR detection method according to claim 1 is characterized in that the PCR response procedures is 94
oC 5min, 94
oC 30sec, 65
oC 30sec, 72
oC 30 sec, 88
oC 10sec collects fluorescence, 40 circulations of increasing, 72
oC 7min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100302119A CN101580874B (en) | 2009-03-17 | 2009-03-17 | Fluorescent quantitative PCR detection method for transcript of ROR gamma t in peripheral blood of human |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100302119A CN101580874B (en) | 2009-03-17 | 2009-03-17 | Fluorescent quantitative PCR detection method for transcript of ROR gamma t in peripheral blood of human |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101580874A CN101580874A (en) | 2009-11-18 |
| CN101580874B true CN101580874B (en) | 2012-03-21 |
Family
ID=41363187
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100302119A Expired - Fee Related CN101580874B (en) | 2009-03-17 | 2009-03-17 | Fluorescent quantitative PCR detection method for transcript of ROR gamma t in peripheral blood of human |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101580874B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140235475A1 (en) * | 2011-06-27 | 2014-08-21 | Isabelle Carlavan | Th17 differentiation markers for acne and uses thereof |
| EP2846794B1 (en) * | 2012-05-08 | 2017-11-01 | Merck Sharp & Dohme Corp. | BICYCLIC SULFONE COMPOUNDS FOR INHIBITION OF RORgamma ACTIVITY AND THE TREATMENT OF DISEASE |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1410546A (en) * | 2002-11-12 | 2003-04-16 | 浙江大学医学院附属第二医院 | Real time fluorescence quantitative RT-PCR detection human alpha-fetoprotein reagent box |
-
2009
- 2009-03-17 CN CN2009100302119A patent/CN101580874B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1410546A (en) * | 2002-11-12 | 2003-04-16 | 浙江大学医学院附属第二医院 | Real time fluorescence quantitative RT-PCR detection human alpha-fetoprotein reagent box |
Non-Patent Citations (3)
| Title |
|---|
| Ivaylo I. Ivanov et al.The Orphan Nuclear Receptor RORγt Directs the Differentiation Program of Proinflammatory IL-17+ T Helper Cells.《cell》.Elsevier Inc.,2006,第126卷1121－1133. * |
| 宁章勇等.金黄地鼠Pr P 基因组织特异性表达的研究.《中国病毒学》.2005,第20卷(第2期),184-188. * |
| 张驰宇等.四步法消除SYBRGreen I实时定量RT-PCR中引物二聚体的影响.《中国生物化学与分子生物学报》.中国生物化学与分子生物学会,2004,第20卷(第3期),389－392. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101580874A (en) | 2009-11-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Venner et al. | Molecular Landscape of T Cell–Mediated Rejection in Human Kidney Transplants: Prominence of CTLA4 and PD Ligands | |
| Wu et al. | Analysis of microRNA expression profiling identifies miR-155 and miR-155* as potential diagnostic markers for active tuberculosis: a preliminary study | |
| Orlova et al. | MicroRNA modulation in complex regional pain syndrome | |
| Kurowska-Stolarska et al. | MicroRNA-34a dependent regulation of AXL controls the activation of dendritic cells in inflammatory arthritis | |
| Asare et al. | Differential gene expression profiles are dependent upon method of peripheral blood collection and RNA isolation | |
| Henriques et al. | Cytokine analysis in lesions refractory to endodontic treatment | |
| CN102181572B (en) | Mycobacterium tuberculosis nucleic acid detection kit by utilizing RNA isothermal amplification | |
| EP2909340B1 (en) | Diagnostic method for predicting response to tnf alpha inhibitor | |
| JP2013526845A (en) | Genes and combinations of genes that predict an initial response or non-response of a subject suffering from an inflammatory disease to a cytokine targeted drug (CyTD) | |
| Greenough et al. | A gene expression signature that correlates with CD8+ T cell expansion in acute EBV infection | |
| Meira-Strejevitch et al. | Ocular toxoplasmosis associated with up-regulation of miR-155-5p/miR-29c-3p and down-regulation of miR-21-5p/miR-125b-5p | |
| Lareau et al. | Latent human herpesvirus 6 is reactivated in CAR T cells | |
| CN101580874B (en) | Fluorescent quantitative PCR detection method for transcript of ROR gamma t in peripheral blood of human | |
| CN103097549A (en) | Method of determining kidney transplantation tolerance | |
| Kim et al. | Multi-omics segregate different transcriptomic impacts of anti-IL-17A blockade on type 17 T-cells and regulatory immune cells in psoriasis skin | |
| CN112730858A (en) | Diagnosis marker for rheumatic arthritis | |
| US20060115826A1 (en) | Gene expression profiling for identification monitoring and treatment of multiple sclerosis | |
| Mei et al. | CD30L+ classical monocytes play a pro-inflammatory role in the development of ulcerative colitis in patients | |
| US20210080453A1 (en) | Blood biomarker for eosinophilic gastrointestinal disorders | |
| US20110300542A1 (en) | Gene Expression Profiling For Identification, Monitoring And Treatment Of Multiple Sclerosis | |
| CN102146467A (en) | Reagent for detecting Yersinia pestis and method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis | |
| CN101538608A (en) | Method for testing fluorescent quantitative PCR of interleukin-9 transcript in a human peripheral blood mononuclear cell | |
| CA2612492A1 (en) | Gene expression profiling for identification and monitoring of multiple sclerosis | |
| EP2024514B1 (en) | Assessment of effect of an agent on a human biological condition using rodent gene expression panels | |
| CN104561257A (en) | Myasthenia gravis detection kit with non-coding RNA Tmevpg1 as detection or diagnosis screening marker and application of kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120321 Termination date: 20130317 |