CN101560521B - Constructing method of VA1-missing adenovirus vector for expressing small interfering RNA (siRNA) - Google Patents
Constructing method of VA1-missing adenovirus vector for expressing small interfering RNA (siRNA) Download PDFInfo
- Publication number
- CN101560521B CN101560521B CN2009100227599A CN200910022759A CN101560521B CN 101560521 B CN101560521 B CN 101560521B CN 2009100227599 A CN2009100227599 A CN 2009100227599A CN 200910022759 A CN200910022759 A CN 200910022759A CN 101560521 B CN101560521 B CN 101560521B
- Authority
- CN
- China
- Prior art keywords
- adenovirus
- sirna
- gene
- carrier
- expressing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a VA1-missing adenovirus vector for expressing small interfering RNA; partial genes of VA1 in the adenovirus vector are missing so that no functional VA1gene can be produced; and siRNA expression elements and report genes are inserted therein. The construction method comprises the steps as follows: a VA1-missing shuttle vector is constructed; the VA1-missing shuttle vectorand an adenovirus vector framework are homogenously recombined in E.coli BJ5183 according to mol ratio of 3:1, thereby obtaining a VA1 gene-mutated adenovirus vector framework and constructing E1-are a shuttle vector for expressing siRNA; a lentivirus vector for expressing VA1 is then constructed, a HEK293 cell is infected thereby, and a reorganized HEK293 clone for expressing VA1 gene is obtainedby hygromycin resistance screening, thus constructing the VA1-missing adenovirus vector for expressing siRNA. The invention also relates to an application of the VA1-missing adenovirus vector for exp ressing small interfering RNA in preparation of anti-tumor drugs.
Description
Technical field
The present invention relates to life science, is a kind of adenovirus system and constructing plan and application that is used to express the VA1 disappearance of siRNA.
Background technology
Applied research continuous 2 years (2001-2002) is chosen as annual 10 quantum jump technology by the U.S. " Science " magazine.At present, siRNA has been widely used in gene expression regulation, gene function and treatment of diseases research, and becomes one of research field of molecular biology hottest point.U.S.'s siRNA entered disease treatment clinical trial one, the second phase stage (as senile maculopathy, age-related macular degeneration, AMD).Estimate that siRNA also will enter the clinical trial treatment stage of other disease (as tumour, virus disease and nerve degenerative diseases etc.) very soon.In addition, in the genome times afterwards comprehensively, siRNA also will play important effect in the functional study of gene.The acquisition of siRNA at present mainly is the expression by chemosynthesis or carrier, both compare, the siRNA that carrier (especially virus vector) is expressed particularly has some unique advantages in gene functional research in treatment of diseases research, thereby gets more and more people's extensive concerning.Adenovirus carrier has been widely used in gene functional research and gene therapy at present.Adenovirus carrier is to be used for the most extensively one of carrier that siRNA is expressed at present, has important effect in therapy of tumor.VA1 is a kind of noncoding RNA that expresses in the adenovirus, can suppress jamming effectiveness (the Lu S.Cullen BR.Adenovirus VAl noncoding RNA can inhibit small interfering RNA andMicroRNA biogenesis.J Virol.2004Dec of siRNA; 78 (23): 12868-76).Therefore the adenovirus carrier of VA1 disappearance can improve the jamming effectiveness of its expressed siRNA.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of adenovirus carrier of expressing the VA1 disappearance of siRNA.
Another technical problem to be solved by this invention is to provide a kind of construction of recombinant adenovirus containing method of expressing the VA1 disappearance of siRNA.
The purposes that also has a technical problem to be to provide a kind of adenovirus carrier of the VA1 disappearance of expressing siRNA to be solved by this invention.
The technical scheme that solves the problems of the technologies described above employing is: VA1 portion gene disappearance in the recombinant adenoviral vector can not produce functional VA1 gene; SiRNA Expression element and reporter gene have been inserted.
VA1 portion gene disappearance of the present invention is 31 base sequences disappearance in the gene, and the base sequence of disappearance is:
GGCGGACGACCGGGGTTCGAGCCCCGTATCC。
SiRNA Expression element of the present invention and reporter gene are positioned at the E1 district of adenovirus carrier, by mU6 promoter expression siRNA.
Recombinant adenoviral vector of the present invention is:
1, inserts an Expression element in the E3 district.
2, between E4 district 3 ' end and fibrinous 3 ' end, insert an Expression element.
Recombinant adenoviral vector of the present invention is:
1, be the recombinant adenoviral vector that 4000～8000 polyoxyethylene glycol chemistry is modified with molecular weight.
2, the recombinant adenoviral vector of the genetic modification of adenovirus carrier capsid protein.
Expressing the construction process of the VA1 deficient adenoviral vector of siRNA is made up of following step:
1, makes up the shuttle vectors of VA1 disappearance;
2, shuttle vectors and 3: 1 in molar ratio homologous recombination acquisition VA1 transgenation carrier framework for adenovirus in E.coli BJ5183 of carrier framework for adenovirus that lacks with VA1;
3, the adenovirus E 1 district shuttle vectors of construction expression siRNA;
4, construction expression VA1 lentiviral vectors, and infect the HEK293 cell, obtain reorganization HEK 293 clones of stably express VA1 gene by the hygromycin resistance screening;
5, with the skeleton carrier of VA1 transgenation and the E1 district shuttle vectors of expressing siRNA through linearization for enzyme restriction, 1: 3 in molar ratio cotransfection HEK293 cell of recombinating, amplification, separation, purifying obtain expressing the VA1 deficient adenoviral vector of siRNA.
Said reorganization HEK293 cell is the HEK293 clone of stably express VA1 in the step 5 of the present invention.
The downstream homologous sequence of the shuttle vectors of VA1 disappearance has striden across and has been positioned at a Pme I site of 13255 on the adenovirus skeleton carrier in the step 1 of the present invention.
The adenovirus carrier of the VA1 disappearance of expression siRNA and the ligand compound of chemotherapeutic agent or biotoxin or monoclonal antibody or cell surface receptor are formed mixture.
Express the purposes of adenovirus carrier in preparation medicine for treating tumor thing of the VA1 disappearance of siRNA.
The adenovirus carrier of the VA1 disappearance of effective constituent expression siRNA prepares the medicine for treating tumor thing to be used with the form of conventional medicinal preparations.Described medicinal conventional formulation contains the adenovirus carrier as the VA1 disappearance of the expression siRNA of activeconstituents, and this activeconstituents mixes as organic or inorganic solid or the liquid excipient that is suitable for intravenous administration with pharmaceutically acceptable carrier in preparation.
Above-mentioned preparation can be made according to the common process of preparation.
Containing the weight ratio that contains the adenovirus carrier that the VA1 that expresses siRNA lacks in the medicine of adenovirus carrier treatment tumour of the VA1 disappearance of expressing siRNA is 0.1%～99.5% activeconstituents, preferably contains weight ratio and be 0.5%～90% activeconstituents.
Gene therapy is the new tool of present disease treatment.Adenovirus carrier is a gene delivery vehicle efficiently, is one of modal virus vector in the present therapy of tumor.Adopt adenovirus carrier to express siRNA and in disease treatment (as tumour or nerve degenerative diseases) and gene functional research, have important value.The adenovirus carrier of VA1 transgenation of the present invention can improve the jamming effectiveness of its expressed siRNA.Therefore examples of such carriers can be better for the effect of disease treatment and gene functional research.
The adenovirus vector construct method of VA1 transgenation of the present invention is: at first make up the shuttle vectors of VA1 disappearance, then shuttle vectors and 3: the 1 in molar ratio homologous recombination acquisition VA1 transgenation carrier framework for adenovirus in E.coli BJ5183 of carrier framework for adenovirus that lacks with VA1; The adenovirus E 1 district shuttle carrier of construction expression siRNA; Construction expression VA1 lentiviral vectors, and infect the HEK293 cell, obtain reorganization HEK 293 clones of stably express VA1 gene by the hygromycin resistance screening; With the skeleton carrier of VA1 transgenation and the E1 district shuttle vectors of expressing siRNA through linearization for enzyme restriction, 1: 3 in molar ratio cotransfection HEK293 cell of recombinating, amplification, separation, purifying obtain expressing the VA1 deficient adenoviral vector of siRNA.
Description of drawings
Fig. 1 is a 31bp disappearance synoptic diagram in the VA1 gene.
Fig. 2 is a VA1 deficient adenoviral vector skeleton synoptic diagram.
Fig. 3 is a synoptic diagram of setting up stably express VA1 gene cell system.
The expression of Fig. 4 Val in HEK 293-VA1 cell.
Fig. 5 expresses the adenovirus carrier of Val disappearance of siHec1 to the silence effect of people Hec1.
Fig. 6 expresses the adenovirus carrier of Val disappearance of siPGRN to the silence effect of people PGRN.
Embodiment
The present invention is described in more detail below in conjunction with drawings and Examples, but the invention is not restricted to these embodiment.
VA1 deficient adenoviral vector with expression siHec1 is that its construction process step of example is as follows:
1, structure contains VA1 transgenation shuttle vectors
The peGFPN1 carrier, is connected with DNA linker (AseI-PacI-XbaI-XhoI-AflII) after DNA agarose electrophoresis purifying reclaims behind AseI and AflII double digestion available from CLONTECH company.Spend the night through 14.5 ℃ of connections of T4 ligase enzyme, then transformed competence colibacillus cell DH5 α.And coat in the LB flat board of the penbritin that contains 100 μ g/ml.Picking colony is inoculated in the LB nutrient solution of penbritin of 100ug/ml, after 14-16 hour, extracts plasmid DNA through the alkaline bleach liquor cleavage method, cuts through the PacI enzyme and identifies and order-checking obtains positive colony.The positive colony called after pEAAL that is obtained thus.With the carrier framework for adenovirus is template, by design primer PCR amplification VA1 upstream region of gene fragment (515bp, 10081-10595), primer is: VA1 up forATTAATTAACTCATCGGCTGAAGCAGGGC; VA1 up back TTCTAGAGTCTAGAGCGTCAACGATTGC.With this fragment subclone in the pGEMT carrier, through enzyme cut and check order after with this upstream fragment through PacI and XbaI enzyme cutting digestion back and warp equally the pEAAL carrier cut of enzyme be connected, the carrier that is obtained is referred to as pEAALVal UPF thus.Adopt the pcr amplification that uses the same method obtain VA1 gene downstream fragment (3.2kb, 10588-13798).Used amplimer: VA1 down forCTCTAGACCGTGCAAAAGGAGAGCCTGTAAGCGGGCACTCTTCCGTGGTCTGG TGGATAAATTCGCAAGGGTATCATGGCCGTCCGCCGTGATCCAT; VA1 down back ACTCGAGGAGTTGTTTAGGTACTCCTCCTCGCCCA.Downstream fragment process subclone is in the pGEMT carrier, through enzyme cut and check order after with this downstream fragment through XbaI and XhoI enzyme cut digestion back and warp equally the pEAALVal UPF carrier cut of enzyme be connected, the carrier that is obtained is referred to as pEAALVal delta shuttle vectors thus.In above shuttle vectors, there is the disappearance of 31 bases in the VA1 gene, therefore make it to produce VA1 gene with function.The shuttle vectors that is obtained is and contains VA1 transgenation shuttle vectors thus.The disappearance that contains 31bp among the VA1, the visible Fig. 1 of the sequence of its disappearance, its deletion sequence is GGCGGACGACC GGGGTTCGAGCCCCGTATCC.13255 at the adenovirus skeleton carrier exist a PmeI site, and top described VA1 downstream fragment has striden across the about 550bp in PmeI site of skeleton carrier, thus can by PmeI with the linearizing of adenovirus skeleton carrier after with the PacI linearizing after the shuttle vectors homologous recombination of VA1 transgenation.
2, make up VA1 transgenation carrier framework for adenovirus
With linearizing VA1 transgenation shuttle carrier and the PmeI linearizing adenovirus carrier cotransformation competent cell Bj5183 of containing of PacI, bacterium liquid is coated in the LB flat board of the penbritin that contains 100 μ g/ml, after 16～24 hours, picking colony, be inoculated in the LB nutrient solution of penbritin of 100 μ g/ml, after 14～16 hours, extract plasmid DNA through the alkaline bleach liquor cleavage method.Through the enzyme evaluation positive colony of cutting and check order, the positive colony that is obtained is VA1 transgenation carrier framework for adenovirus, called after pAd5backbone Val delta carrier.The visible Fig. 2 of VA1 deficient adenoviral vector skeleton.Among Fig. 2, the black widened section is represented the VA1 gene of 31bp disappearance.
3, the adenovirus E 1 district shuttle vectors of construction expression siRNA
The siRNA fragment at people Hec1 gene that screening obtains is passed through following sequence synthesized primer thing:
P1：Xho?I：CAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG，P2：Spe?I：
CTAAAGTAGCCCCTTACTAGTCGAGGCAG?AGGCA，P3：5′TGCTGTTGACAGTGAGCGAGCCAT
TCTTGACCAGAAATTAGGAAGCCACAGATGTAATTTCTGGTCAAGAATGGCGTGCCTACTGCTCGGA?3′。
With the P3 primer is template, and P1 and P2 primer are through the hairpin structure of pcr amplification acquisition at people Hec1.The pcr amplification condition is: 94 ℃, 2 minutes, and 94 ℃, 30 seconds, 55 ℃, 30 seconds, 72 ℃, 30 seconds, 30 circulations.The PCR product is to reclaim the PCR fragment after 1.5% the agarose electrophoresis through mass concentration.The PCR fragment is cut digestion by XhoI and EcoRI enzyme, the electrophoresis purifying, intermediate carrier pMicro30 after enzyme cut PCR product fragment and cut processing with same enzyme is connected, condition of contact is: 2 μ l enzymes are cut the purifying fragment, 1 μ l 10x T4 ligase enzyme damping fluid, 1 μ l enzyme is cut carrier, 0.5 μ l T4 ligase enzyme, 5.5 μ l tri-distilled water, 16 ℃ of connections are spent the night.The high efficiency siRNA expression vector that comprise people mU6 promotor and Micro30 skeleton of pMicro30 intermediate carrier for having built.To connect the DH5 α cell of product transformed competence colibacillus then, and coat in the LB flat board of the penbritin that contains 100 μ g/ml.Picking colony is inoculated in the LB nutrient solution of the penbritin that contains 100 μ g/ml, after 14～16 hours, extracts plasmid DNA through the alkaline bleach liquor cleavage method, by the enzyme evaluation positive colony of cutting and check order.Institute is obtained positive colony called after pMicro30/siHec1.The siHec1 Expression element is gone up to get off through BglII and XbaI enzyme cutting from pMicro30/siHec1, mass concentration be behind 1.5% the agarose electrophoresis purifying be connected with the adenovirus E 1 district shuttle vectors that carries the eGFP reporter gene that the SpeI enzyme is cut processing with BamHI, condition of contact is: 2 μ l enzymes are cut the purifying fragment, 1 μ l 10x T4 ligase enzyme damping fluid, 1 μ l enzyme is cut carrier, 0.5 μ l T4 ligase enzyme, 5.5 μ l tri-distilled waters.Adopt the conversion that uses the same method, extract plasmid DNA, enzyme cuts and identifies and obtain positive colony pAd5 E1 siHec1.Thereby obtained to express the adenovirus E 1 district shuttle vectors of siRNA.
4, construction expression VA1 lentiviral vectors, and infect the HEK293 cell, obtain reorganization HEK 293 clones of stably express VA1 gene by the hygromycin resistance screening
With the adenovirus skeleton carrier is masterplate pcr amplification VA1 full-length gene, and it comprises the VaI promotor, and amplimer is: VA1 forTGG ACA TCC AGG TGA TGC CG; VA1 back AAC CGC TTA CGC TGC GCG CG.Then it is cloned in the pGEMT carrier, through the enzyme evaluation positive colony of cutting and check order, its positive colony called after pGREMT/VA1.Then with the Val gene behind BamHI and Not I double digestion, be to be connected with the lentiviral vectors of cutting through same enzyme after 1.2% agarose electrophoresis purifying reclaims through mass concentration.Condition of contact is: 2 μ l enzymes are cut the purifying fragment, 1 μ l 10x T4 ligase enzyme damping fluid, and 1 μ l enzyme is cut carrier, 0.5 μ l T4 ligase enzyme, 5.5 μ l tri-distilled waters.16 ℃ of connections are spent the night.To connect the DH5 α cell of product transformed competence colibacillus then, and coat in the LB flat board of the penbritin that contains 100 μ g/ml.Picking colony is inoculated in the LB nutrient solution of the penbritin that contains 100 μ g/ml, after 14～16 hours, extracts plasmid DNA through the alkaline bleach liquor cleavage method, by the enzyme evaluation positive colony of cutting and check order.The positive colony called after pLenti-Val-hygro carrier that obtains.This carrier contains hygromycin gene, can be used for the resistance screening of Totomycin.With pLenti-Val-hygro carrier, pCMV-VSVG and pCMV-Gag pol carrier cotransfection 293T cell, then respectively at 24,48,72 hours results slow virus supernatants, through 7400rpm, centrifugal purification obtained to express the VA1 lentiviral vectors in 12～16 hours.The lentiviral vectors of the expression VA1 gene that obtained is infected the HEK293 cell.Obtain reorganization HEK 293 clones of stably express VA1 gene then by the hygromycin resistance screening.The process that clone is set up is seen Fig. 3.
In order to detect the expression of VA1 in the clone, adopt the TRIZOL method to extract total RNA in the clone, adopt the RT-PCR method to detect the VA1 expression of gene then.The results are shown in Figure 4,1 is HEK 293 clones among Fig. 4, as negative control, shows that through the RT-PCR detection HEK 293 clones are not expressed the VA1 gene; 2 are reorganization HEK 293 clones, detect to show reorganization HEK293 expression of cell lines VA1 gene through RT-PCR.
5, with the skeleton carrier of VA1 transgenation and the E1 district shuttle vectors of expressing siRNA through linearization for enzyme restriction, the cotransfection HEK293 cell of recombinating, amplification, separation, purifying obtain expressing the VA1 deficient adenoviral vector of siRNA.
Adopt the adenovirus shuttle vector and the adenovirus skeleton cotransfection HEK 293 Val clones that through PacI linearizing VA1 lack of calcium phosphate method with the linearizing expression of PacI siHec1.After 7～10 days, as seen tangible cytopathy, pass through centrifugal results virus stock solution used then, after 2～3 virus amplification of taking turns, further the virus stock solution used that is obtained is infected the cell cultures plate of 10 150cm, be used for follow-up being further purified thereby amplification obtains the virus stock solution used of q.s.The cell of the virus that infects after centrifugal 15 minutes of 3500rpm, obtains the adenovirus carrier of VA1 disappearance of the expression siHec1 of purifying through multigelation 3 times (37 ℃/alcohol dry ice) by twice cesium chloride density gradient ultracentrifugation.Adenovirus carrier infected person Hela cell with the VA1 disappearance of the expression siHec1 that obtained after 72 hours, detects the reticent effect of the adenovirus carrier of the VA1 disappearance of expressing siHec1 to people Hec1 gene by the RT-PCR method, and detected result is seen Fig. 5.Fig. 5 adopts the TRIZOL method to extract total RNA in the clone, and the adenovirus carrier that adopts the RT-PCR method to detect the VA1 disappearance is expressed the reticent effect of siHec1 to people Hec1 gene.Among the figure, 3 for expressing the adenovirus infection people Hela clone of siHec1, as negative control, 4 is the adenovirus infection people Hela clone of expressing the Val disappearance of siHec1, detect through RT-PCR, compare control group, the expressed siHec1 of the adenovirus carrier of Val disappearance is more obvious to the reticent effect of people Hec1.
VA1 deficient adenoviral vector with expression siPGRN is that its construction process step of example is as follows:
1, construction expression is at the adenovirus E 1 district shuttle vectors of the siRNA (siPGRN) of people PGRN (Progranulin) gene
With the P3 primer is template, and P1 and P2 primer obtain as follows at the hairpin structure of people PGRN through pcr amplification:
P1：XhoI：CAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG，P2：SpeI：CTAAAGTAGCCCCTTACTAGT
CGAGGCAGAGGCA，P3：5′TGCTGTTGACAGTGAGCGAAGGGCGTCTGTTGTGCTGATCGTAGTGAAGCCACAGATGTAC
GATCAGCACAACAGACGCCCTGTGCCTACTGCCTCGGA?3′。
With the P3 primer is template, and P1 and P2 primer are through the hairpin structure of pcr amplification acquisition at people PGRN.The pcr amplification condition is: 94 ℃, 2 minutes, and 94 ℃, 30 seconds, 55 ℃, 30 seconds, 72 ℃, 30 seconds, 30 circulations.The PCR product is to reclaim the PCR fragment after 1.5% the agarose electrophoresis through mass concentration.The PCR fragment is cut digestion by XhoI and EcoRI enzyme, mass concentration is 1.5% agarose electrophoresis purifying, intermediate carrier pMicro30 after enzyme cut PCR product fragment and cut processing with same enzyme is connected, condition of contact is: 2 μ l enzymes are cut the purifying fragment, 1 μ l 10x T4 ligase enzyme damping fluid, 1 μ l enzyme is cut carrier, 0.5 μ l T4 ligase enzyme, 5.5 μ l tri-distilled water, 16 ℃ of connections are spent the night.The high efficiency siRNA expression vector that comprise people mU6 promotor and Micro30 skeleton of pMicro30 intermediate carrier for having built.To connect the DH5 α cell of product transformed competence colibacillus then, and coat in the LB flat board of the penbritin that contains 100 μ g/ml.Picking colony is inoculated in the LB nutrient solution of the penbritin that contains 100 μ g/ml, after 14-16 hour, extracts plasmid DNA through the alkaline bleach liquor cleavage method, by the enzyme evaluation positive colony of cutting and check order.Institute is obtained positive colony called after pMicro30/siPGRN.The siPGRN Expression element is gone up to get off through BglII and XbaI enzyme cutting from pMmicro30/siPGRN, be connected with the adenovirus E 1 district shuttle vectors that the SpeI enzyme is cut processing behind the electrophoresis purifying with BamHI, condition of contact is: 2 μ l enzymes are cut the purifying fragment, 1 μ l 10x T4 ligase enzyme damping fluid, 1 μ l enzyme is cut carrier, 0.5 μ l T4 ligase enzyme, 5.5 μ l tri-distilled waters.Adopt the conversion that uses the same method, extract plasmid DNA, enzyme cuts and identifies and obtain positive colony, called after pAd5 E1 siPGRN.
Other step in this step is identical with embodiment 1, has obtained to express the adenovirus E 1 district shuttle vectors of siRNA.
Other step is identical with embodiment 1, obtains expressing the VA1 deficient adenoviral vector of siPGRN.
Adenovirus carrier infected person Hela cell with the VA1 disappearance of the expression siPGRN that obtained after 72 hours, detects the reticent effect of the adenovirus carrier of the VA1 disappearance of expressing siPGRN to people PGRN gene by the RT-PCR method.Detection is dyed the result as shown in Figure 6: adopt the TRIZOL method to extract total RNA in the clone, the adenovirus carrier that adopts the RT-PCR method to detect the VA1 disappearance is then expressed the reticent effect of siPGRN to people PGRN gene.Among the figure, 5 for expressing the adenovirus infection people Hela clone of siPGRN, as negative control.The 6 adenovirus infection people Hela clones for the Val disappearance of expressing siPGRN detect through RT-PCR, compare control group, and the expressed siPGRN of the adenovirus carrier of Val disappearance is more obvious to the reticent effect of people PGRN.
With the E3 district insertion Trail gene at the adenovirus carrier of the VA1 disappearance of expressing siHec1 is that its construction process of example is as follows:
1, the adenovirus E3 district shuttle vectors of construction expression Trail
With human cDNA library is template, by design primer PCR amplification people Trail gene extracellular fragment, i.e. and aminoacid sequence 114-281, primer is Trail ClaI for:AATCGATGTGAGAGAAAGAGGTCCTCAG; Trail XbaI back:TATCTAGATTAGCCAACTAAAAAGGCC.With this fragment subclone in the pGEMT carrier, through enzyme cut and check order identify after, with positive colony through ClaI and XbaI enzyme cutting digestion back and warp equally the E3 district shuttle vectors Ad E3 that cuts of enzyme be connected, condition of contact is: 5 μ l enzymes are cut the purifying fragment, 1 μ l 10x T4 ligase enzyme damping fluid, 1 μ l enzyme is cut carrier, 0.5 μ l T4 ligase enzyme, 2.5 μ l tri-distilled water, 16 ℃ of connections are spent the night.Cut through conversion, extraction plasmid DNA, enzyme subsequently and identify that obtaining positive colony is exactly the adenovirus E3 district shuttle vectors of expressing Trail, called after pAd E3 Trail.
2, make up the adenovirus carrier that the VA1 disappearance of Trail gene is expressed in the E3 district
Adenovirus skeleton carrier with the VA1 that builds among PacI linearizing pAd E3 Trail and the SwaI linearizing embodiment 1 disappearance, cotransformation competent cell BJ5183 carries out homologous recombination, bacterium liquid is coated in the LB flat board of the penbritin that contains 100 μ g/ml, after 16～24 hours, picking colony, be inoculated in the LB nutrient solution of penbritin of 100 μ g/ml, after 14～16 hours, extract plasmid DNA through the alkaline bleach liquor cleavage method.Through the enzyme evaluation positive colony of cutting and check order, the positive colony that is obtained is the adenovirus carrier that the VA1 disappearance of Trail gene is expressed in the E3 district, called after Ad Val E3 Trail.
Other step and embodiment 1 are identical 3, make up to obtain to express the Trail gene at E3, express the adenovirus carrier that the VA1 of siHec1 lacks in E1 district.
The adenovirus carrier of expressing the VA1 disappearance of Trail gene, E4-Fiber district expression IL-24, F1 district expression siPGRN with expression E3 district is that its construction process step of example is as follows:
1, the adenovirus E4-Fiber district shuttle vectors of construction expression IL-24
With human cDNA library is template, and by design primer PCR amplification human IL-2 4 genes, primer is IL-24 ClaI For:ATCGATATGAATTTTCAACAGAGGC, IL-24 SpeI Back TACTAGTTCAGAGCTTGTAGAAT TTC.With this fragment subclone in the pGEMT carrier, through enzyme cut and check order identify after, with positive colony through ClaI and XbaI enzyme cutting digestion back and warp equally the E4-Fiber district shuttle vectors Ad E4-Fiber that cuts of enzyme be connected, cut through conversion, extraction plasmid DNA, enzyme subsequently and identify that obtaining positive colony is exactly the adenovirus E4-Fiber district shuttle vectors of expressing the IL-24 gene, called after pAd5 E4-Fiber IL-24.
2, make up the E3 district and express the Trail gene, the adenovirus skeleton carrier of the VA1 disappearance of IL-24 is expressed in the E4-Fiber district
In embodiment 3, insert the Trail gene by being binned in of E3 district shuttle vectors and skeleton carrier, also introduced a SwaI site simultaneously in the E4-Fiber interval.The adenovirus carrier Ad5ValE3Trail of Trail gene is expressed in the linearizing E3 of SwaI district and the E4-Fiber district shuttle vectors pAd E4-FiberIL-24 cotransformation competent cell BJ5183 of the linearizing expression of XhoI IL-24 gene carries out homologous recombination, bacterium liquid is coated in the LB flat board of the penbritin that contains 100 μ g/ml, after 16～24 hours, picking colony, be inoculated in the LB nutrient solution of penbritin of 100 μ g/ml, after 14～16 hours, extract plasmid DNA through the alkaline bleach liquor cleavage method.Through the enzyme evaluation positive colony of cutting and check order, the positive colony that is obtained is the E3 district and expresses the Trail gene, and the adenovirus carrier that the VA1 of IL-24 lacks, called after Ad5Val Trail-IL-24 express in E4-Fiber district.
Other step is identical with embodiment 1, makes up to obtain E3 district expression Trail gene, and the IL-24 gene is expressed in the E4-Fiber district, and the adenovirus expression carrier of the VA1 disappearance of siPGRN is expressed in the E1 district.
The adenovirus carrier of the VA1 disappearance of the expression siHec1 that modifies with RGD is that its construction process step of example is as follows:
1, makes up the shuttle vectors of the VA1 disappearance of RGD modification
This step method is with to execute example 1 identical.
2, the shuttle vectors of the VA1 disappearance of modifying with RGD and carrier framework for adenovirus 3: 1 in molar ratio homologous recombination in E.coli BJ5183 obtains the VA1 transgenation carrier framework for adenovirus of RGD modification
This step method is with to execute example 1 identical.
3, the adenovirus E 1 district shuttle vectors of construction expression siHec1
This step method is with to execute example 1 identical.
4, construction expression VA1 lentiviral vectors, and infect the HEK293 cell, obtain reorganization HEK 293 clones of stably express VA1 gene by the hygromycin resistance screening
This step method is with to execute example 1 identical.
5, the adenovirus carrier of the VA1 disappearance of the expression siHec1 of RGD modification
This step is identical with embodiment 1, express the E1 district shuttle vectors of siHec1 among adenovirus skeleton carrier Ad5 Val RGD that the VA1 that the RGD that builds is above modified lacks and the embodiment 1 and all use the PacI linearizing, adopt calcium phosphate method cotransfection reorganization HEK 293 clones.The adenovirus carrier of the VA1 disappearance of the expression siHec1 that acquisition RGD modifies, called after Ad5Val RGD siHec1.
Nucleotide sequence
The nucleotides sequence tabulation
＜110〉Shaanxi Normal University
＜120〉adenovirus carrier and the construction process and the application of the VA1 disappearance of expression siRNA
<160>4
<210>1
<211>31
<212>DNA
＜213〉adenovirus hominis
<220>
<221>misc_recomb
<400>1
ggcgg?acgac?cgggg?ttcga?gcccc?gtatc?c
1 6 11 16 21 26 31
<210>2
<211>515
<212>DNA
＜213〉adenovirus hominis
<220>
<221>misc_recomb
<400>2
ctcatcggct?gaagcagggc?taggtcggcg?acaacgcgct?cggctaatat?ggcctgctgc 60
acctgcgtga?gggtagactg?gaagtcatcc?atgtccacaa?agcggtggta?tgcgcccgtg 120
ttgatggtgt?aagtgcagtt?ggccataacg?gaccagttaa?cggtctggtg?acccggctgc 180
gagagctcgg?tgtacctgag?acgcgagtaa?gccctcgagt?caaatacgta?gtcgttgcaa 240
gtccgcacca?ggtactggta?tcccaccaaa?aagtgcggcg?gcggctggcg?gtagaggggc 300
cagcgtaggg?tggccggggc?tccgggggcg?agatcttcca?acataaggcg?atgatatccg 360
tagatgtacc?tggacatcca?ggtgatgccg?gcggcggtgg?tggaggcgcg?cggaaagtcg 420
cggacgcggt?tccagatgtt?gcgcagcggc?aaaaagtgct?ccatggtcgg?gacgctctgg 480
ccggtcaggc?gcgcgcaatc?gttgacgc
tc?tagac 515
<210>3
<211>77
<212>DNA
＜213〉adenovirus hominis
<220>
<221>misc_recomb
<400>3
ctctagaccg?tgcaaaagga?gagcctgtaa?gcgggcactc?ttccgtggtc?tggtggataa 60
attcgcaagg?gtatcat 77
<210>4
<211>3103
<212>DNA
＜213〉adenovirus hominis
<220>
<221>misc_recomb
<400>4
ggccgtccgc?cgtgatccat?gcggttaccg?cccgcgtgtc?gaacccaggt?gtgcgacgtc 60
agacaacggg?ggagtgctcc?ttttggcttc?cttccaggcg?cggcggctgc?tgcgctagct 120
tttttggcca?ctggccgcgc?gcagcgtaag?cggttaggct?ggaaagcgaa?agcattaagt 180
ggctcgctcc?ctgtagccgg?agggttattt?tccaagggtt?gagtcgcggg?acccccggtt 240
cgagtctcgg?accggccgga?ctgcggcgaa?cgggggtttg?cctccccgtc?atgcaagacc 300
ccgcttgcaa?attcctccgg?aaacagggac?gagccccttt?tttgcttttc?ccagatgcat 360
ccggtgctgc?ggcagatgcg?cccccctcct?cagcagcggc?aagagcaaga?gcagcggcag 420
acatgcaggg?caccctcccc?tcctcctacc?gcgtcaggag?gggcgacatc?cgcggttgac 480
gcggcagcag?atggtgatta?cgaacccccg?cggcgccggg?cccggcacta?cctggacttg 540
gaggagggcg?agggcctggc?gcggctagga?gcgccctctc?ctgagcggta?cccaagggtg 600
cagctgaagc?gtgatacgcg?tgaggcgtac?gtgccgcggc?agaacctgtt?tcgcgaccgc 660
gagggagagg?agcccgagga?gatgcgggat?cgaaagttcc?acgcagggcg?cgagctgcgg 720
catggcctga?atcgcgagcg?gttgctgcgc?gaggaggact?ttgagcccga?cgcgcgaacc 780
gggattagtc?ccgcgcgcgc?acacgtggcg?gccgccgacc?tggtaaccgc?atacgagcag 840
acggtgaacc?aggagattaa?ctttcaaaaa?agctttaaca?accacgtgcg?tacgcttgtg 900
gcgcgcgagg?aggtggctat?aggactgatg?catctgtggg?actttgtaag?cgcgctggag 960
caaaacccaa?atagcaagcc?gctcatggcg?cagctgttcc?ttatagtgca?gcacagcagg 1020
gacaacgagg?cattcaggga?tgcgctgcta?aacatagtag?agcccgaggg?ccgctggctg 1080
ctcgatttga?taaacatcct?gcagagcata?gtggtgcagg?agcgcagctt?gagcctggct 1140
gacaaggtgg?ccgccatcaa?ctattccatg?cttagcctgg?gcaagtttta?cgcccgcaag 1200
atatoccata?ccccttacgt?tcccatagac?aaggaggtaa?agatcgaggg?gttctacatg 1260
cgcatggcgc?tgaaggtgct?taccttgagc?gacgacctgg?gcgtttatcg?caacgagcgc 1320
atccacaagg?ccgtgagcgt?gagccggcgg?cgcgagctca?gcgaccgcga?gctgatgcac 1380
agcctgcaaa?gggccctggc?tggcacgggc?agcggcgata?gagaggccga?gtcctacttt 1440
gacgcgggcg?ctgacctgcg?ctgggcccca?agccgacgcg?ccctggaggc?agctggggcc 1500
ggacctgggc?tggcggtggc?acccgcgcgc?gctggcaacg?tcggcggcgt?ggaggaatat 1560
gacgaggacg?atgagtacga?gccagaggac?ggcgagtact?aagcggtgat?gtttctgatc 1620
agatgatgca?agacgcaacg?gacccggcgg?tgcgggcggc?gctgcagagc?cagccgtccg 1680
gccttaactc?cacggacgac?tggcgccagg?tcatggaccg?catcatgtcg?ctgactgcgc 1740
gcaatcctga?cgcgttccgg?cagcagccgc?aggccaaccg?gctctccgca?attctggaag 1800
cggtggtccc?ggcgcgcgca?aaccccacgc?acgagaaggt?gctggcgatc?gtaaacgcgc 1860
tggccgaaaa?cagggccatc?cggcccgacg?aggccggcct?ggtctacgac?gcgctgcttc 1920
agcgcgtggc?tcgttacaac?agcggcaacg?tgcagaccaa?cctggaccgg?ctggtggggg 1980
atgtgcgcga?ggccgtggcg?cagcgtgagc?gcgcgcagca?gcagggcaac?ctgggctcca 2040
tggttgcact?aaacgccttc?ctgagtacac?agcccgccaa?cgtgccgcgg?ggacaggagg 2100
actacaccaa?ctttgtgagc?gcactgcggc?taatggtgac?tgagacaccg?caaagtgagg 2160
tgtaccagtc?tgggccagac?tattttttcc?agaccagtag?acaaggcctg?cagaccgtaa 2220
acctgagcca?ggctttcaaa?aacttgcagg?ggctgtgggg?ggtgcgggct?cccacaggcg 2280
accgcgcgac?cgtgtctagc?ttgctgacgc?ccaactcgcg?cctgttgctg?ctgctaatag 2340
cgcccttcac?ggacagtggc?agcgtgtccc?gggacacata?cctaggtcac?ttgctgacac 2400
tgtaccgcga?ggccataggt?caggcgcatg?tggacgagca?tactttccag?gagattacaa 2460
gtgtcagccg?cgcgctgggg?caggaggaca?cgggcagcct?ggaggcaacc?ctaaactacc 2520
tgctgaccaa?ccggcggcag?aagatcccct?cgttgcacag?tttaaacagc?gaggaggagc 2580
gcattttgcg?ctacgtgcag?cagagcgtga?gccttaacct?gatgcgcgac?ggggtaacgc 2640
ccagcgtggc?gctggacatg?accgcgcgca?acatggaacc?gggcatgtat?gcctcaaacc 2700
ggccgtttat?caaccgccta?atggactact?tgcatcgcgc?ggccgccgtg?aaccccgagt 2760
atttcaccaa?tgccatcttg?aacccgcact?ggctaccgcc?ccctggtttc?tacaccgggg 2820
gattcgaggt?gcccgagggt?aacgatggat?tcctctggga?cgacatagac?gacagcgtgt 2880
tttccccgca?accgcagacc?ctgctagagt?tgcaacagcg?cgagcaggca?gaggcggcgc 2940
tgcgaaagga?aagcttccgc?aggccaagca?gcttgtccga?tctaggcgct?gcggccccgc 3000
ggtcagatgc?tagtagccca?tttccaagct?tgatagggtc?tcttaccagc?actcgcacca 3060
cccgcccgcg?cctgctgggc?gaggaggagt?acctaaacaa?ctc 3103
Claims (2)
1. construction process of expressing the VA1 deficient adenoviral vector of siRNA is characterized in that it is made up of following step:
(1) make up the VA1 gene shuttle vectors that contains the 31bp disappearance, the base sequence of disappearance is:
GGCGGACGACC?GGGGTTCGAGCCCCGTATCC；
(2) exist with the VA1 gene shuttle vectors that contains 31bp disappearance and adenovirus skeleton carrier 3: 1 in molar ratio
E.coliHomologous recombination obtains VA1 genetically deficient adenovirus skeleton carrier among the BJ5183;
(3) the adenovirus E 1 district shuttle vectors of construction expression siRNA;
(4) construction expression VA1 lentiviral vectors, and infect the HEK293 cell, obtain reorganization HEK 293 cells of stably express VA1 gene by the hygromycin resistance screening;
(5) with the skeleton carrier of VA1 genetically deficient adenovirus and the adenovirus E 1 district shuttle vectors of expressing siRNA through linearization for enzyme restriction, the reorganization HEK293 cell of 1: 3 in molar ratio cotransfection stably express VA1 gene, amplification, separation, purifying obtain expressing the VA1 deficient adenoviral vector of siRNA.
2. according to the construction process of the VA1 deficient adenoviral vector of the described expression siRNA of claim 1, it is characterized in that: the downstream homologous sequence that contains the VA1 gene shuttle vectors of 31bp disappearance in the said step (1) has striden across and has been positioned at a PmeI site of 13255 on the adenovirus skeleton carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100227599A CN101560521B (en) | 2009-06-01 | 2009-06-01 | Constructing method of VA1-missing adenovirus vector for expressing small interfering RNA (siRNA) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100227599A CN101560521B (en) | 2009-06-01 | 2009-06-01 | Constructing method of VA1-missing adenovirus vector for expressing small interfering RNA (siRNA) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101560521A CN101560521A (en) | 2009-10-21 |
| CN101560521B true CN101560521B (en) | 2011-05-04 |
Family
ID=41219497
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100227599A Expired - Fee Related CN101560521B (en) | 2009-06-01 | 2009-06-01 | Constructing method of VA1-missing adenovirus vector for expressing small interfering RNA (siRNA) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101560521B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102229961B (en) * | 2011-05-26 | 2014-03-12 | 陕西师范大学 | Conditionally replicating oncolytic adenoviral vector used for expressing two exogenous genes and modified by small peptide, construction method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1597966A (en) * | 2004-09-09 | 2005-03-23 | 广东省人民医院 | Expression carrier for RNA interference research |
| CN1263864C (en) * | 1993-10-25 | 2006-07-12 | 坎吉公司 | Recombinant adenoviral vector and methods of use |
-
2009
- 2009-06-01 CN CN2009100227599A patent/CN101560521B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1263864C (en) * | 1993-10-25 | 2006-07-12 | 坎吉公司 | Recombinant adenoviral vector and methods of use |
| CN1597966A (en) * | 2004-09-09 | 2005-03-23 | 广东省人民医院 | Expression carrier for RNA interference research |
Non-Patent Citations (5)
| Title |
|---|
| M. Gunnar Andersson et al..Suppression of RNA Interference by Adenovirus Virus-Associated RNA.《Journal of Virology》.American Society for Microbiology,2005,第 79 卷(第 15 期),9556-9565. * |
| Monique V. Davies et al..Complementation of adenovirus virus-associated RNA I gene deletion by expression of a mutant eukaryotic translation initiation factor.《Proc. Natl. Acad. Sci. USA》.1989,第 86 卷9163-9167. * |
| Shihua Lu and Bryan R. Cullen.Adenovirus VA1 Noncoding RNA Can Inhibit Small Interfering RNA and MicroRNA Biogenesis.《Journal of Virology》.American Society for Microbiology,2004,第 78 卷(第 23 期),12868-12876. * |
| 袁子国等.腺病毒载体的研究进展与展望.《吉林畜牧兽医》.2008,第 29 卷(第 1 期),13-14,17. * |
| 陈青等.RNA聚合酶_启动子调控RNA干扰在肿瘤治疗中的应用前景.《生物化学与生物物理进展》.2007,第 34 卷(第 8 期),806-815. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101560521A (en) | 2009-10-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110128550B (en) | Novel replicative oncolytic adenovirus capable of simultaneously blocking immune check points PD-L1 and TIGIT and application | |
| AU2023202423A1 (en) | Alphavirus neoantigen vectors | |
| Reddy et al. | Nucleotide sequence, genome organization, and transcription map of bovine adenovirus type 3 | |
| CN102770146B (en) | Monkey adenovirus and using method | |
| EP3699270A1 (en) | Isolated recombinant oncolytic adenovirus, pharmaceutical composition, and application of isolated recombinant oncolytic adenovirus in medication for treatment of tumor and/or cancer | |
| UA126848C2 (en) | Recombinant modified vaccinia virus ankara (mva) filovirus vaccine | |
| KR20220016137A (en) | modified adenovirus | |
| US11629362B2 (en) | Replicative oncolytic adenovirus for regulating lipid metabolism and use thereof | |
| KR20210090650A (en) | Alphavirus neoantigen vectors and interferon inhibitors | |
| KR20220041844A (en) | HIV antigen and MHC complex | |
| Xiao et al. | Genomic evidence of homologous recombination in spring viremia of carp virus: a negatively single stranded RNA virus | |
| CN102816793B (en) | Single carrier bidirectionally started Tet-on inducible expression system, its construction method and application | |
| KR20230046313A (en) | Multi-epitope vaccine cassette | |
| KR20230014694A (en) | Antigen-coding cassette | |
| WO2014195692A1 (en) | Avian cells for improved virus production | |
| CN101560521B (en) | Constructing method of VA1-missing adenovirus vector for expressing small interfering RNA (siRNA) | |
| Carroll et al. | Mammalian expression systems and vaccination | |
| CN102127546B (en) | Skeletal muscle specificity actin promoter and applications thereof | |
| EP1149917A2 (en) | Hepatitis B virus vectors for gene therapy | |
| CN108367064A (en) | Express the vaccine based on cytomegalovirus of Ebola virus glycoproteins | |
| CN103484462B (en) | The recombinant adenoviral vector of Survivin promoter regulation CD gene builds and application | |
| IE60285B1 (en) | Method for producing selected polypeptides in virally infected insect cells and polypeptides isolated therefrom | |
| CN102453757B (en) | Application of micro RNA and antisense nucleic acid thereof in diagnosis, prevention, treatment and/or prognosis evaluation of myocardial ischemic injury | |
| CN105879060B (en) | Tumor DNA vaccine and virus vector vaccine with fibroblast activation protein α as target spot | |
| CN105039268A (en) | Recombinant duck plague virus of expressing duck tembusu virus E protein as well as construction method and application of recombinant duck plague virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110504 Termination date: 20140601 |