CN101532029B - Method for improving plant aluminum resistance by using plant aluminum to induce expressing gene - Google Patents

Abstract

The invention provides a method for improving plant aluminum resistance by using plant aluminum to induce an expressing gene, which uses Si69 gene to improve the aluminum resistance of a plant. Proved by researches, by using the Si69 gene to transform a plant, the aluminum resistance of the plant can be remarkably improved. The method of the invention has significant meaning for the increase of plant biomass, in particular for the increase of the crops production.

Description

Utilize plant aluminum abduction delivering gene to increase the method for the anti-aluminium of plant

Technical field

The present invention relates to plant genetic engineering field, specifically, relate to the method that a kind of sharp plant aluminum abduction delivering gene (Si69) increases the anti-aluminium of plant.

Background technology

Aluminium is the maximum metallic element of nature content, takes up an area of 7% of shell total mass.Wherein most of in soil the form with aluminum oxide, silicated aluminum exist, the growth of plant is become injury inadequately.After soil solution acidifying (pH＜5), aluminium will discharge from oxide compound or silicate, is dissolved in the soil, mainly with Al ³⁺Form exists.Al ³⁺The maximum of coercing to plant, even lower concentration (μ mol/L) aluminum ion just can produce toxic effect [Horst etal.Effect of aluminum on root growth to plant under acidic conditions, cell-division rate and mineralelement contents in roots of Vigna unguiculata genotypes.ZPflanzenphysiol, 1983,109:95-103; Kinraide and Parker, Assessing thephytotoxicity of mononuclear hydroxyl-aluminum.Plant cell Environ, 1989,12:479-487].The obvious characteristics of aluminium poison is to suppress the growth of root, cause difficulty [the Kochina LV of plant to moisture and dietetic alimentation, Cellular mechanisms of aluminumtoxicity and resistance in plants.Annu Rev Plant Physiol Plant Mol Biol, 1995,46:237-260; Clarkson, Clarkson DT.The effect of aluminum andsome other trivalent metal cations on cell division in the root apices ofAllium cepa.Ann Bot, 1965,29:309-315].

The investigator has done a large amount of research to aluminium inducing plant resistance expression of gene.Richard and Snowden[Richards KD et al.Wali6 and Wali7.Plant physiol 1994,105:1455-1456; Snowden KC and Gardner RC.Five genes induced byaluminum in wheat (Triticum aestivum L.) roots.Plant Physiol, 1993,103:855-861] from the aluminium sensitive wheat, separate and obtained 7 aluminium induced genes, name wali gene (for wheat aluminum induced).The albumen of these genes encodings respectively with plant metalloid sulfoprotein (wali1), phenylalanine ammonia lyase (wali4), proteinase inhibitor (wali3, wali5 and wali6) and glutamine synthetase (wali7) have homology.Also have tens aluminium inductive genes to be separated in addition, comprise the range gene in wheat, Arabidopis thaliana and the tobacco.

In order to study the mechanism of the anti-aluminium of plant, people have utilized transgenic technology.(1997) such as De laFuente are with citrate synthase gene (CS) overexpression in tobacco of bacterium (Pseudomonas aeniginosa), the anti-aluminium ability of transgene tobacco strengthens as a result, this is human trial [the de la FuenteJM et al.Aluminum tolerance in transgenic plants by alteration of citratesynthesis.Science that adopts transgenic technology to improve the anti-aluminium characteristic of plant first, 1997,276:1566-1568].Anoop etc. (2003) import the plastosome Oxalacetic transacetase CS gene of Arabidopis thaliana in the rape and obtain overexpression, CS is active in the transfer-gen plant as a result improves, the anti-aluminium ability of plant increases [Anoop VM et al.Modulation of citrate metabolism alter aluminum tolerance in yeast andtransgenic canola of overexpressing a mitochondrial citrate synthase.Plant Physiol, 2003,132:2205-2217].Delhaize etc. (2004) are with wheat tip of a root oxysuccinic acid excretory transporter gene ALMT1 heterogenous expression in barley, its oxysuccinic acid excretory ability of barley strain and the anti-aluminium ability of changeing the ALMT1 gene [the Delhaize E et al.Engineering high-level aluminum tolerance in barleywith the ALMT1 gene.Plant Biol that all is significantly increased, 2004,101:15249-15254].CDNA is referred to as the Si69 gene, and it comes from the cDNA library of millet immature seed, and this cDNA is relevant with the anti-aluminium of plant,

Summary of the invention

The object of the invention provides a kind ofly utilizes plant to be subjected to aluminium inductive gene to improve the method for the anti-aluminium of plant.

The present invention screens from millet (Setaria italica Beauv.Var.3661,3662) immature seed cDNA library and obtains a cDNA clone, is referred to as the Si69 gene.The sequence length of this cDNA is 1061bp, is the double-strandednucleic acid type, linearity, and its nucleotide sequence is shown in SEQID No.1.Retrieval by three big databases, find that Si69 cDNA proteins encoded and paddy rice (NP_001051238AAP12992), Arabidopis thaliana (NP_188925NP_199196), little salt mustard (AAM19711) and wheat (AAC37416.1) homology are respectively: 84%, 58%, 50%, 50%.They all have common characteristics: there is a conservative wali7 structural domain in the protein structure, but Unknown Function.The Southern trace studies show that this gene exists with single copy in the millet genome.Northern engram analysis Si69 expression of gene pattern shows that it all can detect the existence of its transcription product in tissues such as millet millet seedling, root, stem, leaf, young fringe and immature seed.RT-PCR and fluorescence quantitative PCR research show that the Si69 expression of gene is subjected to inducing of aluminium.

Further, the present invention makes up the expression vector that contains Si69, and it is transformed plant, in order to investigate the anti-aluminium of transgenic plant.

In embodiment of the present invention, made up the Arabidopis thaliana expression vector that contains Si69cDNA, its expression cassette is to constitute by the cauliflower mosaic virus 35S promoter with from 3 Transcription Terminations of rouge alkali synthetase (no) gene are regional, and selectable marker gene is neomycin phosphotransferase II (NPTII).Described expression vector is recombinant plasmid pBI121-Si69 preferably, and wherein the Si69cDNA forward inserts and under 35S promoter drives.

The present invention transforms plant with the above-mentioned recombinant expression vector that contains described Si69cDNA, as Arabidopis thaliana, has obtained the transgenic plant of anti-aluminium raising.

In embodiment of the present invention, will contain the expression vector arabidopsis thaliana transformation of described cDNA, the anti-aluminium raising of the plant of acquisition, root elongation are subjected to aluminium to suppress to weaken.

The present invention has found with plant and has been subjected to aluminium inductive cDNA (being called the Si69 gene), and described gene transformation can be made the anti-aluminium increase of plant in plant.Utilize the inventive method, can significantly improve the anti-aluminium of plant, thereby particularly increasing crop yield is significant to the increase of phytomass.

Description of drawings

Fig. 1 shows is Si69cDNA sequence from millet, and deduced amino acid.

What Fig. 2 showed is the Arabidopis thaliana expression vector establishment procedure chart that contains Si69cDNA.

What Fig. 3 showed is that T3 is hybridized for transgenic arabidopsis Western.

What Fig. 4 showed is the quiet colored graph of Arabidopis thaliana root bush, wherein the picture left above and top right plot are respectively wild-type and the colored graph of transfer-gen plant under 20 μ M A1 handle, and lower-left figure and bottom-right graph are respectively wild-type and the colored graph (100 μ m scale) of transfer-gen plant under 50 μ M A1 handle;

What Fig. 5 showed is Arabidopis thaliana tip of a root sem photograph (magnification upper strata: * 1.00K30 μ m scale; Lower floor: * 2.50K 12.0 μ m scales)

The transgenic arabidopsis that Fig. 6 shows and elongation of the tip of a root of wild-type and MDA content situation.

Embodiment

Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.

If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.

The clone that embodiment 1 plant is subjected to aluminium induced gene Si69

Choose 5,7 and 12 days the immature seed in millet pollination back, after the material mixing, extract total RNA, paramagnetic particle method enrichment mRNA (Promega), adopt the synthetic cDNA of the Stratagene cDNASynthesis Kit of company reverse transcription, double-stranded cDNA connects EcoRIadapter after mending and putting down, it is built up on the λ ZAPII carrier, use ZAP-cDNA Gigapack IIIGold Cloning Kit (Stratagene company) to carry out external packing.After packing finishes, add SM solution and chloroform, centrifugal after, supernatant is the library that builds.Get 1 μ l library supernatant liquor and carry out titer determination, the result shows that the library capacity of structure is 2 * 10 ⁷Pfu/ml.After original library construction was finished, it was once standby to increase.

Utilize yeast two-hybrid (Clontech company) screening cDNA expression library, technology is a known technology, after screening, obtains positive colony.Carry out the sequence order-checking, sequencing result is referred to as Si69 shown in SEQ ID No.1.

The clone that embodiment 2 plants are subjected to aluminium induced gene Si69

1, the extraction of the total RNA of plant tissue

(1) with behind 4ml phenol and the 8ml RNA extraction damping fluid mixing, is placed on 65 ℃ of water-bath preheatings;

(2) get the about 5g of millet blade, add liquid nitrogen and a small amount of quartz sand, abundant grind into powder in the mortar, the 50ml centrifuge tube of packing into;

(3) the extraction mixed solution adding with preheating contains in the centrifuge tube of vegetable material powder, with the abundant mixing of vegetable material, and room temperature extracting 10min; Add the 4ml chloroform again, continue extracting 10min;

(4) under the room temperature condition 12, the centrifugal 20min of 000rpm; Draw supernatant liquor, extracting is once again to add the equal-volume chloroform;

(5) under the room temperature condition 12, the centrifugal 20min of 000rpm; Draw supernatant liquor, add the 8mol/L LiCl of 1/3 volume, mixing is placed on 4 ℃ and places 16h or place 8-12h, precipitated rna on ice;

(6) under 4 ℃ of conditions 12,000rpm, centrifugal 20min, abandoning supernatant;

(7) add 2ml 70% washing with alcohol RNA precipitation, under the room temperature condition 12, the centrifugal 5min of 000rpm is deposited in RNA in the Bechtop and dries up, and is dissolved in an amount of DEPC treating water, and is standby in-20 ℃ (short-terms) or-70 ℃ (for a long time) preservation.

2、RT-PCR

(1) cDNA first chain is synthetic

In the centrifuge tube of handling through DEPC, add following composition successively:

Instantaneous centrifugal behind the mixing, in 70 ℃ of sex change 5min, cooled on ice.

Add following composition successively:

Instantaneous centrifugal behind the mixing, at 42 ℃ of reaction 60min.

(2) PCR reaction

Reaction system is as follows:

At first mentioned reagent is added on 200 μ l centrifuge tubes, mixing, instantaneous centrifugal, be put on the PCR instrument.Be used for Si69cDNA total length amplimer P1:5 '-GCGAGGAGAGAGGAGGGAAGAGC-3 ' P2:5 '-CGTCTCAGCGGTTCAGCGGATA-3 '.Amplification condition is as follows: 94 ℃, and sex change 1min; 60 ℃, annealing 1min; 72 ℃, extend 1min; Amplification cycles number: 35; Last 72 ℃, extend 10min.Get an amount of PCR product agarose gel electrophoresis and detect, all the other products are put in-20 ℃ of preservations.

The PCR product is connected to T-vector, carries out that enzyme is cut and sequence order-checking, identify correctly, naming this plasmid is p Si69.

Embodiment 3 is used for structure and the conversion Agrobacterium that Arabidopis thaliana is expressed the expression vector of Si69

Expression cassette is formed by the cauliflower mosaic virus 35S promoter with from the 3 Transcription Termination zones (people (1982) J.Mol.Appl.Genet.1:561-570 such as Depickere) of rouge alkali synthetase (no) gene, and selectable marker gene is neomycin phosphotransferase II (NPTII).As shown in Figure 2, be template with Si69 plasmid (the positive colony plasmid of embodiment 2), utilize pcr amplification, make 5 ' end bring the BamHI restriction enzyme site into, 3 ' end is brought flag-tag label (MDYKDDDDK) and SacI restriction enzyme site into, and flag-tag and Si69 are merged.Amplimer P1 (5 ' CG GGATCCAAGCGAGGAGAGAGG-3 '), P2 (5 ' GC GAGCTCTCACTTGTCGTCGTCGTCCTTATAGTC GAACTGGTTGGACCAGT-3 '), reaction system such as following table are listed,

Amplification condition is: 94 ℃, and sex change 1min; 60 ℃, annealing 1min (annealing temperature and time should be determined according to the length and the Tm value of primer); 72 ℃, extend 1min; Amplification cycles number: 30-35; Last 72 ℃, extend 10min.Get an amount of PCR product agarose gel electrophoresis and detect, all the other products are put in-20 ℃ of preservations.Be cloned into pMD18-T, order-checking is correct.The Si69 BamHI and the SacI double digestion that will have the flag-tag label, the fragment of recovery 840bp; ((available from Clontech company) uses BamHI and SacI double digestion with binary expression vector pBI121, remove reporter gene GUS, reclaim the big fragment of carrier, carrier is connected with the purpose fragment, after the conversion, obtain being structured on the pBI121 carrier recombinant plasmid pBI121-Si69 that the Si69cDNA forward that is driven by 35S promoter inserts.Molten method is frozen in the pBI121-Si69 employing directly transform Agrobacterium GV3101, obtain to contain the Agrobacterium GV3101 (pBI121-Si69) of recombinant plasmid pBI121-Si69.The Agrobacterium-mediated Transformation technology is a known technology.

Embodiment 4 35S promoters/Si69 expression vector arabidopsis thaliana transformation

Wild-type Arabidopis thaliana plant strain growth elementary inflorescence occurs after about 4 weeks.Elementary inflorescence grows to 5-10cm and it is cut off when high, makes its secondary inflorescence growth.After 6-7 days, the secondary inflorescence of plant is about to bloom, or few Hua Yikai is only arranged, and is at this moment to transform best period.The method of Agrobacterium-mediated Transformation Arabidopis thaliana plant adopts the bud infusion method, and [Clough SJ and Bent AF Floraldip:a simplified method for Agrobacterium-mediated transformation ofArabidopsis thaliana.Plant J.1998,16:735-743), the Arabidopis thaliana plant is inverted, make the above inflorescence of lotus throne leaf immerse the good about 3min of bacterium liquid of dilution, during slightly rock.In plant traverse to the 22 ℃ environment that bacterium liquid was soaked, secretly cultivate 24 hours after, see that vertically light is cultured to the results seed.The T of results ₀Seed for transfer-gen plant is handled 2min with 70% alcohol, and 0.5% clorox is disinfected 8-10min, again with sterilized water washing 4-6 time.Seed evenly placed to contain on the Kan 50 μ g/ml MS substratum screen.Put 4 ℃ of dark cultivations and carried out vernalization in 2-3 days, illumination cultivation (16h illumination, 8h dark) is 7-12 days then, gets resistance seedling 50 strains (the seedling deep green has true leaf, and real root is arranged) and is transplanted to flowerpot (flower nutrition soil: vermiculite=1: 1) cultivate, obtain T ₁For transgenic seed, there is the screening of 85% transgenic line to obtain 3: 1 isolating positive plants of ratio.

Transform the empty carrier that does not contain Si69 with above-mentioned identical method simultaneously, as negative control.

Extract the positive plant genomic dna, amplification Si69 gene.Primer P1:5 '-GCCAACCTGAAGCAGCACTA-3 ' and P2:5 '-GCGTAAGGAACGTAGCAGAA-3 ', reaction system is listed as showing,

Amplification condition is: 94 ℃, and sex change 1min; 55 ℃, annealing 1min (annealing temperature and time should be determined according to the length and the Tm value of primer); 72 ℃, extend 1min; Amplification cycles number: 30-35; Last 72 ℃, extend 10min.Get an amount of PCR product agarose gel electrophoresis and detect expanding fragment length 619bp.All the other products are put in-20 ℃ of preservations.

The result shows that tested 10 strain positive plants all increase and obtain the Si69 gene, and wild plant (2 strain) and negative control (transforming the empty carrier plant that does not contain the Si69 gene) all do not detect.

Proteic detection in embodiment 5 transgenic arabidopsis

Extract T3 for transgenic arabidopsis blade total protein, through the SDS-PAGE electrophoretic separation, the constant current ice bath carries out Western blot hybridization after changeing film.Wherein one anti-is anti-flagtag antibody, and Dilution ratio is 1: 10, and 000, two anti-ly is that the sheep anti-mouse igg of horseradish peroxidase-labeled, Dilution ratio are 1: 10,000.The Western results of hybridization is referring to Fig. 3.The result shows Si69 stably express in transgenic arabidopsis among the figure.

Quiet dyeing of root bush and scanning electron microscopic observation in embodiment 6 transgenic arabidopsis

Experimental subjects: positive plant 10 strains, every group 5 strain; Negative control 4 strains, every group 2 strain; 4 strains of wild-type plant, every group 2 strain.

Sample preparation: wild-type, negative plant and transgenic arabidopsis seed are handled 2min with 70% alcohol, and 0.5% clorox is disinfected 8-10min, again with sterilized water washing 4-6 time.Seed evenly placed on the MS substratum that contains 50 μ g/ml Kan screen.Put 4 ℃ of dark cultivations and carried out vernalization in 2-3 days, 22 ℃ of illumination cultivation (16h illumination, 8h dark) are 7 days then, with containing different aluminum concentration (20 μ M and 50 μ M AlCl ₃) 1/6MS (containing 10g/L sucrose) nutrient solution (pH4.0) handle plant root 24h respectively, root is handled the back with 200ml distilled water immersion 15 minutes at aluminium, uses the 50ml phenodin aqueous solution (w=0.1% phenodin w=0.01%KIO then ₃0.1mmol/L NaOH) dyeing is 20 minutes, embathes 15 minutes to there not being loose colour with deionized water at last.With microscopic examination tip of a root dyeing situation and take pictures.Get the Arabidopis thaliana seedling, fix, be pumped to sample and sink in the stationary liquid, fix 2 hours with osmic acid again, through ethanol series dehydration, CO with 5% glutaraldehyde solution ₂Critical point drying is used the S-570 of Hitachi scanning electron microscopic observation behind the spray metallic membrane.

The microscopic examination result is presented at 20 μ M AlCl ₃Handling the back transgenic arabidopsis tip of a root does not substantially all have red-dyed, and the wild-type Arabidopis thaliana and the negative control tip of a root are bluish voilet; After 50 μ M A1 handled, the transgenic arabidopsis tip of a root had lilac to occur, and dye levels will be starkly lower than wild-type (scarlet) (Fig. 4).

Scanning electron microscopic observation, the result shows 20 μ M AlCl ₃After the processing, the tip of a root structure of transgenic arabidopsis does not all have to change and wild-type is not subjected to the Arabidopis thaliana root-tip cells structure of aluminium processing basic identical; 50 μ M AlCl ₃After the processing, the part depression appears in transgenic arabidopsis tip of a root elongation zone cell, but destructiveness is not serious, by contrast, wild-type Arabidopis thaliana and negative control root-tip cells under aluminum ion is handled is subjected to havoc, particularly root cap and elongation zone, cell cave in a large number (Fig. 5).

Elongation of embodiment 7 transgenic arabidopsis roots and mda content are measured

Experimental subjects: positive plant 6 strains, every group 3 strain; 2 strains of wild-type plant, every group 1 strain.

After wild-type and the transgenic arabidopsis seed sterilization vernalization treatment, 7 days seedling of growth forwarded to contain 20 μ M and 50 μ M AlCl respectively ₃Nutrient solution in the growth 72 hours.

The root of measuring before and after handling is long, with the root elongation contrast under the normal growth situation, 20 μ M and 50 μ M AlCl ₃After the processing, the specific elongation of wild-type Arabidopis thaliana root reduces 35% and 70% respectively, and the specific elongation of transgenic arabidopsis root reduces 10-25% and 50-55% respectively.

Take by weighing AlCl ₃The Arabidopis thaliana root 0.5g that handled adds 1ml 10%TCA and is ground to homogenate, adds 1ml 0.6%TBA solution, homomixture was in 95 ℃ of reactions 20 minutes, cooling back 10000g is centrifugal 5 minutes rapidly, sucts clearly the dullness under mensuration 532,600, the 450nm wavelength.

MDA concentration (μ mol/L)=6.45 (A ₅₃₂-A ₆₀₀)-0.56A ₄₅₀

MDA content (μ mol/g)=MDA concentration (μ mol/L) * extracting liquid volume (ml)/plant tissue fresh weight (g)

At 20 μ M and 50 μ M AlCl ₃Handle down, compared with the control, wild-type Arabidopis thaliana root MDA content increases by 3.5 times and 5.0 times respectively, and transgenic arabidopsis root MDA content is respectively 2.0 times and 3.5 times of contrast, be starkly lower than wild-type (Fig. 6).

The sequence table explanation

SEQ ID No.1﹠amp; The 2nd, Si69 gene and amino acid sequence coded thereof; SEQ ID No.3﹠amp; The 4th, the primer sequence of the Si69cDNA total length that is used to increase; SEQ ID No.5﹠amp; The 6th, amplification Si69 plasmid is also introduced the primer sequence of restriction enzyme site and label at its two ends; SEQ ID No.7﹠amp; The 8th, be used to detect the primer of Si69 gene.

Sequence table

＜110〉China Agricultural University

＜120〉utilize plant aluminum abduction delivering gene to increase the method for the anti-aluminium of plant

<130>KHP09112101.5

<160>8

<170>PatentIn?version?3.5

<210>1

<211>765

<212>DNA

＜213〉millet

<220>

<221>CDS

<222>(1)..(765)

<400>1

atg?ctg?gcg?gtg?ttc?gat?ccc?acg?gtg?gcc?aag?tgc?ccg?gag?ggc?ctc 48

Met?Leu?Ala?Val?Phe?Asp?Pro?Thr?Val?Ala?Lys?Cys?Pro?Glu?Gly?Leu

1 5 10 15

cgc?agc?ccg?ctg?gtg?gcc?ggc?gcg?gcc?gct?gcc?gcg?gcc?ggc?ggc?gtg 96

Arg?Ser?Pro?Leu?Val?Ala?Gly?Ala?Ala?Ala?Ala?Ala?Ala?Gly?Gly?Val

20 25 30

ggc?gcg?ctc?atg?aag?ggc?ttc?tcc?gcc?tca?cac?gac?ggc?acc?gtc?acc 144

Gly?Ala?Leu?Met?Lys?Gly?Phe?Ser?Ala?Ser?His?Asp?Gly?Thr?Val?Thr

35 40 45

gtc?agc?ctg?ggg?ccc?tcc?ggc?gcg?ctg?gcg?cac?tcg?gcg?gcc?aac?cag 192

Val?Ser?Leu?Gly?Pro?Ser?Gly?Ala?Leu?Ala?His?Ser?Ala?Ala?Asn?Gln

50 55 60

agc?ccc?ctc?gtc?cct?agg?ttg?ttt?ggt?gct?gtg?aat?gac?atc?ttt?tgc 240

Ser?Pro?Leu?Val?Pro?Arg?Leu?Phe?Gly?Ala?Val?Asn?Asp?Ile?Phe?Cys

65 70 75 80

ctg?ttc?caa?ggg?aac?att?gag?aac?att?gcc?aac?ctg?aag?cag?cac?tac 288

Leu?Phe?Gln?Gly?Asn?Ile?Glu?Asn?Ile?Ala?Asn?Leu?Lys?Gln?His?Tyr

85 90 95

ggc?ctg?agc?aag?acc?gcc?aac?gag?gtg?act?atc?ctc?atc?gag?gcc?tac 336

Gly?Leu?Ser?Lys?Thr?Ala?Asn?Glu?Val?Thr?Ile?Leu?Ile?Glu?Ala?Tyr

100 105 110

aga?acc?ctg?agg?gac?agg?ggt?ccc?gtc?cca?gcc?agc?cag?gtt?gtg?aga 384

Arg?Thr?Leu?Arg?Asp?Arg?Gly?Pro?Val?Pro?Ala?Ser?Gln?Val?Val?Arg

115 120 125

gat?ctt?agt?gga?aag?ttc?gca?ttc?atc?ttg?tat?gac?acc?ctg?tcg?aag 432

Asp?Leu?Ser?Gly?Lys?Phe?Ala?Phe?Ile?Leu?Tyr?Asp?Thr?Leu?Ser?Lys

130 135 140

tcc?acc?ttc?gtt?gct?gct?gac?gct?gat?ggc?agc?atc?ccc?ttc?ttc?tgg 480

Ser?Thr?Phe?Val?Ala?Ala?Asp?Ala?Asp?Gly?Ser?Ile?Pro?Phe?Phe?Trp

145 150 155 160

ggc?gtc?gac?tcg?gag?gac?cac?ctc?gtg?ttc?tct?gac?gat?gct?ggg?cta 528

Gly?Val?Asp?Ser?Glu?Asp?His?Leu?Val?Phe?Ser?Asp?Asp?Ala?Gly?Leu

165 170 175

ctc?aag?acc?ggc?tgc?ggc?aac?tcg?ttc?gcg?cca?ttc?cct?aaa?ggt?tgc 576

Leu?Lys?Thr?Gly?Cys?Gly?Asn?Ser?Phe?Ala?Pro?Phe?Pro?Lys?Gly?Cys

180 185 190

ttc?tac?acc?acc?tcc?ggc?ggg?ctg?cag?agc?tac?gag?cac?ccg?ctg?cac 624

Phe?Tyr?Thr?Thr?Ser?Gly?Gly?Leu?Gln?Ser?Tyr?Glu?His?Pro?Leu?His

195 200 205

gag?gtc?aag?gcg?gtg?ccg?cgc?gtg?gac?agc?cag?ggc?cag?atg?tgc?ggc 672

Glu?Val?Lys?Ala?Val?Pro?Arg?Val?Asp?Ser?Gln?Gly?Gln?Met?Cys?Gly

210 215 220

tcc?acc?ttc?aag?gtc?gac?agc?gag?acc?aag?aag?aag?cag?gac?gcc?agc 720

Ser?Thr?Phe?Lys?Val?Asp?Ser?Glu?Thr?Lys?Lys?Lys?Gln?Asp?Ala?Ser

225 230 235 240

atc?ccc?cgc?gtc?ggc?agc?gcc?gcc?gac?tgg?tcc?aac?cag?ttc?tga 765

Ile?Pro?Arg?Val?Gly?Ser?Ala?Ala?Asp?Trp?Ser?Asn?Gln?Phe

245 250

<210>2

<211>254

<212>PRT

＜213〉millet

<400>2

Met?Leu?Ala?Val?Phe?Asp?Pro?Thr?Val?Ala?Lys?Cys?Pro?Glu?Gly?Leu

1 5 10 15

Arg?Ser?Pro?Leu?Val?Ala?Gly?Ala?Ala?Ala?Ala?Ala?Ala?Gly?Gly?Val

20 25 30

Gly?Ala?Leu?Met?Lys?Gly?Phe?Ser?Ala?Ser?His?Asp?Gly?Thr?Val?Thr

35 40 45

Val?Ser?Leu?Gly?Pro?Ser?Gly?Ala?Leu?Ala?His?Ser?Ala?Ala?Asn?Gln

50 55 60

Ser?Pro?Leu?Val?Pro?Arg?Leu?Phe?Gly?Ala?Val?Asn?Asp?Ile?Phe?Cys

65 70 75 80

Leu?Phe?Gln?Gly?Asn?Ile?Glu?Asn?Ile?Ala?Asn?Leu?Lys?Gln?His?Tyr

85 90 95

Gly?Leu?Ser?Lys?Thr?Ala?Asn?Glu?Val?Thr?Ile?Leu?Ile?Glu?Ala?Tyr

100 105 110

Arg?Thr?Leu?Arg?Asp?Arg?Gly?Pro?Val?Pro?Ala?Ser?Gln?Val?Val?Arg

115 120 125

Asp?Leu?Ser?Gly?Lys?Phe?Ala?Phe?Ile?Leu?Tyr?Asp?Thr?Leu?Ser?Lys

130 135 140

Ser?Thr?Phe?Val?Ala?Ala?Asp?Ala?Asp?Gly?Ser?Ile?Pro?Phe?Phe?Trp

145 150 155 160

Gly?Val?Asp?Ser?Glu?Asp?His?Leu?Val?Phe?Ser?Asp?Asp?Ala?Gly?Leu

165 170 175

Leu?Lys?Thr?Gly?Cys?Gly?Asn?Ser?Phe?Ala?Pro?Phe?Pro?Lys?Gly?Cys

180 185 190

Phe?Tyr?Thr?Thr?Ser?Gly?Gly?Leu?Gln?Ser?Tyr?Glu?His?Pro?Leu?His

195 200 205

Glu?Val?Lys?Ala?Val?Pro?Arg?Val?Asp?Ser?Gln?Gly?Gln?Met?Cys?Gly

210 215 220

Ser?Thr?Phe?Lys?Val?Asp?Ser?Glu?Thr?Lys?Lys?Lys?Gln?Asp?Ala?Ser

225 230 235 240

Ile?Pro?Arg?Val?Gly?Ser?Ala?Ala?Asp?Trp?Ser?Asn?Gln?Phe

245 250

<210>3

<211>23

<212>DNA

＜213〉artificial sequence

<400>3

gcgaggagag?aggagggaag?agc 23

<210>4

<211>22

<212>DNA

＜213〉artificial sequence

<400>4

cgtctcagcg?gttcagcgga?ta 22

<210>5

<211>23

<212>DNA

＜213〉artificial sequence

<400>5

cgggatccaa?gcgaggagag?agg 23

<210>6

<211>52

<212>DNA

＜213〉artificial sequence

<400>6

gcgagctctc?acttgtcgtc?gtcgtcctta?tagtcgaact?ggttggacca?gt 52

<210>7

<211>20

<212>DNA

＜213〉artificial sequence

<400>7

gccaacctga?agcagcacta 20

<210>8

<211>20

<212>DNA

＜213〉artificial sequence

<400>8

gcgtaaggaa?cgtagcagaa 20

Claims (6)

1.Si69 the application of gene in increasing the anti-aluminium of plant, the nucleotide sequence of described Si69 gene is shown in SEQ ID No.1.

2. a method of utilizing plant aluminum abduction delivering gene to increase the anti-aluminium of plant is characterized in that described gene is Si69, and its nucleotide sequence is shown in SEQ ID No.1.

3. method as claimed in claim 2 is characterized in that, this method is used and contained Si69 expression carrier conversion purpose plant.

4. method as claimed in claim 3 is characterized in that, the promotor of described expression vector is a constitutive promoter.

5. as each described method of claim 2～4, it is characterized in that described plant is a dicotyledons.

6. method as claimed in claim 5 is characterized in that, described plant is an Arabidopis thaliana.

Images