CN101260156A - Immunoglobulin single variant antigen binding domain and specific construct thereof - Google Patents

Immunoglobulin single variant antigen binding domain and specific construct thereof Download PDF

Info

Publication number
CN101260156A
CN101260156A CNA2008100085659A CN200810008565A CN101260156A CN 101260156 A CN101260156 A CN 101260156A CN A2008100085659 A CNA2008100085659 A CN A2008100085659A CN 200810008565 A CN200810008565 A CN 200810008565A CN 101260156 A CN101260156 A CN 101260156A
Authority
CN
China
Prior art keywords
variable region
epi
antibody
sequence
dab
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CNA2008100085659A
Other languages
Chinese (zh)
Inventor
格雷格·温特
伊恩·汤姆林森
奥尔加·伊格内托维奇
露西·霍尔特
埃琳娜·德安杰利斯
菲利普·琼斯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Domantis Ltd
Original Assignee
Domantis Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/GB2002/003014 external-priority patent/WO2003002609A2/en
Application filed by Domantis Ltd filed Critical Domantis Ltd
Publication of CN101260156A publication Critical patent/CN101260156A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46—Hybrid immunoglobulins
    • C07K16/468—Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides a dual-specific ligand comprising a first immunoglobulin variable domain having a first binding specificity and a complementary or non-complementary immunoglobulin variable domain having a second binding specificity.

Description

Immune globulin single variant antigen bonding land and specific construct thereof
The application be that June 30, Chinese application number in 2003 are 03820458.4 the applying date, denomination of invention divides an application for the patent application of " immune globulin single variant antigen bonding land and specific construct thereof ".
Related application
The present invention relates to the dual specific part.This invention provides a kind of method for preparing the dual specific part especially, and this part comprises the single variable region of first immunoglobulin (Ig) in conjunction with first kind of antigen or epi-position, reaches the single variable region of second immunoglobulin (Ig) in conjunction with second antigen or epi-position.More specifically, the present invention relates to the dual specific part, its with first and second antigens or epi-position at least one combine the transformation period in the body that prolongs this part.The present invention describes opening and the closed conformation part that comprises an above binding specificity.
Background technology
Antigen binding domain in the antibody comprises two zones that separate: variable region of heavy chain (V H) and variable region of light chain (V L: V κOr V λ).Antigen binding site itself is made up of 6 polypeptide rings: 3 from V HDistrict (HI, H2 and H3), 3 from V LDistrict (LI, L2 and L3).The combination of constant gene segment C is reset and is caused coding V HDistrict and V LThe diversified one-level storehouse (primary repertoire) of the V gene in district.V HGene is to be V by 3 constant gene segment Cs H, D and J HReorganization forms.According to haplotype (haplotype), human nearly 51 kinds of functional V HSection (Cook and Tomlinson, Immunol Today 16:237 (1995)), 25 kinds of functional D sections (Corbett etc., J.Mol.Biol.268:69 (1997)) and 6 kinds of functional J HSection (Ravetch etc., Cell 27:583 (1981)).V HForm V in the section coded polypeptide chain HDistinguish the zone of the first and second antigen coupling collars (HI and H2), and V H, D and J HSection forms V jointly HDistinguish antigen iii coupling collar (H3).V LGene is V by 2 constant gene segment Cs only LAnd J LReorganization forms.According to haplotype, human nearly 40 kinds of functional V κSection (
Figure A20081000856500071
AndZachau, Biol.Chem.Hoppe-Seyler 374:1001 (1993)), 31 kinds of functional V λSection (Williams etc., J.Mol.Biol.264:220 (1996) and Kawasaki etc., Genome Res 7:250 (1997)), 5 kinds of functional J κSection (Hieter etc., J.Mol.Biol.257:1516 (1982)) and 4 kinds of functional J λSection (Vasicek and Leder, J.Exp.Med.172:609 (1990)).V LForm V in the section coded polypeptide chain LDistinguish the zone of the first and second antigen coupling collars (LI and L2), and V LAnd J LSection forms V jointly LDistinguish antigen iii coupling collar (L3).It is generally acknowledged that these initial storehouses have enough diversity, can select at least can be with medium avidity and nearly all antigen bonded antibody." affinity maturation " through gene rearrangement can produce high-affinity antibody, and in this process, origination point suddenlys change, and is selected by immunity system according to the enhancing of binding ability.
Structure and the sequence of analyzing antibody show that 5 (H1, H2, L1, L2 and L3) in 6 antigen coupling collars have number constrained backbone conformation and norm structure (Chothia and Lesk, J.Mol.Biol.196:901 (1987) and Chothia etc., Nature 342:877 (1989)).The main chain conformation depends on the length of (i) antigen coupling collar and the (ii) concrete residue or the residue type of some key position in antigen coupling collar and the antibody framework.Analyze the length and the Key residues of antigen coupling collar and can infer H1, H2, L1, L2 and L3 main chain conformation (Chothia etc., the J.Mol.Biol.227:799 (1992) that encodes by most of human sequence antibodies; Tomlinson etc., EMBO J 14:4628 (1995); Williams etc., J.Mol.Biol.264:220 (1996)).Though the H3 district is in the diversity of sequence, length and configuration aspects much bigger (because effect of D section), but the existence of special residue of key position or residue type determines this district also to form number constrained backbone conformation (Martin etc., J.Mol.Biol.263:800 (1996) for becate length in its length and antigen coupling collar and the antibody framework; Shirai etc., FEBS Letters 399:1 (1996)).
The V that comprises known in the art HDistrict and V LThe bi-specific antibody of district's complementary pair.These bi-specific antibodies must comprise two couples of V HDistrict and V LThe district, every couple of V H/ V LIn conjunction with single antigen or epi-position.Once the method for Miao Shuing comprised hybrid hybridoma technology (Milstein and Cuello AC, Nature 305:537-40), microbody (minobody) (Hu etc., Cancer Res 56:3055-3061 (1996)), double antibody (diabody) (Holliger etc., Proc.Natl.Acad.Sci.USA 90:6444-6448 (1993); WO94/13804), chelating recombinant antibodies (CRAb) (Neri etc., J.Mol.Biol.246:367-373 (1995)), two Fv antibody (biscFv) (Atwell etc., Mol.Immunol.33:1301-1312 (1996)), " convex-concave is coincide (knobs in holes) " stabilization antibody (Carter etc., Protein Sci.6:781-788 (1997)).Every kind of antibody classification comprises two antigen binding sites under every kind of situation, and the pattern of each antigen binding site is V HDistrict and V LThe complementary pair in district.Therefore, by a V HDistrict and its complementary V LThe district makes each antibody capable simultaneously in conjunction with two different antigens or epi-position in conjunction with each antigen or epi-position.Each of these technology all has its distinctive shortcoming, for example: the V of non-activity in the hybrid hybridoma technology H/ V LTo significantly reducing the shared mark of dual specific IgG (fraction).In addition, most of dual specific methods depend on different V H/ V LRight combination or V HAnd V LThe combination of chain and produce two kinds of different V again H/ V LBinding site.Therefore, can not control in the assembling molecule to the binding site ratio of every kind of antigen or epi-position, so many assembling molecules only in conjunction with a kind of antigen or epi-position, and another kind of antigen of debond or epi-position.Can on the subunit interface, transform heavy chain or light chain (Carter etc. in some cases, 1997) have number with increase, but can not make all molecules all have ability like this in conjunction with two kinds of antigens or epi-position in conjunction with the molecule in the site of two kinds of antigens or epi-position.
Some evidence shows that two kinds of different antibodies binding specificities can mix same binding site, but these antibody show the antigen of structurally associated or epi-position or the extensive two or more specificitys of cross reacting antibody usually.For example: described cross reacting antibody, usually see two kinds of antigens relevant on sequence and structure as white N,O-Diacetylmuramidase of ovum gallinaceum and turkey N,O-Diacetylmuramidase (McCafferty etc., WO 92/01047) or free haptens and with carrier link coupled haptens (Griffiths AD etc., EMBO J 13:143245-60 (1994)).Another example is seen the antibody molecule with " dual specific " that WO 02/02773 (Abbott laboratory) describes.Here related antibody molecule produces at multiple antigen or selects, and the range of specificity that is to say them is more than a kind of antigen.In the antibody that WO 02/02773 describes, every couple of complementary V H/ V LHave at the antigenic single binding specificity of two or more structurally associated, the V in these complementary pairs HDistrict and V LThe district does not have independent specificity separately.Therefore, described antibody has and contains on the structure relevant two kinds of antigenic single specificities widely (broad singlespecificity).In addition, the natural autoantibodies of having described be multiple reactionness (Casali andNotkins, Ann.Rev.Immunol.7:515-531), can with irrelevant different antigen or epi-position reaction at least two kinds of (more usually) structures.Shown and adopted display technique of bacteriophage on monoclonal antibody, to select random peptide library will identify the peptide sequence of a series of suitable antigen binding sites.Some sequence is very relevant, meets consensus sequence, and other sequence is very different and be named as individual (mimotope) (Lane and Stephen, Current Opinion in Immunology 5:268-271 (1993)).Therefore, contain relevant and complementary V obviously HDistrict and V LNatural four chain antibodies in district can be in conjunction with the many not synantigens in the countless known antigens.Indefinite be how in same antibody, to prepare with two kinds of given antigenic binding sites, particularly some structures on the antigen that may not be correlated with.
The protein engineering technological method points out it can be helpful in this respect.For example: the someone advises preparing a kind of catalytic antibody, this antibody can combine with metal ion by a variable region, combine with haptens (substrate) by contacting with a complementary variable region (Barbas etc., Proc.Natl.Acad.Sci.USA 90:6385-6389 (1993)) with metal ion.Yet in this case, in conjunction with and catalytic substrate (first antigen) need with the combining of metal ion (second antigen).Therefore, with V H/ V LRight combination is relevant with single but multicomponent antigen.
Described the bi-specific antibody of preparation in the camel heavy chain of antibody list district (Single domain) that associates, in antibody, combined with a kind of antigen, combined with second kind of antigen by second variable region by a variable region.Yet these variable regions are not complementary.Therefore, select first variable region of heavy chain at first kind of antigen, second variable region of heavy chain be at second kind of antigen, then these two variable regions are connected become on the same chain bispecific antibody fragment (Conrath etc., J.Biol.Chem.270:27589-27594).Yet unusual is the natural camel antibody of camel heavy chain list district from no light chain, and in fact, heavy chain list district can not combine with the camel light chain and form complementary V H/ V LRight.
The single variable region of heavy chain that comes from natural antibody was also described, this variable region of heavy chain usually and light chain (from monoclonal antibody or storehouse, functional zone; See EP-A-0368684) combination.Shown that these variable region of heavy chain energy specificitys and one or more related antigen interact, and be not combined into part with two or more different antigen-specifiies with other heavy chain or variable region of light chain.In addition, these single district transformation period in vivo are very short, so its therapeutic value is limited.
Once the someone advise with not homospecific variable region of heavy chain be connected together the preparation bispecific antibody fragment (as mentioned above), but shortcoming that should strategy is: the isolated antibody variable region have one usually can with the interactional hydrophobic interfaces of light chain, it is exposed to solvent and can is viscosity, thereby allows this list district to be attached on the hydrophobic surface.In addition, lack the light chain companion two or more different heavy chains variable regions combination and may be by the combination of hydrophobic interfaces, can stop them can the bonded parts when they are independent in conjunction with one rather than two.And in this case, variable region of heavy chain does not combine with complementary variable region of light chain, thus stablize qualitative very poor, folding easily open (Worn and Pluckthun, Biochemistry 37:13120-7 (1998)).
Summary of the invention
The inventor has described the double specificity immunoglobulin part that comprises the single variable region of immunoglobulin (Ig) (single variabledomains) in unsettled International Patent Application WO 03/002609 and unsettled and undocumented UK patent application 0230203.2, each variable region has not homospecificity.When antigen on these regional binding target molecules or epi-position or vie each other or do not rely on mutually.
In first configuration, the invention provides further improvement to the dual specific part by inventor's invention, wherein part specificity is at certain albumen or polypeptide in the organism body, described albumen or the polypeptide transformation period by strengthening this part with the part bound energy.
Therefore, at first, the invention provides a kind of dual specific part, this part comprises the single variable region of first immunoglobulin (Ig), there is binding specificity this variable region to first antigen or epi-position, this part also comprises the single variable region of complementary second immunoglobulin (Ig), this variable region has active with combining of second kind of antigen or epi-position, in wherein said antigen or the epi-position one or both play a part to prolong the part transformation period in vivo, the single variable region of described first and second immunoglobulin (Ig)s shortage has same specific common complementary region, if described dual specific part is not by anti--HSA V HDistrict and anti--beta galactosidase enzyme V κThe district forms.Preferably first and second variable regions do not combine with human serum albumin (HSA).
Advantageously, the antigen of the prolongation part transformation period described in the invention or epi-position are albumen or polypeptide in the body of finding in the organism.Example comprises the albumen that exists in the various tissues of extracellular matrix protein, blood protein and organism.These proteic effects are to reduce the speed that part is removed from blood, for example can be used as expanding material (bulking agent) or part is anchored on the desirable action site.Antigen/epi-position the example that prolongs the transformation period in the part body provides in the annex 1 below.
The method of prolong half-life is at immunoglobulin (Ig), and antibody particularly especially is very useful in using in the body of small-sized antibody fragment.These fragments (Fv, the Fv of disulphide bonding, Fab, scFv dAb) is limited by in the body and removes fast; Therefore, on the one hand they can arrive the most of position of health fast and produce rapidly and easy handling, on the one hand owing to its in vivo have of short duration its application in vivo that limited.The invention provides the part of transformation period prolongation in vivo, cause the functional activity time length prolongation in vivo of part, thereby solved the problems referred to above.
Pharmacokinetic analysis and part half life determination method are known for those skilled in the art.Pharmacist's handbook) and the Pharmacokinetic analysis:A Practical Approach (pharmacokinetic analysis: practical approach) (1996) of Peters etc. detail file are seen the Chemical Stability of Pharmaceuticals:A Handbookfor Pharmacists (chemical stability of medicine: of Kennetl etc.Also can be with reference to the Pharmacokinetics (pharmacokinetics) of M Gibaldi and D Perron etc., Marcel Dekker publishes, the 2nd revised edition, nineteen eighty-two, this book has been described t α transformation period, t β transformation period and area under curve pharmacokinetic parameters such as (AUC).
Transformation period (tl/2 α and tl/2 β) and AUC can obtain from the serum-concentration of part and time relation curve, for example can adopt the WinNonlin analysis software package (can be from Pharsight Corp., MountainView, CA94040, USA obtains) simulation curve.Fs (α phase) mainly is that part distributes in patient's body and some removings are arranged.Subordinate phase (β phase) is whole latter stage, and part distribution this moment finishes and because part is removed in the patient body, its serum-concentration begins to descend.The t α transformation period is transformation period fs, and the t β transformation period is the subordinate phase transformation period.Thereby advantageously, one aspect of the present invention provides according to part of the present invention or has comprised the composition of part, and its t α transformation period is the scope more than 15 minutes or 15 minutes.In one embodiment, the lower limit of described scope can be 30 minutes, and 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 10 hours, 11 hours, 12 hours.In addition, or selectively, the t α transformation period of part of the present invention or composition can be up to 12 hours and comprise in 12 hours the scope.In one embodiment, the upper limit of described scope can be 11,10,9,8,7,6 or 5 hours.The example of proper range is 1-6 hour, 2-5 hour or 3-4 hour.
Advantageously, the invention provides according to part of the present invention or comprise the composition of part, its t β transformation period is in the scope more than 2.5 hours or 2.5 hours.In one embodiment, the following of described scope is limited to 3 hours, and 4 hours, 5 hours, 6 hours, 7 hours, 10 hours, 11 hours or 12 hours.In addition, or selectively, the t β transformation period of part of the present invention or composition can be up to 21 days and comprise in 21 days the scope.In one embodiment, the upper limit of described scope can be 12 hours, and 24 hours, 2 days, 3 days, 5 days, 10 days, 15 days or 20 days.Advantageously, the t β transformation period scope of part of the present invention or composition is 12-60 hour.In another embodiment, scope is 12-48 hour.In another embodiment, scope is 12-26 hour.
Except that above-mentioned standard, or selectively, the invention provides according to the part of invention or comprise the composition of part, its area under curve (AUC) is worth in 1mg.min/ml or above scope.In one embodiment, described scope following is limited to 5,10,15,20,30,100,200 or 300mg.min/ml.In addition, or selectively, the AUC value of part of the present invention or composition can be in the scope up to 600mg.min/ml.In one embodiment, the upper limit of described scope can be 500,400, and 300,200,150,100,75 or 50mg.min/ml.Advantageously, the AUC scope of part of the present invention is selected from following several groups: 15-150mg.min/ml, 15-100mg.min/ml, 15-75mg.min/ml and 15-50mg.min/ml.
In first embodiment, the dual specific part comprises two complementary variable regions, and they can be used as in physical environment and related (cognate pair)/group are played a role together, even in the present invention, they are respectively in conjunction with their related epi-position.For example, the complementary variable region can be heavy chain immunoglobulin and variable region of light chain (V HAnd V L).V HAnd V LCan provide by scFv or Fab antibody fragment very conveniently.The variable region formation multivalent ligand that can link to each other, for example, hinge area and the disulfide linkage between the hinge area halfcystine by each V district C-terminal connect, or provide through the dAb that disulfide linkage connects together by the halfcystine of domain C end, perhaps the Fab form of being made up of V-CH and V-CL is perhaps used peptide linker (Gly as described below 4The Ser joint) preparation dimer, tripolymer and polymer.
The inventor finds that the application of complementary variable region makes the surface in two districts be crowded together (packtogether) and isolated with solvent, moreover two complementary districts can stablize mutually.In addition, also make dual specific IgG antibody remove the shortcoming of in the past used heterozygosis hybridoma, or on the subunit interface, transform the needs of heavy chain or light chain.The first, bi-specific antibody has at least one V among the present invention H/ V LRight.So, dual specific IgG of the present invention can comprise two so right, respectively have one on each arm of Y type molecule.Therefore, be different from conventional bi-specific antibody or double antibody, the success of the ratio decision Antibody Preparation that peptide chain uses in their preparation process, thereby preparation exists practical difficulty, and there is not the chain equilibrium problem in dual specific part of the present invention.The uneven reason of conventional bi-specific antibody chain is two kinds of different V LChain and two kinds of different V HV is worked as in the combination of chain LChain 1 and V HChain 1 can conjugated antigen/epi-position 1 together the time, V LChain 2 and V HChain 2 can 2, two of conjugated antigen/epi-positions correctly mate being connected with each other in some way together the time.Therefore, in individual molecule, has only V LChain 1 and V HChain 1 pairing and V LChain 2 and V HCould generate bi-specific antibody after chain 2 pairings.There are two kinds of different modes to prepare this kind bi-specific antibody.First kind of mode is the combination V of synantigen/epi-position not by two existence H/ V LRight combination (as bi-specific antibody IgG).V like this H/ V LThe ratio that occurs together is necessary for 1: 1, so that all antibody molecules of synthetic are the colony of dual specific.Can not occur bi-specific antibody and can only combine with a kind of antigen/epi-position and can not with the mixture (even when strengthening complementary CH district) of another kind of bonded antibody molecule by the convex-concave anastomosis.The second way that forms bi-specific antibody is by two different V HChain and two different V LCombination (as the dual specific double antibody) in the time of chain.Though tend to V like this LChain 1 and V HChain 1 coupling, V LChain 2 and V H(this can pass through V to chain 2 couplings LDistrict and V HThe transformation in district's " convex-concave coincide " and strengthen), this coupling will never occur in all molecules, can form form of mixtures, makes mispairing cause some antibody can not be in conjunction with arbitrary antigen or epi-position.
The bi-specific antibody that makes up according to the dual specific part method of first aspect present invention has overcome all these problems, and reason is to be positioned at V with antigen or epi-position 1 bonded residue HOr V LIn the district, be positioned at complementary V with antigen or epi-position 2 bonded residues HOr V LIn the district, these two kinds of combinations are independently.Because V H/ V LTo being 1: 1, so whole V H/ V LTo be dual specific and use these V H/ V LThe activity that the form of ownership (Fv, scFv, Fab, microbody (minibody), IgG etc.) that makes up is had 100% dual specific.
In the context of the invention first and second " epi-position " can be regarded as different epi-positions and not by the combination of single monospecific part.In one aspect of the invention, described epi-position is on synantigen not, and the effect of one of them is to increase the transformation period in the part body.Same favourable part is that first and second antigens are inequality.
Dual specific part among the present invention does not comprise the described part of WO02/02773, and therefore, the part among the present invention does not comprise by the complementary V of acting in conjunction (co-operatively) in conjunction with any one or more antigen or epi-position H/ V LRight.On the contrary, the part of first aspect present invention comprises V H/ V LComplementary pair, wherein said V district has not homospecificity.
In addition, the part of first aspect present invention comprises that incoherent epi-position or antigen on the structure are had not homospecific V H/ V LComplementary pair.The epi-position or the antigen of being correlated with on the structure, they have sufficient structural similarity, so that obtain conventional V H/ V LThe combination of complementary pair, and these conventional complementary pairs are in conjunction with epi-position or antigen by the acting in conjunction mode.The epi-position of this structurally associated is structurally quite similar, and this makes them " be fit to " enter V H/ V LIn the same binding pocket that forms on the dimer antigen binding site.
Second aspect present invention provides a kind of part, comprise having first antigen/first immune globulin variable region of epi-position binding specificity and have second immune globulin variable region of second antigen/epi-position binding specificity, wherein said first and second variable regions one or both of are in conjunction with the antigen that increases the part transformation period in vivo, and the variable region is not complementary between mutually.
In one embodiment, regulate the combination of part with combining of a variable region with second variable region.
In this embodiment, the variable region can for example be V HThe district to or V LIt is right to distinguish.May regulate (strengthening or inhibition) and antigen combining in second site being combined with of first site with antigen.For example, the small part that is bonded in first site suppresses the combination of antigen in second site.In such embodiments, part continue to exist in host organisms by make part in conjunction with a kind of albumen that increases the part transformation period, combines with second target antigen and dissociates with the albumen of prolong half-life up to part.
Mentioned above can be used as the contiguous result of the mutual structure of antigen binding site in conjunction with modulation, this structure vicinity can be passed through the essence decision of the constituent of two or more antigen binding site of connection, for example, provide a kind of part that has held the relative rigidity structure of the antigen binding site that is close to.Advantage is, and is very approaching each other on physics between these antigen binding sites, therefore, makes the combination of a site modulation antigen molecule in another site by the sterically hindered and/or conformational change in the immunoglobulin molecules.
First and second antigen binding domains can be with covalently or non-covalently mode combination.With covalent manner in conjunction with the time, in conjunction with can be by disulfide linkage or peptide linker as (Gly 4Ser) nMediation, n=1-8 wherein, for example: 2,3,4,5 or 7.
Part can be formed the multivalence mixture with NIg polygamy based structures among the present invention, combines with the target molecule with same antigen, therefore has high affinity, simultaneously at least one variable region in conjunction with a kind of antigen to increase the polymeric transformation period.For example, the natural bacteria acceptor as: SpA is used as supporting structure (Scaffold), with CDRs transplant with produce can specificity in conjunction with the part of one or more epi-positions.These process detail file are at US 5,831, describe in 012.Other supporting structure that is suitable for comprises those materials based on fibronectin and affinity body (affibody).The usability methods detail file are described in WO 98/58965.Supporting structure lipocallin and CTLA4 that other is suitable, referring to van denBeuken etc., J.Mol.Biol.310,591-601 (2001), the support of describing in WO0069907 (MedicalResearch Council) are based on the ring texture of bacterium GroEL or other companion's polypeptide.
The albumen supporting structure can make up, and for example, CDR can be grafted on the CTLA-4 supporting structure, and with the V of immunoglobulin (Ig) HDistrict or V LThe district uses together and forms part.Equally, fibronectin, lipocallin and other supporting structure also can make up.
If variable region described herein is from the V district gene pool that adopts the display technique of bacteriophage screening, these variable regions can comprise a general framework district so, can be belonged to class part (specific generic ligand) identification by the specificity in this definition.General framework, genus class part (generic ligand) or the like are described in W099/20749.The phage display that relates among the present invention comprises the application of phage and/or phagemid.
When adopting the V gene pool, the variation of peptide sequence is preferable in the structure ring of variable region.Adopt DNA reorganization or mutating technology, can change the variable region peptide sequence, to strengthen the interaction between each variable region and its complementary pair.
" dual specific part " is a kind of single chain (singlechain) Fv fragment in the preferred embodiments of the invention.Among the present invention in another embodiment the dual specific part form by the Fab district of antibody molecule.Term " Fab district " comprises Fab sample district, has wherein used two V HDistrict or two V LThe district.
The variable region can be from the antibody at target antigen or epi-position.Perhaps, the variable region also can storehouse from the single antibody district that is expressed in the filobactivirus surface such as those in.System of selection is as described below.
The third aspect, the invention provides a kind of method for preparing part, this part comprises single variable region of first immunoglobulin (Ig) with first binding specificity and the single variable region of the second single immune globulin with second (different) binding specificity (Single immunoglobulin single variable domain), described binding specificity one or both of is that specificity is at a kind of antigen molecule that can prolong the transformation period in the part body, this method may further comprise the steps: (a) according to selecting first variable region with first epi-position bonded ability, (b) according to selecting second variable region, (c) make up these variable regions with second epi-position bonded ability; (d) according to screening part with the above-mentioned first and second epi-position bonded abilities.
Part can combine with above-mentioned first and second epi-positions simultaneously, perhaps when having epi-position bonded competition between the land and occur a zone in conjunction with combination of getting rid of another zone and its related epi-position.Therefore, in one embodiment, require simultaneously in conjunction with first and second (may be more) epi-positions in the above-mentioned steps (d).In another embodiment, be not simultaneously with combining of first and second epi-positions.
Described epi-position is preferably on synantigen not.
Advantageously, part comprises the V of aforesaid immune globulin variable region H/ V L, V H/ V HOr V L/ V LCombination.In addition, part can comprise Camelid V HHThe district.As long as at the V that can prolong the antigen-specific of transformation period in the part body HHThe district can not be in conjunction with as Conrath etc., JBC 276:7346-7350 (2001) and the white N,O-Diacetylmuramidase of the ovum gallinaceum described in the W099/23221 (hen egg whitelysozyme) (HEL), pig pancreas αDian Fenmei or NmC-A, hcg, the BSA-nitrogenous dyestuff of RR6 or the S.mutans HG982 cell that are connected, above-mentioned document is not all described at the antigenic specific application that prolongs the transformation period in the part body.
In one embodiment, above-mentioned first variable region is according to combining with above-mentioned first epi-position and screen lacking under the situation of complementary variable region it.In another embodiment, above-mentioned first variable region is that here the 3rd variable region is different from above-mentioned second variable region according to it can combine with above-mentioned first epi-position/antigen and screens under the situation about existing in the 3rd variable region, it and the first variable region complementation.Equally, second variable region also can have/is screening under the situation of no complementary variable region.
The target antigen of part or epi-position also can be any antigen or epi-position except being can increase the albumen of transformation period among the present invention, but best be target antigen or epi-position with therapeutic value.Part provided by the invention comprises specificity at described target, particularly the part and the isolating dAb monomer part of the opening/closed type conformation of the progressive target of determining.These targets can or be natural or synthetic polypeptide, albumen or nucleic acid partly.Like this, the part among the present invention can be in conjunction with epi-position or antigen, and can be used as antagonist (antagonist) or agonist (agonist) work (as: EPO receptor stimulant).The selection that those skilled in the art will know that described target is extensively various.For example, they can be that the cofactor (enzyme co-factor) or the DNA of human or animal's albumen, cytokine, cytokine receptor, enzyme is conjugated protein.Suitable cytokine and somatomedin include but are not limited to ApoE, Apo-SAA, BDNF, heart nutrient protein-1 (Cardiotrophin-1), EGF, EGF acceptor, ENA-78, Eotaxin, Eotaxin-2, Exodus-2, EpoR, acid FGF, basic FGF, fibroblast growth factor-10, FLT3 part, CX3C chemokine (Fractalkine) (CX3C), GDNF, G-CSF, GM-CSF, GF-β 1, Regular Insulin, IFN-γ, IGF-I, IGF-II, IL-1 α, IL-1 β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (72a.a.), IL-8 (77a.a.), IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18 (IGIF), α statin (inhibin), β statin, IP-10, keratinocyte growth factor-2 (KGF-2), KGF, Leptin, LIF, lymphocyte chemotactic factor (LCF), mullerian inhibitor (Mullerian inhibitory substance), monocyte colony inhibition factor, MCP (monocyte attractant protein), M-CSF, MDC (67a.a.), MDC (69a.a.), MCP-1 (MCAF), MCP-2, MCP-3, MCP-4, MDC (67a.a.), MDC (69a.a.), MIG, MIP-1 α, MIP-1 β, MIP-3 α, MIP-3 β, MIP-4, marrow sample progenitor inhibitory factor (myeloidprogenitor inhibitor factor)-1 (MPIF-1), NAP-2, Neurturin, nerve growth factor, β-NGF, NT-3, NT-4, oncostatin (Oncostatin) M, PDGF-AA, PDGF-AB, PDGF-BB, PF-4, RANTES, SDF1 α, SDF1 β, SCF, SCGF, STEM CELL FACTOR (SCF), TARC, TGF-α, TGF-β, TGF-β 2, TGF-β 3, tumour necrosis factor (TNF), TNF-α, TNF-β, TNF acceptor I, TNF receptor II, TNIL-1, TPO, VEGF, vegf receptor 1, vegf receptor 2, vegf receptor 3, GCP-2, GRO/MGSA, GRO-β, GRO-γ, HCC1,1-309, HER 1, HER 2, HER 3 and HER 4.Cytokine receptor comprises the acceptor of aforesaid cytokine.More than be used for not representing to be only limited to listed material for example.
In one embodiment of the invention, the variable region is from the different antibody at antigen or epi-position.In preferred embodiments, the variable region is from storehouse, the single variable region of antibody.
In addition, the invention provides one or more nucleic acid molecule, at least a dual specific part of encoding in this definition.Single nucleic acid molecule codified dual specific part; Perhaps each district can be respectively by a nucleic acid molecule encoding independently.By the part of single nucleic acid molecule encoding, functional zone can fusion polypeptide, the scFv molecular form is expressed, and perhaps expresses linking together at last respectively, for example uses chemical linking agent.The part that the different IPs acid molecule is expressed can link together by rights.
Nucleic acid further coded signal sequence also can be when expressing merges with the surface composition of filobactivirus grain (or screen other composition of the display systems) with the polypeptide output of guiding host cell expression.
The present invention further provides a kind of carrier, comprised the nucleic acid of code book invention dual specific part.
The present invention further provides a kind of host cell, and transfection has the carrier of the dual specific part of indication in the code book invention.
This kind carrier for example can be constructed as in phage grain surface expression variable region for you to choose.Adopt method of the present invention to allow to screen variable region and the dual specific part of being showed like this.
The present invention further provides the test kit that comprises at least a dual specific part of the present invention.
Dual specific part of the present invention preferably comprises the combination product (combination) in heavy chain district and light chain district.For example, the dual specific part can comprise V HDistrict and V LThe district, they link together with the scFv form.In addition, part can comprise one or more C HDistrict and C LThe district.For example, part can comprise C H1, C H2 or C H3 districts, and/or C LThe district, C μ1, C μ2, C μ3 or C μ4 districts, or their arbitrary combination.In hinge area also can be included in.The combination of these functional zone can for example simulate natural antibody as IgG or IgM, or their fragment is as Fv, scFv, Fab or F (ab ') 2Molecule.Other structure is as including V H, V L, C H1 and C LThe single armed of the IgG molecule in district is also in the middle of imagination.
In the preferred embodiment of the invention, screen from single V district gene pool the variable region.Usually, the storehouse in single antibody function district is showed on the filobactivirus surface.In the preferred embodiment of the invention, screen by phage library and antigen bonded mode in each single antibody district.
Each single variable region is according to its screening that combines with target antigen/epi-position under the situation that lacks complementary variable region in the preferred embodiment of the invention.In another embodiment, single variable region is according to its screening that combines with target antigen/epi-position under the situation of complementary variable region existence.Therefore, first single variable region can exist under the situation the 3rd complementary variable region screens, and second variable region can exist under the situation the 4th complementary variable region screens.Complementary the 3rd or the 4th variable region can be to have and tried mutually homospecific natural related variable region, single variable region (natural cognatevariable domain), or the complementary district of dereferenced as: " simulation (dummy) " variable region.
Dual specific part of the present invention preferably includes only two variable regions, forms same albumen although several such part can be combined, and for example two such parts can be included into IgG or poly-ig as IgM.Perhaps, in another embodiment, a plurality of dual specific ligand combination form a polymer together.For example, two kinds of different dual specific ligand combination generate four specific moleculars.
The light chain and the variable region of heavy chain that it will be understood to those of skill in the art that the dual specific part for preparing according to the inventive method can be on same polypeptide chains, on the perhaps different polypeptide chains.If the variable region is on different polypeptide chains, they can pass through a joint so, normally flexible joint such as polypeptide chain, and cytotoxic compounds, or other method arbitrarily known in the art connects.
On the other hand, the invention provides a kind of composition, it comprises a kind of dual specific part and a kind of carrier, diluent or vehicle that can be used in the medicine that can obtain by method provided by the invention.
In addition, the invention provides a kind of employing dual specific part of the present invention or combination treatment/prophylactic method.
In second kind of configuration, the present invention provides the polyspecific that comprises at least two incomplementarity variable regions part on the other hand.For example, part can comprise a pair of V HDistrict or a pair of V LThe district.The advantage part is variable region right and wrong Camelid source, and preferably they are the functional zone in people source or comprise people source framework region (FWs) and one or more allos CDR.CDR and framework region are the immune globulin variable regions that define in the immune associated protein sequence Kabat database.
Preferred people source framework region is gene fragment DP47 and DPK9 coding by kind.The advantage part is V HDistrict or V LFW1 in the district, FW2 and FW3 have the FW1 from DP47 or DPK9, FW2 or FW3 sequence.The framework in people source can be chosen wantonly and comprise sudden change, for example, can comprise in the people source framework that uses in part of the present invention and for example reaches about 5 or 10 amino acid whose changes altogether.
The polyspecific part variable region of second configuration can a kind of opening or closed conformational array among the present invention, that is to say, they can be combined on the related part simultaneously independently, perhaps have only a variable region to be combined on its related part at any one time.
The inventor recognizes under some structural states, incomplementarity variable region (as: two variable region of light chain or two variable region of heavy chain) can appear in the part, so that first epi-position and first variable region combine combining of inhibition second epi-position and second variable region, even this incomplementarity district does not play a role to mode together with association.
Part advantage of the present invention is to comprise two pairs or more variable region, that is to say, comprises at least 4 variable regions; People source framework is contained in preferred these four variable regions.
In preferred embodiments, people source framework is that sequence is consistent with ethnic group.
The present inventor thinks to have special purpose in the part binding analysis of this antibody in treatment or other application.
Therefore, the first aspect of second kind of configuration of the present invention, the method for preparing the polyspecific part is provided, may further comprise the steps: a) select can with first epi-position land of first epi-position bonded, b) select can with second epi-position land of second epi-position bonded, c) make up these epi-position lands, and d) screening can with the polyspecific part of the closed conformation of the above-mentioned first and second epi-position bonded.
Second kind of configuration of the present invention on the other hand, a kind of method for preparing the polyspecific part of closed conformation is provided, this polyspecific part comprises the first epi-position land with first epi-position binding specificity and has the non-complementary second epi-position land of the second epi-position binding specificity, wherein first and second binding specificities competition epi-position combination, cause the polyspecific part of this closure conformation cannot be simultaneously in conjunction with two epi-positions, aforesaid method may further comprise the steps: a) select can with first epi-position land of first epi-position bonded, b) select can with second epi-position land of second epi-position bonded, c) make up these epi-position lands so that described location in closed conformation, and d) according to the above-mentioned first and second epi-position bonded abilities rather than simultaneously screen the polyspecific part of closed conformation with above-mentioned two epi-position bonded abilities.
In addition, the invention provides a kind of polyspecific part of closed conformation, comprise first epi-position land with first epi-position binding specificity and the non-complementary second epi-position land with second epi-position binding specificity, wherein, the combination of first and second binding specificities competitions epi-position causes the polyspecific part of closed conformation cannot be simultaneously in conjunction with two epi-positions.
The embodiment of another selection of above-mentioned second configuration of the present invention can be chosen wantonly and comprise other step (b1), comprises screening the 3rd or further epi-position land.Like this, no matter be open or closed conformation, the polyspecific part that is produced all contains two above epi-position binding specificities.The preferred aspect of the present invention's second configuration, when the polyspecific part comprises plural epi-position land, at least two districts in the described district are closed conformation and competition combination, and other district can compete combination also can the epi-position combination related with it of independence and freedom ground.
With reference to the present invention, term " polyspecific part " is meant the part of the epi-position binding specificity with more than one of definition here.
Here Ding Yi term " closed conformation " (polyspecific part) is meant that the epi-position land of part depends on mutually or mutually combines, optional by the albumen framework, the epi-position that causes an epi-position land is in conjunction with combining competition with the epi-position of another epi-position land.That is to say that related epi-position is independent rather than combination simultaneously by each epi-position land.The closed conformation of part can obtain by method described herein.
" open conformation " is meant that the epi-position land of part depends on mutually or mutually combines, and optional by the albumen framework, the epi-position that causes an epi-position land is in conjunction with or not competition with the epi-position of another epi-position land.
About the term " competition " here be meant when second epi-position epi-position land related with it in conjunction with the time, the combination of the epi-position land that first epi-position is related with it is suppressed.For example, in conjunction with can spatially being suppressed, for example:, cause with epi-position bonded avidity or avidity and reduce by the physical containment of land or by the structure of land or the change of environment.
In the further solid yardage case of the present invention's second configuration, but epi-position in conjunction with the time phase double replacement (displace).For example, first epi-position can be present on the antigen, first epi-position, first land related with it in conjunction with the time can cause sterically hindered or configuration to change to second land, replaced like this and the second land bonded epi-position.
The preferred combination ability reduces by 25% or more, preferred 40%, 50%, 60%, 70%, 80%, 90% or more, preferably up to 100% or be close to 100%, so that in conjunction with being suppressed fully.Epi-position in conjunction with the antigen binding analysis of available routine as ELISA, or based on the technology of fluorescence as FRET, or the surface plasma body resonant vibration technology methods such as (suface plasmon resonance) of measuring molecular mass is measured.
Preferred each the epi-position land of method provided by the invention has different epi-position binding specificities.
In the context of the invention first and second " epi-position " can be regarded as epi-position inequality and not by the combination of single monospecific part.They can be distributed in not on the synantigen, or are distributed on the same antigen, but separate with sufficient distance, and not forming can be by single monospecific V in the conventional antibody H/ V LIn conjunction with to the bonded single entity.In the experiment, if independently two variable regions of single-chain antibody form (functional domain antibody (domain antibody), or dAb) are by a monospecific V at two epi-positions H/ V LPart is competed respectively, thinks that so these two epi-positions are far away inadequately apart, can not think the epi-position of separating of indication of the present invention.
The polyspecific part of closed conformation does not comprise the part of describing among the WO 02/02773 among the present invention.Therefore, among the present invention part do not comprise can be by the complementary V of acting in conjunction in conjunction with any one or more antigen or epi-position H/ V LRight.Replace, the part among the present invention preferably includes non-complementary V H-V HTo or V L-V LRight.Preferably, at each V H-V HOr V L-V LEach V of centering HDistrict or V LThe district has different epi-position binding specificities.And the epi-position binding site is so arranged the epi-position that makes on the site in conjunction with the epi-position combination on another site of competition.
According to the present invention, preferably each epi-position land comprises immune globulin variable region; That have more advantage is each immune globulin variable region or variable region of light chain (V L) or variable region of heavy chain (V H).In second configuration of the present invention, the functional zone that are present in the immunoglobulin (Ig) in the part of the present invention are non-complementary, and that is to say, they do not combine into V H/ V LAntigen binding site.Therefore, the polyspecific part of second configuration definition comprises the functional zone of the immunoglobulin (Ig) of same hypotype among the present invention, that is, and and variable region of light chain (V L) or variable region of heavy chain (V H).In addition, when part of the present invention was closed conformation, the functional zone of described immunoglobulin (Ig) can be Camelid V HHType.
In another embodiment, part of the present invention does not comprise CamelidV HHThe district.More particularly, the part among the present invention does not comprise the V with respect to the people HQu Eryan is CamelidV HHDistinguish distinctive one or more amino-acid residue.
Preferred single variable region is from synantigen or epi-position do not have in conjunction with active antibody.For example, can partly isolate the variable region at least by artificial immunization.Other method also is known in this area, comprises from the separation of people's antibody library or synthesizing by artificial antibody's gene.
But variable region preferred combination superantigen is as albumin A or albumen L.Can be a characteristic of the correct antibody variable region that folds in conjunction with superantigen, make these variable regions from the library, functional zone of reorganization or sudden change, separate.
The epi-position land comprises albumen framework and epi-position interaction sites (preferably being present in albumen framework surface) among the present invention.
The epi-position land also can be based on albumen framework rather than immunoglobulin domain.For example, natural bacteria acceptor such as SpA etc. have been used as the framework of grafting CDR, with generate can with one or more epitope specificity bonded parts.The detail file of this method are referring to US 5,831,012.Other suitable framework comprises those frameworks based on fibronectin and affine body.Usability methods describes in detail in WO 98/58965.Other suitable framework comprises: lipocallin and CTLA4, referring to van den Beuken etc., J.Mol.Biol.310,591-601 (2001), and such as those frameworks of describing in WO0069907 (Medical Research Council), they are based on the ring texture of bacterium GroEL for example or other companion's polypeptide.
The albumen framework can make up, and for example, CDR can graft on the CTLA-4 framework, and and IgV HDistrict or V LThe district forms multivalent ligand together.Equally, fibronectin, lipocallin and other framework also can make up.
The epi-position land that it will be understood to those of skill in the art that the closed conformation polyspecific part for preparing according to the inventive method can be on same polypeptide chain, on the perhaps different polypeptide chains.If the variable region is on different polypeptide chains, they can link to each other by joint so, preferably normally flexible joint such as polypeptide chain, cytotoxic compounds, or other method arbitrarily known in the art.
Covalently or non-covalently mode combination can be passed through in the first and second epi-position lands.If described district is a covalent attachment, so in conjunction with can for example mediating by disulfide linkage.
In the present invention's second configuration, first and second epi-positions are preferably different.They can all or part ofly be polypeptide, and albumen or nucleic acid can be natural or synthetic.Like this, the part among the present invention can be in conjunction with epi-position or antigen, and as antagonist or agonist work (as: EPO receptor stimulant).The epi-position land of part has identical epitope specificity in one embodiment, can be for example simultaneously in conjunction with its corresponding epi-position (on a plurality of epi-positions copy out now with a kind of antigen time).These epi-positions are provided by different antigen in another embodiment, so part can be in conjunction with epi-position and the described antigen of bridging.It will be understood by those skilled in the art that to epi-position and antigenic selection be extensive and various.For example, they can be that human or animal's albumen, cytokine, cytokine receptor, enzyme co-factor or DNA are conjugated protein.Suitable cytokine and somatomedin include but are not limited to ApoE, Apo-SAA, BDNF, heart nutrient protein-1, EGF, EGF acceptor, ENA-78, Eotaxin, Eotaxin-2, Exodus-2, EpoR, acid FGF, basic FGF, fibroblast growth factor-10, FLT3 part, CX3C chemokine (CX3C), GDNF, G-CSF, GM-CSF, GF-β 1, Regular Insulin, IFN-γ, IGF-I, IGF-II, IL-1 α, IL-1 β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (72a.a.), IL-8 (77a.a.), IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18 (IGIF), α statin, β statin, IP-10, keratinocyte growth factor-2 (KGF-2), KGF, Leptin, LIF, lymphocyte chemotactic factor (LCF), mullerian inhibitor, monocyte colony inhibition factor, MCP, M-CSF, MDC (67a.a.), MDC (69a.a.), MCP-1 (MCAF), MCP-2, MCP-3, MCP-4, MDC (67a.a.), MDC (69a.a.), MIG, MIP-1 α, MIP-1 β, MIP-3 α, MIP-3 β, MIP-4, marrow sample progenitor inhibitory factor-1 (MPIF-1), NAP-2, Neurturin, nerve growth factor, β-NGF, NT-3, NT-4, oncostatin M, PDGF-AA, PDGF-AB, PDGF-BB, PF-4, RANTES, SDFl α, SDF1 β, SCF, SCGF, STEM CELL FACTOR (SCF), TARC, TGF-α, TGF-β, TGF-β 2, TGF-β 3, tumour necrosis factor (TNF), TNF-α, TNF-β, TNF acceptor I, TNF receptor II, TNIL-1, TPO, VEGF, vegf receptor 1, vegf receptor 2, vegf receptor 3, GCP-2, GRO/MGSA, GRO-β, GRO-γ, HCC1,1-309, HER 1, HER 2, and HER 3, and HER 4, the TACE recognition site, TNF BP-I and TNF BP-II, and in this paper annex 2 and annex 3 disclosed any target material, can be array mode to set forth in the annex, with different array modes or independently exist.
Acceptor that cytokine receptor comprises aforementioned cytokine is as IL-1 RI; IL-6R; IL-10R; IL-18R, and disclosed acceptor in the acceptor of the cytokine of illustrating in annex 2 or 3 and annex 2 and 3.Be appreciated that cited example is not limit.When polyspecific part during, select during from then on described antigen can tabulate in conjunction with two epi-positions (two epi-positions on the identical or different antigen).
The dual specific part preferably can be used for targeting in cytokine and other synergistic molecule under organism treatment situation.Therefore, the invention provides the method that increases two or more cytokine activity, comprising: give a kind of can be in conjunction with the dual specific part of above-mentioned two or more cytokine.In this invention, the dual specific part can be any dual specific part, comprising: contain the part in complementation and/or incomplementarity district, the part of open conformation and the part of closed conformation.For example, this respect of the present invention relates to V HDistrict and V HThe assembly thing (combinations) in district has only V HDistinguish the assembly thing and have only V LDistrict's assembly thing.
Synergy in the treatment environment can obtain by number of ways.For example, if under the condition that two target position are aimed at by part, purpose assembly thing just has therapeutic activity, does not have therapeutic activity and only aim at a target position.In another embodiment, target can provide a little or minimal therapeutic effect separately, and but, combining with second target position to provide a kind of treatment of collaborative rising effect.
The dual specific part bonded cytokine of preferred this respect of the present invention is selected from annex 2 tabulations.
In addition, the dual specific part can be used in the oncology applications, and one of them specific target is the CD89 that is expressed on the cytotoxic cell, and another is a tumour-specific.Example as the tumour antigen of target provides in annex 3.
In the embodiment of the present invention's second configuration, the variable region is from the antibody at first and/or second antigen or epi-position.In the preferred embodiment, in the storehouse of variable region from single antibody variable region.In an example, this storehouse be not produce in animal body or synthetic.In another example, (to small part) do not separated by animal immune in single variable region.Therefore single zone can be separated from initial library (naive library).
Second kind of configuration of the present invention provides a kind of polyspecific part on the other hand, comprises first epi-position land with first epi-position binding specificity and the incomplementarity second epi-position land with second epi-position binding specificity.Described first and second binding specificities can be identical or different.
In addition, the present invention further provides a kind of polyspecific part of closed conformation, comprise first epi-position land with first epi-position binding specificity and the non-complementary second epi-position land with second epi-position binding specificity, wherein, first and second binding specificities can be competed the epi-position combination, cause the polyspecific part of closed conformation can not be simultaneously in conjunction with two epi-positions.
The present invention further provides the part of open conformation, comprises the incomplementarity land, and wherein, the land is the different epi-positions of specificity at same target thing.This part with the enhanced avidity in conjunction with target.Equally, the invention provides multivalent ligand, comprise the incomplementarity land of specificity, point to the target that comprises the described epi-position of multiple copied at identical epi-position, as: IL-5, PDGF-AA, PDGF-BB, TGF-β, TGF-β 2, TGF-β 3 and TNF α, for example: people TNF acceptor 1 and human TNF alpha.
With one side, part of the present invention can be configured to the part of low-affinity in conjunction with independent epi-position, and causing in conjunction with independent epi-position does not have the treatment meaning; But can increase avidity in conjunction with two epi-positions can provide the treatment benefit.In one example, on the normal cell type self-existent and only unusual or sick cell as: merging the epi-position that exists on the tumour cell can be by target.In this case, have only unusual or sick cell could be by the dual specific part efficient targeting among the present invention.
Specificity can also be tripolymer or polymer (tetramer or more) part at the part (being called chelating dAb) of same epi-position of the multiple copied on the identical target or adjacent epi-position, comprises 3,4 or more incomplementarities land.For example, part can be built into and contain 3 or 4 V HDistrict or V LThe district.
In addition, also provide the part in conjunction with many subunits target, here, each land specificity is at the subunit of above-mentioned target.Part can be dimer, tripolymer or polymer.
Preferably above-mentioned aspect polyspecific part can obtain by the method for first aspect present invention according to the present invention.
According to the above-mentioned aspect of second configuration of inventing, the preferred first epi-position land and the second epi-position land are the incomplementarity immune globulin variable regions, as definition here.That is: both can be V H-V HOr V L-V LThe variable region.
Concrete is that huge legendary turtle is closed dAb and can prepare according to a preferred aspect of the present invention promptly, adopts grappling dAb preparation.At this, adopted vector construction dimerization, trimerization or poly dAb library, this carrier comprises constant dAb, is positioned at joint sequence upstream or downstream, and inserts second, third and other dAb storehouse at the other end of joint.For example, grappling or guiding dAb can be TAR1-5 (V κ), TAR1-27 (V κ), TAR2h-5 (V H) or TAR2h-6 (V κ).
Use diverse ways, can avoid the application of joint, for example, can adopt non covalent bond or land as V HAnd V KBetween natural avidity.Therefore the invention provides a kind of method that huge legendary turtle is closed the poly part for preparing, comprise following steps: a kind of carrier (a) is provided, contains the nucleotide sequence of coding specificity at the single land of first epi-position of target; (b) provide a kind of carrier, coding comprises the storehouse of special second land at second epi-position on the above-mentioned target, and second epi-position and first epi-position can be identical or different, and described second epi-position and described first epi-position are contiguous; And (c) express first and second lands; And (d) separate the assembly thing that those first and second lands combine, be prepared into target in conjunction with dimer.
First and second epi-positions are contiguous, so the poly part can be combined on these epi-positions simultaneously.The part that provides like this have in conjunction with the time avidity enhanced advantage.When epi-position was identical, the enhanced avidity obtained by there being the multiple copied epi-position on the target, and in order to obtain avidity enhanced effect, allowing has the epi-position of two copies combined at least simultaneously.
The land can be by the several method combination, and is the same with the application of joint good.For example, the land can comprise that cys residue, affinity element and strepto-affinity plain gene or alternate manner are to synthesize non-covalent adhering to of back.Effectively in conjunction with those assembly things of target with separated.Perhaps, joint can appear between first and second lands, and these lands can be expressed with single polypeptide form from single carrier, and this polypeptide comprises first land, joint and storehouse, second land, as mentioned above.
One preferred aspect, during conjugated antigen, first and second lands are natural combination, for example, V HDistrict and V κThe district will be combined into stable dimer with three kinds of interaction modes naturally in conjunction with adjacent epi-position the time, this bonded albumen can be separated in conjunction with experiment by target.This method advantage is, having only could be with correct configuration combination in conjunction with the land of phase neighbour's epi-position, therefore because it is to the high affinity of target and separated.
In another example of the above-mentioned aspect of second configuration, at least one epi-position land comprises NIg " albumen framework " or " albumen support " in the foregoing invention, as what define here.The NIg framework that is suitable for includes but are not limited to from SpA, fibronectin, GroEL and other mate molecule, lipocallin, any that select in CTLA-4 and the affine body (as mentioned above).
The above-mentioned aspect of second configuration according to the present invention, preferred epi-position land is attached on the albumen framework, and preferred, albumen framework of the present invention is the immunoglobulin (Ig) framework.
Term among the present invention " immunoglobulin (Ig) framework " is meant the albumen that comprises at least one immunoglobulin folding, and can be used as the nuclear of one or more epi-position lands.Just as herein defined.
Here Ding Yi preferred immunoglobulin framework comprises from following any one or more that select: a kind of immunoglobulin molecules comprises at least the C of (i) antibody L(κ or λ hypotype) district; Or (ii) heavy chain of antibody C H1 district; A kind of immunoglobulin molecules contains heavy chain of antibody C H1 district and C H2 districts; A kind of immunoglobulin molecules contains heavy chain of antibody C H1 district, C H2 districts and C H3 districts; Or arbitrary subclass and antibody C (ii) LThe combination in (κ or λ hypotype) district.In hinge area also can be included in.The combination in these districts can for example be simulated natural antibody, as IgG or IgM or its fragment as Fv, scFv, Fab or F (ab ') 2Molecule.It will be understood by those skilled in the art that this is not limit for example.
Connection between framework and the epi-position land as definition here, can obtain in the polypeptide level, promptly after the expression of nucleic acid of coding framework and/or epi-position land.Perhaps, Connection Step can carry out on nucleic acid level.The method that connects albumen framework and one or more epi-position lands according to the present invention comprises that to adopt albumen chemistry and/or Protocols in Molecular Biology, these methods be conventional in this area and at this paper description is arranged.
The polyspecific part of preferred closed conformation can comprise can binding target molecule first district and can be in conjunction with the molecule of prolongation part transformation period or second district of group, for example, described molecule or group can be expanding materials (bulky agent) as HSA or cell matrix albumen.As the phrase of using here " prolong molecule or the group of part transformation period " and be meant by dual specific part described herein in conjunction with after, with respect to molecule or the group of transformation period in the body when increasing these dual specific parts for the part of this molecule or group and use in animal body not.Described hereinafter and can prolong the molecule of part transformation period or the example of group.In a preferred embodiment, closed conformation polyspecific part only could binding target molecule when the transformation period strengthens molecule or group displacement, therefore, for example, closed conformation polyspecific part can by increase-volume molecule (bulky molecule) as: HAS makes it keep circulation in experimenter's blood flow.When running into target molecule, competition causes HSA displacement and in conjunction with target between the closed conformation polyspecific ligand binding domain.
The part of either side of the present invention, and make up dAb monomer used in this part preferred they can be related with it target (cognate target) dissociate dissociation constant (K d) be 300nM-5pM (that is, 3 * 10 -7-5 * 10 -12M), preferred 50nM-20pM, or 5nM-200pM or 1nM-100pM, 1 * 10 -7M or littler, 1 * 10 -8M or littler, 1 * 10 -9M or littler, 1 * 10 -10M or following, 1 * 10 -11M or following; And/or K OffRate constant (K OffRate contant) be 5 * 10 -1-1 * 10 -7S -1, preferred 1 * 10 -2-1 * 10 -6S -1, or 5 * 10 -3-1 * 10 -5S -1, or 5 * 10 -1S -1Or below, or 1 * 10 -2 S -11 or below, or 1 * 10 -3S -1Or below, or 1 * 10 -4S -1Or below, or 1 * 10 -5S -1Or below, or 1 * 10 -6S -1Or below, this measures by surface plasma body resonant vibration (surface plasmonresonance) and draws.Dissociation constant (K d) be defined as K Off/ K On
Particularly the invention provides a kind of anti-TNF alpha dAb monomer (or comprise this dAb dual specific part), homodimer, heterodimer or homotrimer part, here each dAb is in conjunction with TNF α.The bonded Kd of part and TNF α is 300nM-5pM (that is: 3 * 10 -7-5 * 10 -12M), preferred 50nM-20pM, more preferably 5nM-200pM, and 1nM-100pM most preferably; If express K in another way dBe 1 * 10 -7M or following, preferred 1 * 10 -8M or following, more preferably 1 * 10 -9M or following, preferred again 1 * 10 -10M or following, and most preferably 1 * 10 -11M or following; And/or K OffRate constant is 5 * 10 -1-1 * 10 -7S -1, preferred 1 * 10 -2-1 * 10 -6S -1, more preferably 5 * 10 -3-1 * 10 -5S -1, for example 5 * 10 -1S -1Or below, preferred 1 * 10 -2 S -11 or below, more preferably 1 * 10 -3S -1Or below, more preferably 1 * 10 -4S -1Or below, more preferably 1 * 10 -5S -1Or below, most preferably be 1 * 10 -6S -1Or below, draw surely by surface plasmon resonance measurement.
Preferably is, adopts standard L929 to analyze to draw in the part and the ND50 of TNF α is 500nM-50pM preferred 100nM-50pM, more preferably 10nM-100pM, further preferred 1nM-100pM; For example: 50nM or following, preferred 5nM or following, 500pM or following more favourable, more preferably 200pM or following, most preferably 100pM or following.
Suitable more is, part suppresses the combination of TNF α and TNF α R I (p55 acceptor), and IC50 is 500nM-50pM, preferred 100nM-50pM, more preferably 10nM-100pM, preferred 1nM～100pM; For example: 50nM or following, preferred 5nM or following, more preferably 500pM or following, 200pM or following more favourable, and 100pM or following most preferably.Preferably TNF α is a human TNF alpha.
The present invention further provides-the dAb monomer of kind of anti-TNF acceptor I; Or comprising the dual specific part of this dAb, itself and TNF acceptor I bonded Kd are 300nM-5pM (that is, 3 * 10 -7-5 * 10 -12M), preferred 50nM-20pM, more preferably 5nM-200pM and most preferably be 1nM-100pM, for example: 1 * 10 -7M or following, preferred 1 * 10 -8M or following, more preferably 1 * 10 -9M or following, preferred again 1 * 10 -10M or following, and most preferably 1 * 10 -11M or following; And/or K OffRate constant is 5 * 10 -1-1 * 10 -7S -1, preferred 1 * 10 -2-1 * 10 -6S -1, more preferably 5 * 10 -3-1 * 10 -5S -1, for example 5 * 10 -1S -1Or below, preferred 1 * 10 -2 S -11 or below, more preferably 1 * 10 -3S -1Or below, more preferably 1 * 10 -4S -1Or below, more preferably 1 * 10 -5S -1Or below, most preferably be 1 * 10 -6S -1Or below, draw surely by surface plasmon resonance measurement.
Preferably, in the dAb monomer part and the standard test of TNF α (as, L929 described herein or HeLa laboratory method) to record ND50 be 500nM-50pM, preferred 100nM-50pM, more preferably 10nM-100pM, 1nM-100pM is more favourable; For example: 50nM or following, preferred 5nM or following, more preferably 500pM or following, 200pM or following more favourable and 100pM or following most preferably.
Preferably, dAb monomer or part suppress the combination of TNF α and TNF α R I (p55 acceptor), and IC50 is 500nM-50pM, preferred 100nM-50pM, and more preferably 10nM-100pM, 1nM-100pM is more favourable; For example: 50nM or following, preferred 5nM or following, more preferably 500pM or following, 200pM or following more favourable, and 100pM or following most preferably.Preferably TNF acceptor I target is a human TNF alpha.
Further, the invention provides a kind of dAb monomer in conjunction with serum albumin (SA) (or comprise this dAb dual specific part), Kd is 1nM-500 μ M (that is, 1 * 10 -9-5 * 10 -4), preferred 100nM-10 μ M.Preferably, for the dAb that comprises first anti--SA and second dual specific part that resists the dAb of another target, the 2nd dAb (as: gets Kd and/or Koff value by surface plasmon resonance measurement in conjunction with the avidity of its target, for example adopt BiaCore) be 1-100000 times (the preferred 100-100000 of a dAb in conjunction with the avidity of SA, more preferably 1000-100000, or 10000-100000 doubly).For example, a dAb is approximately 10 μ M in conjunction with the avidity of SA, and the 2nd dAb is 100pM in conjunction with the avidity of its target.Preferably, serum albumin is human serum albumin (HSA).
In one embodiment, a dAb (or dAb monomer) in conjunction with SA (as, K HSA) dValue is about 50, and is preferred 70, and more preferably 100,150 or 200nM.
The present invention also provides aforementioned dAb monomeric dimer, tripolymer and polymer, and this is consistent with the aforementioned aspect of the present invention.
Can link to each other with the antibody Fc district according to the dAb of comprising monomer of the present invention, dimer and trimerical part, the Fc district comprises CH2 and CH3 district or one of them, also can choose wantonly to comprise hinge area.For example, the carrier of the part that is connected with a Fc district as single nucleotide sequence of coding can be used to prepare this peptide species.
The present invention's second configuration provides the nucleic acid molecule of at least a polyspecific part of one or more codings this paper definition on the other hand.In one embodiment, part is a kind of closed conformation part.Part is a kind of open conformation in another embodiment.The polyspecific part can be by single nucleic acid molecule encoding; Perhaps, each epi-position land can be by nucleic acid molecule encoding independently.During by single nucleic acid molecule encoding part, described functional zone can be expressed as a kind of fusion polypeptide, perhaps separately express and connect together, for example adopt chemical linking agent.Part by independently nucleic acid molecule expression can connect together by suitable mode.
Nucleic acid is coded signal sequence further, and the polypeptide of auxiliary expression is exported from host cell, and can merge with filobactivirus particle surface composition (or select other composition of the display systems) when expressing.The leader sequence that can be used in the displaying of bacterial expression and/or phage or phagemid comprises pelB, stII, ompA, phoA, bla and pelA.
The present invention's second configuration provides a kind of carrier that comprises nucleic acid of the present invention on the other hand.
The present invention further provides a kind of transfection that the host cell of carrier of the present invention is arranged.
This carrier for example can be built at the phage particle surface expression and produce the binding domain polypeptide that is used to screen.Therefore, adopt method of the present invention can select functional zone and the polyspecific part of being showed.
In the preferred embodiment of the present invention's second configuration, binding domain polypeptide is immune globulin variable region and selects from individual feature district V gene pool.The storehouse of the functional zone of common single antibody is at thread phagemid surface display.In preferred embodiments, the functional zone of each single antibody (domain) selects by phage library and antigen bonded mode.
The present invention also provides a kind of test kit, comprises a kind of polyspecific part among the present invention at least, can be open conformation part or closed conformation part.Test kit of the present invention for example can be: diagnostic kit, treatment test kit or chemistry or biological species (biological species) detection kit or the like.
The present invention's second configuration provides a kind of Advances in Homogeneous Immunoassay (homogenous immunoassay) of utilizing part of the present invention on the other hand.
The present invention's second configuration provides a kind of composition on the other hand, comprises applicable carrier, diluent or vehicle on the closed conformation polyspecific part that can obtain by the inventive method and the pharmacology.
In addition, the invention provides the closed conformation polyspecific part that adopts among the present invention or the method for its composition therapeuticing disease.
Disease in a preferred embodiment of the present invention is cancer or diseases associated with inflammation as rheumatoid arthritis, asthma or Crohn disease (Crohn ' s disease).
The present invention's second configuration provides a kind of diagnostic method on the other hand, comprises that the closed conformation polyspecific part or its composition that adopt among the present invention diagnose the illness.Therefore, common a kind of analyte (analyte) can be used as a kind of reagent of displacement with combining of closed conformation polyspecific part, causes signal generation in the replacement process.For example: the enzyme (first antigen) of the displacement of the bound energy of analyte (second antigen) and antibodies provides the immunoassay basis, particularly the enzyme by avtive spot and antibodies.
Therefore, last aspect of the present invention's second configuration provides a kind of method that target molecule exists that detects, comprise: a kind of closed conformation polyspecific part that is combined on a kind of reagent (a) is provided, above-mentioned ligand specificity is at described target molecule and described reagent, wherein, the described reagent that is combined on the part causes a kind of generation of surveying signal when part is replaced; (b) make closed conformation polyspecific ligand exposed in described target molecule; And (c) detect as the reagent displacement signal that the result produced.
The above-mentioned aspect of second configuration according to the present invention, advantage is that reagent is enzyme, non-activity when this enzyme combines with closed conformation polyspecific part.Perhaps, reagent can be to be selected from following group one or more: enzyme substrates, fluorescence molecule, light emitting molecule or chromonic molecule, non-activity or cancellation when it combines with part.
Similar or the homology with sequence disclosed herein (as, at least about 70% sequence identity) sequence also be the part of invention.In certain embodiments, on amino acid levels, sequence identity may be about 80%, 85%, 90%, 91%, 92%,, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher.Sequence identity on the nucleic acid level may be about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher.Perhaps, when the complementary strand hybridization of nucleic acid fragment (as: under the very high stringent hybridization condition) and this chain under the selective cross condition, there is substantive identity (substantial identity).Nucleic acid can be present in whole cell or the cell lysate, or exists with partial purification or abundant purified form.
The calculating of the homology of two sequences or sequence identity or similarity (term can be used alternatingly herein) is undertaken by laxative remedy.For the best compares purpose, sequence is arranged (as: for optimal arrangement, can introduce breach and can ignore non-homogeneous sequence in order to compare purpose in first and/or second amino acid or nucleotide sequence).In a preferred embodiment, the length that is used for the reference sequences of being compared of comparison purpose is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even the more preferably length of at least 70%, 80%, 90%, 100% reference sequences.Then, amino-acid residue or the nucleotide residue on more corresponding amino acid position or the nucleotide position.When position in first sequence was occupied by the same amino acid residue on the second sequence corresponding position or Nucleotide, so described molecule was identical on this position.(amino acid of Shi Yonging or nucleic acid " homology " equal amino acid or nucleic acid " identity " herein).The per-cent of two sequence identity is functions of the number of the total same position of described sequence, considers the length of breach number and each breach, and it is required that the introducing of breach is that two sequences reach optimal arrangement.
Advantageously, there is the BLAST algorithm (version 2.0) of default value parameter to can be used to collating sequence.In state-run biotechnology information center (" the .ncbi ") network address (" www ") of NIH of United States Government (" .gov ") (" .nih "), be described in detail the BLAST algorithm, in " blast_help.html " file in "/Blast/ " directory.Search parameter is defined as follows, and is provided with the default value of definition easily.
BLAST (the local comparison in basis research tool, Basic Local Alignment Search Tool) heuristic search rule is used by blastp, blastn, blastx, tblastn and tblastx supervisor; The significance of these programs owing to use Karlin and Altschul in 1990 at Proc.Natl.Acad.Sci.USA 87 (6): statistical method among the 2264-8 (referring to above-mentioned " blast help.html " file) and the improved discovery of minority.Blast program is used for the sequence similarity search through transformation, for example: the homologous sequence of determining search sequence.This program is not suitable for motif-pattern search usually.Basic problem is referring to (1994) such as Altschul in the relevant similarity searching sequence library.
Can find 5 kinds of blast programs in the NCBT network address, they carry out following task:
" blastp " compares amino acid search sequence and protein sequence database;
" blastn " compares nucleotide query sequence and nucleotide sequence database;
" blastx " compares the supposition translation product and the protein sequence database of nucleotide query sequence (two strands) six frames (six-frame);
" tblastn " compares the translation that dynamic six of albumen search sequence and nucleotide sequence database read frame (two strands);
" tblastx " compares six frame translation products of nucleotide query sequence six frame translation products and nucleotide sequence database.
BLAST adopts following search parameter:
HISTOGRAM shows the histogram of each search score; Default value is " yes " (seeing Parameter H in the BLAST handbook).
DESCRIPTIONS limits the number of the matching sequence Short Description that specifies number of reporting; Default value is 100 descriptions.(seeing the man pages V parameter) also can be with reference to EXPECT and CUTOFF.
The ALIGNMENTS restriction specifies number database sequence so that report that the high score fragment is to (HSPs); Default value is 50.If greater than the accidental significance,statistical threshold value (seeing following EXPECT and CUTOFF) that meets report of the database sequence of this value, have only the coupling of maximum significance,statistical just to be reported so.(seeing B parameter in the BLAST handbook).
EXPECT significance,statistical threshold value is used for reporting the coupling with database sequence; Default value is 10, like this according to the stochastic model of Karlin and Altschul (1990), estimates to have only 10 couplings to be chanced on.If the significance,statistical of a coupling is greater than the EXPECT threshold value, coupling will not reported.The EXPECT threshold value is low more then strict more, causes reporting that the chance of coupling is less.Fractional value also can be accepted.(seeing parameter E in the BLAST menu).
CUTOFF Cutoff divides value reporting high score fragment right, and default value can calculate (on seeing) from the EXPECT value.Only the same with the single HSP significance,statistical that equals the CUTOFF value at least when high at the significance,statistical of HSPs, this HSPs is as the database sequence report.The CUTOFF value is high more then strict more, causes reporting that the chance of coupling is less.(seeing parameter S in the BLAST handbook).Usually adopt EXPECT, the significance threshold value can be controlled more intuitively.
MATRIX describes the selectable minute value matrix of BLASTP, BLASTX, TBLASTN and TBLASTX in detail.Default value is BLOSUM62 (Henikoff ﹠amp; Henikoff, 1992, Proc.Natl.Aacad.Sci.USA 89 (22): 10915-9).Effective alternative comprising: PAM40, PAM120, PAM250 and IDENTITY.BLASTN does not have alternative rating matrix; Describe MATRIX indication answer wrong reaction in the BLASTN request in detail.
STRAND limits the TBLASTN search and is the chain up and down of database sequence; Or restriction BLASTN, BLASTX or TBLASTX search is the search sequence reading frame of chain up and down.
FILTER shielding as: Wootton ﹠amp; The simple search sequence of composition that the SEG program is measured among Federhen (1993) the Computers and Chemistry 17:149-163; Or the shielding as: Claverie ﹠amp; States, 1993, the short period internal repeat that the XNU program is measured among the Computers and Chemistry 17:191-201 perhaps, is used in the BLASTN in Tatusov and Lipman (seeing the NCBI network address) the DUST program.Filtration can remove in the blast output significance,statistical is arranged but the report of abiology meaning (for example, the discovery in common acid, alkali or proline rich district), residue more has in the search sequence zone of biological significance to can be used as with the database sequence specificity to mate.
Low-complexity sequence by filter is found replaces (as: N repeats 13 times) and replace (as: X repeats 9 times) with letter " X " in protein sequence with letter " N " in nucleotide sequence.
Filtration only is used for search sequence (or its translation product), is not used in database sequence.The acquiescence filtration is DUST among the BLASTN, and it is SEG that other program acquiescence filters.Among SEG and the XNU one or two shielding is unrare yet whatever at all, during sequence in being applied in SWISS-PROT, so refractory phase federation to be filtered tells on.In addition, in some cases, sequence is shielded fully, shows that the significance,statistical of being reported to any coupling of unfiltered search sequence is incredible.
NCBI-gi is presented in the output NCBI gi mark formula symbol, wherein also comprises numbering and/or locus title (the accession and/or locus name).
Most preferably the blast search simple algorithm that relatively adopts of sequence carries out, and "/BLAST " catalogue provides in above-mentioned NCBI network address.
The present invention includes and the following:
1. dual specific part, it comprises the single variable region of first immunoglobulin (Ig) and the complementary that have first epi-position or antigenic binding specificity has second epi-position or antigenic in conjunction with the single variable region of active second immunoglobulin (Ig), one of wherein said antigen or epi-position or both bring into play the effect that prolongs the transformation period in the part body, and wherein said first and second variable regions shortage has mutually homospecific common complementary district, and condition is that described dual specific part is not by anti--HSA V HDistrict and anti--beta galactosidase enzyme V κ district form.
2. 1 dual specific part, it comprises an one antibody heavy chain variable region and the one antibody chain variable region of complementary at least, cause these two zones can in conjunction with and formation complementary V H/ V LRight.
3. 2 dual specific part, V wherein HAnd V LProvide by the antibody scFv fragment.
4. 2 dual specific part, V wherein HAnd V LThe district provides by monoclonal antibody.
5. chain IgG immunoglobulin (Ig) part, it comprises the dual specific part in 2.
6. 5 four chain IgG immunoglobulin (Ig) parts, wherein said IgG comprises two dual specific parts, and described dual specific part is identical in their variable region.
7. 5 four chain IgG immunoglobulin (Ig) parts, wherein said IgG comprises two dual specific parts, and described dual specific part is different in their variable region.
8. part, second immune globulin variable region that it comprises first immune globulin variable region with first antigen or epi-position binding specificity and has second antigen or epi-position binding specificity, one of wherein said first and second variable regions or both combine with the antigen that prolongs the interior transformation period of part body, and described variable region is not complementary each other.
9. the part in 8, first and second immune globulin variable regions wherein are variable region of heavy chain (V H).
10. the part in 8, first and second immune globulin variable regions wherein are variable region of light chain (V L).
11. aforementioned each part, the first and second epi-position independence combinations wherein cause the dual specific part can be simultaneously in conjunction with first and second epi-positions or antigen.
12. the part in 11, dual specific part wherein are included in balanced first kind of form and second kind of form that exists in the solution, two kinds of epi-positions wherein or antigen is all independently in conjunction with first kind of form, but the combining of competition and second kind of form.
13. aforementioned each part, variable region wherein is derived from described epi-position or antigenic immunoglobulin (Ig).
14. aforementioned each part, wherein said first and second epi-positions are present on the different antigen.
15. the part of any one among the 1-11, wherein said first and second epi-positions are present on the identical antigen.
16. aforementioned each part, it comprises the variable region that is derived from storehouse, single antibody function territory.
17. the part in the item 16, wherein said storehouse is showed in the filobactivirus surface, and single antibody function territory is wherein selected with antigenic the combination by phage library.
18. aforementioned each part, wherein the sequence of at least one variable region is through sudden change or DNA reorganization modified.
19. aforementioned each dual specific part, wherein said variable region right and wrong are covalently bound.
20. the dual specific part of any one among the 1-18, variable region wherein is covalently bound.
21. the dual specific part in the item 20, covalent attachment wherein mediates by disulfide linkage.
22.TNF the dAb monomer part of alpha specific, its dissociation constant (Kd) and 5 * 10 with 50nM to 20pM -1To 1 * 10 -7S -1K OffRate constant and human TNF alpha dissociate, and this draws surely by surface plasmon resonance measurement.
23. the dAb monomer part of the TNF alpha specific in the item 22, dAb wherein is V κ.
24.TNF the specific dAb monomer of acceptor 1 (p55) part, it is with the dissociation constant (K of 50nM to 20pM d) and 5 * 10 -1To 1 * 10 -7S -1K OffRate constant and TNF acceptor 1 dissociate, and this draws surely by surface plasmon resonance measurement.
25. each dAb monomer part of 22-24, monomer wherein in the standard cell lines assay method with among the ND50 of 500nM to 50pM and human TNF alpha or TNF acceptor 1.
26.TNF the specific dAb monomer of acceptor 1 (p55) part, dAb wherein in the standard cell lines assay method with the activity of the ND50 antagonism TNF acceptor 1 of≤100nM, and dAb in this assay method the concentration of≤10 μ M stimulate TNF acceptor 1 activity reach≤5%.
27. the specific dAb monomer of serum albumin (SA) part, its dissociation constant with 1nM to 500 μ M (Kd) is dissociated with SA, and this draws surely by surface plasmon resonance measurement.
28. the dAb monomer part in 27, monomer wherein in standard part binding assay with the IC50 of 1nM to 500uM in conjunction with SA.
29.TNF the dAb monomer part of alpha specific, wherein dAb comprise TAR1-5-19 aminoacid sequence or with its at least 80% homologous sequence.
30.TNF the dAb monomer part of alpha specific, wherein dAb comprise TAR1-5 aminoacid sequence or with its at least 80% homologous sequence.
31.TNF the dAb monomer part of alpha specific, wherein dAb comprise TAR1-27 aminoacid sequence or with its at least 80% homologous sequence.
32.TNF acceptor 1 specific dAb monomer part, wherein dAb comprise TAR2-10 aminoacid sequence or with its at least 80% homologous sequence.
33.TNF acceptor 1 specific dAb monomer part, wherein dAb comprise TAR2-10 aminoacid sequence or with its at least 90% homologous sequence.
34.TNF acceptor 1 specific dAb monomer part, wherein dAb comprise TAR2-5 aminoacid sequence or with its at least 80% homologous sequence.
35.TNF acceptor 1 specific dAb monomer part, wherein dAb comprise TAR2-5 aminoacid sequence or with its at least 90% homologous sequence.
36.SA specific dAb monomer part, wherein dAb comprise MSA-16 aminoacid sequence or with its at least 80% homologous sequence.
37.SA specific dAb monomer part, wherein dAb comprise MSA-26 aminoacid sequence or with its at least 80% homologous sequence.
38. 29 to 37 each dAb monomer parts, wherein TNF α, TNF acceptor 1 or SA are the forms in people source.
39. a dAb monomer, it also comprises terminal Cys residue.
40. the dAb monomer of any one among the 29-38, it also comprises terminal Cys residue.
41. comprise the monomeric dual specific part of each at least a dAb among the 22-40.
42. the dual specific part of item 41, it is a dimer.
43. 42 dual specific part, dimer wherein comprise 22,23 and 28-30 in any one anti-human TNF alpha dAb and 26,27 and 34-36 in any one anti-SA dAb.
44. the dual specific part in 42, dimer wherein be a kind of with or heterodimer, it comprises the first and second anti-human TNF alpha dAb, each dAb be 22,23 and 28-30 in any one dAb.
45. the dual specific part in the item 41, it is a tripolymer.
46. the dual specific part in 45, it is a homotrimer, comprises the item 22,23 of 3 copies and any one the anti-human TNF alpha dAb among the 29-31.
47. aforementioned each part, it comprises general framework.
48. the part in the item 47, general framework wherein comprises the V that is selected from DP47, DP45 and DP38 HFramework; And/or V LFramework is DPK9.
49. aforementioned each part, it comprises the binding site that belongs to the class part.
50. the part in the item 49, genus class ligand-binding site point wherein is selected from albumin A, albumen L and Protein G.
51. aforementioned each part, part wherein comprises the variable region with one or more framework regions, it is the same aminoacid sequence in respective frame district of antibody gene fragment coding that described framework region comprises with ethnic group, and perhaps the aminoacid sequence integral body of described one or more framework regions comprises 5 of as many as and is different from the amino acid of aminoacid sequence that ethnic group is the respective frame district of antibody gene fragment coding.
52. the part of any one among the 1-51, part wherein comprises the variable region, wherein the aminoacid sequence of FW1, FW2, FW3 and FW4 and ethnic group are that the aminoacid sequence in respective frame district of antibody gene fragment coding is identical, and perhaps the aminoacid sequence integral body of FW1, FW2, FW3 and FW4 comprises 10 of as many as and is different from the amino acid of aminoacid sequence that described ethnic group is the respective frame district of antibody gene fragment coding.
53. 51 or 52 part, it comprises the antibody variable region that contains FW1, FW2 and FW3 zone, and the aminoacid sequence of described FW1, FW2 and FW3 and ethnic group are that the aminoacid sequence in respective frame district of antibody gene fragment coding is identical.
54. each part of 51-53, wherein said ethnic group is that the antibody gene fragment is selected from DP47, DP45, DP48 and DPK9.
55. aforementioned each part, it comprises V HThe district, this district is not the Camelid immune globulin variable region.
56. the part in the item 55, it comprises V HThe district, this district does not comprise the V with the people HIt is special one or more amino acid that the district compares the Camelid immune globulin variable region.
57. method for preparing part, this part comprises the single variable region of first immune globulin with first binding specificity and has the single variable region of second immunoglobulin (Ig) of second binding specificity, one of described binding specificity or both are specificitys at prolonging the proteinic of transformation period in the part body, this method comprises the steps: that (a) is according to selecting first variable region with the first epi-position bonded ability, (b) according to selecting second variable region with the second epi-position bonded ability, (c) make up these variable regions, and (d) according to selecting part with the above-mentioned first and second epi-position bonded abilities, wherein, when described variable region was complementary, described zone was not special V at HSA HThe district.
58. the method in the item 57 is not selected in conjunction with described first epi-position when wherein said first variable region does not exist according to complementary variable region.
59. the method in the item 57 is selected in conjunction with described first epi-position when wherein said first variable region exists according to the 3rd complementary variable region, described the 3rd variable region is different from described second variable region.
60. the nucleic acid of the dual specific part of any one among the coding 1-56.
61. the nucleic acid in 60, it is the TNF alpha specific, comprise TAR1-5-19 nucleotide sequence or with its at least 70% homologous sequence.
62. the nucleic acid in 60, it is the TNF alpha specific, comprise TAR1-5 nucleotide sequence or with its at least 70% homologous sequence.
63. the nucleic acid in 60, it is the TNF alpha specific, comprise TAR1-27 nucleotide sequence or with its at least 70% homologous sequence.
64. the nucleic acid in 60, it is that TNF acceptor 1 is specific, comprise TAR2-10 nucleotide sequence or with its at least 70% homologous sequence.
65. the nucleic acid in 60, it is that TNF acceptor 1 is specific, comprise TAR2-10 nucleotide sequence or with its at least 80% homologous sequence.
66. the nucleic acid in 60, it is that TNF acceptor 1 is specific, comprise TAR2h-5 nucleotide sequence or with its at least 70% homologous sequence.
67. the nucleic acid in 60, it is that TNF acceptor 1 is specific, comprise TAR2h-5 nucleotide sequence or with its at least 80% homologous sequence.
68. the nucleic acid in 60, it is that SA is specific, comprise MSA-16 nucleotide sequence or with its at least 70% homologous sequence.
69. the nucleic acid in 60, it is that SA is specific, comprise MSA-26 nucleotide sequence or with its at least 70% homologous sequence.
70. a carrier, it comprises any one the nucleic acid among the 60-69.
71. the carrier in the item 70, it also comprises expresses the necessary composition of dual specific part.
72. a transfection has the host cell of the carrier of item 71.
73. method for preparing closed conformation polyspecific part, this part comprises first single epi-position land with first epi-position binding specificity and the non-complementary second epi-position land with second epi-position binding specificity, first and second binding specificities wherein can be competed in conjunction with epi-position, cause the closed conformation polyspecific part can not be simultaneously in conjunction with these two epi-positions, said method comprising the steps of: a) according to selecting the first epi-position land with the first epi-position bonded ability, b) according to selecting the second epi-position land with the second epi-position bonded ability, c) make up these epi-position lands, cause described location in closed conformation, and d) according to described first epi-position and the second epi-position bonded ability rather than with described two epi-positions simultaneously the bonded ability select closed conformation polyspecific part.
74. the method in the item 73, the first and second epi-position lands wherein are immunoglobulin heavy chain variable region (V H).
75. the method in the item 73, first and second immune globulin variable regions wherein are immunoglobulin light chain variable region (V L).
76. the method for any one among the 73-75, immunoglobulin (Ig) functional domain wherein is derived from the immunoglobulin (Ig) at described epi-position.
77. the method for any one among the 73-76, wherein said first and second epi-positions are present on the antigen separately.
78. the method for any one among the 73-76, wherein said first and second epi-positions are present on the identical antigen.
79. the method for any one among the 73-78, variable region wherein is derived from storehouse, single antibody function territory.
80. the method for item 79, wherein said storehouse is illustrated in the filobactivirus surface, and single antibody function territory is wherein selected with antigenic the combination by phage library.
81. the method for any one among the 73-80, wherein the sequence of at least one immune globulin variable region is reorganized and modified through sudden change or DNA.
82. closed conformation polyspecific part, the non-complementary second epi-position land that it comprises the first epi-position land with first epi-position binding specificity and has the second epi-position binding specificity, first and second binding specificities wherein can be competed the epi-position combination, cause the closed conformation polyspecific part can not be simultaneously in conjunction with these two epi-positions.
83. the closed conformation polyspecific part in 82, it can obtain by any one the method among the item 73-80.
84. the closed conformation polyspecific part in the item 82 or 83, it comprises more than one single antibody heavy chain variable region, or more than one antibody chain variable region.
85. the closed conformation polyspecific part in the item 84, V wherein HAnd V LLink to each other by peptide linker.
86. the closed conformation polyspecific part in the item 84, V wherein HOr V LProvide by monoclonal antibody sample zone.
87. the closed conformation polyspecific part in any one among the 82-84, variable region right and wrong wherein are covalently bound.
88. the closed conformation polyspecific part in any one among the 82-84, variable region wherein is covalently bound.
89. the closed conformation polyspecific part in the item 87, covalent attachment is wherein mediated by disulfide linkage.
90. the closed conformation polyspecific part in any one among the 82-89, it comprises general framework.
91. the closed conformation polyspecific part in any one among the 82-90, it comprises the binding site that belongs to the class part.
92. the closed conformation polyspecific part in the item 91, genus class ligand-binding site point wherein is selected from albumin A, albumen L and Protein G.
93. the closed conformation polyspecific part in any one among the 82-92, part wherein comprises the variable region with one or more framework regions, it is the same aminoacid sequence in respective frame district of antibody gene fragment coding that described framework region comprises with ethnic group, and perhaps the aminoacid sequence integral body of described one or more framework regions comprises 5 of as many as and is different from the amino acid of aminoacid sequence that ethnic group is the respective frame district of antibody gene fragment coding.
94. the closed conformation part of item 93, part wherein comprises the variable region, wherein the aminoacid sequence of FW1, FW2, FW3 and FW4 and ethnic group are that the aminoacid sequence in respective frame district of antibody gene fragment coding is identical, and perhaps the aminoacid sequence integral body of FW1, FW2, FW3 and FW4 comprises 10 of as many as and is different from the amino acid of aminoacid sequence that described ethnic group is the respective frame district of antibody gene fragment coding.
95. 93 or 94 closed conformation part, it comprises the antibody variable region that contains FW1, FW2 and FW3 zone, and the aminoacid sequence of described FW1, FW2 and FW3 and ethnic group are that the aminoacid sequence in respective frame district of antibody gene fragment coding is identical.
96. the closed conformation part in any one among the 92-95, wherein said ethnic group is that the antibody gene fragment is selected from DP47, DP45, DP48 and DPK9.
97. the closed conformation part in any one among the 92-96, it comprises V HThe district, this district is not the Camelid immune globulin variable region.
98. the closed conformation part in the item 97, V wherein HThe district does not comprise the V with the people HIt is special one or more amino acid that the district compares the Camelid immune globulin variable region.
99. the closed conformation polyspecific part in any one among the 82-98, a wherein said specificity are at the preparation that can effectively prolong the described part transformation period.
100. a test kit, it comprises the closed conformation polyspecific part among the 82-99 any one.
101. a nucleic acid, the closed conformation polyspecific part in any one among at least a 82-99 of its coding.
102. carrier that comprises 101 amplifying nucleic acid.
103. the carrier in the item 102, it also comprises expresses the necessary composition of closed conformation polyspecific part.
104. a transfection has the host cell of carrier in the item 103.
105. one kind is detected the method that target molecule exists, comprise: a kind of closed conformation polyspecific part that is combined on certain preparation (a) is provided, described part be specificity at described target molecule and described preparation, the described preparation of wherein said part institute's bonded produces detectable signal when this part cements out; (b) with described closed conformation polyspecific ligand exposed in described target molecule; And (c) detect described preparation and replace the signal that is produced.
106. the method in 105, wherein said preparation is a kind of enzyme, when be closed conformation polyspecific part in conjunction with the time be non-activity.
107. the method in the item 105, preparation wherein is a kind of substrate of enzyme.
108. the method in 107, preparation wherein is a kind of fluorescent agent, luminous agent or developer, when by part in conjunction with the time be non-activity or by cancellation.
109. the test kit of the method for any one among the practical matter 105-108, it comprises a kind of closed conformation polyspecific part and optional a kind of preparation and suitable damping fluid thereof that can binding target molecule.
110. Advances in Homogeneous Immunoassay that combines any one the middle method among the 105-108.
111. the part of any one among the 1-56, it is used for the treatment of.
112. a pharmaceutical composition, it comprises any one part and pharmaceutically acceptable vehicle, carrier or the thinner among the 1-56.
113. a method for preparing chelating polymer part may further comprise the steps: the carrier that comprises certain nucleotide sequence (a) is provided, and this nucleic acid sequence encoding specificity is at the single land of first epi-position on the target molecule; (b) provide a kind of carrier of code database, described storehouse comprises second land of specificity at second epi-position on the described target, and this epi-position can be identical or different with first epi-position, and described second epi-position is adjacent with described first epi-position; (c) express described first and second lands; (d) separating those combines described first and second lands and generates target in conjunction with dimeric combination.
114. the method in the item 113, first and second lands wherein are by the joint covalent attachment.
115. the method in the item 113, the non-covalent combination in first and second lands wherein.
116. the method in the item 113, first and second lands combination wherein by the natural combination in described district.
117. the method in the item 116, land wherein comprises V HDistrict and V κ district.
The accompanying drawing summary
Fig. 1: be presented at V HThe diversity of/HAS is distributed in V HOn H50, H52 in the/HAS antigen binding site, H52a, H53, H55, H56, H58, H95, H96, H97, H98 (respectively by DVT or the NNK coding) position.V κSequence has diversity on L50 and L53 position.
Fig. 2: demonstration exists with phage display/ScFv form:
The storehouse is V for a kind κ/ DVTV H
The storehouse is V for 2 kinds κ/ NNKV H
The storehouse is V for 3 kinds H/ DVTV κ
The storehouse is V for 4 kinds H/ NNKV κ
These storehouses are by combining and screening in advance with belonging to class part (generic ligand) albumin A and albumen L, so most clone and screening storehouse all are functional.These storehouses are by HSA (first round) and β-gal (second takes turns) or HAS/ β-gal chosen process or select by β-gal (first round) and HSA (second takes turns) β-gal/HSA chosen process.Solubility scFv sequence from these PCR clones is amplified.A clone who selects coding bi-specific antibody K8 is in order to further work.
Fig. 3: show V HChain and V κThe contrast of chain.
Fig. 4: show the description of K8 antibodies characteristic, by the mono-clonal phage E LISA method binding characteristic of K8 antibody qualitatively, finding that dual specific K8 antibody capable combines with HSA and β-gal also can be at phage display, and absorption signal is greater than 1.Do not measure other proteic cross reactivity.
Fig. 5: show the solubility scFv ELISA that the K8 antibody fragment with concentration known carries out.Be that HSA, the BSA of 100 μ g of 10 μ g/ml and β-gal and concentration are that the Protein A bag of 100 μ g/ml of 1 μ g/ml is by 96 orifice plates with concentration.Use the K8 scFv serial dilution of 50 μ g, and detect institute's bonded antibody fragment with ProteinL-HRP.ELISA result confirms the dual specific essence of K8 antibody.
Fig. 6: show and adopt solubility scFv elisa assay K8 V κ/ simulation V HClone's binding characteristic.As Harrison etc., Methods Enzymol.1996; Inducing through IPTG that 267:83-109 describes produces solubility scFv fragment, directly measures the supernatant that contains scFv.The operation of solubility scFv elisa assay such as embodiment 1 describe, and bonded scFv detects with Protein L-HRP.ELISA result shows that this clone still can not be in conjunction with BSA in conjunction with β-gal.
Fig. 7: the sequence that shows variable region carrier 1 and carrier 2.
Fig. 8: be to be used to make up V H1/V HThe C of 2 polyspecific parts HCarrier figure.
Fig. 9: be to be used to make up V κ1/V κThe V of 2 polyspecific parts κCarrier figure.
Figure 10: the TNF receptor assay is TAR1-5 dimer 4, TAR1-5-19 dimer 4 and TAR1-5-19 monomer relatively.
Figure 11: the TNF receptor assay is TAR1-5 dimer 1-6 relatively.All dimers pass through FPLC purifying, and have shown the result of the kind of best dipolymer.
Figure 12: the TNF receptor assay of multi-form TAR1-519 homodimer: have the dAb-joint-dAb form of 3U, 5U or 7U joint, Fab form and halfcystine knuckle joint form.
Figure 13: simulate V in the storehouse 1 HSequence.V HThe framework sequence is a sequence based on the DP47-JH4b kind.NNK (N=A or T or C or the G Nucleotide of having incorporated randomization (randomisation) in the storehouse 1 into; K=G or T Nucleotide) position marks with the runic underscore.
Figure 14: simulate V in the storehouse 2 HSequence.V HThe framework sequence is a sequence based on the DP47-JH4b kind.Randomized NNK (N=A or T or C or G Nucleotide have been incorporated in the storehouse 2 into; K=G or T Nucleotide) position marks with the runic underscore.
Figure 15: simulate V in the storehouse 3 κSequence.V κThe framework sequence is based on DP κ9-J κ1 kind is sequence.Incorporate randomized NNK (N=A or T or C or G Nucleotide in the storehouse 3 into; K=G or T Nucleotide) position marks with the runic underscore.
Figure 16: Nucleotide and the aminoacid sequence of anti-MSA dAb MSA 16 and MSA26.
Figure 17: MSA 16 and MSA 26 suppress biacore and detect.Adopt inhibition biacore method to measure the dAb MSA16 of purifying and the K of MSA26 dValue.In brief, detection can obtain the concentration that 200RU replys required dAb on wrapping by the biacore CM5 chip of high-density MSA.In case required dAb concentration is determined, will expect that the MSA antigen and the dAb of Kd value left and right sides concentration range are pre-mixed also overnight incubation.Then, measure dAb and bag combining in every part of pre-composition at the high flow rate (flow-rate) that 30 μ l/ divide by the MSA of biacore chip.
Figure 18: injection back MSA16 serum level.Measure the serum half-life of dAb MSA16 in the mouse body.Give intravenous injection MSA16 of CD1 mouse, dosage is approximately 1.5mg/kg.The modeling of 2 compartment models (2 compartment model) shows that the tl/2 α of MSA16 is 0.98hr, and tl/2 β is 36.5hr, and AUC is 913hr.mg/ml.Compare with HEL4 (the white N,O-Diacetylmuramidase dAb of anti-ovum gallinaceum), MSA16 has the transformation period of relative prolongation, and the tl/2 α of HEL4 is that 0.06hr and tl/2 β are 0.34hr.
Figure 19: ELISA (a) and TNF receptor assay (c) show that TNF and Fab sample that contains MSA26Ck and TAR1-5-19CH are segmental and combine inhibition.Add MSA with Fab print section and can reduce the inhibition level.Use dual specific V KC HAnd V KC KFab print section is detected the elisa plate that is coated with 1ug/ml TNFa, compares in conjunction with dAb with TNFa simultaneously, and its concentration is calculated according to producing same signal among the ELISA.Dual specific dAb and contrast dAb are used for detecting to be had/elisa plate of no 2mg/ml MSA.Signal in two special holes reduces and surpasses 50%, and signal reduces at all that (Figure 19 a) in the dAb hole.Identical dual specificity protein also is used for having/receptor assay of no MSA, and the competition of MSA also shows (seeing Figure 19 c) in the drawings.This combination that shows MSA and bispecific molecule can be competed by combining with TNFa.
Figure 20: the TNF receptor assay shows that TAR1-5-19dAb and MSA16dAb suppress the TNF bonded through the heterodimer that disulfide linkage is linked to be.Add MSA with dimer and can reduce the inhibition level in dosage dependence mode.In TNF receptor assay (Figure 19 (the b)) operation, adopt the heterodimer of constant density (18nM) and the MSA and the HSA of a series of weaker concns.Concentration range can not make dimer suppress the ability reduction of TNFa up to the HSA of 2mg/ml.Yet the increase of MSA causes that in dosage dependence mode dimer suppresses the ability reduction of TNFa.(Figure 19 a).This shows the MSA TAR1-5-19 that competition is connected in conjunction with cys with TNFa, MSA16 dimer.MSA and HSA do not have the effect of TNF in conjunction with level that influence separately in the analysis.
Detailed Description Of The Invention
Definition
Complementary (Complementary): when two immunoglobulin domains belong to form related to or the structure family of group or they when being derived from these families and keeping its characteristic, these two immunoglobulin domains are " complementations " so. For example, the V of antibodyHDistrict and VLThe district is complementary, two VHThe district is not complementary, two VLThe district is not complementary. Complementation is distinguished and also can be found in other member of immunoglobulin superfamily, as: the Va of φt cell receptor and V β (or γ and δ) district. In the context of the present invention's the second configuration, the incomplementarity district can not act synergistically in conjunction with a target molecule, but can act on independently the different target epi-positions on the identical or different molecule. Artificial synthetic district as: can not in conjunction with the zone based on the albumen support of epi-position (unless transform its can in conjunction with epi-position), be not complementary. Equally, (for example) is not complementary based on two zones in immunoglobulin domain and fibronectin district.
Immunoglobulin (Ig): refer to keep the peptide family of the immunoglobulin folding characteristic of antibody molecule, generally include two β lamellas and a conservative disulfide bond. The immunoglobulin superfamily member participates in cells in vivo and the interactional many aspects of acellular, (for example be included in immune wide application, antibody, φt cell receptor molecule are like that), participation cell adherence (as: ICAM molecule) and Cellular Signaling Transduction Mediated (for example: acceptor molecule, such as pdgf receptor). The present invention is applicable to all immunoglobulin superfamily molecules with land. Preferably the present invention relates to antibody.
Associating (combining): the variable region among the present invention constitutes jointly a series of zones; For example: complementary district can unite, such as VLDistrict and VHThe district can unite. The incomplementarity district also can unite. Described zone can be united in several ways, comprise by covalency be connected mode and connect.
Functional areas (district, zone (domain)): functional areas are a kind of folded protein structures, do not rely on the other parts of albumen and keep its tertiary structure. Usually, the discrete functionality characteristic of albumen is responsible in functional areas, and under many circumstances, and described functional areas can be added, remove or be transferred to other albumen and the function of not losing albumen and/or regional remainder. Single antibody variable region refers to comprise a folding polypeptide zone of antibody variable region sequence signature. Therefore, it comprises complete antibody variable region and modified variable region, for example, wherein one or more rings are not had the variable region of the sequence replacement of antibody variable region feature, the antibody variable region of perhaps being deleted or comprise N-or the terminal antibody variable region that extends of C, and it is at least part of in conjunction with active and specific variable region fold segments to keep the total length zone.
Storehouse/library (Repertoire): the set of different variants, for example, the different polypeptide variants of primary sequence (primary sequence). The storehouse of using among the present invention comprises at least 1000 members' polypeptide set.
Library/storehouse (Library): term " library " refers to the mixture of heterogeneous polypeptide or nucleic acid. The library is by a plurality of member compositions, and each member has single polypeptide or nucleotide sequence. On this layer meaning, the library is identical with the storehouse. Be not both the multifarious origin cause of formation in the library among the member in library between the sequence. The library can be a kind of simple polypeptide or mixtures of nucleic acids form, biology or the cellular forms that perhaps can be transformed by nucleic acid library, and for example: bacterium, virus, animal or plant cell are like that. Preferably, each microorganism or cell monomer comprise only one or a limited number of library member. Advantageously, nucleic acid mixes in the expression vector, so that the polypeptide of express nucleic acid coding. Therefore, one preferred aspect, the library can be host living beings group's form, each biology comprises one or more copies of expression vector, carrier comprises the single member of nucleic acid library, can express producing corresponding polypeptide member from described nucleic acid. Like this, the host living beings group has the potential in the large storehouse of genetic coding diversity polypeptide variants.
Closed conformation polyspecific part (closed conformation multi-specific ligand): describe a kind of polyspecific part of definition here, it comprises at least two epi-position lands of definition here. Term closed conformation (polyspecific part) refer to part the epi-position land arrangement so that the epi-position of an epi-position land in conjunction with the competition another epi-position land the epi-position combination. That is: related epi-position can be by each epi-position land separately but not simultaneously combination. Closed conformation part can prepare with method described herein.
Antibody: antibody (as: IgG, IgM, IgA, IgD or IgE) or fragment (as: Fab, F (ab ')2, the scFv that connects of Fv, disulfide bond Fv, the scFv, closed conformation multi-specificity antibody, the disulfide bond that connect, double antibody) no matter be to be derived from nature to produce any kind of antibody or produce by recombinant DNA technology, perhaps from serum, B cell, hybridoma, transfectoma, yeast or bacterium, separate and get.
The bispecific part: the part of definition comprises the single variable region of the first immunoglobulin (Ig) and the single variable region of the second immunoglobulin (Ig) here, here the variable region can be in conjunction with two two epi-positions on synantigen or the same antigen not, and described antigen or epi-position be not coverlet SIG combination usually. For example, two epi-positions can be present on the same haptens, but are not identical epi-positions or fully approach and the combination of coverlet SIG. Bispecific part of the present invention is comprised of not homospecific variable region, and does not comprise having mutually homospecific variable region complimentary to one another pair.
Antigen: a kind of by the molecule of ligand binding of the present invention. Usually antigen by antibody ligand in conjunction with and can improve internal antibody and reply. It can be polypeptide, albumen, nucleic acid or other molecule. In general, the bispecific part among the present invention is to select by the target-specific for specific antigen. For conventional antibody and its fragment, can conjugated antigen by the antibody combining site of variable loop (L1, L2, L3 and H1, H2, H3) definition.
Epi-position: conventional by immunoglobulin (Ig) VH/V LStructural units to combination. Epi-position defines the minimum binding site of antibody, therefore represents the specific target of antibody. For single domain antibodies, epi-position represents by the structural units of variable region independence combination.
Belong to class part (Generic ligand): in conjunction with the part of all members in the storehouse. Usually, not by above-mentioned antigen binding site combination. Non-limitative example comprises albumin A, albumen L and Protein G.
Select: come by screening or Darwin's system of selection derivation, in selection course, binding interactions occurs between district and antigen or the epi-position or between antibody and antigen or the epi-position. Therefore, the selection of the first variable region conjugated antigen or epi-position by with/without complementary variable region the time selected.
General framework (Universal framework): single antibody framework sequence such as Kabat corresponding to the conservative antibody regions of sequence are defined. (" Sequences of Proteins of Immunological Interest ", US Department of Health and Human Services) or corresponding to ethnic group be immunoglobulin (Ig) storehouse or structure, such as Chothia and Lesk, (1987) J.Mol.Biol.196:910-917 is defined. The invention provides the purposes of single framework or a series of such framework, find to cause deriving of any in fact binding specificity by the independent variation in hypervariable region.
Half-life: serum-concentration reduces by 50% required time in the part body, for example, removes or isolation owing to ligand degradation and/or by the part that natural mechanism causes. Part of the present invention in vivo can be by stabilized in conjunction with the molecule that can resist degraded and/or removing or isolate and prolong its half-life. Usually these molecules are the natural albumen that exists, and they itself have long Half-life in vivo. If the time that part functional activity in vivo continues prolongs than the similar part that increases molecular specificity without the half-life, the half-life of this part has namely obtained prolongation so. Therefore, comparison is for the ligands specific of HSA and target molecule and do not have the specific similar part of HSA, and the latter is not in conjunction with HSA but in conjunction with another molecule. For example, the second epi-position that it can binding target molecule. Usually, the half-life can increase by 10%, 20%, 30%, 40%, 50% or more. The scope that increases may be 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 30 times, 40 times, 50 times of the described half-life or more than. Perhaps or in addition, the scope of increase may be 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 150 times of described half-life.
Homogeneous immunoassay (Homogeneous immunoassay): a kind of immune analysis method, the detection of analyte do not need to separate combination and the step of binding reagents not.
Basic identical (or basic homology) (substantially identical): first amino acid or nucleotide sequence contain the identical or equal of enough numbers with second amino acid or nucleotide sequence and (as have similar side chain, replace such as conserved amino acid) amino acid residue and nucleotides, therefore, the first and second amino acid or nucleotide sequence have similar activity. For antibody, SA has the binding specificity identical with first antibody and has 50% affinity at least.
Here the term of usefulness " low stringency ", " medium stringency ", " high stringency " or " very high stringency " are described the condition of nucleic acid hybridization and flushing. The hybridization reaction operating guidance sees Current Protocols in Molecular Biology, John Wiley ﹠ Sons, and N.Y. (1989), 6.3.1-6.3.6 all introduces for referencial use here. Water law and non-water law have description in the literature, and two methods are held concurrently available. Here the specific hybridization condition that relates to is as described below: (1) low stringency hybridization conditions is to hatch in 6 about 45 ℃ * sodium chloride/sodium citrate (SSC), then uses at least 50 ℃ 0.2 * SSC and 0.1%SDS washed twice (low stringency condition wash temperature can rise to 55 ℃). (2) medium stringency hybridization conditions is to hatch in 6 about 45 ℃ * SSC, and then 60 ℃ with 0.2 * SSC and 0.1%SDS washing once or once; (3) high stringency hybridization conditions is to hatch in 6 about 45 ℃ * SSC, and then 65 ℃ with 0.2 * SSC and 0.1%SDS washing one or many; Preferably (4) very high stringency hybridization conditions is to hatch in 65 ℃ of 0.5M sodium phosphates and 7%SDS, then washs one or many at 65 ℃ with 0.2 * SSC and 1%SDS. Very high stringency condition (4) is optimum condition, is the condition that should adopt during without other designation method.
Detailed Description Of The Invention
Unless scientific and technical terminologies of using here are defined as other, conventional understand equivalent in meaning of common and this area (for example, cell cultivation, molecular genetics, nucleic acid chemistry, hybridization technique and biochemistry) those skilled in the art. Be applied to molecule, heredity and biochemical method (usually referring to Sambrook etc., Molecular Cloning:A Laboratory Manual, second edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. with Ausubel etc., Short Protocols in Molecular Biology the 4th edition (1999), John Wiley ﹠ Sons, Inc. is and draws list of references here) and the standard technique of chemical method.
Preparation based on the polyspecific part of immunoglobulin (Ig)
No matter bispecific part of the present invention is all can to prepare according to the technology that former foundation is applied in the antibody engineering according to the open or closed type conformation in the invention contemplated configurations. As prepare scFv, phage antibody and other engineered antibody molecule. The antibody particularly technology of preparing example of bispecific antibody is described in following summary and citing document: Winter ﹠ Milstein, (1991) Nature 349:293-299; Plueckthun (1992) Immunological Reviews 130:151-188; Wright et al., (1992) Crti.Rev.Immunol.12:125-168; Holliger, P.﹠ Winter, G. (1993) Curr. Op.Biotechn.4,446-449; Carter, et al. (1995) J.Hematother.4,463-470; Chester, K.A.﹠ Hawkins, R.E. (1995) Trends Biotechn.13,294-300; Hoogenboom, H.R. (1997) Nature Biotechnol.15,125-126; Fearon, D. (1997) Nature Biotechnol.15,618-619; Pliickthun, A.﹠ Pack, P. (1997) Immunotechnology 3,83-105; Carter, P.﹠ Merchant, A.M. (1997) Curr.Opin. Biotechnol.8,449-454; Holliger, P.﹠ Winter, G. (1997) Cancer Immunol. Immunother.45,128-130.
The invention provides for two the not selection of the variable region of synantigen or epi-position and the subsequent combination of these variable regions.
Select the technology of variable region to adopt storehouse well known in the art and screening sequence. Natural storehouse (Marks et al. (1991) J.Mol.Biol., 222:581; Vaughan etal. (1996) Nature Biotech., 14:309) use the rearrangement V gene that from human B cell, obtains, this is well-known to those skilled in the art. Synthesize storehouse (Hoogenboom ﹠ Winter (1992) J.Mol.Biol., 227:381; Barbas et al. (1992) Proc.Natl.Acad.Sci.USA, 89:4457; Nissim et al. (1994) EMBO J., 13:692; Griffiths etal. (1994) EMBOJ, 13:3245; De Kruif et al. (1995) J.Mol.Biol., 248:97) by clone's immunoglobulin (Ig) V gene preparation, usually adopt the PCR method. Mistake among the PCR can cause height random. VHAnd/or VLThe storehouse can be selected separately or together for target antigen or epi-position, and in the previous case, single district is in conjunction with directly selecting.
The method for optimizing of preparation bispecific part comprises a kind of selective system of application in according to the present invention, in this system, storehouse, a variable region is in conjunction with the first antigen or epi-position and select, and storehouse, a variable region is in conjunction with the second antigen or epi-position and select. Then, the first and second variable variable regions of selecting combine, and select the energy while in conjunction with the bispecific part of the first and second antigens or epi-position. The selection of closed conformation part is according to respectively rather than selecting in conjunction with the first and second antigens or epi-position simultaneously.
A. carrier library system
Technical known multiple choices system is applicable to the present invention. The below describes these systems for example.
The bacteriophage lambda expression system can be used as the bacteriophage spot or the lysogenicity bacterium colony directly screens, and the two was before stated. (Huse etal. (1989) Science, 246:1275; Caton and Koprowski (1990) Proc. Natl.Acad.Sci.US.A., 87; Mullinax etal. (1990) Proc.Natl.Acad.Sci.U.S.A., 87:8095; Persson etal. (1991) Proc.Natl.Acad.Sci.U.S.A., 88:2432) and use in the present invention. Although these expression systems can be in order to screening up to 106Plant different library members, they are not suitable for a large amount of members (greater than 106The member) screening.
The specific use of library construction is the screening display systems, and it can make nucleic acid be connected to its expressed polypeptide. As this paper application, a kind of display systems that screens is to adopt the system that suitable methods of exhibiting belongs to class by combination and/or target ligands screens the independent member in the library.
Purpose member's screening sequence in the large library of technical known separation, display technique of bacteriophage can be used as representative. Different peptide sequences are illustrated in (Scott and Smith (1990) Science, 249:386) on the filobactivirus surface in these systems. Proved that these systems (and encode their nucleotide sequence) in making the antibody fragment storehouse are that useful (McCafferty et al., WO 92/01047) is useful for external screening and amplification in the specific antibody fragment in conjunction with target antigen. Coding VHAnd VLThe nucleotide sequence in district is connected on the genetic fragment of coding pilot signal, and pilot signal instructs VHAnd VLThe district arrives the colibacillus periplasm space, and the antibody fragment that the result synthesizes is illustrated in phagotope, exemplary be with bacteriophage coat protein (as, pIII or pVIII) fusions. Perhaps, antibody fragment can outwards be illustrated in (phagebodies) on the bacteriophage lambda capsid. Display systems advantage based on bacteriophage is that the library member who selects can increase by simply cultivate the bacteriophage that comprises selected library member in bacterial cell, because they are biosystems. In addition, because coded polypeptide library member's nucleotide sequence is included in bacteriophage or the phagemid vector, the genetic manipulation of order-checking, expression and postorder is relative directly simple.
The method that makes up phage antibody display libraries and bacteriophage lambda expression library is known (McCafferty et al. (1990) Nature, 348:552 technically; Kang et al. (1991) Broc.Natl.Acad. Sci.U.S.A., 88:4363; Clackson et al. (1991) Nature, 352:624; Lowman et al. (1991) Biochemistry, 30:10832; Burton et al. (1991) Proc.Natl.Acad.Sci U.S. A., 88:10134; Hoogenboom et al. (1991) Nucleic Acids Res., 19:4133; Chang et al. (1991) J.Immunol., 147:3610; Breitling et al. (1991) Gene, 104:147; Marks etal. (1991) supra; Barbas et al. (1992) supra; Hawkins and Winter (1992) J. Immunol., 22:867; Marks et al., 1992, J.Biol.Chem., 267:16007; Lerner et al. (1992) Science, 258:1313, it is for referencial use to include this paper in).
Application (Huston etal., 1988, Proc. Natl.Acad.Sci U.S.A., the 85:5879-5883 that the peculiar advantage method is the scFv phage library; Chaudhary etal. (1990) Proc.Natl.Acad. Sci U.S.A., 87:1066-1070; McCafferty et al. (1990) supra; Clackson et al. (1991) Nature, 352:624; Marks etal. (1991) J.Mol.Biol., 222:581; Chiswell etal. (1992) Trends Biotech., 10:80; Marks et al. (1992) J.Biol.Chem., 267). The multiple embodiments that is illustrated in the scFv library on the bacteriophage capsid protein was described. The fine detail of known phage display method, the same as what describe at W096/06213 and W092/01047 (Medical Research Council et al.) and W097/08320 (Morphosys), these all are incorporated herein for referencial use.
Other system that produces polypeptide libraries is included in external synthetic library member's acellular enzyme equipment. In the method, by screening and pcr amplification screening RNA molecule (Tuerk and Gold (1990) Science, the 249:505 that takes turns for the difference of target ligands; Ellington and Szostak (1990) Nature, 346:818). Similarity method can be for the identification of dna sequence dna (Thiesen and Bach (1990) Nucleic Acids Res., the 18:3203 in conjunction with predetermined human transcription factor; Beaudry and Joyce (1992) Science, 257:635; W092/05258 and W092/14843). Similarly, In Vitro Translation can for the synthesis of polypeptide, can be used as a kind of method that produces large library. Usually comprise the method for stable polysome complex at W088/08453, W090/05785, W090/07003, W091/02076, W091/05058, and further describe among the W092/02536. Other non-based on phage display system as: be to adopt the polysome displayed polypeptides to be used for screening in W095/22625 and the disclosed system of W095/11922 (Affymax).
Another technology is included in the artificial compartment and screens the storehouse, and gene is connected with its gene outcome. Nucleic acid such as coding genes of interest product in a kind of screening system can screen in the micro-capsule that water-in-oil emulsion forms, this is at W099/02671, WO00/40712 and Tawfik ﹠ Griffiths (1998) Nature Biotechnol 16 (7) describe among the 652-6. The gene element of gene outcome that coding has the purpose activity is positioned in the micro-capsule, then at the micro-capsule transcription and/or translate into their corresponding gene outcomes (RNA or albumen). Then the gene element that generation is had purpose active gene product carries out sorting. This method is selected interested gene outcome by multiple means testing goal activity.
B. the structure in library
Purpose selects the structure in storehouse can adopt technology known in the art, for example said method or buy by the commercial channel. For example the storehouse of the present invention's application for example is being described among the W099/20749. In case selected carrier system, nucleotide sequences of one or more coding polypeptide of interest are cloned in this library carrier so, can produce diversity in the cloning molecular by expressing front mutagenesis; Perhaps, as mentioned above, before mutagenesis and the generation of other selection cycles, encoding proteins can express and select. The mutagenesis of the nucleotide sequence of the polypeptide of optimizing on the coding structure is undertaken by the standard molecule method. Typical usage is polymerase chain reaction or PCR, (Mullis and Faloona (1987) Methods Enzymol., 155:335, this paper quotes for referencial use) PCR is the technical method of knowing, and is by the dna replication dna that adopts a plurality of circulations of archaeal dna polymerase catalysis that a kind of heat endurance DNA the relies on interested target sequence that increases. At Winter etc., (1994) Ann.Rev. Immunology 12 discussed in 433-55 and the institute's citing document structure in Multiple Antibodies storehouse.
The PCR process adopts dna profiling (1fg at least; 1-1000ng commonly used) and at least the Oligonucleolide primers of 25pmol; When primer sets is serious when heterogeneous, it may be favourable using a large amount of primers, because each sequence only represents the sub-fraction in described group the molecule, and the quantitative change of primer gets limited in the amplification cycles after. Typical reactant mixture comprises: the 10X PCR buffer solution 1 (Perkin-Elmer of the Oligonucleolide primers of 2 μ l DNA, 25pmol, 2.5 μ l, Foster City, CA), the 1.25 μ MdNTP of 0.4 μ l, 0.15 Taq archaeal dna polymerase (the Perkin Elmer of μ l (or 2.5 units), Foster City, CA) and deionized water, cumulative volume is 25 μ l. Cover reaction system with mineral oil, carry out PCR with the sequencing thermal cycler. The length in each step of PCR circulation and temperature and period can be regulated according to the stringency of effect needs. Annealing temperature and time are all decided according to primer annealing to the efficient of template and the mispairing degree that can allow. Obviously, when nucleic acid molecules increased with mutagenesis simultaneously, mispairing was essential in the synthetic first round at least. The stringency of optimizing the primer annealing condition is the ability that those of ordinary skills possess. The annealing temperature that adopts is at 30 ℃-72 ℃. The initial sex change of template molecule is sex change 4 minutes between 92 ℃-99 ℃, 20-40 circulation then occurs, comprise: (94 ℃-99 ℃ of sex change, 15 seconds-1 minute), the annealing (temperature that determines according to the above discussion, 1-2 minute), extend (72 ℃, 1-5 minute, according to the length of amplified production). Extended at last normally 72 ℃, 4 minutes, and can follow a step that does not limit (0-24 hour, 4 ℃).
C. the combination of single variable region
The district that the present invention is used can be by known several different methods in the technology in case just be selected, and comprises that covalency and non-covalent method join together.
Method for optimizing comprises the use peptide linker, as divide at scFv cross described in the sub-connection (Bird etc., (1988) Science 242:423-426). The discussion of applicable joint is at Bird et al.Science 242,423-426; Hudson et al, Journal Immunol Methods 231 (1999) 177-189; Hudson etal, Proc Nat Acad Sci USA 85 provides among the 5879-5883. Joint preferably flexible, allow two single areas to interact. A joint example is (Gly4Ser) n joint, n=1-8 wherein is such as 2,3,4,5 or 7. Also can use though the joint of using in double antibody flexibility is relatively poor. (Holliger etc., (1993) PNAS (USA) 90:6444-6448).
In one embodiment, used joint is not immunoglobulin hinge region.
Also available joint method associating in addition of variable region, for example, the use of disulfide bond can be developed stable V by the cysteine residues of naturally-occurring or designH-V H、V L-V LOr VH-V LDimer (Reiter etc., (1994) Protein Eng.7:697-704) or by again transform between the variable region interface with promote to coincide and interactional stability (Ridgeway etc., (1996) Protein Eng.7:617-621; Zhu etc., (1997) Protein Science 6:781-788).
Other connection or stabilizing immunoglobulin variable region be antibody V particularlyHThe method in district also can suitably be used.
According to the present invention, the bispecific part may be the closed conformation in the solution. Closed conformation is that two districts are (such as VHAnd VL) exist with combining form, such as the V of combinationH-V LTo forming antibody combining site. For example, scFv can present closed conformation, depends on to connect VHDistrict and VLThe arrangement of district's joint. If joint is enough to pliable and tough, allow interregional combination or strictly the zone is fixed on binding site, closed conformation might be taked in described zone.
Similarly, VHThe district to and VLThe district is to also can closed conformation existing. Usually, this will be a kind of function of combining closely in the zone, as being connected by the rigid joint in the ligand molecular. Not only the binding partner half-life increased molecule but also in conjunction with the second target molecule to closed conformation part. Therefore, part is usually only in conjunction with increasing the second target molecule of molecular dissociation with the part half-life.
In addition, jointless VH/V H、V L/V LOr VH/V LDimeric structure provides the competition between the zone.
In addition, part can be open conformation among the present invention. The binding partner half-life increases molecule and the second target molecule to the part of this conformation simultaneously. Typically, the variable region of open conformation is (with regard to VH-V LFor) keep distance enough far away in order to can not interact between the zone, can not form an antibody combining site, and not compete combination epi-position separately. With regard to VH/V HOr VL/V LDimer, the zone is not connected together by rigid joint. In the nature situation, these zones do not form antibody combining site to will not competing conjugated antigen yet.
Probably exist with multiple equilibrium under different situations although be understandable that opening and closed type bispecific part, Fab fragment and whole antibody will mainly exist with closed conformation. Being combined with of part and target may be with the balance of described equilibrium to open Conformation Transition. Therefore, some part of the present invention can exist with two kinds of conformations in solution, and one of them (opening mode) can be independently in conjunction with two antigens or epi-position, and another kind of configuration (closed form) can only be in conjunction with an antigen or epi-position; Therefore, the competition of antigen or epi-position is in conjunction with the part of this configuration.
Although the bispecific part of open conformation can exist with closed form is balanced in solution, what it is contemplated that is that equilibrium trends towards closed form; In addition, by the combination of target thing, opening mode can hiddenly become closed conformation. Therefore, preferably some bispecific part of the present invention is that the equalized form that presents two kinds of conformations (open and closed) coexistence exists.
Bispecific part of the present invention can improve in order to be conducive to the formation of open conformation or closed type conformation. For example, stablize V with disulfide bondH-V LInteraction energy steady closure conformation. In addition, can make up for join domain and (comprise VHDistrict and VLThe district to) joint in order to be conducive to the formation of open conformation; For example, joint can stop in the space combination in described zone, as incorporate large amino acid residue at suitable position or design a suitable rigid structure with retaining zone between physical space separately.
D. the characteristics of bispecific part
The combination of bispecific part and its specific antigen or epi-position can detect by the method for the known ELISA of comprising of those skilled in the art. In a preferred embodiment of the present invention, in conjunction with adopting monoclonal Phage-ELISA method to detect.
The Phage-ELISA method can operate according to arbitrary compatible procss: the following example that this method is provided.
Each is taken turns the bacteriophage group energy that select to produce and measures its combination with selected antigen or epi-position by the ELISA method and obtain screening, with discriminating " polyclone " phage antibody. So, the phagocytosis physical efficiency in the single bacterial infection bacterium colony in these colonies screens to determine " monoclonal " phage antibody by the ELISA method. Be hopeful equally to filter out the soluble antibody fragment of conjugated antigen or epi-position, and also can adopt such as carrying out for C-or the end-labelled reagent of N-by the ELISA method. (referring to Winter et al. (1994) Ann.Rev.Immunology 12,433-55 and literature cited).
The bacteriophage monoclonal antibody diversity of selecting also can adopt gel electrophoresis (Marks et al.1991, the supra of PCR product; Nissim et al.1994 supra), detects, or estimate by carrier DNA order-checking (Tomlinson et al., (1992) J.Mol.Biol.227,776).
E. the structure of bispecific part
As mentioned above, the antibody of this paper be defined as contain at least one variable region of heavy chain and a variable region of light chain, at least two variable region of heavy chain or at least two variable region of light chain antibody (such as IgG, IgM, IgA, IgA, IgE) or fragment (Fab, Fv, the Fv that disulfide bond connects, scFv, double antibody). Antibody can be at least part ofly to come from the spontaneous antibody of some kind or produce by the DNA recombinant technique; Or from serum, B cell, hybridoma, transfectoma, yeast or bacterium, separate.
Bispecific part in the preferred embodiment of the invention comprises single variable region of heavy chain of antibody and a single variable region of light chain of antibody at least, perhaps two single heavy chains or variable region of light chain. For example, part can comprise VH/V LTo or a pair of VHDistrict or a pair of VLThe district.
The first and second variable regions of this part can be on identical polypeptide chain, and perhaps, they also can be on different polypeptide chains. In the situation of identical polypeptide chain, they can be connected by joint, joint preferred peptide sequence, as mentioned above.
The covalently or non-covalently combination of the first and second variable regions, if covalent bond, covalent bond can be disulfide bond.
If the variable region is to select from the V gene pool, for example adopt display technique of bacteriophage described herein, these variable regions comprise the general framework district so, and they can be identified by the specified genus class part that this paper defines like this. The use of general framework, genus class part etc. is described in WO99/20749.
When using the V gene pool, the variation preferred distribution on the peptide sequence is in the structure ring of variable region. The peptide sequence of each variable region can change to increase interaction between each variable region and its complementary pair by DNA reorganization or mutation method. DNA reorganization is known technically, as being lectured by Stemmer, and Stemmer, 1994, Nature 370:389-391 and United States Patent (USP) 6,297,053, the two all is incorporated herein for referencial use. Other method of mutagenesis is known to those skilled in the art.
In a preferred embodiment of the invention, the bispecific part is Single-Chain Fv Fragment of Murine. In another preferred embodiment of the present invention, the bispecific part is comprised of the Fab form.
On the other hand, the invention provides at least a nucleic acid of the bispecific part of definition here of coding.
Those skilled in the art will understand two antigens according to each side of the present invention or epi-position can be simultaneously in conjunction with the same antibody molecule. Perhaps, they can be competed in conjunction with same antibody molecule. For example, when two epi-positions are simultaneously combined, in the bispecific part two variable regions can be independently in conjunction with their target epi-position. When functional areas were competed, variable region can be in conjunction with its target, and the simultaneously related target combination with it of another variable region; In other words, the first variable region can be in conjunction with its target, and the second variable region can not be simultaneously in conjunction with its related target.
The variable region can be from the antibody for target antigen or epi-position. In addition, they can come freely to express the storehouse in the single antibody district on filobactivirus surface, and system of selection is as follows.
Usually, the nucleic acid molecules that needs in the invention process and vector construct can make up and operation by the secundum legem laboratory manual, such as (1989) Molecular Cloning:A Laboratory Manual such as Sambrook, Cold Spring Harbor, USA.
Used nucleic acid operation realizes in recombinant vector usually among the present invention.
Therefore, the present invention further provides a kind of carrier that comprises the nucleic acid of the bispecific part that at least a the present invention of coding defines.
Here used carrier refers to for allogeneic dna sequence DNA is introduced cell so that follow-up expression and/or the discontinuous element that copies. The method of selection or structure and these carriers of subsequent applications is that persons skilled in the art are known. Variety carrier is open also can be utilized, and comprises bacterial plasmid, bacteriophage and artificial chromosome and episome carrier. These carriers can be used for simple clone and mutagenesis; Perhaps expression vector also adopts. Used carrier of the present invention can be selected the size with the adaptation to end polypeptid coding sequence, and size is 0.25-40kb or longer usually. A kind of suitable host cell can be transformed by the carrier after operating through body outer clone. Each carrier comprises the several functions composition, generally includes clone's (or " polylinker ") site, origin of replication and at least one selected marker gene. If known carrier is a kind of expression vector, it has one or more following compositions in addition: enhancer element, promoter, tanscription termination and burst, each structure is positioned near the cloning site, in order to operationally link to each other with the gene of code book invention part.
Clone and expression vector contain the nucleotide sequence that carrier is copied usually in the host cell of one or more selections. In typical cloning vector, this sequence is that a kind of carrier that can make is independent of the sequence that host chromosome DNA copies outward, and comprises origin of replication or autonomously replicating sequence. These sequences are known for various bacteria, fungi and virus.
The origin of replication of plasmid pBR322 is applicable to most gramnegative bacteriums, and 2 μ m plasmid starting points are applicable to yeast, different viral starting points (as, SV40, adenovirus) useful in the mammalian cell cloning carrier. Usually, mammalian expression vector does not need origin of replication, unless they are used for the mammalian cell of the high-level repetition DNA of energy, such as the COS cell.
Advantageously, clone or expression vector can comprise Select gene, are also referred to as the screening sign. A kind of indispensable protein of this gene code is survived in selective medium or is grown for the host cell that transforms. The host cell of the carrier of involved screening-gene conversion can not survived in described culture medium. The albumen of representational screening-gene coding can to antibiotic and other toxin as: ampicillin, neomycin, methotrexate or tetracycline produce opposing, and the extra-nutrition defective is not enough or supply with the crucial nutrients that does not contain in the somatomedin.
Because the carrier of code book invention part copies and can finish in Escherichia coli very easily, adopt the Escherichia coli selection marker, can make Escherichia coli that ampicillin is produced opposing such as the beta-lactamase gene. These signs can from escherichia coli plasmid as: pBR322 or pUC plasmid as: obtain pUC18 or the pUC19.
Expression vector comprises promoter usually, and it can be identified by host organisms and can operate with the purpose coded sequence and link to each other. This kind promoter can be induction type or composing type. Term " is operably connected " and refers to position side by side (juxtaposition), and the relation between the wherein said composition allows them to play a role in set mode. The control sequence that is operably connected to coded sequence connects by this way, in order to make coded sequence obtain to express under the condition compatible with control sequence.
The promoter that is applicable to prokaryotic hosts comprises: such as beta-lactamase and Lac operon system, alkaline phosphatase, tryptophan (trp) promoter systems and hybrid promoter such as the tac promoter. The used promoter of bacterial system also generally includes and is operatively connected the sequence in the Shine-Delgarno of coded sequence.
Preferred vector is the expression vector that nucleotide sequence corresponding to peptide library member expressed. Therefore, screening the first and/or second antigen or epi-position breeding and the expression that can separate by the single clone who expresses the polypeptide libraries member or use and select arbitrarily display systems to finish. As mentioned above, preferably selecting display systems is display technique of bacteriophage, therefore, can adopt bacteriophage or phagemid vector, as: pIT1 or pIT2. The targeting sequencing of using in the invention comprises pelB, stII, ompA, phoA, bla and pelA. An example is phagemid vector, and it comprises Escherichia coli origin of replication (being used for double-stranded DNA copies), also can be phage replication starting point (being used for single stranded DNA produces). The operation of these carriers and expression are (Hoogenboom and Winter (1992) supra well-known to those skilled in the art; Nissim et al. (1994) supra). In brief, carrier comprises the beta-lactamase gene to give the selective of phasmid, be positioned at the lac promoter of expression cassette upstream, expression cassette is comprised of pelB targeting sequencing (instruct and express polypeptide arrival periplasmic space), MCS (for clone library member's nucleotides pattern), optional one or more peptide-labeled (being used for screening), optional one or more TAG terminator codons and bacteriophage albumen pIII from N to C end. Therefore, adopt different inhibition or non-inhibition coli strain, other adds glucose, isopropylthio-β-D-galactoside (IPTG) or helper phage such as VCSM13, described carrier can not expressed as plasmid replication, only produce a large amount of polypeptide libraries members or produce bacteriophage, wherein some phage surface contains the polypeptide that a copies-pIII fusions at least.
The vector construction of code book invention part adopts conventional interconnection technique. Carrier or the DNA fragment of separating are tailored, and reconnect the form that forms required carrier. If necessary, the correct sequence in the constructed carrier of Analysis and Identification in a known manner. Construction of expression vector, preparation in-vitro transcription thing, DNA introduced host cell and assay is expressed and the usability methods such as function are well known to those skilled in the art. What the existence of gene order detected, increases and/or express in the sample quantitatively can be undertaken by conventional method, as: Southern or Northern analysis, Western trace, DNA, RNA or protein spots trace, in situ hybridization, immunocytochemistry or nucleic acid or protein molecular sequence analysis. If necessary, those skilled in the art will expect how revising these methods at an easy rate.
The structure of closed conformation polyspecific part：
According to the one side of the present invention's the second configuration, two or more incomplementarity epi-positions land links together in order to form a kind of closed conformation of this paper definition. Advantageously, they can further be attached to a skeleton or/can be attached to joint described herein in addition, with the formation that promotes the closed conformation between the epi-position binding site and/or keep.
(I) skeleton
Skeleton can be based on immunoglobulin molecules or from the above-mentioned NIg. Here the preferred immunoglobulin skeleton of definition comprises from following select any or multiple: immunoglobulin molecules, and it comprises (i) antibody CL district (κ or λ subclass) at least; Or (ii) the CH1 district of heavy chain of antibody; Immunoglobulin molecules, it comprises CH1 and the CH2 district of heavy chain of antibody; Immunoglobulin molecules, it comprises the CH1 of heavy chain of antibody, CH2 and CH3 district; Or the associating in any subset (ii) and antibody CL (κ or λ subclass) district. Hinge area also can be included. The combination of this zone for example can be simulated natural antibody such as IgG or IgM, or its fragment, such as Fv, and scFv, Fab or F (ab ')2Molecule. Those skilled in the art will know that listed material is not exhaustive.
(II) albumen support
Each epi-position land comprises albumen support and one or more CDR district, and the specificity that the CDR district participates between this zone and one or more epi-position interacts. Epi-position of the present invention land advantage is to comprise 3 CDR. Applicable albumen support comprises from following any one that select: based on the immunoglobulin (Ig) zone, based on fibronectin, based on affine body (affibody), based on CTLA4, based on chaperone such as GroEL, based on lipocallin's with based on those albumen supports of bacterium Fc acceptor SpA and SpD. Those skilled in the art will know that these are not exhaustive for example.
F: be used for the support that the bispecific part makes up
i . the selection of Conformation of the main chain
Immunoglobulin superfamily member's polypeptide chain all has similar folding. For example, although antibody is highly different on primary sequence, relatively its sequence and crystal structure result demonstration againsts one's expectation, 5 (H1 in the antibody in 6 antigen coupling collars, H2, L1, L2, L3) adopt a limited number of Conformation of the main chain or norm structure (Chothia and Lesk (1987) J.Mol.Biol., 196:901; Chothia et al. (1989) Nature, 342:877). Therefore, analyze Conformation of the main chain (Chothia et al. (1992) J.Mol.Biol., the 227:799 that ring length and Key residues can be inferred H1, the H2, L1, L2 and the L3 that find in the most people antibody-like; Tomlinson et al. (1995) EMBO J., 14:4628; Williams et al. (1996) J. Mol.Biol., 264:220). Although H3 district on sequence, length and structure (because application of D section) changes very large, it also is formed with the limited number Conformation of the main chain for becate length, this depends on (Martin et al. (1996) J.Mol.Biol., the 263:800 of existing of the special residue of key position on length and ring and the antibody framework or residue type; Shirai et al. (1996) FEBS Letter, 399:1).
Bispecific antibody advantage of the present invention is that they are that regional library assembles, such as VHLibrary, district and/or VLThe library, district. In addition, bispecific part of the present invention itself can provide with the form in library. An aspect of of the present present invention, bispecific part and/or regional library are designed to can guarantee that member's Conformation of the main chain is known in the selection of some ring length and Key residues. Preferably they are real conformations of native immunoglobulin superfamily molecule, to reduce their non-functional probabilities, as mentioned above. Plant is that the V constant gene segment C can be used as a kind of applicable basic framework that makes up antibody or φt cell receptor storehouse; Other sequence also can be used. But the variation low frequency occurs, so that a few functions member can have the Conformation of the main chain after the change, and does not affect its function.
Norm structure theoretical (canonical structure theory) also for assessment of the number of the different Conformation of the main chains of part coding, is used for inferring Conformation of the main chain according to ligand sequence, is used for selecting not affect for variation the residue of its norm structure. Known person VκL1 in district ring can adopt a kind of in 4 kinds of norm structures, and the L2 ring has an independent norm structure, and 90% people VκThe L3 ring in district adopt 4 or 5 kind of norm structure in a kind (Tomlinson etc. (1995), the same); Therefore, at independent VκIn the district, the different specification structure can be in conjunction with forming a series of different Conformation of the main chains. Suppose VλThe district is norm structure and the V of L1, L2 and L3 ring coding different rangeκDistrict and VλAny V of Qu Nengyu coding H1 and H2 number of rings kind norm structureHDistrict's pairing, the number of the norm structure combination of 5 rings of this that observe so is very large. This means that in the multifarious generation that is created in the wide spectrum binding specificity of Conformation of the main chain may be necessary. Yet, by making up the antibody library based on single known Conformation of the main chain, found that with expect opposite, target basically in the abundant diversity generation of all antigens the Conformation of the main chain diversity optional. More surprisingly, the single primary chain conformation does not need the conformation of apokoinou construction-a self-assembling formation to can be used as the basis in whole storehouse. Therefore, preferred aspect is that bispecific part of the present invention has single known Conformation of the main chain.
The single primary chain conformation of selecting is common in the immunoglobulin superfamily types of molecules that comes into question preferably. Adopt certain conformation if observe a large amount of abiogenous molecules, then this conformation is usual. Therefore, according to a preferred aspect of the present invention, consider respectively the abiogenous different Conformation of the main chains of each coupling collar of immunoglobulin (Ig) zone, then can select abiogenous variable region, they have the required combination of the Conformation of the main chain of different rings. Be fit to such as nothing, immediate equivalent is also optional. Preferably the required combination of the Conformation of the main chain of different rings is that the kind by coding purpose Conformation of the main chain is that the selection of constant gene segment C produces. More preferably, to choose seeds be that constant gene segment C is frequent the expression in essence, most preferably they are that all natural kinds are to express the most frequently in the constant gene segment C.
When design bispecific part and storehouse thereof, the occurrence probability of the different Conformation of the main chains of each of 6 antigen coupling collars can be considered respectively. For H1, H2, LI, L2 and L3, select a specific conformation, it adopts the antigen coupling collar of the 20%-100% of natural birth son estranged. Normally its occurrence probability of recording is greater than 35% (that is: between 35%～100%), when desirable greater than 50% or even greater than 65%. Because most H3 rings preferably select to present Conformation of the main chain common in the ring of norm structure without the standard structure. For each ring, often the conformation of observation is therefore selected in natural storehouse. In people's antibody, the most frequently used norm structure (CS) of each ring is as follows: H1-CS 1 (expression library 79%), H2-CS 3 (46%), VκL1-CS 2 (39%), L2-CS 1 (100%), VκL3-CS 1 (36%) (calculate hypothesis κ: the λ ratio is 70: 30, Hood et al. (1967) Cold SpringHarbor Symp.Quant.Biol, 48:133). For the H3 ring with norm structure, the CDR3 of 7 residue length (Kabat et al. (1991) Sequences of proteins of immunological interest, U.S.Department of Health and Human Services) the most common, a salt bridge is arranged between residue 94 and residue 101. In the EMBL database, have at least 16 kinds of human sequence antibodies to have required H3 length and Key residues forming this conformation, and in albumen database, have at least two kinds of crystal structures can be as the basis (2cgr and 1tet) of antibody modeling. The kind of normal expression is that constant gene segment C is that the combination of norm structure is VHSection 3-23 (DP-47), JHSection JH4b, VκSection O2/O12 (DPK9) and JκSection Jκ1。V HSection DP45 and DP38 are also applicable. Therefore these section combinations can be used as the basis to be built with the storehouse of single purpose Conformation of the main chain.
Perhaps, the single primary chain conformation of selecting based on the naturally-occurring of the different Conformation of the main chains of each independent coupling collar be the substitute is the naturally-occurring of Conformation of the main chain combination with the basis of the single primary chain conformation that elects. For example, with regard to antibody, can determine the Lock-in of the norm structure combination of any 2,3,4,5 or all 6 antigen coupling collars. Here, the preferred conformation of selecting is common in naturally-occurring antibody, and most preferably it the most often observes in natural storehouse. Therefore, for example in human antibodies, when considering the naturally combination of 5 antigen coupling collar H1, H2, L1, L2 and L3, determine that modal norm structure is combined the conformation combination the most general with the H3 ring, as the basis of selecting the single primary chain conformation.
Ii. the variation of canonical sequence
Selected several known Conformation of the main chains or preferred single known Conformation of the main chain, bispecific part of the present invention or the used storehouse of the present invention can make up by changing binding site molecule point, have the storehouse of structure and/or functional diversity with generation. The generation of this meaning variant is so that they have abundant diversity in structure and/or function, in order to a series of activity can be provided.
The purpose diversity mainly produces by changing selected molecule in one or more position. The position of these changes can be selected at random or preferentially select. Can to be conventional amino acid by randomization be both replaced to produce a large amount of variants by arbitrary amino acid or its nature or synthetic analogues in the acquisition of variation so, maybe can by with one or more 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors routine amino acid of restriction subset (subset) to produce a limited number of variant.
Reported that several different methods introduces this species diversity. Fallibility PCR (Hawkins et al. (1992) J. Mol.Biol., 226:889), mutagenesis (Deng et al. (1994) J.Biol.Chem., 269:9533) or bacterium mutator (Low et al. (1996) J.Mol.Biol., 260:359) can be used for random mutation is introduced the gene of coding molecule. The mutation method of selection part is also known technically, and comprises the application of mispairing oligonucleotides or degenerate oligonucleotide, wherein with or without the application of PCR. For example, suddenly change to the antigen coupling collar by target and prepared several synthetic antibodies storehouse. Generate a series of new binding specificities (Barbas et al. (1992) Proc. Natl.Acad.Sci.USA, 89:4457) in conjunction with the H3 district of the Fab of people's tetanus toxoid randomization. At random or partly to be added into kind be to generate large library (Hoogenboom ﹠ Winter (1992) J.Mol.Biol., the 227:381 with the framework region that do not suddenly change in the V constant gene segment C H3 and L3 zone at random; Barbas et al. (1992) Proc.Natl.Acad.Sci.USA, 89:4457; Nissim et al. (1994) EMBO J., 13:692; Griffiths et al. (1994) EMBO J., 13:3245; De Kruif et al. (1995) J.Mol.Biol., 248:97). This variation has extended to and has comprised some or all other antigen coupling collar (Crameri et al. (1996) Nature Med., 2:100; Riechmann et al. (1995) Bio/Technology, 13:475; Morphosys, WO97/08320, the same).
Because having to produce approximately, the ring randomization surpasses 1015The ability of the variant of other 5 rings of the independent H3 structure of kind and similar big figure, it is infeasible adopting existing transformation technology or adopting cell free system production to represent the storehouse that might make up. For example, in a kind of maximum storehouse of present structure, produce 6 * 1010Planting different antibodies, is a potential multifarious part in the designed storehouse (Griffiths etc. (1994), the same).
In a preferred embodiment, it is diversified only having the generation of those purpose functions that are directly involved in molecule or the residue of modification. For many molecules, described function will be in conjunction with target, so variation should concentrate on the target binding site, avoid simultaneously in the molecule foldable integral (overall packing) or keep the variation of the Key residues in the selected Conformation of the main chain.
Iii. be used for the variation of the canonical sequence of antibody regions
As for the situation of antibody bispecific part, the target binding site is antigen-combining site normally. Therefore, the present invention highly preferred aspect, the invention provides the storehouse of antibody bispecific part or be used for the storehouse of antibody bispecific part assembling, wherein only have the residue on those antigen binding sites to change. These residues are very diversified in people's antibody library, and known the generation in high-resolution antibody/antigen compound contacts. For example, known in the L2 of naturally-occurring antibody on the 50th and 53 the position residue be various, and observe them and contact with antigen. Comparatively speaking, conventional method will make all residues of respective complementary determining area (CDR1) (Kabat etc. (1991, the same) definition) that variation occurs, about 7 residues, and by contrast two residue variations in the used storehouse of the present invention. The significant improvement of the needed functional diversities of a series of antigen-binding specificities aspect is created in this explanation.
The self-assembling formation of antibody diversity is the result of two processes: kind is that the body cell of V, D, J constant gene segment C recombinates to produce initial one-level storehouse (naive primary repertoire) (be also referred to as kind be and junctional diversity), and the body cell high frequency sudden change that is caused by V gene rearrangement. Human sequence antibody the analysis showed that the diversity in the one-level storehouse concentrates on the antigen binding site center, and the sudden change of body cell high frequency is the position (Tomlinson et al. (1996) J.Mol.Biol., 256:813) of high conservative in the one-level storehouse around diversity is diffused into antigen binding site. This is supplemented with the available strategy that may develop into the search sequence space, although mainly for antibody, also can be easy to be used in other peptide library. The residue that changes is the subset that forms the target binding site. In difference (the comprising overlapping) subset of target binding site residue, if necessary, in the different phase variation of selection course.
For antibody library, initial " initial (naive) " storehouse is produced as some rather than whole antigen binding site residue variations. Refer to not predetermine the antibody molecule of target at this term of quoting " initially " as this paper. These molecules similar those without the individual coded molecules of immunoglobulin gene of immunity variation, be not subjected to extensively a large amount of antigenic stimulus such as the immune system of fetus an d neonate. Then for a series of antigens or epi-position the storehouse is selected. If necessary, can outside variation zone, initial storehouse, introduce more diversity. The storehouse of this maturation can obtain selecting according to improved function, specificity or affinity.
The invention provides two kinds of initial storehouses of difference that make up the bispecific ligand binding domain, or the initial storehouse of bispecific part, wherein antigen binding site some or all residue be changed. Abiogenous one-level storehouse has been simulated in initial storehouse, diversity is confined on the residue at antigen binding site center, and these positions are that the V constant gene segment C has diversity (kind is diversity) or quilt variation (junctional diversity) in regrouping process in kind. Those diversified residues comprise but are not only limited to H50, H52, H52a, H53, H55, H56, H58, H95, H96, H97, H98, L50, L53, L91, L92, L93, L94 and L96. In " body cell " storehouse, diversity is confined to occur in the regrouping process on the residue of variation (junctional diversity) or the sudden change of body cell high frequency. Diversified residue occurs to be comprised but not to be only limited to H31, H33, H35, H95, H96, H97, H98, L30, L31, L32, L34 and L96. Diversified all residues occur in above-mentioned listed these storehouses that are suitable for, and known the generation in one or more Antibody-antigen complexes contacts. Because all residues that are not antigen binding site in two kinds of storehouses change, so, if necessary, can in selection course, can introduce other diversity by the method that changes the residue residue. Any inferior collection of very clear any these residues of those skilled in the art (or be included in the antigen binding site other residue) can be used as the initial and/or follow-up variation of antigen-combining site.
In making up the used storehouse of the present invention, the variation at selected position mainly obtains in nucleic acid level, and the coded sequence by changing the regulation peptide sequence is in order to can be incorporated on that position the possible amino acid (whole 20 kinds or its subset) of some. Adopt IUPAC (IUPAC) nomenclature, universal code is NNK, its encode all amino acid and TAG terminator codon. It is to introduce required diversity that the NNK codon preferably adopts purpose. Other codon that obtains identical purpose also can adopt, and comprises the NNN codon, and it can cause the generation of extra terminator codon TGA and TAA.
The side chain variation feature of the antigen binding site of human antibodies is that some amino acid residue is had obvious preference. If calculate each VH、V κ, V λ zone the summation that forms of the amino acid of 10 most diverse positions, side chain diversity greater than 76% is only from 7 kinds of different residues, and they are serine (24%), tyrosine (14%), asparagine (11%), glycine (9%), alanine (7%), asparatate (6%) and threonine (6%). This hydrophilic residue and the preference of little residue to flexibility that main chain can be provided perhaps reflected and tends to also can help to explain required the mixing of antibody in the one-level storehouse in conjunction with the extensive evolutionary process on the surface of antigen or epi-position.
Because preferably imitate this amino acids distribution, be changed and see in the antigen binding site of the preferred analog antibody of amino acids distribution at position. The preference of this amino acid replacement allows to select some polypeptide for a series of target antigens (not being antibody polypeptides), is easy to be used in any peptide library. The amino acids distribution (comprise and adopt trinucleotide mutagenesis (tri-nucleotide mutagenesis) to see WO97/08320) that has several different methods to be used to setover to change the position, because it is easy to synthesize, method for optimizing is to adopt conventional degenerate codon. By amino acids distribution figure and the natural amino acid utilization rate of all degenerate code sub-portfolios (single, double, three be identical in each position with four kinds of degeneracies) coding, can calculate most representative codon by relatively. Codon (AGT) is (AGC) C and (AGT) (AGC) (CT) of T, (AGT) (AGC), also can use respectively IUPAC called after DVT, DVC and DVY, they are extremely near the amino acid whose distribution map of purpose: their encode 22% serine and 11% tyrosine, asparagine, glycine, alanine, asparatate, threonine and cysteines. Therefore, preferably can adopt DVT, DVC or DVY codon to make up the library in each diversified position.
G: the antigen that can increase the part half-life
Bispecific part of the present invention is combined with the molecule that one or more can increase this part Half-life in vivo with its a kind of configurational energy. Common described molecule is abiogenous polypeptide in the body, can resist internal body and get rid of the degraded of inessential material endogenous mechanism and remove. For example, increasing the molecule of organism half-life can be from following screening:
Extracellular matrix protein, for example: collagen, laminin, integrin and fibronectin. Collagen is the extracellular matrix major protein. Approximately know at present 15 kinds of tropocollagen molecules that are positioned at the body different parts, be distributed in bone, skin, tendon, ligament, cornea and the internal organ such as type i collagen (accounting for body collagen 90%), the II Collagen Type VI is distributed in cartilage, spinal disc, notochord, the eye vitreous humor.
Albumen in the blood comprises: plasma protein such as fibrin, alpha2 Macroglobulin, serum albumin and fibrinogen A, fibrinogen B, serum amyloid A protein, heptoglobin (heptablobin), CKIs (profilin), ubiqutin (ubiquitin), uteroglobin (uteroglobulin) and β 2 microglobulins;
Enzyme and mortifier, as: plasminogen, lysozyme, cysteine proteinase inhibitor C, α-1 antitrypsin and pancreas trypsininhibitory substance. Plasminogen is the inactive precursor of trypsin-like serine protease fibrinolysin. It is found in blood circulation usually. Behind Plasminogen activation, be transformed into fibrinolysin, manifest effective enzyme district with the fibrin fibrillation of the haemocyte that condenses in the dissolved blood clot. This is called fibrinolysis.
Immune system protein, as: IgE, IgG, IgM.
Transport protein, as: RBP ELISA, α 1 microglobulin.
Sozin, as: β sozin 1, neutrophil cell sozin 1,2 and 3.
The albumen of finding on blood-brain barrier or the nerve fiber, as: short melanocyte acceptor, myelin, ascorbic acid transport protein.
TfR ligands specific-neuropharmaceutical agent fusion (seeing US5977307);
Brain capillary endothelial cell acceptor, transferrins, TfR, insulin, type-1 insulin like growth factor (IGF 1) Receptors, insdri like growth factor 2 (IGF 2) Receptors, insdri acceptor.
Be positioned at the albumen of kidney, as: poly cystine (polycystin), IV Collagen Type VI, organic anion transport protein K1, Heymann ' s antigen.
Be positioned at the albumen of liver, as: alcohol dehydrogenase, G250.
Stuart factor.
Alpha1 Anti-trypsin.
HNF 1α。
Be positioned at the albumen of lungs, as: secretory component (in conjunction with IgA).
Be positioned at the albumen of heart, as: HSP 27. This is relevant with dilated cardiomyopathy.
The egg matter that is positioned at skin is white, as: keratin.
Bone matrix proteins, as: bone morphogenetic protein (BMP) is a subclass of transforming growth factor β superfamily, has living bone active. For example: BMP-2 ,-4 ,-5 ,-6 ,-7 (being also referred to as living SPP1 (OP-1)) and BMP-8 (OP-2).
Tomour specific albumen comprises: people's TA, herceptin acceptor, ERs, cathepsin such as cathepsin B (seeing in the liver spleen).
Disease specific albumen is as only expressing the antigen on activating T cell: comprise that LAG-3 (lymphocyte activation gene), OPG (osteoprotegerin) part (OPGL) are referring to Nature 402,304-309; 1999, OX40 (TNF receptor family member, expression on activating T cell, and be unique knownly produce on the cell by the common stimulation T cellular elements of specificity up-regulated expression in people I type T chronic myeloid leukemia virus (HTLV-I)) see J Immunol.2000Jul 1; 165 (1): 263-70; Metalloproteinases (related with arthritis/cancer) comprises CG6512 fruit bat, people's paraplegia albumen (paraplegin), people FtsH, people AFG3L2, mouse ftsH; The angiogenic growth factor, comprise acid fibroblast growth factor (FGF-1), basic fibroblast growth factor (FGF-2), the VEGF/vascular permeability factor (VEGF/VPF), transforminggrowthfactor-α (TGF a), tumor necrosis factor α (TNF-a), angiogenin, interleukin 3 (IL-3), interleukin 8 (IL-8), platelet-derived endothelial growth factors (PD-ECGF), placenta growth factor (PlGF), Midkine (midkine), platelet-derived growth factor-BB (PDGF), CX3C chemotactic factor (CF) (fractalkine).
Stress protein (heat shock protein, HSP). HSP generally finds in cell. When outside born of the same parents, finding HSP prompting cell death and content being overflowed. This non-procedural cell death (necrosis) thus only causing in vivo the outer HSP initiation of born of the same parents immune system to reply anti-infective and disease because of wound, i or I. Two sepcific ligands in conjunction with the outer HSP of born of the same parents can be located in disease location.
The albumen that relates to the Fc transhipment.
Brambell acceptor (being also referred to as FcRB), this Fc acceptor has two kinds of functions, and the two has potential purposes in delivery. Described function is that (1) is transitted to fetus (2) with IgG from parent by placenta and prevents that IgG from degrading to prolong its serum half-life. It is believed that acceptor makes IgG recycle from endosome. See Holliger etc., Nat Biotechnol 1997 Jul; 15 (7): 632-6.
Part can be designed to above-mentioned target-specific and without any need for increasing or do not increase Half-life in vivo among the present invention. For example: the part among the present invention can be specifically for the target from aforementioned tissue-specific screening, thereby can make the bispecific part have the tissue specificity target, the perhaps relevant target of dAb monomer conjunctive tissue specific treatment, this result do not consider any increase of half-life, although can reach yet. In addition, when part or dAb monomer target kidney or liver, this can be redirected to optional removing approach (for example, part can change kidney into from liver removing approach and remove approach) with part or dAb monomer in vivo.
H: according to the application of the polyspecific part of the present invention's the second configuration
Polyspecific part according to the present invention's the second configuration method can be applicable to interior therapeutic and prevention, inside and outside diagnosis, analyzed in vitro and reaction reagent purposes etc. For example, antibody molecule can be used for the analytical technology based on antibody, and such as elisa technique, these methods are known for the technical staff.
As above indirectly mentioned, polyspecific part of the present invention can be used for diagnosis, prevention and treatment. The purposes of polyspecific part in diagnosis is to adopt standard immunoassay group means to carry out Western to analyze and the original position Protein Detection among the present invention; In these were used, part was according to the technology conventional means and mark. In addition, when with the chromatography holder as: during resin compounded, this antibody polypeptides can be used for preparation property affinity chromatography program. All these methods are known for those skilled in the art.
The diagnostic uses of the polyspecific part of the closed conformation of the present invention comprises the homogeneous analysis to analyte, what use is that the polyspecific part of closed conformation can be competed the ability in conjunction with two target position, thereby two targets can not be simultaneously in conjunction with (closed conformation), or use they can be simultaneously in conjunction with the ability (open conformation) of two targets.
The diagnosis that drug development is used and the manufacturer that researchs and analyses system seek real homogeneous immunoassay form very solicitously. Main Diagnosis market comprises: hospital, clinic and outpatient service, relate to the people's class testing in commercial laboratory, blood bank and the family, be not used in people's diagnosis (for example: food inspection, water detection, environment measuring, biological protection and animal doctor detect), and final research (comprising: drug development, basic research and academic research).
At present, the immunoassay system used of all these markets all center on chemiluminescence, ELISA, fluorescence or the putting immune technology of employing and setting up sometimes. Each analytical form needs separating step (reagent that separates combination from non-binding reagent). In some cases, the step that needs several steps separation. Increasing these additional steps has increased reagent and automation mechanized operation, has needed the time, has affected the final analysis result. In mankind's diagnosis, separating step can be automation, has covered up problem, but can not deal with problems. Robotics, interpolation reagent, interpolation incubation time etc. have increased suitable cost and complexity. In drug development as: in the high flux screening, test one by one millions of samples at once with very low-level test molecule, add additional separating step and can make and carry out the Disability that screens. Yet, do not divide defection in reading, to produce too many noise. So, need a real homogeneous phase form so that the sensitivity within the available scope of present analysis form to be provided. Preferably a kind of have high sensitivity and than the fully quantitatively reading Analysis method of great dynamic range. Sensitivity is a very important condition, reduces so required sample size. These features all are the features that homogeneous system provides. This is extremely important when sample is very precious in health detection and in drug development. Outphasing system, it is current available technology, needs great amount of samples and expensive reagent.
The homogeneous analysis purposes comprises: cancer detection, maximum analysis are the PSAs that screens in the patients with prostate cancer. Other purposes comprises the fertility inspection, a series of detections is provided for the conceived women of plan, comprises the β-HCG of gestation. The experiment of infectious diseases comprises: hepatitis, HIV, rubella and other virus and microorganism and sexually transmitted disease. Experiment can be used for blood bank and detects, and particularly detects HIV, A type, Type B, C type and non-a non-b hepatitis. The curative drug monitoring experiment comprises that the prescription medicine level of tracking and monitoring produce effects in patient body is to avoid toxicity, for example: the used digoxin of arrhythmia cordis, insane phenobarbital level, the used theophylline of asthma. Diagnostic test also can be used for drug abuse and detects, such as the detection of cocaine, hemp etc. Metabolism is used for measuring thyroid function, anaemia and other physiologic derangement and function.
The homogeneous immunoassay form also can be used for the manufacturing of standard clinical chemical examination. Collect immunoassay and chemically examine on same instrument and in diagnostic test, extremely preponderate. Suitable chemical analysis comprises measures glucose, cholesterol and potassium etc.
Another main application of homogeneous immunoassay is to find medicine and drug development: high flux screening comprises with the combinatorial chemistry library of ultra-high capacity mensuration for target. Then detection signal is divided into more group with positive colony, finally detects in cell and animal body. Homogeneous analysis can be used for the detection of all these types. In drug development, particularly immunoassay is adopted in zooscopy and clinical testing in a large number. Homogeneous analysis promotes and has simplified these operations greatly. Other purposes comprises that F﹠B detects: the Escherichia coli in mensuration meat and other food, salmonella etc.; Water detects and comprises that all types pollutant of water plant comprises colibacillary detection; Detect with the animal doctor.
In an extensive embodiment, the invention provides a kind of binding analysis method, comprise a kind of detectable reagent that is combined in the closed conformation polyspecific part in the invention, and can detect characteristic by the Binding change of analyte and described closed conformation polyspecific part. This detection can be set for multiple multi-form, and each all utilizes the characteristic of above-mentioned closed conformation polyspecific part.
Analysis depends on analyte and directly or indirectly replaces preparation, causes the detected characteristic of described preparation to change. For example when described preparation be when can one of catalysis having a kind of enzyme of reaction of end point detectable, thereby described enzyme can be blocked its avtive spot by ligand binding, therefore makes enzyme deactivation. Can be closed the replaceable enzyme of analyte of conformation polyspecific ligand binding, make enzyme have activity by discharging avtive spot. Then this enzyme-to-substrate reaction produces a kind of event that detects. In another embodiment, part can be combined in outside the enzyme active sites, thereby the conformation that affects enzyme changes its activity. For example: part that the structure of avtive spot can be combined limitation, or the combination of active essential co-factor is prevented from.
The physical implementation condition of described analysis can adopt any form known in the art. For example: closed conformation polyspecific part/multienzyme complex can the test-strips form provide; Substrate can provide in the test-strips zones of different, and the solvent that comprises analyte allows by part/multienzyme complex migration, substituted enzyme, and take it to substrate zone and produce signal. Perhaps, part/multienzyme complex can prod or other solid phase provide, be immersed in analyte/substrate solution, enzyme is discharged into existing with the response analysis thing in the solution.
Because enzyme molecule of each analyte molecule release potential, so described analysis is quantitative, the signal strength signal intensity that produces in the stipulated time relies on the concentration of analyte in the solution.
Adopt the analyte of closed conformation that how possible configuration is arranged. For example, the polyspecific part of closed conformation can be designed to the allosteric site of desmoenzyme, thus kinase. In this embodiment, enzyme is activated when existing without analyte. Add the replaceable enzyme of analyte and eliminate allosteric activation, therefore make enzyme deactivation.
Context in above-mentioned embodiment utilizes enzymatic activity to weigh the concentration of analyte, and enzyme activation or inactivation refer to increase and the minimizing of enzymatic activity, by measuring the ability measurement of enzymatic signal reaction of formation. For example, enzyme can catalysis can not be surveyed the form surveyed that substrate conversion is it. For example, horseradish peroxidase and colour former and chemiluminescence agent substrate are widely used in this area, and described enzyme and colour former or chemiluminescence agent substrate can conveniently have been bought. The increase of enzymatic activity or descend can be between 10%-100%, for example 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%; If active increasing, described increase can be greater than 100%, that is: 200%, 300%, 500% or more, if repressed enzyme baseline activity does not measure, can not detect and be percentage.
In multi-configuration more, substrate rather than enzyme that closed conformation polyspecific part can desmoenzyme/substrate centering. Therefore substrate is difficult to touch enzyme, until discharge from closed conformation polyspecific part by the bound analyte enzyme. The enforcement of this configuration relates to the configuration of desmoenzyme.
In addition, analysis can be set as in conjunction with a kind of fluorescence molecule, and such as fluorescein or another kind of fluorogen, fluorescence is with regard to cancellation when binding partner. In this case, analyte and ligand binding will be replaced fluorescence molecule, therefore produce a signal. The alternate item of the fluorescence molecule that the present invention is used comprises luminous agent such as luciferin/luciferase, and colour former comprises preparation such as the HRP that is usually used in immunoassay.
The polyspecific part of the present invention preparation prevent and treat purposes relate to the mammal receptor as: the people uses part of the present invention. Polyspecific can allow antibody with high affinity in conjunction with polymer antigen. The polyspecific part can make two antigen crosslinkings, for example in the kill process of raising cytotoxic T cell mediation tumor cell line.
Substantially pure part or its be in conjunction with albumen for example: the dAb monomer, and the 90-95% homogeney preferably delivers medicine to mammal at least, and 98-99% or more homogeneys most preferably are used for medicinal, particularly when mammal is the people. In case purifying, partially or completely reach required homogeneous part and can be used for diagnosis or treatment (comprising external application) or (the Lefkovite and Pernis such as Application and Development analytical method, immunofluorescence dyeing, (1979 and 1981) Immunological Methods, Volumes I and II, Academic Press, NY).
Part or its will be generally used for prevention, suppress or treatment inflammatory conditions, allergia hypersensitivity, cancer, bacterium and virus infections and autoimmunity disease (comprise but be not only limited to type i diabetes, asthma, multiple sclerosis, rheumatoid arthritis, systemic loupus erythematosus, Crohn's disease disease and myasthenia gravis) such as: the dAb monomer among the present invention in conjunction with albumen.
In instant the application, term " prevention " gives protective composite before being included in and inducing disease. " inhibition " refers to induce after the event but give composition before the disease clinical manifestation. " treatment " comprises that disease symptoms gives protective composite after obvious.
Can utilize animal model system, be used for screening antibodies or it is in conjunction with the validity of albumen in protection or treatment disease. The method of detection system lupus erythematosus (SLE) technically known (Knight et al. (1978) J.Exp.Med., 147:1653 in responsive mouse; Reinersten et al. (1978) New Eng J. Med., 299:515). Myasthenia gravis (MG) is tested in the SJL/J female mice, by with the solubility AchR of another species is protein induced should disease (Lindstrom et al. (1988) Adv.Immunol., 42:233). Be that mouse is induced arthritis (Stuart et al. (1984) Ann. Rev.Immunol., 42:233) by injection II Collagen Type VI to the susceptible kind. Described by injection mycobacterium heat shock protein and induced the arthritic model of susceptible rat generation adjuvant type (Van Eden et al. (1988) Nature, 331:171). Inducing of Mouse thyroid inflammation is by giving thyroglobulin (Maron et al. (1980) J.Exp.Med., 152:1115). IDD (IDDM) naturally-occurring or induce in some Strains of Mouse, such as Kanasawa et al. (1984) Diabetologia, 27:113 is described. The EAE Mouse and rat is as the model of people MS. In this model, Demyelination is induced by giving MBP and (is seen Paterson (1986) Textbook of Immunopathology, Mischer et al., eds., Grune and Stratton, New York, pp.179-213; McFarlin et al. (1973) Science, 179:478; And Satoh et al. (1987) J.Immunol., 138:179).
Usually, part of the present invention will add suitable pharmaceutical carrier and use with purified form. Typically say, these carriers comprise water quality, alcohol/aqueous solution, emulsion or suspending agent, comprise any carrier of salt and/or buffer medium. The parenteral medium comprises sodium chloride solution, woods Ge Shi glucose, glucose and sodium chloride and lactate ringer's solution. If must keep polypeptide complex to be suspended state, receptible adjuvant can be selected from thickener such as carboxymethyl cellulose, polyvinylpyrrolidone, gelatin and alginates on the suitable physiology.
Intravenous injection with medium comprise liquid nutritional fill-in and electrolyte supplements as: those are based on the material of woods Ge Shi glucose. Anticorrisive agent and other additive as: also can there be (Mack (1982) Remington ' s Pharmaceutical Sciences, 16th Edition) in antiseptic and antioxidant, chelating agent and inert gas.
Part of the present invention can be used as the composition of independent administration or unites use with other preparation. These comprise that various immunization therapy medicines are such as cyclosporin, methotrexate, adriamycin or cis-platinum and immunotoxin. Pharmaceutical composition can comprise " mixture " of the preparation of various cellulotoxic preparations or other and the ligand united application of the present invention, perhaps in addition the combination with homospecific part not such as the part selected with different target antigens or epi-position, no matter whether they converge before use.
The method of administration of pharmaceutical composition of the present invention can be that any those skilled in the art in those this areas know. Be used for the treatment of, comprise without limitation immunization therapy, give arbitrary patient with standard method with the selected part of the present invention. Medication can comprise by any suitable pattern: parenteral, intravenous, intramuscular, endoperitoneal, through skin, through the lung approach or also can suitably directly pour into by conduit. Contraindication and other parameter that whether the dosage of medication and frequency will be according to patient age, sex and conditions, give simultaneously with other medicines, the clinician considers decide.
Part of the present invention can freeze-drying be preserved and can rebuild in appropriate carrier before use. This technology has shown that for the routine immunization globulin be effectively, and known freeze-drying and reconstruction technique can be employed. Those skilled in the art know freeze-drying and rebuild the antibody activity can cause in various degree lose (for example: for the routine immunization globulin, IgM antibody tends to have larger loss of activity than IgG antibody) and application level can raise to recompense.
The composition that comprises part of the present invention or its mixture can be administered for and prevent and/or treat. In some treatments are used, reach at least part of prevention, inhibition, regulate, kill and wound the sufficient dosage of selected cell mass, or reach some other sufficient dosage that can survey parameter and be defined as " treatment effective dose ". The amount that need to reach this dosage will depend on the order of severity and the immune general state of patient itself of disease, but common dosage range is every kg body weight 0.005-5.0mg part, and for example: antibody, acceptor are (for example: φt cell receptor) or it is in conjunction with albumen. 0.05-2.0mg/kg/ dosage is more commonly used. During prophylactic, can be with similar or lower slightly dosage when comprising the composition administration of part of the present invention or its mixture.
With the symptom that occurs before the treatment or with do not compare with the symptom of said composition treatment individual (human or animal's model), if one or more sx↓ (as: alleviate at least 10% or alleviate at least a branch of clinical evaluation standard), " effectively " thought in the treatment of carrying out with composition described herein so. According to the disease for the treatment of or disorderly difference, symptom will be obviously different, but can be recorded by ordinary skill skilled clinician or technician. For example, these symptoms can (for example be measured by the level of following the tracks of one or more biochemical indicators that detect disease or disorder, level with enzyme or the metabolin of disease association, affected cell number etc.), by the monitoring physical manifestations (as, inflammation, tumor size etc.), or the clinical evaluation standard by generally acknowledging, for example: the anergy situation grade of expansion (be used for multiple sclerosis), (32 branch evaluations relate to the score of the quality of life of intestines function, constitutional symptom, social function and heartbeat conditions to Irvine inflammatory bowel disease questionnaire, scope 32-224, high score represents that quality of life is better), life in patients with rheumatoid scoring or other clinical score grade of generally acknowledging are known in the field. The continuing of disease or disorderly symptom alleviates (for example, more than a day or a day or preferred longer time) at least 10% or clinical one or more branches that provide grade then show it is that " effectively " treated. Equally, compare with the corresponding symptom without the similar individuals (human or animal's model) of combination treatment, if the morbidity of one or more symptoms or seriousness are postponed, reduce or eliminates, the effect that composition so of the present invention is used for prevention is " effectively ".
The composition that comprises part of the present invention or its mixture can be used for preventing and treats background to help change, deactivation, to kill and wound or eliminate the target cell group who selects in the mammal. In addition, polypeptide described herein selects the storehouse to can be used for the external target cell group who optionally kills and wounds, subdues or otherwise effectively eliminate in the foreign cell set. Mammalian can be at external binding partner, for example: antibody, cell surface receptor or its be in conjunction with albumen, and undesired cell is killed or is removed from blood in the blood by this, then according to standard method with blood recovery to mammal.
I: the application of the bispecific part that the half-life increases among the present invention
The bispecific part of method preparation can be used for interior therapeutic and prophylactic applications, in-vivo diagnostic application etc. among the present invention.
The treatment of the bispecific part for preparing among the present invention and preventive use comprise part of the present invention are delivered medicine to the mammal receptor such as the people. Bispecific antibody of the present invention comprises at least a specificity that strengthens molecule for the half-life; One or more specificitys are orientable for target molecule. For example: bispecific IgG can specificity for 4 epi-positions, one of them is to strengthen on the molecule in the half-life. Bispecific can allow antibody with high affinity in conjunction with poly antigen. Bispecific antibody can make two antigen crosslinkings, for example occurs in the kill process of raising cytotoxic T cell mediation tumor cell line.
Substantially such as the dAb monomer, the 90-95% homogeney preferably delivers medicine to mammal at least in conjunction with albumen for pure part or its, and 98-99% or more homogeneys most preferably are used for medicinal, particularly when described mammal is the people. In case purifying, partially or completely reach required homogeneous part and can be used for diagnosis or treatment (comprising external) or (the Lefkovite and Pernis such as development and application analytical method, immunofluorescence dyeing, (1979 and 1981) Immunological Methods, Volumes I and II, Academic Press, NY).
Part among the present invention will be typically be used for prevention, suppress or treatment inflammatory conditions, allergia hypersensitivity, cancer, bacterium or virus infections and autoimmunity disease (comprise but be not only limited to type i diabetes, asthma, multiple sclerosis, rheumatoid arthritis, systemic loupus erythematosus, Crohn's disease and myasthenia gravis).
In instant the application, term " prevention " gives protective composite before being included in and inducing disease. " inhibition " gives composition when referring to induce after the event and to occur prior to the disease clinical manifestation. " treatment " comprises that disease symptoms gives protective composite after obvious.
Can utilize animal model system, be used for screening bispecific part in the validity of protection or treatment disease. The method of detection system lupus erythematosus (SLE) is known technically in responsive mouse. (Knight et al. (1978) J.Exp.Med., 147:1653; Reinersten et al. (1978) New Eng J. Med., 299:515). Myasthenia gravis (MG) is tested in the SJL/J female mice, by with the solubility AchR of another species is protein induced should disease (Lindstrom et al. (1988) Adv.Immunol., 42:233). Induce arthritis (Stuart et al. (1984) Ann. Rev.Immunol., 42:233) by injection II Collagen Type VI to mouse susceptible system. Described by injection mycobacterium heat shock protein and induced the arthritic model of susceptible rat generation adjuvant type (Van Eden et al. (1988) Nature, 331:171). Inducing of Mouse thyroid inflammation is by giving thyroglobulin (Maron et al. (1980) J.Exp.Med., 152:1115). IDD (IDDM) naturally-occurring or induce the Diabetologia such as Kanasawa et al. (1984) in some mouse system, 27:113 is described. The EAE Mouse and rat is as the model of people MS. In this model, Demyelination is induced by giving MBP and (is seen Paterson (1986) Textbook of Immunopathology, Mischer et al., eds., Grune and Stratton, New York, pp.179-213; McFarlin et al. (1973) Science, 179:478; And Satoh et al. (1987) J.Immunol., 138:179).
Bispecific part of the present invention and dAb monomer can be in conjunction with the born of the same parents' external targets (such as Clathrin) that relates to endocytosis, and described target can make the bispecific part by endocytosis, makes another kind be delivered to intracellular environment in conjunction with the specificity of target in the cell. This strategy needs the bispecific part to have the physical features that keeps function in born of the same parents. Perhaps, if compartment is oxidisability in the final cell of part, a kind of part that suitably folds may not require without disulfide bond.
Usually, this bispecific part will add suitable pharmaceutical carrier and use with purified form. Usually, these carriers comprise water-based or alcohol/aqueous solution, emulsion or suspending agent, comprise any carrier of salt and/or buffer medium. The parenteral medium comprises sodium chloride solution, woods Ge Shi (Ringer ' s) glucose, glucose and sodium chloride and lactate ringer's solution. If must keep polypeptide complex to be suspended state, receptible adjuvant can be selected from thickener such as carboxymethyl cellulose, polyvinylpyrrolidone, gelatin and alginates on the suitable physiology.
The intravenous medium comprises liquid nutritional fill-in and electrolyte supplements, as: those are based on woods Ge Shi glucose. Anticorrisive agent and other additive as: also can there be (Mack (1982) Remington ' s Pharmaceutical Sciences, 16th Edition) in antiseptic and antioxidant, chelating agent and inert gas.
Part of the present invention can be used as the composition of independent administration or unites use with other preparation. These comprise that various immunization therapy medicines are such as cyclosporin, methotrexate, adriamycin or cis-platinum and immunotoxin. Pharmaceutical composition can comprise " mixture " of the preparation that various cellulotoxic preparations or other and the present invention are ligand united.
The method of administration of pharmaceutical composition of the present invention can be that any those of ordinary skill in those this areas is known. Be used for the treatment of, include but not limited to immunization therapy, give arbitrary patient with standard method with part of the present invention. Medication can by any suitable pattern, comprise: parenteral, intravenous, intramuscular, endoperitoneal, through skin, through the lung approach or also can suitably directly pour into by conduit. Contraindication and other parameter that whether the dosage of medication and frequency will be according to patient's age, sex and situations, give simultaneously with other medicines, the clinician considers decide.
Part of the present invention can freeze-drying be preserved and can rebuild in appropriate carrier before use. This technology has shown that for the routine immunization globulin be effectively, and the freeze-drying of known method and reconstruction technique can be employed. Those skilled in the art know freeze-drying and rebuild the antibody activity can cause in various degree lose (for example: for the routine immunization globulin, IgM antibody tends to have larger loss of activity than IgG antibody) and application level has to raise with compensation.
The composition that comprises part of the present invention or its mixture can be administered for and prevent and/or treat. In some treatments are used, reach at least part of prevention, inhibition, regulate, kill and wound the sufficient dosage of selected cell mass, or reach some other sufficient dosage that can survey parameter and be defined as " treatment effective dose ". The amount that need to reach this dosage will depend on the order of severity and the immune general state of patient itself of disease, but the common dosage range of part is every kg body weight 0.005-5.0mg. Dosage range is that the 0.05-2.0mg/kg/ agent is more commonly used. During prophylactic, the administration that comprises the composition of part of the present invention or its mixture can be with identical or lower slightly dosage.
A kind of composition that comprises part of the present invention can be used for preventing and treats background to help change, deactivation, to kill and wound or remove the target cell group who selects in the mammal.
In addition, polypeptide described herein selects the storehouse to can be used for external selective killing, subdue or otherwise effectively eliminate targeted cell population in the foreign cell set. Mammalian can be at external binding partner, for example: antibody, cell surface receptor or it is in conjunction with albumen, undesired cell is killed or is otherwise removed from blood in the blood by this, then according to standard method with blood recovery to mammal.
In order to further describe the present invention, following examples have been enumerated.In order to name dAb, used here human TNF alpha is called TAR1, and human TNF alpha acceptor 1 (p55 acceptor) is called TAR2.
Embodiment 1: at (the screening of the dual specific scFv antibody (K8) of β-gal) of human serum albumin (HSA) and beta-galactosidase enzymes
Present embodiment has been explained the method for preparation at the bi-specific antibody of β-gal and HSA, is (simulation) V according to selecting and plant in conjunction with β-gal HThe V that the district connects κThe storehouse, variable region is (simulation) V according to selecting and plant in conjunction with HSA κThe V that the district connects HThe storehouse, variable region.Make up the V that selects then HHSA and V κ β-gal variable region, and according to selecting antibody in conjunction with β-gal and HAS.HSA strengthens albumen at the transformation period of finding in human blood.
Four kinds with in this experiment people's phage antibody library.
The storehouse is V for a kind κ/ DVTV H8.46 * 10 7
The storehouse is V for 2 kinds κ/ NNKV H9.64 * 10 7
The storehouse is V for 3 kinds H/ DVTV κ1.47 * 10 8
The storehouse is V for 4 kinds H/ NNKV κ1.45 * 10 8
All antibody libraries are based on single people V H(V3-23/DP47 and J H4b) and V κ(O12/O2/DPK9 and J κ1) framework, complementary determining region (CDR2 and CDR3) has mixed the side chain diversity.
Storehouse 1 and storehouse 2 comprise simulation V κSequence, and V HSequence variation (Fig. 1) on H50, H52, H52a, H53, H55, H56, H58, H95, H96, H97 and H98 (respectively by DVT or NNK coding) position.Storehouse 3 and storehouse 4 comprise simulation V HSequence, and V κSequence variation (Fig. 1) on L50, L53, L91, L92, L93, L94 and L96 (respectively by DVT or NNK coding) position.These storehouses are phagemid pIT2/ScFv forms (Fig. 2), and according to selecting in advance in conjunction with belonging to class part, albumin A and albumen L, so the overwhelming majority clone who does not screen in the storehouse has function.Above the size of sizableness behind prescreen in shown storehouse.Storehouse 1 and storehouse 2 are generating one V with mixing before the antigen selection H/ simulation V κThe storehouse, the single V of formation is mixed in storehouse 3 and storehouse 4 κ/ simulation V HThe storehouse.
β-gal is used V κ/ simulation V HThe storehouse is carried out 3 and is selected circulation, and HSA is used V H/ simulation V κThe storehouse is carried out 3 and is selected circulation.With regard to β-gal, phage titre is from first round-robin 1.1 * 10 6Rise to the 3rd round-robin 2.0 * 10 8With regard to HSA, phage titre is from first round-robin 2 * 10 4Rise to the 3rd round-robin 1.4 * 10 9(1993) such as the execution of this selection such as Griffith are described, except employing KM13 helper phage (it comprises a kind of pIII albumen, has protease cracking site between D2 and D3 district), and with containing the tryptic PBS wash-out bacteriophage of 1mg/ml.Tryptic interpolation is that cracking is from the pIII albumen (but not being that those are from phagemid) of helper phage and by cut the scFv-phage fusions (Fig. 2) of elution of bound in the c-myc mark, therefore further enriched the phage of expressive function scFv and background correspondingly reduces (Kristensen and Winter, Folding ﹠amp; Design 3:321-328, Jul 9,1998).Selection is to adopt to be coated with the HSA of 100 μ g/ml concentration or the immune test tube of β-gal.
In order to detect combination, 24 bacterium colonies in each the 3rd circulation source of selecting can be by the screening of mono-clonal phage E LISA method.The phage particulate is pressed Harrison etc., Methods Enzymol.1996; Preparation that 267:83-109 describes.With the concentration of 100 μ l be the HSA of 10 μ g/ml or β-gal PBS liquid bag by 96 hole elisa plates, under 4 ℃ of conditions, spend the night.Carry out standard ELISA operation steps (Hoogenboom etc., 1991) then, adopt anti--M13-HRP conjugate to detect the bonded phage.Clonal selection discharge the ELISA signal in 50 μ l supernatants greater than 1.0.
Then, adopt QIAprep Spin Miniprep test kit (Qiagen), to the V of HSA screening H/ simulation V κStorehouse and the V that β-gal is screened κ/ simulation V HThe storehouse prepares DNA prepared product (preps).For obtaining bigger diversity, the DNA prepared product can prepare from each circulation of 3 round-robin of chosen process, collects together then each antigenic DNA prepared product.Use SalI/NotI37 ℃ of digested overnight DNA prepared product then.The fragment that obtains behind glue purification, on β-gal, screen from V κ/ simulation V HThe V in storehouse κChain is connected, and substitutes the V to the HSA screening H/ simulation V κSimulation V in the storehouse κChain generates 3.3 * 10 9Individual clone.
This storehouse both can be selected promptly HSA/ β-gal then: the first round, second took turns the selection about β-gal about the selection of HSA; Also can select promptly β-gal/HSA: the first round, second took turns the selection about HAS about the selection of β-gal.Chosen process as mentioned above.After second takes turns selection, adopt the segmental ELISA method of mono-clonal phage E LISA method (as mentioned above) and solubility scFv to detect the combination of 48 clones to HSA and β-gal.The segmental preparation of soluble antibody is as (1996) such as Harrison are described, the standard ELISA program is according to (1991) NucleicAcids Res. such as Hoogenboom, the described method of 19:4133 detects with albumen L-HRP as sealing damping fluid and bonded scFv except adopting 2%Tween/PBS.2 clones (K8 and K10) during 3 clones (E4, E5 and E8) during HSA/ β-gal selects and β-gal/HSA selects can be in conjunction with two kinds of antigens.ScFv among these clones of pcr amplification also checks order, and the primer is LMB3 and pHENseq, as (1999) J Mol Biol 1999 Nov 26 such as Ignatovich; 294 (2): the described method of 457-65 is the same.Sequential analysis shows that all clones are same.Therefore, only select the clone (K8) of a coding bi-specific antibody to be used for further work (Fig. 3).
The sign of embodiment 2:K8 antibodies performance
At first, characterize the binding characteristic of K8 antibody with mono-clonal phage E LISA method.With 100 μ l concentration in PBS is that the HSA of 10 μ g/ml and β-gal and alkaline phosphatase (APS), bovine serum albumin(BSA) (BSA), peanut agglutinin, N,O-Diacetylmuramidase and cytochrome C (in order to check cross reactivity) spend the night bag by 96 orifice plates for 4 ℃.With the phagemid of KM13 rescue from the K8 clone, (1996) such as method such as Harrison are described, and direct analysis contains the supernatant (50 μ l) of phage.Carry out standard ELISA program (Hoogenboom etc., 1991) then, adopt anti--M13-HRP conjugate to detect the bonded phage.When the absorption signal that is showed in phage surface greater than 1.0 the time, find that dual specific K8 antibody capable is in conjunction with HAS and β-gal (Fig. 4).Also can observe (Fig. 4) to the combination that BSA is strong.Because HSA and BSA have 76% to be homologous on amino acid levels,, do not observe and other proteic cross reactivity (Fig. 4) so two kinds of structurally associated albumen of K8 antibody capable identification are no wonder.
Secondly, the binding characteristic of K8 antibody can detect with solubility scFv ELISA method.The segmental generation of solubility scFv is induced by IPTG, describes as (1996) such as Harrison.For determining K8 scFv expression level, induce the soluble antibody fragment in the supernatant with albumin A-Sepharose column purification 50ml, as Harlow and Lane, Antibodies:a Laboratory Manual, the method that (1988) Cold SpringHarbor describes is the same.Adopt the method for (1989) descriptions such as Sambrook to measure OD280 and calculate protein concentration then.K8 scFv concentration is 19mg/l in the supernatant.
Then the K8 antibody fragment with concentration known carries out solubility scFv ELISA detection.With 100 μ l concentration be HSA, the BSA of 10 μ g/ml and β-gal and 100 μ l concentration be the albumin A bag of 1 μ g/ml by 96 orifice plates, add the K8 scFv solution 50 μ l of serial dilution, detect the bonded antibody fragment with albumen L-HRP.ELISA result has confirmed the dual specific essence (Fig. 5) of K8 antibody.
For determining in conjunction with β-gal is to be determined and be by K8 scFv antibody V in conjunction with HSA/BSA by V κ district HDistrict's decision digests K8 scFv DNA with V with SalI/NotI κTherefrom downcut in the district, is connected to through SalI/NotI and comprising of digest simulates V HOn the pIT2 carrier of chain (Fig. 1 and 2).The clone K8V that produces κ/ simulation V HBinding characteristic analyze by solubility scFv ELISA method.The segmental generation of solubility scFv is induced by IPTG, and as description such as Harrison (1996), direct analysis contains the supernatant (50 μ l) of scFvs.Solubility scFv ELISA method is pressed operation among the embodiment 1, and bonded scFvs detects with albumen L-HRP.ELISA result shows that this clone can also be in conjunction with β-gal, and is eliminated (Fig. 6) with combining of BSA.
Embodiment 3: at the single V of antigen A and antigen B HDomain antibodies and at the single V of antigens c and antigen D κThe screening of domain antibodies
This case description a kind of preparation single V at antigen A and antigen B HDomain antibodies and at the single V of antigens c and antigen D κThe method of domain antibodies, by the no complementary variable region of screening when existing in conjunction with these antigenic initially (virgin) single antibody variable region storehouses.
Screening and sign in conjunction with the clone are undertaken (seeing embodiment 5, PCT/GB02/003014) by preceding method.Select 4 and be used for the further clone of research:
V HThe anti-A V of 1- H
V HThe anti-B V of 2- H
The anti-C V of VK1- κ
The anti-D V of VK2- κ
The program that can adopt the foregoing description 1-3 to describe comprises V with described similar manner preparation HDistrict's combination (is V H-V HPart) and V LDistrict's combination (is V L-V LPart) dimer molecule.
Embodiment 4: the preparation of dual specific ScFv antibody and sign (at the VH1/VH2 of antigen A and antigen B with at the VK1/VK2 of antigens c and antigen D)
This embodiment has confirmed that dual specific ScFv antibody (at the VH1/VH2 of antigen A and antigen B with at the VK1/VK2 of antigens c and antigen D) can be by combination in the ScFv carrier at the V of corresponding antigens screening κAnd V HSingle zone and preparing.
For preparation bi-specific antibody VH1/VH2, cut from the single zone of VH1 in the variable region carrier 1 (Fig. 7) with the NcoI/XhoI enzyme, connect in the variable region carrier 2 after the NcoI/XhoI enzyme is cut (Fig. 7) with generation VH1/ variable region carrier 2.The single district of VH2 through pcr amplification, introduces the SalI restriction enzyme sites with primer at 5 ' end from variable region carrier 1, introduce the NotI restriction enzyme sites at 3 ' end.The PCR product is with SalI/NotI digestion and connect in the VH1/ variable region carrier 2 after the SalI/NotI enzyme is cut to generate VH1/VH2/ variable region carrier 2 then.
Carrier 2 usefulness similar manners in VK1/VK2/ variable region generate.The VH1/VH2 ScFv of preparation and the dual specific essence of VK1/VK2 ScFv are to confirm (see embodiment 6, PCT/GB 02/003014) by aforesaid solubility scFv ELISA method.Competitive ELISA carries out (see embodiment 8, PCT/GB 02/003014) by preceding method.
Possible result:
-VH1/VH2 ScFv is conjugated antigen A and antigen B simultaneously
-VK1/VK2 ScFv is conjugated antigen C and antigen D simultaneously
The combination of-VH1/VH2 ScFv is emulative (when combining with antigen A, VH1/VH2ScFv can not conjugated antigen B)
The combination of-VK1/VK2 ScFv is emulative (when combining with antigens c, VK1/VK2ScFv can not conjugated antigen D)
Embodiment 5: the structure of dual specific VH1/VH2 Fab and VK1/VK2 Fab and the analysis of binding characteristic thereof
Be preparation VH1/VH2 Fab, the single zone of VH1 connected in the CH carrier of NcoI/lXhoI digestion (Fig. 8), to generate VH1/CH; The single zone of VH2 is connected in the CK carrier of SalI/NotI digestion (Fig. 9), to generate VH2/CK.Will be from the plasmid co-transfection competence Bacillus coli cells of VH1/CH and VH2/CK, method is as described above.(see embodiment 8, PCT/GB02/003014).
Induce the clone who comprises VH1/CH and VH2/CK plasmid with preparation solubility VH1/VH2 Fab with IPTG, method as described above.(see embodiment 8, PCT/GB02/003014)
VK1/VK2 Fab prepares with similarity method.
Verify the binding characteristic of the Fab of preparation by aforesaid competitive ELISA method (see embodiment 8, PCT/GB 02/003014).
Possible result:
-VH1/VH2 Fab is conjugated antigen A and antigen B simultaneously
-VK1/VK2 Fab is conjugated antigen C and antigen D simultaneously
The combination of-VH1/VH2 Fab is emulative (when combining with antigen A, VH1/VH2 Fab can not conjugated antigen B)
The combination of-VK1/VK2 Fab is emulative (when combining with antigens c, VK1/VK2 Fab can not conjugated antigen D)
Embodiment 6: chelating dAb dimer
General introduction
VH and VK homodimer are to be linked to be dAb-joint-dAb form with flexible peptide linker.The structure of carrier is the dAb-linker-dAb form, contains the glycine-Serine joint 3U:(Gly of different lengths 4Ser) 3, 5U:(Gly 4Ser) 5, 7U:(Gly 4Ser) 7The structure in dimer storehouse adopts guiding dAb at joint upstream: TAR1-5 (VK), TAR1-27 (VK), TAR2-5 (VH) or TAR2-6 (VK) with in the storehouse of corresponding the 2nd dAb in joint downstream.Adopt this method, select new dimer dAb.Dimerization can pass through ELISA, BIAcore research, cell neutralization and receptor binding assay to antigen bonded effect and measure.The dimerization of TAR 1-5 and TAR 1-27 has improved binding affinity and neutralization levels greatly.
1.0 method
1.1 the storehouse generates
1.1.1 carrier
Design pEDA3U, pEDA5U and pEDA7U carrier are to import the joint of the different lengths compatible with dAb-joint-dAb form.For pEDA3U, 73 base pair oligonucleotide joints of normal chain and antisense were by the annealing of the slow mechanism of anneal in damping fluid (95 ℃-5 minutes, 80 ℃-10 minutes, 70 ℃-15 minutes, 56 ℃-15 minutes, 42 ℃ up to using), described damping fluid comprises 0.1M NaCl, 10mM Tris-HCl pH7.4; And be cloned on XhoI and the NotI restriction site.Joint comprises 3 (Gly 4Ser) unit and the filled band (diagram 1) between SalI and NotI cloning site.Select the possibility of monomer dAb in order to reduce display technique of bacteriophage, the filled band is designed to comprise 3 terminator codons, a SacI restriction site and the sudden change of frameing shift, and purpose is when second dAb of nothing exists, and described zone is placed outside the frame.For pEDA5U and 7U because the needs of joint length, each carrier design the eclipsed oligonucleotide joint, annealing and extend with the Klenow enzyme.Then, purifying fragment and with suitable enzymic digestion before the clone, the restriction site of employing is XhoI and NotI.
Figure A20081000856500791
Diagram 1
1.1.2 storehouse preparation
In the upstream of joint, restricted cloning site is NcoI and XhoI corresponding to the N-terminal V gene clone that guides dAb.V HThere is compatible site in gene, however clone V κGene need be introduced suitable restriction site.This can adopt the PCR primer (VK-DLIBF:5 ' cggccatggcgtcaacggacat of modification property; VK-XholR:5 ' atgtgcgctcgagcgtttgattt 3 ') and 2: 1 SuperTaq enzyme (HTBiotechnology Ltd) and pfu turbo enzyme (Stratagene) mixture obtain through 30 round-robin pcr amplifications.This has kept 5 ' terminal NcoI site and has destroyed adjacent SalI site and introduced the XhoI site at 3 ' end.5 guiding dAb are cloned in each carrier of 3 dimer carriers: TAR1-5 (VK), TAR1-27 (VK), TAR2-5 (VH), TAR2-6 (VK) and TAR2-7 (VK).All constructions are all identified through sequencing analysis.
After guiding dAb:TAR1-5 (VK), TAR1-27 (VK), TAR2-5 (VH) or TAR2-6 (VK) had been cloned in the joint upstream of (pEDA3U, 5U and 7U) in each carrier, corresponding second dAb storehouse was cloned in the joint downstream.For reaching this purpose, complementary dAb storehouse is the pcr amplification product of the phage that obtains from first round screening, and screening both can be at the VK storehouse screening of human TNF alpha (after the first round circulation about 1 * 10 when TAR1-5 or TAR1-27 are guiding dAb 6Diversity), also can be when TAR2-5 or TAR2-6 are guiding dAb respectively at the VH of people p55TNF acceptor or the screening of VK storehouse (first round circulate the latter two all nearly 1 * 10 5Diversity).For the pcr amplification in VK storehouse is to obtain through 30 round-robin pcr amplifications by SuperTaq enzyme and the pfu turbo enzyme mixture that adopts primer and 2: 1.V HThe storehouse is to adopt to obtain through pcr amplification at the primer of gene 5 ' SalI restriction site of end introducing.With the PCR product in suitable restriction enzyme digestion dAb storehouse, and it is connected into joint downstream in the respective carrier, and enters in the competence TG1 cell of prepared fresh through electroporation with the SalI/NotI restriction site.
The titre in each storehouse that obtains is as follows:
TAR1-5：pEDA3U＝4×10 8，pEDA5U＝8×10 7，pEDA7U＝1×10 8
TAR1-27：pEDA3U＝6.2×10 8，pEDA5U＝1×10 8，pEDA7U＝1×10 9
TAR2h-5：pEDA3U＝4×10 7，pEDA5U＝2×10 8，pEDA7U＝8×10 7
TAR2h-6：pEDA3U＝7.4×10 8，pEDA5U＝1.2×10 8，pEDA7U＝2.2×10 8
1.2 screening
1.2.1TNFa
Adopt the passive immune pipe that is coated with human TNF alpha to screen.In brief, spend the night bag by the immunity pipe with the required antigen of 1-4ml.Use the PBS wash bags by immunity pipe 3 times then, and, wash 3 times with PBS again with the PBS sealing that contains 2% milk powder 1-2 hour.Also at room temperature hatched 2 hours with the PBS dilution phage solution that contains 2% milk powder.Wash pipe with PBS then, with containing the tryptic PBS wash-out bacteriophage of 1mg/ml.Three kinds of strategies of selecting TAR1-5 dimer storehouse have been studied.First round screening is to carry out in the immune pipe with 1 μ g/ml or 20 μ g/ml human TNF alpha bag quilts, washes 20 times with the PBS that contains 0.1%Tween.With the phage-infect TG1 cell of wash-out and measure its titre (for example, Marks et al JMol Biol.1991 Dec 5; 222 (3): 581-97, Richmann et al Biochemistry.1993 Aug31; 32 (34): 8848-55).
The results titre is:
pEDA3U＝2.8×10 7(1μg/ml TNF)，1.5×10 8(20μg/ml TNF)，
pEDA5U＝1.8×10 7(1μg/ml TNF)，1.6×10 8(20μg/ml TNF)，
pEDA7U＝8×10 6(1μg/ml TNF)，7×10 7(20μg/ml TNF)
Adopt three kinds of diverse ways to carry out second and take turns selection.
1. in immune pipe, wash 20 times after night incubation wash again 10 times.
2. in immune pipe, washed after 20 times in the lavation buffer solution that contains 1 μ g/ml TNF α incubated at room 1 hour, wash again 10 times.
3. on the plain pearl of strepto-affinity, screen, adopt the biotinylated human TNF alpha of 33pM (Henderikx etal., 2002, Selection of antibodies against biotinylated antigens.Antibody PhageDisplay:Methods and protocols, Ed.O ' Brien and Atkin, Humana Press).The second single clone who takes turns screening is chosen in 96 orifice plates rough supernatant prepared product 2ml of preparation in 96 orifice plates.
First round human TNF alpha immunity pipe bag is by concentration Second takes turns screening method 1 Second takes turns screening method 2 Second takes turns screening method 3
pEDA3U 1μg/ml 1×10 9 1.8×10 9 2.4×10 10
pEDA3U 20μg/ml 6×10 9 1.8×10 10 8.5×10 10
pEDA5U 1μg/ml 9×10 8 1.4×10 9 2.8×10 10
pEDA5U 20μg/ml 9.5×10 9 8.5×10 9 2.8×10 10
pEDA7U 1μg/ml 7.8×10 8 1.6×10 8 4×10 10
pEDA7U 20μg/ml 1×10 10 8×10 9 1.5×10 10
Selection about TAR1-27 is undertaken by preceding method, and does following the modification.First round screening is to carry out in the immune pipe with 1 μ g/ml or 20 μ g/ml human TNF alpha bag quilts, washes 20 times with the PBS that contains 0.1%Tween.Second take turns the screening be the washing 20 times after night incubation wash again 20 times.To choose in 96 orifice plates rough supernatant prepared product 2ml of preparation in 96 orifice plates from the second single clone who takes turns screening.
The TAR1-27 titre is as follows:
Human TNF alpha immunity pipe bag is by concentration The first round Second takes turns
pEDA3U 1μg/ml 4×10 9 6×10 9
pEDA3U 20μg/ml 5×10 9 4.4×10 10
pEDA5U 1μg/ml 1.5×10 9 1.9×10 10
pEDA5U 20μg/ml 3.4×10 9 3.5×10 10
pEDA7U 1μg/ml 2.6×10 9 5×10 9
pEDA7U 20μg/ml 7×10 9 1.4×10 10
1.2.2TNF acceptor 1 (p55 acceptor; TAR2)
Method is only screened the TAR2h-5 storehouse as described above.3 to take turns screening be to carry out in the immune pipe with 1 μ g/ml or 10 μ g/ml people p55TNF acceptor bag quilts, and night incubation was washed 20 times again after the PBS that usefulness contains 0.1%Tween washed 20 times.Choose 96 orifice plates rough supernatant prepared product 2ml of preparation in 96 orifice plates from the 2nd, the 3 single clones that take turns screening.
The TAR2h-5 titre is as follows:
First round people P 55TNF acceptor immunity pipe bag is by concentration The first round Second takes turns Third round
pEDA3U 1μg/ml 2.4×10 6 1.2×10 7 1.9×10 9
pEDA3U 10μg/ml 3.1×10 7 7×10 7 1×10 9
pEDA5U 1μg/ml 2.5×10 6 1.1×10 7 5.7×10 8
pEDA5U 10μg/ml 3.7×10 7 2.3×10 8 2.9×10 9
pEDA7U 1μg/ml 1.3×10 6 1.3×10 7 1.4×10 9
pEDA7U 10μg/ml 1.6×10 7 1.9×10 7 3×10 10
1.3 screening
Single clone takes turns the screening from the 2nd or 3 of each 3U, the 5U of the suitable screening of different screening methods and 7U storehouse to pick out.Be cloned in 37 ℃ of overnight incubation among the 2 * TY that contains 100 μ g/ml penbritins and 1% glucose.1/100 diluent of this culture is inoculated in 96 orifice plates of the 2 * TY that contains 100 μ g/ml penbritins and 0.1% glucose of 2ml, 37 ℃ of concussions are cultivated and are about 0.9 up to OD600.Culture is induced to induce at 30 ℃ through 1mM IPTG and is spent the night then.Supernatant centrifugal 15 minutes of 4000rpm in the dull and stereotyped whizzer of sorval.The supernatant prepared product is used for initial screening.
1.3.1 ELISA
Adopt albumin A/L ELISA or antigen ELISA method to compare the combination activity of monomer and dimer recombinant protein.In brief, spend the night bag by 96 orifice plates with 4 ℃ of antigen or albumin A/L.Wash plate with the PBS that contains 0.05%Tween, with 2%Tween-PBS sealing 2 hours.Sample added in the entering plate incubated at room 1 hour, washed plate and with second (secondary) reagent incubated at room 1 hour.Wash plate and develop the color with tmb substrate.Albumin A/L-HRP or India-HRP are as second reagent.For antigen ELISA s, used antigen concentration is human TNF alpha and the people TNF acceptor 1 of 1 μ g/ml among the PBS.Because the existence of guiding dAb, in most of the cases dimer discharges positive ELISA signal, therefore can measure dissociation rate (offrate datermination) by BIAcore.
1.3.2 BIAcore
TAR1-5 and TAR2h-5 clone are carried out the BIAcore analysis.In order to screen, the human TNF alpha and the CM5 chip of high-density (approximately 10000RU) are coupled.On the coupled chip in the PH5.5 acetate buffer of the human TNF alpha of 50 μ l (50 μ g/ml) (5 μ l/min).With the chip after the standard method regeneration analysis is impossible, because the human TNF alpha instability, so after each sample analysis, chip was washed 10 minutes with damping fluid.
For TAR1-5, second clone's supernatant of taking turns selection screens with BIAcore.48 clones screen in each 3U, the 5U that obtain with following screening method and the 7U storehouse.
R1:1 μ g/ml human TNF alpha immunity pipe, R2:1 μ g/ml human TNF alpha immunity pipe, the washing of spending the night.
R1:20 μ g/ml human TNF alpha immunity pipe, R2:20 μ g/ml human TNF alpha immunity pipe, the washing of spending the night.
R1:1 μ g/ml human TNF alpha immunity pipe, the biotinylated human TNF alpha pearl of R2:33pM.
R1:20 μ g/ml human TNF alpha immunity pipe, the biotinylated human TNF alpha pearl of R2:33pM.
In order to screen, the people TNF acceptor and the CM5 chip of high-density (approximately 4000RU) are coupled.The people p55TNF acceptor of 100 μ l (10 μ g/ml) is connected to (5 μ l/min) on the chip in the PH5.5 acetate buffer.Examination criteria regeneration condition (glycine of pH2 or pH3) but in each case antigen shift out situation from chip surface as TNF α, behind therefore each analyzing samples, chip was washed 10 minutes with damping fluid.
To TAR2-5, screening second clone's supernatant of taking turns selection.
48 clones screen from each 3U, 5U and 7U storehouse with following screening method.
R1:1 μ g/ml people p55TNF acceptor immunity pipe, R2:1 μ g/ml people p55TNF acceptor immunity pipe, the washing of spending the night.
R1:10 μ g/ml people p55TNF acceptor immunity pipe, R2:10 μ g/ml people p55TNF acceptor immunity pipe, the washing of spending the night.
1.3.3 acceptor and cell analysis
Dimeric neutralising capacity is following in receptor assay carries out:
Receptors bind
Test anti-TNF dAb suppresses ability to TNF with reorganization TNF acceptor 1 (p55) bonded.In brief, use anti-people Fc mouse monoclonal antibody (Zymed, San Francisco, USA) the night incubation Maxisorp plate of 30mg/ml.With the phosphate buffered saline buffer that contains 0.05%Tween-20 (PBS) hole flushing, then with 100ng//ml TNF acceptor 1Fc fusion rotein (R ﹠amp; D Systems, Minneapolis, USA) hatch before, with containing the PBS closed pores of 1%BSA.Anti-TNF dAb mixes the back and adds in the washed hole with TNF, final concentration is 10ng/ml.Detecting the TNF combination is with the biotinylated anti-TNF antibodies of 0.2mg/ml (HyCult biotechnology, Uben, Netherlands), strepto-affinity element (the Amersham Biosciences of the HRP mark of dilution in 1: 500, UK), then with tmb substrate (KPL, Gaithersburg USA) is hatched.Add the HCl termination reaction, read the absorbancy at 450nm place.Anti-TNF dAb activity causes the TNF bonded to reduce, and descends so compare absorbancy with the control group that has only TNF.
The L929 cell toxicant is analyzed
Can detect anti-TNF dAb kills and wounds mouse L929 inoblast cytotoxicity to TNF neutralising capacity.(Evans，T.(2000)Molecular Biotechnology 15，243-248)。In brief, the L929 cell is packed in the microwell plate and anti-TNF dAb and 100pg/ml TNF and 1mg/ml dactinomycin (Sigma, Poole, UK) common overnight incubation.With [3-(4,5-dimethylthiazole-2-yl)-5-(3-carboxylic methoxyphenyl)-2-(4-sulfophenyl)-([3-(4 for the 2H-tetrazolium, 5-dimethylthiazol-2-yl)-5-(3-carbboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) (Promega, Madison USA) is hatched the back by reading the absorbance measurement cell viability at 490nm place.Anti-TNF dAb activity causes the TNF cytotoxic activity to descend, and increases so compare absorbancy with the control group that has only TNF.
In initial screening, the supernatant that the above-mentioned BIAcore of being ready for use on analyzes also can be used in the receptor assay.Selected dimeric further analysis also can adopt the proteic acceptor and the cell analysis of purifying to carry out.
HeLa IL-8 analyzes
Can test anti-TNF Rl or anti-TNF alpha dAb (adopts according to Akeson the neutralising capacity of TNF induced Hcla emiocytosis IL-8, L. method (1996) the Journal ofBiological Chemistry 271 that the method that waits is transformed, 30517-30523 has described IL-1 and has induced HUVEC to produce IL-8; Here we have observed the inducing action of human TNF alpha, and we adopt the HeLa cell to replace HUVEC clone).In brief, the HeLa cell is packed in the microwell plate and dAb and the common overnight incubation of 300pg/ml TNF.After hatching supernatant is siphoned away, with sandwich ELISA (R ﹠amp; D Systems) measures IL-8 concentration.Compare with the control group that has only TNF, the IL-8 that anti-TNF Rl dAb activity causes being secreted in the supernatant descends.
L929 analyzes and is widely used in following experiment; Yet HeLa IL-8 analyzes and preferably is used for measuring anti-TNF acceptor 1 (p55) part; The existence of mouse p55 caused some restriction in its purposes during L929 analyzed.
1.4 sequential analysis
Be determined in the screening of BIAcore and receptor assay and be proved to be dimeric sequence with meaningful characteristic.Described sequence write up in sequence table.
1.5 format (formatting)
1.5.1 TAR1-5-19 dimer
Show have good in and the TAR1-5 dimer of characteristic in cell and receptor assay by reformatting (re-formatted) with analyze.TAR1-5 guiding dAb is replaced by the clone TAR1-5-19 of affinity maturation.For realizing this purpose, clone TAR1-5 and use the TAR1-5-19 of pcr amplification to replace from independent dimer centering.In addition, the TAR1-5-19 homodimer also makes up in 3U, 5U and 7U carrier.The terminal copy of gene N-is cloned through pcr amplification and with aforesaid method, and SalI and NotI restriction site that the utilization of C-terminal gene fragment exists are cloned.
1.5.2 mutagenesis
The amber terminator codon appears among the dAb2, by site-directed mutagenesis the terminal dAb of the C-of TAR1-5 dimer centering is mutated into glutamine.
1.5.3 Fab
The dimer reformatting that comprises TAR1-5 or TAR1-5-19 enters in the Fab expression vector, with Sfil and NotI restriction site dAb is cloned into and contains in CK or the CH expression carrier, and it is carried out the sequencing analysis checking.Based on amp-R pUC carrier, the CH carrier is derived from a kind of pACYC carrier of anti-paraxin derived from a kind of for the CK carrier.In order to express Fab, dAb-CH and the common transfection of dAb-CK construct are advanced in the HB2151 cell, in the 2 * TY that contains 0.1% glucose, 100 μ g/ml penbritins and 10 μ g/ml paraxin, cultivate.
1.5.4 hinge dimerisation
The dAb dimerization that mensuration constitutes by cystine linkage.One section short sequence EPKSGDKTHTCPPCP of amended human IgG Cl hinge area amino acid joins the C-terminal district of dAb by genetically engineered.The oligonucleotide joint of this sequence of encoding is synthesized and anneal by preceding method.With XhoI and NotI restriction enzyme sites joint is cloned in the pEDA carrier that contains TAR1-5-19.The dimerisation original position betides pericentral siphon.
1.6 express and purifying
1.6.1 express
As previously mentioned, the 2ml supernatant for preparing in 96 orifice plates is used for initial screening.The dimer of further Analysis and Screening behind the primary dcreening operation.The dimer construct is expressed in the supernatant of TOP10F ' or HB2151 cell.In brief, 37 ℃ of overnight incubation in the 2 * TY that contains 100 μ g/ml penbritins and 1% glucose of the single bacterium colony on the fresh streak plate.1/100 diluent of this culture is inoculated among the 2 * TY that contains 100 μ g/ml penbritins and 0.1% glucose 37 ℃ of concussions to be cultivated up to OD 600Be about 0.9.Culture is induced at 30 ℃ through 1mM IPTG and is spent the night then.By centrifugal removal cell and with albumin A or L agarose purifying supernatant.
Fab and halfcystine hinge dimer are expressed as periplasm protein in the HB2152 cell.Be inoculated into after overnight culture 1: 100 dilution to contain among 0.1% glucose and the suitable antibiotic 2 * TY and grow, 30 ℃ of concussions are cultivated up to OD 600Be about 0.9.Then, culture was induced 3-4 hour with 1mM IPTG, 25 ℃ of temperature.By centrifugal collecting cell, precipitation is resuspended in pericentral siphon and prepares (30mMTris-HCl pH8.0,1mM EDTA, 20% sucrose) in the damping fluid.Keep centrifugal back supernatant, precipitation is resuspended in 5mMMgSO 4In.Recentrifuge is collected supernatant, is compiled and purifying.
1.6.2 the purifying of albumin A/L
To from albumen L agarose (Affitech, Norway) or the albumin A agarose (Sigma, the optimization of the purifying of dimer protein UK) detects.With peristaltic pump in batches or the post eluted protein.Test three kinds of damping fluid 0.1M phosphate-citrate salts pH of buffer 2.6,0.2M glycine pH2.5 and 0.1M glycine pH2.5.Optimal condition is defined as adopting 10 column volumes of 0.1M glycine pH2.5 wash-out under the peristaltic pump condition.Purifying from albumin A adopts 0.1M glycine pH2.5 to carry out under the peristaltic pump condition.
1.6.3 FPLC purifying
Be further purified and adopt AKTA Explorer 100 systems (Amersham Biosciences Ltd) to be undertaken by the FPLC analysis.By cation-exchange chromatography (1ml Resource S-AmershamBiosciences Ltd) fractional separation TAR1-5 and TAR1-5-19 dimer, with the NaCl wash-out of 0-1M concentration gradient in the 50mM acetate buffer (pH4).The hinge dimer is by ion-exchange purification (1ml Resource Q Amersham Biosciences Ltd) 0-1MNaCl concentration gradient wash-out among the 25mMTris HCl pH8.0.By size exclusion chromatography method purifying Fab, adopt superose 12 posts (Amersham Biosciences Ltd) to carry out, the PBS flow velocity that contains 0.05%tween is 0.5ml/min.Next hold back the concentrated and purified sample of (cut off) thickener (Vivascience Ltd) with vivaspin 5K.
2.0 result
2.1 TAR1-5 dimer
6 * 96 clones select from comprising that second of all storehouses and all screening conditions are taken turns the selection.The preparation of supernatant prepared product and analysis adopt antigen and albumen L ELISA, BIAcore and receptor assay to carry out.In ELISA, every kind of system of selection all identifies positive in cloning and being distributed between 3U, 5U and the 7U storehouse.Yet, owing to guide dAb to exist always, so this method can not be distinguished the height of zygote (binder) avidity, so adopt BIAcore to analyze.
BIAcore analyzes and adopts the 2ml supernatant liquor.BIAcore analyzes demonstration: compare dimeric Koff with monomer TAR1-5 and lead greatly and improve.The monomer Koff scope of leading is 10 -1M, the dimer Koff scope of leading is 10 -3-10 -4M.From 3U, 5U and 7U storehouse, select Koff and lead 16 very low clones, and check order.In addition, supernatant is used in the receptor assay and the analysis of human TNF alpha ability.
To there being 6 leading clones (lead clone) (calling d1-d6 in the following text) of neutralizing effect to carry out sequencing analysis in these analyses, the result shows: have only 3 the 2nd different dAb (dAb1, dAb2 and dAb3) among 6 clones of gained, but the place more than second dAb occurs once, they connect by the joint of different lengths.
TAR1-5d1:3U joint 2 NdThe washing of spending the night of dAb=dAb1-1 μ g/ml antigen immune pipe
TAR1-5d2:3U joint 2 NdThe washing of spending the night of dAb=dAb2-1 μ g/ml antigen immune pipe
TAR1-5d3:5U joint 2 NdThe washing of spending the night of dAb=dAb2-1 μ g/ml antigen immune pipe
TAR1-5d4:5U joint 2 NdThe washing of spending the night of dAb=dAb3-20 μ g/ml antigen immune pipe
TAR1-5d5:5U joint 2 NdThe washing of spending the night of dAb=dAb1-20 μ g/ml antigen immune pipe
TAR1-5d6:7U joint 2 NdThe washing of spending the night of dAb=dAb1-R1-1 μ g/ml antigen immune pipe, the R2-pearl.
Further measure 6 leading clones.Measure with the albumen in albumen L agarose purifying pericentral siphon and the supernatant liquor and with cell and receptor assay.The neutralizing effect level is (table 1) that changes.Determine the optimal conditions of protein Preparation.The protein yield that from the HB2151 cell, prepares the highest (approximately being the 10mgs/L culture) as supernatant.Under the room temperature condition supernatant and albumen L agarose hatched jointly and spent the night in 2 hours or 4 ℃.Clean pearl and use the peristaltic pump upper prop on the FPLC post with PBS/NaCl.PBS/NaCl with 10 times of column volumes washes pearl, uses 0.1M glycine pH2.5 wash-out again.Generally speaking, dimer protein elutes behind monomer.
With FPLC purifying TAR1-5d1-6 dimer.Obtain 3 kinds, identify with the FPLC purifying and with SDS-PAGE.One class is equivalent to monomer, and two classes are equivalent to the dimer of different sizes in addition.Bigger possibility is because the existence of C-terminal mark in two classes.Detect these albumen with receptor assay.The data represented optimal result (Figure 11) that from two dimer kinds, obtains that provides in the table 1.
Dimer is cloned as monomer 3 the 2nd dAb in (that is, dAb1, dAb2 and dAb3) and is detected with ELISA and cell and receptor assay.Cross reaction does not take place with plastics and BSA in conjunction with TNF in all 3 kinds of dAb energy specificity in antigen ELISA.As monomer, no a kind of dAb has neutralizing effect in cell or receptor assay.
2.1.2 TAR1-5-19 dimer
Replace 6 TAR1-5 among the leading clone with TAR1-5-19.Analyze all TAR1-5-19 dimers with cell and receptor analysis method, employing be intact proteins (an albumen L purifying), (table 2) except as otherwise noted.In cell analysis, TAR1-5-19d4 and TAR1-5-19d3 have best ND 50(about 5nM), this is consistent with the receptor assay result, and than TAR1-5-19 monomer (ND 50About 30nM) improvement is arranged.Though the TAR1-5 dimer of purifying is result in acceptor and cell analysis change, and the dimeric result of TAR1-5-19 is relatively more consistent.When using different elution buffer in the present protein purification of change list.Although can from albumen L agarose, remove all albumen as a rule, protein function is reduced with the wash-out that 0.1M phosphate-citrate salts pH of buffer 2.6 or 0.2M glycine pH2.5 damping fluid carry out.
Expression TAR1-5-19d4 also obtains the dimer of complete purifying with cationic exchange FPLC method purifying in fermentor tank.Obtain 3 kinds of TAR1-5d4 with the FPLC purifying, be equivalent to a kind of monomer and two kinds of dimers.Dimer is carried out amino acid sequencing.With receptor assay TARI-5-19 monomer and TAR1-5-19d4, the result is that monomer I C50 is 30nM, and dimer IC50 is 8nM.Receptor assay result such as Figure 10 of TAR1-5-19d4 and TAR1-5d4 and the comparison of TAR1-5-19 monomer show.
TAR1-5-19 homodimer in preparation 3U, 5U and the 7U carrier is expressed and with albumen L purifying.Measure albumen, measured value IC with cell and receptor analysis method 50(receptor assay is used) and ND 50(cell analysis with) sees Table 3 and Figure 12.
2.2 Fab
TAR1-5 and TAR1-5-19 dimer are also cloned in the Fab form (Fab format), express and with albumen L agarose purifying.Assess Fab (table 4) with receptor assay.The result shows: the initial Gly of the dimeric neutralizing effect level of TAR1-5-19 and TAR1-5 and its origin 4Ser joint dimer is similar.Expression is illustrated in the TAR1-5-19 Fab of the TAR1-5-19 on CH and the CK, assesses with albumen L purifying and with receptor assay.IC50 result is about 1nM.
2.3 TAR1-27 dimer
3 * 96 clones select from comprising that second of all storehouses and all screening conditions are taken turns the selection.Preparation 2ml supernatant prepared product is so that with ELISA and bioanalysis analysis.The antigen ELISA analysis obtains 71 positive colonies.The receptor assay of rough supernatant obtains 42 and has the active clone (TNF is in conjunction with 0-60%) of inhibition.Rejection characteristic and strong ELISA signal correction in most cases.Measure 42 clones' sequence, wherein 39 have the 2nd unique dAb sequence.Further analyze to have and preferably suppress active 12 kinds of dimers.
The clonal expression of 12 neutralizing effects is in 200ml supernatant prepared product, with albumen L purifying.With albumen L and antigen ELISA, BIAcore and receptor assay evaluation.Obtain strong positive ELISA signal in all cases.BIAcore analyzes all clones of prompting and has quick K OnAnd K OffRate (fast onand offrate).TAR1-27 compares K with monomer OffRate improves to some extent, however the dimeric K of TAR1-27 OffRate (K OffThe rate scope approximately is 10 -1-10 -2M) than the fast (K of the TAR1-5 dimer that had before recorded OffThe rate scope approximately is 10 -3-10 -4M).The dimeric stability of purifying is open to suspicion, therefore in order to increase its stability, adds 5% glycerine, 0.5%Triton X100 or 0.5%NP40 (Sigma) in the purge process of two kinds of TAR1-27 dimers (d2 and d16).NP40 or Triton X 100 TMAdding can make purifying produce amount improve about 2 times.Estimate described two kinds of dimers with receptor assay.Under all purification conditions, the IC of TAR1-27d2 50Be about 30nM.TAR1-27d16 does not have neutralizing effect behind the purifying without stablizer the time, but under stable condition during purifying, its IC 50Be about 50nM.
2.4 TAR2-5 dimer
3 * 96 clones select from comprising that second of all storehouses and all screening conditions are taken turns the selection.Preparation 2ml supernatant prepared product is used for analyzing.Every block of plate is carried out albumin A and antigen ELISA analysis.Adopt BIAcore to analyze and determined that 30 interested clones have good K OffRate (K OffThe rate scope is between 10 -2-10 -3Between the M).The dimer of 13 uniquenesses has been determined in analysis to cloning and sequencing.
Table 1:TAR1-5 dimer
Dimer Cell type Purifying Protein fractions Elution requirement Recipient cell is analyzed
TAR1-5d1 HB2151 Albumen L+ FPLC Little dimer 0.1M glycine pH2.5 RA～30nM
TAR1-5d2 HB2151 Albumen L+ FPLC Little dimer 0.1M glycine pH2.5 RA～50nM
FPLC Kind pH2.5 M
TAR1-5d3 HB2151 Albumen L+ FPLC Big dimer 0.1M glycine pH2.5 RA～300 nM
TAR1-5d4 HB2151 Albumen L+ FPLC Little dimer 0.1M glycine pH2.5 RA～3n M
TAR1-5d5 HB2151 Albumen L+ FPLC Big dimer 0.1M glycine pH2.5 RA～200 nM
TAR1-5d6 HB2151 Albumen L+ FPLC Big dimer 0.1M glycine pH2.5 RA～100 nM
*Notice that dimer 2 has identical the 2nd dAb (being called dAb2) with dimer 3, but have the joint (d2=(Gly of different lengths 4Ser) 3, d3=(Gly 4Ser) 3).DAb1 is the companion dAb in dimer 1,5 and 6.DAb3 is the companion dAb in the dimer 4.Companion dAb does not have neutralizing effect separately.Unless otherwise indicated, the FPLC purifying is to pass through cationic exchange.Analyze decision through each dimeric best dimer kind that FPLC obtains by these.
Table 2:TAR1-5-19 dimer
Dimer Cell type Purifying Protein fractions Elution requirement Acceptor/cell analysis
TAR1-5-19d1 top10F’ Albumen L Total protein 0.1M glycine pH2.0 RA～15 nM
TAR1-5-19d2 (not having the codon of termination) top10F’ Albumen L Total protein 0.1M glycine pH2.0+ 0.05%NP40 RA～2n M
TAR1-5-19d3 (not having the codon of termination) top10F’ Albumen L Total protein 0.1M glycine pH2.5+ 0.05%NP40 RA～8n M
TAR1-5-19d4 top10F’ Albumen L+ FPLC The fraction of FPLC purifying 0.1M glycine pH2.0 RA～2- 5nM CA～12 nM
TAR1-5-19d5 top10F’ Albumen L Total protein 0.1M glycine pH2.0+ NP40 RA～8n M CA～10 nM
TAR1-5-19d6 top10F’ Albumen L Total protein 0.1M glycine pH2.0 RA～10 nM
Table 3:TAR1-5-19 homodimer
Dimer Cell type Purifying Protein fractions Elution requirement Acceptor/cell analysis
Homodimer nM CA～30 nM
TAR1-5-19 5U homodimer HB2151 Albumen L Total protein 0.1M glycine pH2.5 RA～2n M CA～3n M
TAR1-5-19 7U homodimer HB2151 Albumen L Total protein 0.1M glycine pH2.5 RA～10 nM CA～15 nM
TAR1-5-19 cys hinge HB2151 Albumen L+FPLC The dimer fraction of FPLC purifying 0.1M glycine pH2.5 RA～2n M
TAR1-5-19CH/ TAR1-5-19CK HB2151 Albumen Total protein 0.1M glycine pH2.5 RA～1n M
Table 4:TAR1-5/TAR1-5-19 Fab
Dimer Cell type Purifying Protein fractions Elution requirement Acceptor/cell analysis
TAR1-5CH/ dAb1CK HB2151 Albumen L Total protein 0.1M Citrate trianion pH2.6 RA～90 nM
TAR1-5CH/ dAb2CK HB2151 Albumen L Total protein 0.1M glycine PH2.5 RA～30 nM CA～60 nM
dAb3CH/ TAR1-5CK HB2151 Albumen L Total protein 0.1M Citrate trianion pH2.6 RA～10 0nM
TAR1-5-19CH/ dAb1CK HB2151 Albumen L Total protein 0.1M glycine pH2.0 RA～6n M
dAb1CH/ TAR1-5-19CK HB2151 Albumen L 01M glycine pH2.0 The Myc/ mark RA～6n M
TAR1-5-19CH/ dAb2CK HB2151 Albumen L Total protein 0.1M glycine pH2.0 RA～8n M CA～12 nM
TAR1-5-19CH/ dAb3CK HB2151 Albumen L Total protein 0.1M glycine pH2.0 RA～3n M
The dimeric PCR of TARl-5-19CYS makes up
See the dAb tripolymer that embodiment 8 describes.Trimer preparation method produces monomer, dimer and trimerical mixture.
Expression that TARl-5-19CYS is dimeric and purifying
With albumen L agarose prize law purifying dimer from culture supernatant, as described in embodiment 8.
From the TARl-5-19CYS dimer, separate the TARl-5-19CYS monomer
According to the business directory operation, before the cationic exchange, adopt PD-10 post (AmershamPharmacia) that blended monomer/dimer sample buffering exchange is gone among the 50mM sodium-acetate buffer pH4.0.Then with sample application in the 1mL ResourceS cationic exchange coloum of crossing with 50mM sodium acetate soln pH4.0 balance (AmershamPharmacia).Adopt salt concn gradient separations monomer and dimer among the following 50mM sodium acetate pH4.0:
150-200mM sodium-chlor on 15 column volumes
200-450mM sodium-chlor on 10 column volumes
450-1000mM sodium-chlor on 15 column volumes
Only contain dimeric fraction with the SDS-PAGE evaluation, compile then, the 1M Tris pH8.0 that adds 1/5 volume at last is increased to 8.0 with pH.
External function binding analysis: TNF receptor assay and cell analysis
Adopt TNF acceptor and cell analysis method to determine the avidity of dimer to people TNFa.IC in the receptor assay 50Be approximately 0.3-0.8nM; ND in the cell analysis 50Be approximately 3-8nM.
The TAR1-5-19CYS dimeric forms that other is possible
PEG dimer and conventional synthetic maleimide dimer
Nektar (Shearwater) provides a series of bismaleimides PEG[mPEG2-(MAL) 2 or mPEG-(MAL) 2], it can make monomer form dimer, dimer has a little joint separates dAb, and two dAb all are connected size on the PEG of 5-40kDa.In the TNF receptor assay, shown that the avidity of the mPEG-(MAL) 2 (that is: [TAR1-5-19]-Cys-maleimide-PEG * 2, wherein maleimide is joined together) of 5kDa is about 1-3nM in dimer.Equally also can adopt TMEA (three [2-maleimide ethyl] amine) (Tris[2-maleimidoethyl] amine) (Pierce Biotechnology) or other bifunctional linker to prepare dimer.
The coupled method of chemistry also is possible with 2,2 '-two sulphur, two pyridines (Sigma Aldrich) preparation disulfide dimer and reductive monomer.
At terminal peptide linker or the hinge of adding of dAb C-
Little joint can be (Gly 4Ser) n n=1-10 here, as, 1,2,3,4,5,6 or 7, also can be a kind of immunoglobulin (Ig) (as, IgG hinge area or at random peptide sequence (as, from peptide sequence storehouse at random, screen), can be binned between dAb and the terminal cysteine.This can be used for preparing above-mentioned dimer.
Embodiment 8:dAb terpolymerization
Summary
For the dAb trimerizing, need the free halfcystine at the PROTEIN C end.Cysteine residues can be used for coupled specifically albumen so and form trimeric maleimide amine molecule, for example: TMEA (three [2-maleimide ethyl] amine) in case reduction produces free mercaptan.
PCR makes up TARl-5-19CYS
Following oligonucleotide is used for specific PCR and contains the TAR1-5-19 in SalI and BamHI site for clone and introducing C-terminal cysteine residue.
SalI
--------
Trp Ser Ala Ser Thr Asp ＊Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val
1 TGG AGC GCG TCG ACG GAC ATC CAG ATG ACC CAG TCT CCA TCC TCT CTG TCT GCA TCT GTA
ACC TCG CGC AGC TGC CTG TAG GTC TAC TGG GTC AGA GGT AGG AGA GAC AGA CGT AGA CAT
Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Asp Ser Tyr Leu His Trp
61 GGA GAC CGT GTC ACC ATC ACT TGC CGG GCA AGT CAG AGC ATT GAT AGT TAT TTA CAT TGG
CCT CTG GCA CAG TGG TAG TGA ACG GCC CGT TCA GTC TCG TAA CTA TCA ATA AAT GTA ACC
Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Glu Leu Gln
121 TAC CAG CAG AAA CCA GGG AAA GCC CCT AAG CTC CTG ATC TAT AGT GCA TCC GAG TTG CAA
ATG GTC GTC TTT GGT CCC TTT CGG GGA TTC GAG GAC TAG ATA TCA CGT AGG CTC AAC GTT
Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
181 AGT GGG GTC CCA TCA CGT TTC AGT GGC AGT GGA TCT GGG ACA GAT TTC ACT CTC ACC ATC
TCA CCC CAG GGT AGT GCA AAG TCA CCG TCA CCT AGA CCC TGT CTA AAG TGA GAG TGG TAG
Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val Val Trp Arg Pro
241 AGC AGT CTG CAA CCT GAA GAT TTT GCT ACG TAC TAC TGT CAA CAG GTT GTG TGG CGT CCT
TCG TCA GAC GTT GGA CTT CTA AAA CGA TGC ATG ATG ACA GTT GTC CAA CAC ACC GCA GGA
BamHI
--------
Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Cys ＊＊＊ ＊＊＊Gly Ser Gly
301 TTT ACG TTC GGC CAA GGG ACC AAG GTG GAA ATC AAA CGG TGC TAA TAA GGA TCC GGC
AAA TGC AAG CCG GTT CCC TGG TTC CAC CTT TAG TTT GCC ACG ATT ATT CCT AGG CCG
( *TAR1-5-19CYS sequence starting point)
Forward primer:
5′-TGGAGCGCGTCGACGGACATCCAGATGACCCAGTCTCCA-3′
Reverse primer:
5′-TTAGCAGCCGGATCCTTATTAGCACCGTTTGATTTCCAC-3′
PCR reacts (50 μ l volume) following foundation: 200 μ M dNTPs, 0.4 the various primers of μ M, 10 * PfuTurbo damping fluid (Stratagene) of 5 μ L, the template plasmid of 100ng (coding TAR1-5-19), the PfuTurbo enzyme (Stratagene) of 1 μ L is 50 μ L with sterilized water conditioned reaction volume.Use following PCR condition: 94 ℃ of initial denaturing steps 2 minutes, carry out following 25 circulations then: 94 ℃ 30 seconds, 64 ℃ of 30 seconds and 72 ℃ 30 seconds also comprised 72 ℃ of final step extensions 5 minutes.Purified pcr product is also with being connected on the carrier of same restriction enzyme digestion after SalI and the BamHI digestion.Adopt dna sequencing to confirm correct clone.
The expression of TARl-5-19CYS and purifying
According to operational guidance the TAR1-5-19CYS carrier is transformed into the chemically treated competent cell of BL21 (DE3) pLysS (Novagen).Adopt the screening of 100 μ g/ml Pyocianils and 37 μ g/ml paraxin to carry the cell of dAb plasmid.Cultivation is based upon a 2L who contains the fabulous meat soup of 500ml (Sigma-Aldrich) 100 μ g/ml Pyocianils and 37 μ g/ml paraxin and is with in the Erlenmeyer flask (baffled flask) of filter membrane plate.30 ℃ of 200rpm shaking culture are up to OD 600Be 1-1.5, use 1mMIPTG (sec.-propyl-β-D-sulfo-gala pyranoside, the Melford laboratory provides) inducing culture then.Allow dAb under 30 ℃ of conditions, to express 12-16 hour.Find that most dAb are present in the substratum.Therefore, the cell in centrifugal (8,000 * g, 30 minutes) isolation medium, supernatant is used for purifying dAb.The albumen L agarose (Affitech) that adds 30mL in whenever going up clearly allows dAb intermittently to stir in conjunction with 2 hours.Then, before the sucking-off supernatant, allow resin to rely on the power precipitation for support 1 hour.Then agarose is packed in the post (Amersham Phamacia) of an XK 50, wash post with the PBS of 10 times of volumes.With the dAb of 100mM glycine pH2.0 elution of bound, add among the 1M TrispH8.0 of 1/5 volume then and albumen place fraction.Isolate the 20mg pure protein in every liter of culture supernatant, wherein monomer and dimeric ratio are 50: 50.
The trimerizing of TARl-5-19CYS
With the 100 μ M TAR1-5-19CYS of 5mM dithiothreitol (DTT) (DTT) reductase 12 .5ml, room temperature was placed 20 minutes.Use the exchange of PD-10 post (AmershamPharmacia) buffering then.Pillar is used 5mM EDTA in advance, and 50mM sodium phosphate pH6.5 balance mistake carries out according to operation instructions that sample applies and wash-out.Sample places standby on ice.TMEA (three [2-maleimide ethyl] amine) is available from PierceBiotechnology.The storage liquid of 20mM TMEA prepares in 100%DMSO (dimethyl sulfoxide (DMSO)).Cause proteic rapid precipitation and crosslinked when discovering TMEA concentration greater than 3: 1 (mol ratio of dAb: TMEA).Along with the increase of PH, precipitation and crosslinking rate also raise simultaneously.Therefore,, add 25 μ M TMEA and make the albumen trimerizing, be reflected at room temperature and carried out 2 hours with 100 μ M reductive TAR1-5-19CYS.Discovery adds additive such as glycerine or ethylene glycol to 20% (v/v) when linked reaction is carried out can obviously reduce trimerical precipitation.Analyze to be presented at SDS-PAGE after the linked reaction and have monomer, dimer and tripolymer in the solution.
The trimerical purifying of TARl-5-19CYS
Add 40 μ L, 40% Glacial acetic acid in every milliliter of TMEA-TAR1-5-19cys reactant so that the pH value drops to about 4.Then with sample application in the 1mLResource S cationic exchange coloum of crossing with 50mM sodium-acetate liquid pH4.0 balance (AmershamPharmacia).The sodium-chlor of 340-450mM salt concn gradient partly separates dimer and tripolymer among the 50mM sodium acetate pH4.0 of 30 column volumes of employing.Only contain trimerical fraction and identify with SDS-PAGE, the 1M Tris pH8.0 that compiles and add 1/5 volume then is increased to 8 with pH.(adopt 5K to hold back the Viva spiral shell and change thickener for preventing that tripolymer precipitates in concentration process; Vivascience), add 10% glycerine in the sample.
The binding analysis of external function: TNF receptor assay and cell analysis
Adopt TNF acceptor and cell analysis can measure the avidity of tripolymer and human TNF alpha.IC50 in the receptor assay is 0.3nM; ND50 scope in the cell analysis between 3-10nM (for example, 3nM).
The TAR1-5-19CYS trimeric form that other is possible
TAR1-5-19CYS also can adopt following reagent to form tripolymer:
PEG tripolymer and conventional synthetic maleimide tripolymer
Nektar (Shearwater) provides a series of multi-arm PEG, and it can chemically modified PEG end.Therefore, adopt a kind of PEG tripolymer that has a maleimide amine function group at each arm end to make dAb that trimerizing take place, mode is similar with the aforesaid method of TMEA that adopts.PEG also has the advantage that increases trimerical solubility can prevent trimerical gathering.Therefore, can generate a kind of dAb tripolymer, wherein each dAb has the C-terminal halfcystine that is connected on the maleimide amine function group, and the maleimide amine function group is connected on the PEG tripolymer.
At terminal peptide linker or the hinge of adding of dAb C-
Little joint can be (Gly 4Ser) n n=1-10 here, as 1,2,3,4,5,6 or 7, also can be a kind of immunoglobulin (Ig) (as, IgG hinge area or at random peptide sequence (as, from peptide sequence storehouse at random, screen), can be binned between dAb and the terminal cysteine.When be used to prepare polymer (as, dimer or tripolymer) time, this can also introduce bigger flexibility and distance between single monomer, this helps to improve the binding characteristic to target, for example: as many subunits target of human TNF alpha.
Embodiment 9: at the screening of the single domain antibody (dAb) of human serum albumin (HSA) and mice serum white protein (MSA) set
Present embodiment is explained the method for a kind of preparation at the single domain antibody (dAb) of serum albumin.The two the screening method of dAb at mice serum white protein (MSA) and human serum albumin (HSA) has been described.Utilized three-type-person's phage displaying antibody storehouse in experiment, each is based on single people V HFramework (is seen Figure 13: based on the simulation V of V3-23/DP47 and JH4b HSequence) or VK framework (seeing Figure 15 :), mixed the side chain diversity of NNK codon coding in the complementary determining region (CDR1, CDR2 and CDR3) based on the simulation VK sequence of ol2/o2/DPK9 and Jkl.
Storehouse 1 (V H):
Diversity is positioned at: H30, H31, H33, H35, H50, H52, H52a, H53, H55, H56, H58, H95, H97, H98.
Storehouse size: 6.2 * 10 9
Storehouse 2 (V H):
Diversity is positioned at: H30, H31, H33, H35, H50, H52, H52a, H53, H55, H56, H58, H95, H97, H98, H99, H100, H100a, H100b.
Storehouse size: 4.3 * 10 9
Storehouse 3 (V κ):
Diversity is positioned at: L30, L31, L32, L34, L50, L53, L91, L92, L93, L94, L96
Storehouse size: 2 * 10 9
V HPassed through conjugated protein A and albumen L genus class part prescreen separately with V κ storehouse, therefore the great majority clone in the non-selected storehouse is functional.Big or small consistent behind above-mentioned storehouse size and the prescreen.
Adopt each storehouse to carry out screening respectively at the two-wheeled of serum albumin.Each is taken turns in the screening, and antigen is made into 100 μ g/ml in 4mlPBS concentration is used for bag by immunity pipe (nunc).In the first round selection, each of 3 kinds of storehouses is at HSA (Sigma) and MSA (Sigma) elutriation (panned) respectively.Take turns in the selection second, the phage of each that select from 6 first round is at (i) same antigen (as: first round MSA, second takes turns MSA) again by elutriation with at (ii) mutual antigen (as: first round MSA, second takes turns HSA) by elutriation, cause altogether taking turns screening 12 times second.In each case, second take turns selection after, identify the characteristic of 48 clones in conjunction with HSA and MSA.The segmental preparation of solubility dAb is carried out (Harrison et al, Methods Enzymol.1996 according to described scFv sheet phase method; 267:83-109).The standard ELISA method is according to (Hoogenboom et al. (1991) Nucleic AcidsRes., 19:4133) method just use 2%tween PBS as the sealing damping fluid.The detection of bonded dAb or with albumen L-HRP (Sigma) (for V κ) or with albumin A-HRP (AmershamPharmacia Biotech) (for V H).
Whether can in conjunction with MSA, HSA or they the two dAb only be incorporated into plate on, but all be that specificity is at serum albumin with insoluble form ELISA method if measuring the signal indicating that surpasses background.Point out the dAb sequence of having determined 21 uniquenesses to described cloning and sequencing (seeing the following form) then.The V of screening κMinimum similarity (amino acid levels) is 86.25% ((69/80) * 100 between the dAb clone; This is as the asynchronous result of all diversified residues, for example: clone 24 and 34).The V of screening HMinimum similarity is 94% ((127/136) * 100) between the dAb clone.
Next, measure serum albumin in conjunction with dAb according to the ability that can from solution, catch biotinylated antigen.Follow above-mentioned ELISA method, different is (for V with 1 μ g/ml albumen L κClone) and 1 μ g/ml albumin A (for V HThe clone) bag is by elisa plate.That catch from solution in the method is solubility dAb, is to detect with biotinylated MSA or HAS and the plain HRP of strepto-affinity.Prepare biotinylated MSA and HSA according to operation instructions, to reach the purpose that obtains average 2 biotin molecules of each serum albumin molecule.Identify 24 clones and can in ELISA, from solution, catch biotinylated MSA.Wherein 2 (following clones 2 and 38) also can catch biotinylated HSA.Then, detect dAb in conjunction with the ability that is coated on the MSA on the CM5 Biacore chip, find that 8 clones can be in conjunction with the MSA on the Biacore chip according to them.
Figure A20081000856500971
In all cases, framework is identical with framework in the corresponding simulated series, the diversity that table is pointed out on having in CDR.
In can 8 clones in conjunction with MSA on the Biacore chip, the clone (clone MSA16 and MSA26) who selects two energy high expression level in intestinal bacteria be in order to further research (seeing example 10).Provide the Nucleotide and the amino acid full length sequence of MSA16 and 26 among Figure 16.
Embodiment 10: measure MSA in conjunction with the avidity of dAb MSA16 and MSA26 with at the intravital serum half-life of mouse
DAb MSA16 and MSA26 are expressed in the colibacillus periplasm, and (Affitech, Norway) purification via adsorption-based process in batches is then with the glycine wash-out of pH2.2 with albumen L-agarose affine resin.The dAb that uses Biacore inhibition analysis purifying then is to determine K dValue.In brief, the concentration of test MSA16 of purifying and MSA26 required dAb when determining that can obtain 200RUs on being coated with the CM5 chip of high-density MSA reacts.In case required dAb concentration is determined, at expection K dThe MSA antigen of value left and right sides scope concentration mixes with dAb and overnight incubation in advance.Measure the dAb that is attached in every part of premixture on the MSA that is coated on the BiaCore chip at 30 μ l/ minutes high flow-rate (flow-rate) then.Result curve provides the K of estimation as generating Klotz figure dValue, MSA16 is 200nM, MSA26 is 70nM (Figure 17 A and B).
Then, to clone MSA16 and MSA26 and be cloned into have the HA mark (nucleotide sequence: TATCCTTATGATGTTCCTGATTATGCA and aminoacid sequence: in expression vector YPYDVPDYA), amount with 2-10mg is expressed in the intestinal bacteria, with the affine resin (Affitech of albumen L-agarose, Norway) purifying supernatant, and with the glycine wash-out of pH2.2.Measure dAb at the intravital serum half-life of mouse.Respectively with the MSA26 of about 1.5mg/kg dosage and MSA16 single intravenous injection in CD1 mouse body.With goat anti--HA (Abcam UK) catches and albumen L-HRP (invitrogen) detects ELISA method serum analysis level, with the 4%Marve sealing, 0.05%tween PBS washing.Set up typical curve with the comparability of assurance with the dAb that is present in concentration known in the 1x mice serum with laboratory sample.Tl/2 α with 2 compartment models (compartment model) analog information MSA-26 is that 0.16hr, tl/2 β are that 14.5hr, area under curve (AUC) are 465hr.mg/ml (data does not provide), and the tl/2a of MSA-16 is that 0.98hr, tl/2 β are that 36.5hr, AUC are 913hr.mg/ml (Figure 18).Compare with HEL4 (the white N,O-Diacetylmuramidase dAb of anti-ovum gallinaceum, its tl/2 α is 0.06hr, tl/2 β is 0.34hr), two kinds of anti--MSA clones have the quite long transformation period.
Embodiment 11:V H-V HAnd V κ-V κThe segmental preparation of dual specific Fab sample
Present embodiment is described a kind of preparation V H-V HAnd V κ-V κThe segmental method of dual specific Fab sample.Before making up described every kind of Fab print section, in conjunction with selecting in the first dAb storehouse of from be similar to embodiment 9, describing of the dAb of selected target.The V of separation and combination hen-egg lysozyme (Sigma) HDAb is HEL4, simultaneously the 2nd V of separation and combination TNF α acceptor (R and D systems) HDAb (TAR2h-5).These sequences provide in sequence list.By screening and affinity maturation separation energy in conjunction with the V of TNF α (TAR1-5-19) κDAb, its sequence provides in sequence list.This experiment also is applied in the 2nd V that describes among the embodiment 9 κDAb (MSA 26), its sequence is in Figure 17 B.
Digest the DNA of the DNA acquisition coding dAb of the expression vector that comprises above-mentioned 4 kinds of dAb with SalI and NotI.The band (300-400bp) of separating digesting product purification expection size downcuts this band on agarose gel electrophoresis, and (Qiagen UK) carries out gel-purified with Qiagen gel-purified test kit.The DNA of dAb of will encoding then inserts C HOr C κ(Fig. 8 and Fig. 9) is as shown in the table in the carrier.
dAb Target antigen dAb V HOr dAb V κ Insert carrier Mark (C end) Antibiotics resistance
HEL4 Hen-egg lysozyme V H C H myc Paraxin
TAR2-5 The TNF acceptor V H Cκ Flag Penbritin
TAR1-5-19 TNFα Vκ C H myc Paraxin
MSA
26 The mice serum albumin Vκ Cκ Flag Penbritin
Use V HC HAnd V HC κConstruction transforms the HB2151 cell jointly.In addition, use V κC HAnd V κC κConstruction transforms the HB2151 cell jointly.(2 * Ty that contains 5% glucose, 10 μ g/ml paraxin and 100 μ g/ml penbritins is to keep C for each cotransfection cloned culture overnight growth HAnd C κThe two microbiotic of plasmid is selected).Overnight culture is used to inoculate fresh culture (2 * Ty, 10 μ g/ml paraxin and 100 μ g/ml penbritins) and hatches growth is 0.7-0.9 up to the OD value, adds IPTG then to induce C HAnd C κThe expression of construction.Then, use the albumin A method of purification (for the V of common conversion HC HAnd V HC κ) and the affine resin purification method of MSA (for the V of common conversion κC HAnd V κC κ) purifying is expressed from pericentral siphon Fab print section.
V H-V HDual specific
With gel separation albumen to identify V HC HAnd V HC κThe expression of dual specific.Gel is adsorbed and passes through the band of the Western trace method detection Fab fragment expection size of myc mark and flag mark, shows the segmental V of Fab sample HC HAnd V HC κPart all exists.Then, whether the two halves of dual specific are present in the same Fab print section in order to measure, and spend the night bag by elisa plate with 4 ℃ of the sodium bicarbonate buffer liquid that contains 3mg/ml hen-egg lysozyme (HEL), the 100ul/ hole.Then, with 2%tween PBS sealing plate hole (as described in example 1 above), follow and V HC H/ V HC κ dual specific Fab print section is hatched jointly.With 9e10 (a kind of monoclonal antibody in conjunction with the myc mark, Roche) and anti-mouse IgG-HRP (Amersham Pharmacia Biotech) detect combining of dual specific material and HEL by dereferenced chain (non cognate chain).V HC H/ V HC κThe segmental signal of dual specific Fab sample is 0.154, and the V of single expression HC κThe background signal of chain is 0.069.This explanation Fab print section has binding specificity to target antigen.
V κ-V κDual specific
The V of purifying cotransformation on the affine resin of MSA κC HAnd V κC κAfter the dual specific Fab print section, gained albumen is used to detect elisa plate that is coated with 1 μ g/ml TNF α and the elisa plate that is coated with 10 μ g/ml MSA.As expection, when detecting two elisa plates with albumen L-HRP, the signal (data not shown) of background appears being higher than.This shows therefore protein fractions can be in conjunction with MSA (with MSA affinity column purifying), also can be in ensuing ELISA in conjunction with TNF α, thus determined the dual specific of antibody fragment.This protein fractions was used for two subsequent experimental afterwards.At first, use dual specific V κC HAnd V κC κFab print section is detected the elisa plate that is coated with 1 μ g/ml TNF α, simultaneously with the TNF α that calculates the concentration that can discharge similarity signal on ELISA in conjunction with dAb in contrast.Having/dual specific and contrast dAb are used to detect elisa plate during no 2mg/ml MSA.Signal in two special holes reduces greater than 50%, and the signal in the dAb hole does not a bit have to reduce (to see Figure 19 a).Same albumen is used for having/receptor assay of no MSA, also shown MSA competition (seeing Figure 19 c).This shows that MSA combines bispecific antibody fragment with TNF α competition.
Embodiment 12: have the V to the cys bonding of the dual specific of mice serum white protein and TNF α κ-V κThe segmental preparation of bispecific antibody
This example has been described a kind of method for preparing bispecific antibody fragment, and this antibody is the chemical coupling generation by disulfide linkage, specifically at mice serum white protein and TNF α.MSA16 (from embodiment 1) and TAR1-5-19dAb are entered one based on pET the C-terminal halfcystine being arranged and in the unmarked carrier by clone again.The expression level of two kinds of dAb is 4-10mg, with the affine resin of albumen L-agarose (Affitiech, Norway) the described dAb of purifying from supernatant.Then with the dAb of dithiothreitol (DTT) reduction halfcystine mark.To stop the formation again of disulfide linkage, cause the formation of PEP 1-5-19 homodimer with dithio two pyridine coupling TAR1-5-19 dAb.Mix the heterodimer that two kinds of different dAb (pH6.5) promote the formation of disulfide linkage and generate TAR1-5-19 and MSA16 cys bonding.The method of two kinds of different protein conjugates of this preparation is at first by descriptions (King TP, Li YKochoumian L Biochemistry.1978 vol 17:1499-506 Preparation of proteinconjugates via intermolecular disulfide bond formation) such as King.The separation of heterodimer from monomer is by the cationic exchange method.Isolate is to obtain identifying by the band that occurs the expection size in sds gel.With the kind of TNF receptor assay evaluation gained heterodimer, the IC50 with TNF in the discovery is approximately 18nM.Then, repeat receptor assay with the heterodimer of constant density (18nM) and the MSA and the HSA of a series of dilutions.The HSA of finite concentration scope (up to 2mg/ml) can not reduce the ability that dimer suppresses TNF α.Yet.The adding of MSA causes dimer to suppress the ability dose-dependently ground decline (Figure 20) of TNF α.This shows that MSA and TNF α compete the TAR1-5-19/MSA16 dimer in conjunction with the cys bonding.
Data are summed up
The gained data are listed in appendix 4 in the experiment of previous embodiment.
The reference of quoting in whole publications that present disclosure provides and the described publication is included this paper in as a reference here in the lump.The various modifications and changes of the method for the invention and system will be clearly for a person skilled in the art, not depart from invention scope and spirit.Although the invention describes concrete preferred embodiment, should be understood that the invention of claim should excessively not be confined to these specific embodiments.In fact, be conspicuous for the various modifications of finishing pattern of the present invention for the technician in molecular biology or the association area, they are all within the scope of claim of the present invention.
Appendix 1: the polypeptide that increases the transformation period in the body
Alpha1 Glycoprotein (seromucoid) (AAG)
α 1 chymotrypsin inhibitor (ACT)
Alpha1 Anti-trypsin (AAT)
α 1 microglobulin (albumen HC) (AIM)
Alpha2 Macroglobulin (A2M)
Antithrombin III (AT III)
APoA-I (Apo A-1)
Apolipoprotein B (Apo B)
B2M (β 2M)
Ceruloplasmin (Cp)
Complement component (C3)
Complement component (C4)
C1 esterase inhibition (C1 INH)
C-reactive protein (CRP)
Cysteine proteinase inhibitor C (Cys C)
Ferritin (FER)
Fibrinogen (FIB)
Fibronectin (FN)
Haptoglobin (Hp)
Hemopexin (HPX)
Immunoglobulin A (IgA)
Immunoglobulin D (IgD)
Immunoglobulin E (IgE)
Immunoglobulin G (IgG)
Immunoglobulin M (IgM)
Light chain immunoglobulin (κ/λ)
Lipoprotein (a) [Lp (a)]
Mannose-binding protein (MBP)
Myosin (Myo)
Profibr(in)olysin (PSM)
Prealbumin (transthyretin) (PAL)
Retinol conjugated protein (RBP)
Rheumatoid factors, polyclonal (RF)
Serum amyloid A (SAA)
Solubility TfR (sTfR)
Transferrins,iron complexes (Tf)
Annex 2
Pairing The treatment coherent reference
TNF α/TGF β TNF α/TGF β is expelled to the inflammation that obviously strengthens the joint in the ankle joint of collagen-induced arthritis model, invalid to the mouse that non-collagen is attacked.
TNF α/IL-1 TNF/IL-1 is at uveitis, malaria (hypoglycemia, No) play synergy in the morbidity, the migration of co-induction multiple type nuclear leukocyte (PMN) in inflammation, co-induction PMN soaks into and enters peritonaeum, co-induction endotheliocyte secretion IL-1, very important during inflammation, IL-1 or TNF induce the infiltration of some cell in the synovium of joint separately.IL-1 induces PMN, and TNF induces monocyte, because the PMN that increases, they induce more serious inflammatory reaction together.Round-robin cardiac muscle inhibition (existing during shock) is the TNF α and the IL-1 of low-level co-action.
TNF α/IL-2 The most relevant with the collaborative activation of killer T cell.
TNF α/IL-3 TNFa induces secondary hematopoietic cytokine, thereby causes IL-3 and the collaborative clone's hyperplasia Cancer Res.1992 Apr 15 that stimulates the acute myeloid leukaemia parent cell of TNFa; 52 (8): 2197-201.
TNF α/IL-4 VCAM expresses on TNF α/IL-4 co-induction endotheliocyte, and prompting plays a role in asthma.Similar RA synovitis; The expression of IL-6 in TNF α/IL-4 co-induction keratinocyte; The combination of TNFa and IL-4 or IL-13 can make the level of VCAM-1 among the fibroblast-like synovial cell of cultivation continue to raise by the stability that increases mRNA.AM J Pathol.1999 Apr；154 (4)：1149-58。
TNF α/IL-5 Relation between IL-4, IL-5, IL-8, acidophilia cationic protein, the IgE level in system of tumor necrosis factor and the serum among irritated adult of segmental bronchus and the children thereof, Allergy Astham Proc.2003 Mar-Apr; 24 (2) 111-8.
TNF α/IL-6 TNF α and IL-6 are that a kind of new human medullary cell is effective somatomedin of OH-2 cell, Eur J Haematol.1994 Jul; 53 (1): 31-7.
TNF α/IL-8 TNF α and IL-8 and PMNs synergistic activation thrombocyte.The effect of prompting in acute respiratory distress syndrome.See IL-5/TNF α (asthma).Synergy in the platelet activation of neutrophil leucocyte mediation between TNF α and the IL-8.Eur Cytokine Netw 1994 Sep-Oct; 5 (5): 455-60 (adult respiratory distress syndrome (ARDS)).
TNF α/IL-9
TNF α/IL-10 IL-10 induce and with TNF co-induction chronic infection T cell on the expression of HIV.
TNF α/IL-11 Cytokine co-induction osteoclast differentiation: supported Am J Physiol Cell Physiol.2002 Sep by immortalized cells or normal braincap cell; 283 (3): C679-87. (bone injury).
TNF α/IL-12
TNF α/IL-13 Lasting high expression level VCAM-1 in the fibroblast sample synovioblast of cultivating can increase mRNA stability by TNF α merging IL-4 or IL-13 and obtain Am J Pathol.1999 Apr 154; (4): 1149-58.The generation of eotaxin in IL-13 and the TNF α co-induction people nose fibroblast, Clin Exp Allergy.2000 Mar; 30 (3): 348-55.The generation of eotaxin in IL-13 and the TNF α co-induction people nose fibroblast, Clin Exp Allergy.2000Mar; 30 (3): 348-55 (allergic inflammation).The implication of serum TNF α and IL-13 in children's nephrotic syndrome therapeutic response, Cytokine.2003Feb 7; 21 (3): 155-9.
TNF α/IL-14 The effect of imbedibility tumour necrosis factor in the mild asthma patient, Thorax.2002 Sep; 57 (9): 774-8.
TNF α/IL-15 The effect of imbedibility tumour necrosis factor in the mild asthma patient, Thorax.2002 Sep; 57 (9): 774-8.
TNF α/IL-16 IL-16's is synthetic in the TNF α inductive respiratory tract endotheliocyte: the stimulation of serotonin activates, Am J Respir Cell Mol Biol.2003 Mar; 28 (3): 354-62 (respiratory inflammation).Dependency among the rheumatic arthritis patient between proinflammatory cytokine and the circulation IL-16, Rheumatology (Oxford) .2001 Apr; 40 (4): 474-5 (not having summary).IL-16 level in Crohn's disease raises and mediation mouse TNBS enteritis, Gastroenterology.2000 Oct; 119 (4): 972-82.
TNF α/IL-17 Inhibition IL-17TNF α/can prevent the arthritic development of Bollinger body burgdorferi strain infecting mouse, Infect Immun.2003 Jun; 71 (6): 3437-42.The collaborative TNF α of IL-17 is at external evoked cartilage injury.Ann Rheum Dis. 2002 Oct；61(10)：870-6。The effect of GM-CSF in the respiratory tract neutrophil accumulation that TNF α and IL-17 cause.Eur Respir is Mar J.2003; 21 (3): 387-93. (respiratory inflammation).Summarized the collaborative generation of raising NO and prostaglandin E2 in the scorching meniscal implantation body of human knee joint of IL-1, TNF α and IL-17, Arthritis Rheum.2001 Sep; 44 (9): 2078-83.
TNF α/IL-18 The expression of IL-18 combines Arthritis Rheum.2003 Feb in rheumatic arthritis patient's knee joint synovial tissue with IL-1 and increasing of TNF alpha levels; 48 (2): 339-47.Summarized increasing of IL-18 and TNF alpha levels among the type ii diabetes patients serum: with diabetic nephropathy concern Metabolism.2003 May; 52 (5): 605-8.
TNF α/IL-19 Having summarized IL-19 induces the generation of IL-6 and TNF α and causes apoptosis by TNF α, J Immunol.2002 Oct 15; 169 (8): 4288-97.
TNF α/IL-20 Cytokine summary: IL-20 new dermatitis effector molecule, Curr Biol.2001 Jul 10; 11 (13): R531-4.
TNF α/complement Inflammation and aggegation: for the inference of septic patient, Clin Infect Dis.2003 May 15; 36 (10): 1259-65.Epub 2003 May 08. summary.
TNF α/IFN-γ Toxic action people star spongiocyte when inducing the beta induced neutrophilic granulocyte activation of MHC synergistic corrosion virus reaction/IFN-/respiratory burst activated endothelial cell in the brain to note using TNF α/IFN-γ antiviral therapy is expressed many papers about inflammatory reaction of CX3C chemokine-as LPS, macrophage activation anti-TNF and anti--IFN-γ coordinating protection lethality endotoxemia mouse
TGF-β/IL-1 The generation of IL-6 and IL-8 in IL-11 in artificial bone's cell synthesis of prostaglandins small intestine endotheliocyte generation IL-6 (inflammatory model) stimulation lung fibroblast and IL-6 (inflammatory model) retina
TGF-β/IL-6 Chondrosarcoma (Chondrocarcoma) propagation
IL-1/IL-2 The synergy of B cell activation LAK cell activation T cell activation IL-1 and IL-2 in lymphokine activated killer cell produces is by TNF α and TNF β (lymphotoxin) mediation, Cytokine.1992 Nov; 4 (6): 479-87
IL-1/IL-3
IL-1/IL-4 The expression of IL-1 in the activation of B cell activation IL-4 inducing endothelial cell.
IL-1/IL-5
IL-1/IL-6 B cell activation T cell activation IL-1 induces IL-6 to express C3 and serum amyloid is expressed the damage of (acute phase reaction) HIV expression chondrogen
IL-1/IL-7 IL-7 is essential in IL-1 inductive thymocyte proliferation.IL-7 in GM-CSF or TNF and IL-1 synergy, J Immunol.1992 Jan 148 (1): 99-105.
IL-1/IL-8
IL-1/IL-10
IL-1/IL-11 Cytokine co-induction osteoclast differentiation: supported Am J Physiol Cell Physiol.2002 Sep by immortality or normal calvarium cell; 283 (3): C679-87. (bone injury).
IL-1/IL-16 Dependency among the rheumatic arthritis patient between proinflammatory cytokine and the circulation IL-16, Rheumatology (Oxford) .2001 Apr; 40 (4): 474-5. does not have summary.
IL-1/IL-17 Inhibition IL-17TNF α/can prevent the arthritic development of Bollinger body burgdorferi strain infecting mouse, Infect Immun.2003 Jun; 71 (6): 3437-42.IL-17 is the effect in the damage of cartilage destruction and synovial membrane in osteoarthritis, Osteoarthritis Cartilage.2002 Oct; 10 (10): 799-807.Summarized the collaborative generation of raising NO and prostaglandin E2 in the scorching meniscal implantation body of human knee joint of IL-1, TNF α and IL-17, Arthritis Rheum.2001 Sep; 44 (9): 2078-83.
IL-1/IL-18 The expression of IL-18 combines Arthritis Rheum.2003 Feb in rheumatic arthritis patient's knee joint synovial tissue with IL-1 and increasing of TNF alpha levels; 48 (2): 339-47.
IL-1/IFN-γ
IL-2/IL-3 T cell proliferation B cell proliferation
IL-2/IL-4 B cell proliferation T cell proliferation (the lymphocytic activation of selective induction CD8 and NK) IL-2R beta antagonists P1-30 can work in coordination with the effect of IL-2, IL-4, IL-9 and IL-15: biology and molecular effect.J Immunol.2000 Oct 15；165(8)：4312-8。
IL-2/IL-5 B cell proliferation/IgG secretion IL-5 induces IL-2 acceptor on the B cell
IL-2/IL-6 The growth of cytotoxic T cell
IL-2/IL-7
IL-2/IL-9 See IL-2/IL-4 (NK cell)
IL-2/IL-10 The B cell activation
IL-2/IL-12 The collaborative IL-2 of IL-12 induces lymphokine activated cytotoxicity, pore-forming protein and granzyme expression of gene in the human fresh NK cell, Cell Immunol.1995 Oct 1; 165 (1): 33-43. (T cell activation).
IL-2/IL-15 See IL-2/IL-4 (NK cell) (T cell activation and propagation) IL-15 and IL-2: T cell life and death problem in the body.Nat Med.2001 Jan；7(1)：114-8。
IL-2/IL-16 IL-16 and IL-2 synergistic activation CD4+T cell.JImmunol.1998 Mar 1；160(5)：2115-20。
IL-2/IL-17 The evidence that early stage participant of IL-17 and experimental kidney heteroplastic transplantation are repelled, J Patlrol.2002 Ju1; 197 (3): 322-32.
IL-2/IL-18 IL-18 works in coordination with IL-2 inducing mouse lethality injury of lung: the latent effect of cytokine, chemokine and natural killer cell in the interstitial pneumonia morbidity.Blood. 2002 Feb 15；99(4)：1289-98。
IL-2/TGF-β The control of CD4 effector destiny: collaborative apoptosis and the amplification of accelerating effect, J Exp Med 1995 Sep 1 of preventing of transforminggrowthfactor-and IL-2; 182 (3): 699-709.
IL-2/IFN-γ B emiocytosis Ig IL-2 inducing T cell is expressed IFN-γ
IL-2/IFN-α/β Do not have
IL-3/IL-4 Collaborative mastocyte growth IL-4 and GM-CSF or IL-3 are inducing the person monocytic cell to express synergistic effect among the CD23: the adjusting effect of IFN-α and IFN-γ.Cytokine.1994 Jul； 6(4)：407-13。
IL-3/IL-5
IL-3/IL-6
IL-3/IFN-γ Whole poly IgA receptor level in the collaborative increase of IL-4 and the IFN-γ people small intestine endotheliocyte.The effect of protein tyrosine kinase.J Immunol.1996 Jun 15； 156(12)：4807-14。
IL-3/GM-CSF Cytokine is regulated the difference of people's eosinophil IL-3, IL-5 and the expression of GM-CSF receptor alpha chain: IL-3, IL-5 and GM-CSF downward modulation IL-5 acceptor alpha expression are accompanied by the reduction to the IL-5 reaction, but raise IL-3 acceptor alpha expression, J Immunol.2003 Jun1; 170 (11): 5359-66. (allergic inflammation).
IL-4/IL-2 Collaborative IL-2 or the IL-12 inducing mouse NK cell expressing IFN-γ of increasing of IL-4 is before the Blood.2003 Mar 13[Epub printing].
IL-4/IL-5 The secretion of histamine etc. when increasing mastocyte IgE being reacted.The Th2 like cell factor relevant in the pemphigoid is reacted.IL-4 and the IL-5 effect in morbidity.Int J Immunopathol Pharmacol.1999 May-Aug； 12(2)：55-61。
IL-4/IL-6
IL-4/IL-10
IL-4/IL-11 Keep the Synergistic interaction between the IL-11 and IL-4 in the initial hemopoietic stem cell proliferation process of mouse.Blood.1991 Sep 15；78(6)：1448-51。
IL-4/IL-12 IL-4 and IL-18 produce the synergistic effect of IL-12 dependency IFN-γ to dendritic cell.J Immunol.2000 Jan 1; 164 (1): 64-71. (increasing the Th1/Th2 difference).Collaborative IL-2 or the IL-12 inducing mouse NK cell expressing IFN-γ of increasing of IL-4 is before the Blood.2003 Mar 13[Epub printing].
IL-4/IL-13 IL-4 and IL-13 signal interface chart have been summarized.Science.2003 Jun 6; 300 (5625): 1527-8. (irritated, asthma).Suppress IL-4/IL-13 receptor system Ammonium Glycyrrhizate susceptibility and do not influence the foundation of allergic asthma mouse model.J Aller Clin Immunol.2003 Jun；111(6)： 1361-1369。
IL-4/IL-16 (asthma) IL-4/IL-9 and exogenous IL-16 induce the BEAS-2B cell to produce IL-16, and the BEAS-2B cell is that a kind of bronchial epithelial cell is.Cell Immunol.2001 Feb 1；207(2)：75-80。
IL-4/IL-17 The collaborative secretion that stimulates IL-6 in people's colonic muscle fibrocyte of IL-4 and IL-17.J Mol Med.2002 Nov; 10 (5): 631-4 (enteritis).
IL-4/IL-24 IL-24 is expressed on rat and the human macrophage.Irnnmunobiology.2002 Ju1；205(3)：321-34。
IL-4/IL-25 Summarize new IL-17 family member and promote Th1 or Th2 reaction in the lung: effect in the body of novel cytokine IL-25.J Immunol.2002 Jul 1; 169 (1): 443-53. (allergic inflammation).Summarize Fc ε RI mediation and activated mastocyte generation IL-25.Blood.2003 May 1; 101 (9): 3594-6.Epub 2003 Jan 02. (allergic inflammation).
IL-4/IFN-γ Summarized the IL-4 inducing endothelial cell and produced IL-6: with the synergy of IFN-γ.Eur J Immunol.1991 Jan；21(1)：97-101。
IL-4/SCF The little intestinalmast cell of SCF and IL-4 mediator.Immunol Rev.2001 Feb; 179:57-60 (summary).
IL-5/IL-3 Cytokine is regulated the difference of people's eosinophil IL-3, IL-5 and the expression of GM-CSF receptor alpha chain: IL-3, IL-5 and GM-CSF downward modulation IL-5 acceptor alpha expression are accompanied by the reduction to the IL-5 reaction, but raise IL-3 acceptor alpha expression, J Immunol.2003 Jun1; 170 (11): 5359-66 (allergic inflammation is seen summary).
IL-5/IL-6
IL-5/IL-13 Suppress mouse allelgic respiratory inflammation and respiratory tract allergy with dexamethasone: the effect of eosinophil, IL-5 and IL-13.J Aller Clin Immunol.2003 May；111(5)：1049-61。
IL-5/IL-17 IL-17 worked in coordination with the infiltration of neutrophil leucocyte in respiratory tract, Am J Respir Cell Mol Biol.2003 Jan after the mouse allelgic asthma model sucked anaphylactogen; 28 (1): 42-5.
IL-5/IL-25 Summarize new IL-17 family member and promote Th1 or Th2 reaction in the lung: effect in the body of novel cytokine IL-25.J Immunol.2002 Jul 1; 169 (1): 443-53. (allergic inflammation).Summarize Fc ε RI mediation and activated mastocyte generation IL-25.Blood.2003 May 1; 101 (9): 3594-6.Epub 2003 Jan 02. (allergic inflammation).
IL-5/IFN-γ
IL-3/GM-CSF Cytokine is regulated the difference of people's eosinophil IL-3, IL-5 and the expression of GM-CSF receptor alpha chain: IL-3, IL-5 and GM-CSF downward modulation IL-5 acceptor alpha expression are accompanied by the reduction to the IL-5 reaction, but raise IL-3 acceptor alpha expression, J Immunol.2003 Jun1; 170 (11): 5359-66. (allergic inflammation).
IL-6/IL-10
IL-6/IL-11
IL-6/IL-16 IL-16 stimulates person monocytic cell's proinflammatory cytokine expression and generation, Immunology.2000 May; 100 (1): 63-9.
IL-6/IL-17 IL-17 stimulates the respiratory mucus plain gene to express by IL-6 paracrine/autocrine loop.J Biol Chem.2003 May 9; 278 (19): 17036-43.Epub 2003 Mar 06. (respiratory inflammation, asthma).
IL-6/IL-19 Having summarized IL-19 induces the generation of IL-6 and TNF α and passes through TNF α cell death inducing.J Immunol.2002 Oct 15；169(8)：4288-97。
IL-6/IFN-g
IL-7/IL-2 IL-7 increases the weight of graft versus host disease.Blood.2002 Oct 1；100(7)： 2642-9。
IL-7/IL-12 The synergistic effect of IL-7 and IL-12 in human T-cell's activation.J Immunol 1995 May 15；154(10)：5093-102。
IL-7/IL-15 IL-7 and IL-15 regulate bcl-2 and c-myb genetic expression in the cutaneous T cell lymphoma.Blood 2001 Nov1; 98 (9): 2778-83. (somatomedin).
IL-8/IL-11 The unusual generation of IL-8 and IL-11 in the polycyth(a)emia.Cytokine.2002 Nov 21；20(4)：178-83。
IL-8/IL-17 The effect of IL-17 in the joint injury.Drug News Perspect.2002 Jan; 15 (1): 17-23. (sacroiliitis) has summarized IL-17 stimulates the human respiratory endotheliocyte to express IL-8, the relevant oncogene-α of growth and granulocyte clone stimulating factor.Am J Respir Cell Mol Biol. 2002 Jun; 26 (6): 748-53. (respiratory inflammation).
IL-8/CSF IL-8: a kind of autocrine at human hemopoietic forebody cell/paracrine somatomedin, its effect are that collaborative CSF-1 promotes monokaryon-scavenger cell growth and differentiation.Exp Hematol.1999 Jan；27(1)：28-36。
IL-8/VGEF Level in the chamber of VEGF, bFGF, IL-8 and IL-12 in former or recurrent glioblastoma.J Neurooncol.2003 May；62(3)：297-303。
IL-9/IL-4 Anti-IL-9 Antybody therapy can suppress mouse asthmatic model respiratory inflammation and allergy, Am J Respir Crit Care Med.2002 Aug 1; 166 (3): 409-16.
IL-9/IL-5 The cytokine-expressing of induced expression Th2 excessively of the IL-9 of lung causes immunopathogenesis.J Clin Invest.2002 Jan；109(1)：29-39。Th2 cytokine and asthma.IL-9 is as a kind of target for the treatment of asthma.Respir Res.2001; 2 (2): 80-4.Epub 2001 Feb 15. summaries.Summarize IL-9 and strengthened IL-5 receptor expression and differentiation of people's eosinophil and existence.Blood.2000 Sep 15; 96 (6): 2163-71 (asthma).
IL-9/IL-13 Anti-IL-9 Antybody therapy can suppress mouse asthmatic model respiratory inflammation and allergy, Am J Respir Crit Care Med.2002 Aug 1; 166 (3): 409-16.IL-13 causes respiratory tract allergy and the excessive generation of mucus in the asthma to the direct effect of endotheliocyte.Nat Med.2002 Aug；(8)：885-9。
IL-9/IL-16 See IL-4/IL-16
IL-10/IL-2 The collaborative IL-2 of the interaction of IL-10 and IL-2: IL-10 strengthens the human B lymphocyte reaction in humoral immunoresponse(HI), and mechanism is different from the CD25 up-regulated.Cell Immunol.1994 Sep；157(2)：478-88。
IL-10/IL-12
IL-10/TGF-β The collaborative T cell of regulating of IL-10 and TGF-β is to former the replying of mucous membrane irritability in normal immunity and specific active immunotherapy.Eur J Immunol.2003 May；33(5)：1205-14。
IL-10/IFN-γ
IL-1l/IL-6 IL-6 and IL-11 keep the formation of osteoclast by the non-dependent mechanism of RANKL.Bone.2003 Jan; 32 (1): 1-7. (bone resorption in the inflammation).
IL-11/IL-17 The polarization of IL-11 and IL-17 expression in vivo between the acute and chronic skin damage.Allergy Clin Immunol.2003 Apr; 111 (4): 875-81. (allergic dermatitis).IL-17 is by NF-κ B part/the protect collagen-induced sacroiliitis bone erosion of ossein (protecting bone protein) receptor activation thing unbalance promotion mouse.J Immunol.2003 Mar 1； 170(5)：2655-62。
IL-11/TGF-β The polarization of IL-11 and IL-17 expression in vivo between the acute and chronic skin damage.J Allergy Clin Immunol.2003 Apr; 111 (4): 875-81. (allergic dermatitis).
IL-12/IL-13 Relation in the systemic lupus erythematous between unbalance and the generic specificity rheumatism factor and the anticardiolipin antibody of IL-12 and IL-13.Clin Rheumatol.2003 May； 22(2)：107-11。
IL-12/IL-17 The rise of IL-12 and IL-17 in the reactivity inflammation intestinal disease.Scand J GastroenteroL 2003 Feb；38(2)：180-5。
IL-12/IL-18 IL-12 and IL-18 are to the collaborative propagation and the activation of natural killer cell.Cytokine.1999 Nov；11(11)：822-30。The inflammatory fatty degeneration of liver that IL-12 and IL-18 cause.J Interferon Cytokine Res.2003 Mar；23(3)：155-62。
IL-12/IL-23 The key cytokines of brain autoimmune disease inflammation is IL-23 rather than IL-12.Nature.2003Feb 13；421(6924)：744-8。The unique effect of having summarized IL-23 in promoting the cellular immunization process.J leukoc Biol.2003 Jan; 73 (1): the 49-56. summary.
IL-12/IL-27 Having summarized the heterodimer of forming by EBI3 and p28 albumen---IL-27 induces the propagation of initial CD4 (+) T cell, Immunity.2002 Jun; 16 (6): 779-90.
IL-12/IFN-γ IL-12 induces B, T cell expressing IFN-γ as the immunostimulation part.
IL-13/IL-5 See IL-5/IL-13
IL-13/IL-25 Summarize new IL-17 family member and promote Th1 or Th2 reaction in the lung: effect in the body of novel cytokine IL-25.J Immunol.2002 Jul 1; 169 (1): 443-53. (allergic inflammation).Summarize Fc ε RI mediation and activated mastocyte generation IL-25.Blood.2003 May 1; 101 (9): 3594-6.Epub 2003 Jan 02. (allergic inflammation).
IL-15/IL-13 IL-13 and IL-15 be the differential expression on Ectopic Endometrium and the normal endometrial among endometriosis and the normal child-bearing woman in uterus.Am J Reprod Immunol.2003 Feb；49(2)：75-83。
IL-15/IL-16 Crossing of IL-15 and IL-16 expressed in the cutaneous T cell lymphoma: the stage dependency increases in the mycosis fungoides progress.Exp Dermatol.2000 Aug；9(4)： 248-51。
IL-15/IL-17 Summarized in lipopolysaccharide-induced respiratory tract neutrophilic leukocytosis, the IL-17 that is produced by lymphocyte and neutrophil leucocyte is essential: IL-15 may trigger agent as a kind of.J Immunol.2003 Feb 15; 170 (4): 2106-12. (respiratory inflammation).
IL-15/IL-21 Collaborative NK cells of human beings and the T cell generation IFN-γ of increasing of IL-21 and IL-15 or IL-18.J Immunol.2003 Jun 1；170(11)：5464-9。
IL-17/IL-23 IL-23 promotes tangible cd4 t cell active state feature to show as the generation of IL-17.J Biol Chem.2003 Jan 17；278(3)：1910-4.Epub 2002 Nov 03。
IL-17/TGF-β The polarization of IL-11 and IL-17 expression in vivo between the acute and chronic skin damage.J Allergy Clin Immunol.2003 Apr; 111 (4): 875-81. (allergic dermatitis).
IL-18/IL-12 IL-12 and IL-18 are to the collaborative propagation and the activation of natural killer cell.Cytokine.1999 Nov；11(11)：822-30。Summarized the restraining effect that IL-12 produces external Ig in the mouse chronic graft versus host disease: act synergistically with IL-18.Eur J Immunol.1998 Jun；28(6)： 2017-24。
IL-18/IL-21 Collaborative NK cells of human beings and the T cell generation IFN-γ of increasing of IL-21 and IL-15 or IL-18.J Immunol.2003 Jun 1；170(11)：5464-9。
IL-18/TGF-β With IL-18 and the transforminggrowthfactor-in the sick persons suffering from ocular disorders serum of corticosteroid treatment Graves.Int Immunopharmacol.2003 Apr；3(4)： 549-52。
IL-18/IFN-γ
Anti-TNF alpha/anti-CD4 Synergistic therapeutic action to DBA/1 sacroiliitis mouse
Annex 3 oncology combinations (oncology combinations)
Target Disease Counterpart
CD89 * The person of raising as cytotoxic cell All
CD19 B cell lymphoma HLA-DR CD5
HLA-DR B cell lymphoma CD89 CD19 CD5
CD38 Multiple myeloma CD138 CD56 HLA-DR
CD138 Multiple myeloma CD38 CD56 HLA-DR
CD138 Lung cancer CD56 CEA
CD33 Acute marrow sample lymphoma CD34 HLA-DR
CD56 Lung cancer CD138 CEA
CEA General cancer (pan carcinoma) The MET acceptor
VEGF General cancer The MET acceptor
Vegf receptor General cancer The MET acceptor
IL-13 Asthma/pneumonia IL-4 IL-5 Eotaxin(s) MDC TARC TNFα IL-9 EGFR CD40L IL-25 MCP-1 TGFβ
IL-4 Asthma IL-13 IL-5 Eotaxin(s) MDC TARC TNFα IL-9 EGFR CD40L IL-25 MCP-1 TGFβ
Eotaxin Asthma IL-5 Eotaxin-2 Eotaxin-3
EGFR Cancer HER2/neu HER3 HER4
HER2 Cancer HER3 HER4
TNFR1 The RA/ Crohn disease IL-1R IL-6R IL-18R
TNFα The RA/ Crohn disease IL-α/β IL-6 IL-18 ICAM-1 IL-15 IL-17
IL-1R The RA/ Crohn disease IL-6R IL-18R
IL-18R The RA/ Crohn disease IL-6R
Figure A20081000856501171
Figure A20081000856501181
Figure A20081000856501191
Sequence table
＜110〉Domantis Ltd. (Domantis Limited)
Winter，Greg
Tomlinson，Ian
Ignatovich，Olga
Holt，Lucy
De Angelis，Elena
＜120〉immune globulin single variant antigen bonding land and specific construct thereof
<130>P014435WO ATM
<140>PCT/GB 03/02804
<141>2003-06-30
<150>PCT/GB2002/003014
<151>2002-06-28
<150>GB 0230202.4
<151>2002-12-27
<160>240
<170>Patentin version 3.1
<210>1
<211>360
<212>DNA
＜213〉artificial sequence
<220>
<223>HEL4
<220>
<221>CDS
<222>(1)..(360)
<223>
<400>1
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttt agg att agc gat gag 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Arg Ile Ser Asp Glu
20 25 30
gat atg ggc tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gta 144
Asp Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca agc att tat ggc cct agc ggt agc aca tac tac gca gac tcc gtg 192
Ser Ser Ile Tyr Gly Pro Ser Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgt gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tat tgc 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg agt gct ttg gag ccg ctt tcg gag ccc ctg ggc ttt tgg ggt cag 336
Ala Ser Ala Leu Glu Pro Leu Ser Glu Pro Leu Gly Phe Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg agc 360
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>2
<211>120
<212>PRT
＜213〉artificial sequence
<220>
<223>HEL4
<400>2
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Arg Ile Ser Asp Glu
20 25 30
Asp Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ser Ile Tyr Gly Pro Ser Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ser Ala Leu Glu Pro Leu Ser Glu Pro Leu Gly Phe Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>3
<211>348
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR2-5
<220>
<221>CDS
<222>(1)..(348)
<223>
<400>3
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt gat ctt tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Leu Tyr
20 25 30
aat atg ttt tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Asn Met Phe Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca ttt att agt cag act ggt agg ctt aca tgg tac gca gac tcc gtg 192
Ser Phe Ile Ser Gln Thr Gly Arg Leu Thr Trp Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa acg ctg gag gat ttt gac tac tgg ggc cag gga acc ctg gtc 336
Ala Lys Thr Leu Glu Asp Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
acc gtc tcg agc 348
Thr Val Ser Ser
115
<210>4
<211>116
<212>PRT
＜213〉artificial sequence
<220>
<223>TAR2-5
<400>4
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Leu Tyr
20 25 30
Asn Met Phe Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Phe Ile Ser Gln Thr Gly Arg Leu Thr Trp Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Thr Leu Glu Asp Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser Ser
115
<210>5
<211>324
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR1-5-19
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>5
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc gtt aag gag ttt 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Lys Glu Phe
20 25 30
tta tgg tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Trp Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat atg gca tcc aat ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Met Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag aag ttt aag ctg cct cgt 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Lys Phe Lys Leu Pro Arg
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>6
<211>108
<212>PRT
＜213〉artificial sequence
<220>
<223>TAR1-5-19
<400>6
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Lys Glu Phe
20 25 30
Leu Trp Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Met Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Lys Phe Lys Leu Pro Arg
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>7
<211>362
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR2-10
<400>7
gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60
tcctgtgcag cctccggatt cacctttgag tggtattgga tgggttgggt ccgccaggct 120
ccagggaagg gtctagagtg ggtctcagct attagtggta gtggtggtag cacatactac 180
gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240
ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaagttaag 300
ttgggggggg ggcctaattt tgactactgg ggccagggaa ccctggtcac cgtctcgagc 360
gc 362
<210>8
<211>360
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR2-10
<220>
<221>CDS
<222>(1)..(360)
<223>
<400>8
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt gag tgg tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Glu Trp Tyr
20 25 30
tgg atg ggt tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Trp Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gct att agt ggt agt ggt ggt agc aca tac tac gca gac tcc gtg 192
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa gtt aag ttg ggg ggg ggg cct aat ttt gac tac tgg ggc cag 336
Ala Lys Val Lys Leu Gly Gly Gly Pro Asn Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg agc 360
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>9
<211>120
<212>PRT
＜213〉artificial sequence
<220>
<223>TAR2-10
<400>9
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Glu Trp Tyr
20 25 30
Trp Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Val Lys Leu Gly Gly Gly Pro Asn Phe Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>10
<211>324
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR1-5-19
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>10
gac atc cag atg acc cag tct cca tcc tct ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att gat agt tat 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Asp Ser Tyr
20 25 30
tta cat tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat agt gca tcc gag ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Ser Ala Ser Glu Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag gtt gtg tgg cgt cct ttt 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val Val Trp Arg Pro Phe
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgc 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>11
<211>108
<212>PRT
＜213〉artificial sequence
<220>
<223>TAR1-5-19
<400>11
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Asp Ser Tyr
20 25 30
Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Ala Ser Glu Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val Val Trp Arg Pro Phe
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>12
<211>324
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR1-5-19
<400>12
gcgtttgatt tccaccttgg tcccttggcc gaacgtaaaa ggacgccaca caacctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaactcgg atgcactata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caatgtaaat aactatcaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagagagga 300
tggagactgg gtcatctgga tgtc 324
<210>13
<211>324
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR1-5
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>13
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att ttt atg aat 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Phe Met Asn
20 25 30
tta ttg tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Leu Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat aat gca tcc gtg ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Asn Ala Ser Val Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag gtt gtg tgg cgt cct ttt 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val Val Trp Arg Pro Phe
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>14
<211>108
<212>PRT
＜213〉artificial sequence
<220>
<223>TAR1-5
<400>14
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Phe Met Asn
20 25 30
Leu Leu Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Asn Ala Ser Val Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val Val Trp Arg Pro Phe
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>15
<211>324
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR1-5
<400>15
ccgtttgatt tccaccttgg tcccttggcc gaacgtaaaa ggacgccaca caacctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaacacgg atgcattata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac cacaataaat tcataaaaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>16
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉monomer-dAb1: mating partner dAb is present in TAR1-5d1 (3U connexon), d5 (5U connexon
), d6 (7U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>16
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att tat gat gcg 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Tyr Asp Ala
20 25 30
tta gag tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Glu Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat act gca tcc cgg ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Thr Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag gtt atg cag cgt cct gtt 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val Met Gln Arg Pro Val
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>17
<211>108
<212>PRT
＜213〉artificial sequence
<220>
＜223〉monomer-dAb1: mating partner dAb is present in TAR1-5d1 (3U connexon), d5 (5U connexon
), d6 (7U connexon)
<400>17
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Tyr Asp Ala
20 25 30
Leu Glu Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Thr Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val Met Gln Arg Pro Val
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>18
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉monomer-dAb1: mating partner dAb is present in TAR1-5d1 (3U connexon), d5 (5U connexon
), d6 (7U connexon)
<400>18
ccgtttgatt tccaccttgg tcccttggcc gaacgtaaca ggacgctgca taacctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaccggg atgcagtata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac cactctaacg catcataaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>19
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉monomer-dAb2: mating partner dAb is present in TAR1-5d2 (3U connexon), d3 (5U connexon)
<400>19
gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga ccgtgtcacc 60
atcacttgcc gggcaagtca gagcatttat gatgctttac agtggtacca gcagaaacca 120
gggaaagccc ctaagctcct gatctatact gcatcccggt tgcaaagtgg ggtcccatca 180
cgtttcagtg gcagtggatc tgggacagat ttcactctca ccatcagcag tctgcaacct 240
gaagattttg ctacgtacca ctgtcaacag gttatgcagc gtcctgttac gttcggccaa 300
gggaccaagg tggaaatcaa acgg 324
<210>20
<211>33
<212>PRT
＜213〉artificial sequence
<220>
＜223〉monomer-dAb2: mating partner dAb is present in TAR1-5d2 (3U connexon), d3 (5U connexon)
<400>20
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Tyr Asp Ala
20 25 30
Leu
<210>21
<211>74
<212>PRT
＜213〉artificial sequence
<220>
＜223〉monomer-dAb2: mating partner dAb is present in TAR1-5d2 (3U connexon), d3 (5U connexon)
<400>21
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Thr
1 5 10 15
Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly
20 25 30
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp
35 40 45
Phe Ala Thr Tyr His Cys Gln Gln Val Met Gln Arg Pro Val Thr Phe
50 55 60
Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
65 70
<210>22
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉monomer-dAb2: mating partner dAb is present in TAR1-5d2 (3U connexon), d3 (5U connexon)
<400>22
ccgtttgatt tccaccttgg tcccttggcc gaacgtaaca ggacgctgca taacctgttg 60
acagtggtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaccggg atgcagtata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac cactgtaaag catcataaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>23
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉monomer-dAb3: mating partner dAb is present in TAR1-5d4 (5U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>23
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc gtt aag gag ttt 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Lys Glu Phe
20 25 30
tta tgg tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Trp Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat atg gca tcc aat ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Met Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag aag ttt aag ctg cct cgt 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Lys Phe Lys Leu Pro Arg
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>24
<211>108
<212>PRT
＜213〉artificial sequence
<220>
＜223〉monomer-dAb3: mating partner dAb is present in TAR1-5d4 (5U connexon)
<400>24
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Lys Glu Phe
20 25 30
Leu Trp Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Met Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Lys Phe Lys Leu Pro Arg
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>25
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉monomer-dAb3: mating partner dAb is present in TAR1-5d4 (5U connexon)
<400>25
ccgtttgatt tccaccttgg tcccttggcc gaacgtacga ggcagcttaa acttctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaattgg atgccatata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caccataaaa actccttaac 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>26
<211>324
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR1-27
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>26
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile 4Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att tgg acg aag 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Trp Thr Lys
20 25 30
tta cat tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat atg gca tcc agt ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Met Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag tgg ttt agt aat cct agt 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Trp Phe Ser Asn Pro Ser
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgc 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>27
<211>108
<212>PRT
＜213〉artificial sequence
<220>
<223>TAR1-27
<400>27
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Trp Thr Lys
20 25 30
Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Met Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Trp Phe Ser Asn Pro Ser
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>28
<211>324
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR1-27
<400>28
gcgtttgatt tccaccttgg tcccttggcc gaacgtacta ggattactaa accactgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaactgg atgccatata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caatgtaact tcgtccaaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>29
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d1 (3U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>29
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att tag ccg att 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Pro Ile
20 25 30
tta tgt tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Cys Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat gct gca tcc agt ttg caa agt ggg gtc cca rca cgt ttc agt ggc 192
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75
gaa gat ttt gct acg tac tac tgt caa cag att cag cat att cct gtg 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ile Gln His Ile Pro Val
80 85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>30
<211>29
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d1 (3U connexon)
<400>30
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile
20 25
<210>31
<211>78
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d1 (3U connexon)
<400>31
Pro Ile Leu Cys Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
1 5 10 15
Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe
20 25 30
Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu
35 40 45
Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ile Gln His Ile
50 55 60
Pro Val Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
65 70 75
<210>32
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d1 (3U connexon)
<400>32
ccgtttgatt tccaccttgg tcccttggcc gaacgtcaca ggaatatgct gaatctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaactgg atgcagcata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caacataaaa tcggctaaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>33
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d2 (3U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>33
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att ggg tag gat 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Gly Asp
20 25 30
tta cat tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat acg gca tcc ctt ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Thr Ala Ser Leu Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75
gaa gat ttt gct acg tac tac tgt caa cag cag agt gct ttt cct aat 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gln Ser Ala Phe Pro Asn
80 85 90 95
acg ctc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Leu Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>34
<211>30
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d2 (3U connexon)
<400>34
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Gly
20 25 30
<210>35
<211>77
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d2 (3U connexon)
<400>35
Asp Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu
1 5 10 15
Ile Tyr Thr Ala Ser Leu Leu Gln Ser Gly Val Pro Ser Arg Phe Ser
20 25 30
Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln
35 40 45
Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gln Ser Ala Phe Pro
50 55 60
Asn Thr Leu Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
65 70 75
<210>36
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d2 (3U connexon)
<400>36
ccgtttgatt tccaccttgg tcccttggcc gagcgtatta ggaaaagcac tctgctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaaaggg atgccgtata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caatgtaaat cctacccaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>37
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d7 (3U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>37
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tcc gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc ata acg aag aat 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Thr Lys Asn
20 25 30
tta ctt tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Leu Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat tag gca tcc tct ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75
gaa gat ttt gct acg tac tac tgt caa cag ctt cgt cat aag cct ccg 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Arg His Lys Pro Pro
80 85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>38
<211>49
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d7 (3U connexon)
<400>38
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Thr Lys Asn
20 25 30
Leu Leu Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr
<210>39
<211>58
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d7 (3U connexon)
<400>39
Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly
1 5 10 15
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp
20 25 30
Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Arg His Lys Pro Pro Thr Phe
35 40 45
Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
50 55
<210>40
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d7 (3U connexon)
<400>40
ccgtttgatt tccaccttgg tcccttggcc gaacgtcgga ggcttatgac gaagctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaagagg atgcctaata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caaagtaaat tcttcgttat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acggatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>41
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d8 (3U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>41
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att tag aag tct 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Lys Ser
20 25 30
tta agg tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Arg Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat cat gca tcc gat ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr His Ala Ser Asp Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75
gaa gat ttt gct acg tac tac tgt caa cag atg gtt aat agt cct gtt 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Met Val Asn Ser Pro Val
80 85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>42
<211>29
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d8 (3U connexon)
<400>42
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile
20 25
<210>43
<211>78
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d8 (3U connexon)
<400>43
Lys Ser Leu Arg Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
1 5 10 15
Leu Ile Tyr His Ala Ser Asp Leu Gln Ser Gly Val Pro Ser Arg Phe
20 25 30
Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu
35 40 45
Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Met Val Asn Ser
50 55 60
Pro Val Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
65 70 75
<210>44
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d8 (3U connexon)
<400>44
ccgtttgatt tccaccttgg tcccttggcc gaacgtaaca ggactattaa ccatctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaatcgg atgcatgata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caccttaaag acttctaaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>45
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d12 (3U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>45
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att tag acg gcg 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Thr Ala
20 25 30
tta cat tgg tac cag cag aaa cca ggg aaa gcc cct aag crc ctg atc 144
Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat tct gca tcc agt ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Ser Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75
gaa gat ttt gct acg tac tac tgt caa cag tcg agt ttt ttg cct ttt 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Ser Phe Leu Pro Phe
80 85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>46
<211>29
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d12 (3U connexon)
<400>46
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile
20 25
<210>47
<211>78
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d12 (3U connexon)
<400>47
Thr Ala Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
1 5 10 15
Leu Ile Tyr Ser Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe
20 25 30
Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu
35 40 45
Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Ser Phe Leu
50 55 60
Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
65 70 75
<210>48
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d12 (3U connexon)
<400>48
ccgtttgatt tccaccttgg tcccttggcc gaacgtaaaa ggcaaaaaac tcgactgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaactgg atgcagaata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caatgtaacg ccgtctaaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>49
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d16 (3U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>49
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att ggg ccg aat 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Gly Pro Asn
20 25 30
tta gag tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Glu Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat gct gca tcc agt ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag cag atg ggg cgt cct cgg 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gln Met Gly Arg Pro Arg
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>50
<211>108
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d16 (3U connexon)
<400>50
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Gly Pro Asn
20 25 30
Leu Glu Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gln Met Gly Arg Pro Arg
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>51
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d16 (3U connexon)
<400>51
ccgtttgatt tccaccttgg tcccttggcc gaacgtccga ggacgcccca tctgctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaactgg atgcagcata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac cactctaaat tcggcccaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>52
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d23 (5U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>52
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att aag cat tag 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Lys His
20 25 30
tta gct tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat aag gca tcc gtg ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Lys Ala Ser Val Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75
gaa gat ttt gct acg tac tac tgt caa cag ctt agg cgt cgt cct act 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Arg Arg Arg Pro Thr
80 85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>53
<211>31
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d23 (5U connexon)
<400>53
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Lys His
20 25 30
<210>54
<211>76
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d23 (5U connexon)
<400>54
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
1 5 10 15
Tyr Lys Ala Ser Val Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
20 25 30
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
35 40 45
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Arg Arg Arg Pro Thr
50 55 60
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
65 70 75
<210>55
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d23 (5U connexon)
<400>55
ccgtttgatt tccaccttgg tcccttggcc gaacgtagta ggacgacgcc taagctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaacacgg atgccttata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caagctaact aatgcttaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>56
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d30 (7U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>56
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc gtt aag gct tag 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Lys Ala
20 25 30
tta act tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Thr Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat aag gca tcc act ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Lys Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phc Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75
gaa gat ttt gct acg tac tac tgt caa cag cat agt tct agg cct tat 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Ser Ser Arg Pro Tyr
80 85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>57
<211>31
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d30 (7U connexon)
<400>57
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Lys Ala
20 25 30
<210>58
<211>76
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d30 (7U connexon)
<400>58
Leu Thr Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
1 5 10 15
Tyr Lys Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
20 25 30
Ser Gly Ser Gly Thr A sp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
35 40 45
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Ser Ser Arg Pro Tyr
50 55 60
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
65 70 75
<210>59
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d30 (7U connexon)
<400>59
ccgtttgatt tccaccttgg tcccttggcc gaacgtataa ggcctagaac tatgctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaagtgg atgccttata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caagttaact aagccttaac 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>60
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d31 (7U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>60
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att gag aat cgg 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Glu Asn Arg
20 25 30
tta ggt tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat tag gcg tcc ttg ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Ala Ser Leu Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75
gaa gat ttt gct acg tac tac tgt caa cag gat tcg tat ttt cct cgt 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Asp Ser Tyr Phe Pro Arg
80 85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>61
<211>49
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d31 (7U connexon)
<400>61
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Glu Asn Arg
20 25 30
Leu Gly Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr
<210>62
<211>58
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d31 (7U connexon)
<400>62
Ala Ser Leu Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly
1 5 10 15
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp
20 25 30
Phe Ala Thr Tyr Tyr Cys Gln Gln Asp Ser Tyr Phe Pro Arg Thr Phe
35 40 45
Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
50 55
<210>63
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d31 (7U connexon)
<400>63
ccgtttgatt tccaccttgg tcccttggcc gaacgtacga ggaaaatacg aatcctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaacaagg acgcctaata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caacctaacc gattctcaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>64
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d36 (7U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>64
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att atg gat aag 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Met Asp Lys
20 25 30
tta aag tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Lys Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat tag gca tcc att ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Ala Ser Ile Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75
gaa gat ttt gct acg tac tac tgt caa cag gat agt ggg ggt cct aat 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Asp Ser Gly Gly Pro Asn
80 85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>65
<211>49
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d36 (7U connexon)
<400>65
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Met Asp Lys
20 25 30
Leu Lys Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr
<210>66
<211>58
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d36 (7U connexon)
<400>66
Ala Ser Ile Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly
1 5 10 15
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp
20 25 30
Phe Ala Thr Tyr Tyr Cys Gln Gln Asp Ser Gly Gly Pro Asn Thr Phe
35 40 45
Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
50 55
<210>67
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d36 (7U connexon)
<400>67
ccgtttgatt tccaccttgg tcccttggcc gaacgtatta ggacccccac tatcctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaaatgg atgcctaata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac cactttaact tatccataat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>68
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d37 (7U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>68
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att ggg agg aat 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Gly Arg Asn
20 25 30
tta gag tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Glu Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat gat gca tcc cat ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Asp Ala Ser His Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag tcg cgt tgg ctt cct cgt 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Trp Leu Pro Arg
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>69
<211>108
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d37 (7U connexon)
<400>69
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Gly Arg Asn
20 25 30
Leu Glu Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Asp Ala Ser His Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Trp Leu Pro Arg
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>70
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d37 (7U connexon)
<400>70
ccgtttgatt tccaccttgg tcccttggcc gaacgtacga ggaagccaac gcgactgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaatggg atgcatcata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac cactctaaat tcctcccaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>71
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d39 (7U connexon)
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>71
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att agg aag atg 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Arg Lys Met
20 25 30
tta gtt tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Val Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat cgg gca tcc tat ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Arg Ala Ser Tyr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag gct ttt cgg cgg cct agg 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Phe Arg Arg Pro Arg
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>72
<211>108
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d39 (7U connexon)
<400>72
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Arg Lys Met
20 25 30
Leu Val Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Arg Ala Ser Tyr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Phe Arg Arg Pro Arg
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>73
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR1-27d39 (7U connexon)
<400>73
ccgtttgatt tccaccttgg tcccttggcc gaacgtccta ggccgccgaa aagcctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaatagg atgcccgata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caaactaaca tcttcctaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>74
<211>345
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR2h-5
<220>
<221>CDS
<222>(1)..(345)
<223>
<400>74
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt gat ctt tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Leu Tyr
20 25 30
aat atg ttt tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Asn Met Phe Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca ttt att agt cag act ggt agg ctt aca tgg tac gca gac tcc gtg 192
Ser Phe Ile Ser Gln Thr Gly Arg Leu Thr Trp Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa acg ctg gag gat ttt gac tac tgg ggc cag gga acc ctg gtc 336
Ala Lys Thr Leu Glu Asp Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
acc gtc tcg 345
Thr Val Ser
115
<210>75
<211>115
<212>PRT
＜213〉artificial sequence
<220>
<223>TAR2h-5
<400>75
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Leu Tyr
20 25 30
Asn Met Phe Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Phe Ile Ser Gln Thr Gly Arg Leu Thr Trp Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Thr Leu Glu Asp Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser
115
<210>76
<211>345
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR2h-5
<400>76
cgagacggtg accagggttc cctggcccca gtagtcaaaa tcctccagcg ttttcgcaca 60
gtaatatacc gcggtgtcct cggcacgcag gctgttcatt tgcagataca gcgtgttctt 120
ggaattgtcg cgggagatgg tgaaccggcc cttcacggag tctgcgtacc atgtaagcct 180
accagtctga ctaataaatg agacccactc tagacccttc cctggagcct ggcggaccca 240
aaacatatta taaagatcaa aggtgaatcc ggaggctgca caggagagac gcagggaccc 300
cccaggctgt accaagcctc ccccagactc caacagctgc acctc 345
<210>77
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d1 (3U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>77
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt crc tcc tgt gca gcc tcc gga ttc acc ttt ccg gtt tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Pro Val Tyr
20 25 30
atg atg ggt tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Met Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca tcg att gat gct ctt ggt ggg cgg aca ggt tac gca gac tcc gtg 192
Ser Ser Ile Asp Ala Leu Gly Gly Arg Thr Gly Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa act atg tcg aat aag acg cat acg ttt gac tac tgg ggc cag 336
Ala Lys Thr Met Ser Asn Lys Thr His Thr Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>78
<211>119
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d1 (3U connexon)
<400>78
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Pro Val Tyr
20 25 30
Met Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ser Ile Asp Ala Leu Gly Gly Arg Thr Gly Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Thr Met Ser Asn Lys Thr His Thr Phe Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser
115
<210>79
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d1 (3U connexon)
<400>79
cgagacggtg accagggttc cctggcccca gtagtcaaac gtatgcgtct tattcgacat 60
agttttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
acctgtccgc ccaccaagag catcaatcga tgagacccac tctagaccct tccctggagc 240
ctggcggacc caacccatca tataaaccgg aaaggtgaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>80
<211>345
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d2 (3U connexon)
<220>
<221>CDS
<222>(1)..(345)
<223>
<400>80
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt gtg gct tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Val Ala Tyr
20 25 30
aat atg act tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Ash Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca agt att aat act ttt ggt aat tag aca agg tac gca gac tcc gtg 192
Ser Ser Ile Asn Thr Phe Gly Asn Thr Arg Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Ash Ser Lys Asn Thr Leu Tyr
65 70 75
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
80 85 90 95
gcg aaa ggt agt agg cct ttt gac tac tgg ggc cag gga acc ctg gtc 336
Ala Lys Gly Ser Arg Pro Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
acc gtc tcg 345
Thr Val Ser
<210>81
<211>56
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d2 (3U connexon)
<400>81
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Val Ala Tyr
20 25 30
Asn Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ser Ile Asn Thr Phe Gly Asn
50 55
<210>82
<211>58
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d2 (3U connexon)
<400>82
Thr Arg Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp
1 5 10 15
Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu
20 25 30
Asp Thr Ala Val Tyr Tyr Cys Ala Lys Gly Ser Arg Pro Phe Asp Tyr
35 40 45
Trp Gly Gln Gly Thr Leu Val Thr Val Ser
50 55
<210>83
<211>345
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d2 (3U connexon)
<400>83
cgagacggtg accagggttc cctggcccca gtagtcaaaa ggcctactac ctttcgcaca 60
gtaatatacc gcggtgtcct cggcacgcag gctgttcatt tgcagataca gcgtgttctt 120
ggaattgtcg cgggagatgg tgaaccggcc cttcacggag tctgcgtacc ttgtctaatt 180
accaaaagta ttaatacttg agacccactc tagacccttc cctggagcct ggcggaccca 240
agtcatatta taagccacaa aggtgaatcc ggaggctgca caggagagac gcagggaccc 300
cccaggctgt accaagcctc ccccagactc caacagctgc acctc 345
<210>84
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d3 (3U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>84
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt tag ggg tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Tyr
20 25 30
cgt atg ggt tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Arg Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca tgg att acg cgt act ggt ggg acg aca cag tac gca gac tcc gtg 192
Ser Trp Ile Thr Arg Thr Gly Gly Thr Thr Gln Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
80 85 90 95
gcg aaa ccg gcg aag ctt gtt ggg gtt ggg ttt gac tac tgg ggc cag 336
Ala Lys Pro Ala Lys Leu Val Gly Val Gly Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>85
<211>29
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d3 (3U connexon)
<400>85
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
20 25
<210>86
<211>89
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d3 (3U connexon)
<400>86
Gly Tyr Arg Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
1 5 10 15
Trp Val Ser Trp Ile Thr Arg Thr Gly Gly Thr Thr Gln Tyr Ala Asp
20 25 30
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr
35 40 45
Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
50 55 60
Tyr Cys Ala Lys Pro Ala Lys Leu Val Gly Val Gly Phe Asp Tyr Trp
65 70 75 80
Gly Gln Gly Thr Leu Val Thr Val Ser
85
<210>87
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d3 (3U connexon)
<400>87
cgagacggtg accagggttc cctggcccca gtagtcaaac ccaaccccaa caagcttcgc 60
cggtttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
ctgtgtcgtc ccaccagtac gcgtaatcca tgagacccac tctagaccct tccctggagc 240
ctggcggacc caacccatac gataccccta aaaggtgaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>88
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d4 (3U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>88
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt cgg aag tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Lys Tyr
20 25 30
tag atg ggg tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca cag att ggt gcg aag ggt cag tct aca gat tac gca gac tcc gtg 192
Ser Gln Ile Gly Ala Lys Gly Gln Ser Thr Asp Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
80 85 90 95
gcg aaa aag aag agg ggg gag aat tat ttt ttt gac tac tgg ggc cag 336
Ala Lys Lys Lys Arg Gly Glu Asn Tyr Phe Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>89
<211>32
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d4 (3U connexon)
<400>89
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Lys Tyr
20 25 30
<210>90
<211>86
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d4 (3U connexon)
<400>90
Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser
1 5 10 15
Gln Ile Gly Ala Lys Gly Gln Ser Thr Asp Tyr Ala Asp Ser Val Lys
20 25 30
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
35 40 45
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
50 55 60
Lys Lys Lys Arg Gly Glu Asn Tyr Phe Phe Asp Tyr Trp Gly Gln Gly
65 70 75 80
Thr Leu Val Thr Val Ser
85
<210>91
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d4 (3U connexon)
<400>91
cgagacggtg accagggttc cctggcccca gtagtcaaaa aaataattct cccccctctt 60
ctttttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
atctgtagac tgacccttcg caccaatctg tgagacccac tctagaccct tccctggagc 240
ctggcggacc caccccatct aatacttccg aaaggtgaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>92
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d5 (3U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>92
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt cgg cgg tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Arg Tyr
20 25 30
agt atg tcg tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Ser Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gat att tct cgt tct ggt cgg tat aca cat tac gca gac tcc gtg 192
Ser Asp Ile Ser Arg Ser Gly Arg Tyr Thr His Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa cgt att gat tct tct cag aat ggg ttt gac tac tgg ggc cag 336
Ala Lys Arg Ile Asp Ser Ser Gln Asn Gly Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>93
<211>119
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d5 (3U connexon)
<400>93
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Arg Tyr
20 25 30
Ser Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Asp Ile Ser Arg Ser Gly Arg Tyr Thr His Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Arg Ile Asp Ser Ser Gln Asn Gly Phe Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser
115
<210>94
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d5 (3U connexon)
<400>94
cgagacggtg accagggttc cctggcccca gtagtcaaac ccattctgag aagaatcaat 60
acgtttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
atgtgtatac cgaccagaac gagaaatatc tgagacccac tctagaccct tccctggagc 240
ctggcggacc cacgacatac tataccgccg aaaggtgaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>95
<211>345
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d6 (3U connexon)
<220>
<221>CDS
<222>(1)..(345)
<223>
<400>95
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt tag ggg tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Tyr
20 25 30
aag atg ttt tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Lys Met Phe Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gct att agt ggt agt ggt ggt agc aca tac tac gca gac tcc gtg 192
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
80 85 90 95
gcg aaa cag aag gag aat ttt gac tac tgg ggc cag gga acc ctg gtc 336
Ala Lys Gln Lys Glu Asn Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
acc gtc tcg 345
Thr Val Ser
<210>96
<211>29
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d6 (3U connexon)
<400>96
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
20 25
<210>97
<211>85
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d6 (3U connexon)
<400>97
Gly Tyr Lys Met Phe Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
1 5 10 15
Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp
20 25 30
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr
35 40 45
Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
50 55 60
Tyr Cys Ala Lys Gln Lys Glu Asn Phe Asp Tyr Trp Gly Gln Gly Thr
65 70 75 80
Leu Val Thr Val Ser
85
<210>98
<211>345
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d6 (3U connexon)
<400>98
cgagacggtg accagggttc cctggcccca gtagtcaaaa ttctccttct gtttcgcaca 60
gtaatatacc gcggtgtcct cggcacgcag gctgttcatt tgcagataca gcgtgttctt 120
ggaattgtcg cgggagatgg tgaaccggcc cttcacggag tctgcgtagt atgtgctacc 180
accactacca ctaatagctg agacccactc tagacccttc cctggagcct ggcggaccca 240
aaacatctta tacccctaaa aggtgaatcc ggaggctgca caggagagac gcagggaccc 300
cccaggctgt accaagcctc ccccagactc caacagctgc acctc 345
<210>99
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d7 (3U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>99
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt ggg gat tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Asp Tyr
20 25 30
gct atg tgg tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Ala Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gtg att agt tcg aat ggt ggg agt aca ttt tac gca gac tcc gtg 192
Ser Val Ile Ser Ser Asn Gly Gly Ser Thr Phe Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa cgt gtt cgt aag agg act cct gag ttt gac tac tgg ggc cag 336
Ala Lys Arg Val Arg Lys Arg Thr Pro Glu Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>100
<211>119
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d7 (3U connexon)
<400>100
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Asp Tyr
20 25 30
Ala Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Val Ile Ser Ser Asn Gly Gly Ser Thr Phe Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Arg Val Arg Lys Arg Thr Pro Glu Phe Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser
115
<210>101
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d7 (3U connexon)
<400>101
cgagacggtg accagggttc cctggcccca gtagtcaaac tcaggagtcc tcttacgaac 60
acgtttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
aaatgtactc ccaccattcg aactaatcac tgagacccac tctagaccct tccctggagc 240
ctggcggacc caccacatag cataatcccc aaaggtgaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>102
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d8 (3U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>102
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt agg agg tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Arg Tyr
20 25 30
aag atg ggt tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Lys Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gcg att ggg agg aat ggt acg aag aca aat tac gca gac tcc gtg 192
Ser Ala Ile Gly Arg Asn Gly Thr Lys Thr Asn Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa att tat acg ggg aag cct gct gcg ttt gac tac tgg ggc cag 336
Ala Lys Ile Tyr Thr Gly Lys Pro Ala Ala Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>103
<211>119
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d8 (3U connexon)
<400>103
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Arg Tyr
20 25 30
Lys Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Gly Arg Asn Gly Thr Lys Thr Asn Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Ile Tyr Thr Gly Lys Pro Ala Ala Phe Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser
115
<210>104
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d8 (3U connexon)
<400>104
cgagacggtg accagggttc cctggcccca gtagtcaaac gcagcaggct tccccgtata 60
aattttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
atttgtcttc gtaccattcc tcccaatcgc tgagacccac tctagaccct tccctggagc 240
ctggcggacc caacccatct tatacctcct aaaggtgaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>105
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d9 (3U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>105
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt aag aag tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Lys Lys Tyr
20 25 30
tag atg tct tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gct att agt ggt agt ggt ggt agc aca tac tac gca gac tcc gtg 192
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
80 85 90 95
gcg aaa atg ctg agg act aag aat aag gtg ttt gac tac tgg ggc cag 336
Ala Lys Met Leu Arg Thr Lys Asn Lys Val Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>106
<211>32
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d9 (3U connexon)
<400>106
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Lys Lys Tyr
20 25 30
<210>107
<211>86
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d9 (3U connexon)
<400>107
Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser
1 5 10 15
Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys
20 25 30
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu
35 40 45
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
50 55 60
Lys Met Leu Arg Thr Lys Asn Lys Val Phe Asp Tyr Trp Gly Gln Gly
65 70 75 80
Thr Leu Val Thr Val Ser
85
<210>108
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d9 (3U connexon)
<400>108
cgagacggtg accagggttc cctggcccca gtagtcaaac accttattct tagtcctcag 60
cattttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
gtatgtgcta ccaccactac cactaatagc tgagacccac tctagaccct tccctggagc 240
ctggcggacc caagacatct aatacttctt aaaggtgaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>109
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d10 (5U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>109
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt agg agg tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Arg Tyr
20 25 30
aag atg ggt tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Lys Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gcg att ggg agg aat ggt acg aag aca aat tac gca gac tcc gtg 192
Ser Ala Ile Gly Arg Asn Gly Thr Lys Thr Asn Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa att tat acg ggg aag cct gct gcg ttt gac tac tgg ggc cag 336
Ala Lys Ile Tyr Thr Gly Lys Pro Ala Ala Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>110
<211>119
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d10 (5U connexon)
<400>110
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Arg Tyr
20 25 30
Lys Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Gly Arg Asn Gly Thr Lys Thr Asn Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Ile Tyr Thr Gly Lys Pro Ala Ala Phe Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser
115
<210>111
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d10 (5U connexon)
<400>111
cgagacggtg accagggttc cctggcccca gtagtcaaac gcagcaggct tccccgtata 60
aattttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
atttgtcttc gtaccattcc tcccaatcgc tgagacccac tctagaccct tccctggagc 240
ctggcggacc caacccatct tatacctcct aaaggtgaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>112
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d11 (5U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>112
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt tag agt tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Tyr
20 25 30
cgg atg ggt tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Arg Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca agt att tcg tcg agg ggt agg cat aca tct tac gca gac tcc gtg 192
Ser Ser Ile Ser Ser Arg Gly Arg His Thr Ser Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
80 85 90 95
gcg aaa agg gtt ccg ggt cgg ggg cgt tct ttt gac tac tgg ggc cag 336
Ala Lys Arg Val Pro Gly Arg Gly Arg Ser Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>113
<211>29
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d11 (5U connexon)
<400>113
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
20 25
<210>114
<211>89
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d11 (5U connexon)
<400>114
Ser Tyr Arg Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
1 5 10 15
Trp Val Ser Ser Ile Ser Ser Arg Gly Arg His Thr Ser Tyr Ala Asp
20 25 30
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr
35 40 45
Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
50 55 60
Tyr Cys Ala Lys Arg Val Pro Gly Arg Gly Arg Ser Phe Asp Tyr Trp
65 70 75 80
Gly Gln Gly Thr Leu Val Thr Val Ser
85
<210>115
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d11 (5U connexon)
<400>115
cgagacggtg accagggttc cctggcccca gtagtcaaaa gaacgccccc gacccggaac 60
ccttttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
agatgtatgc ctacccctcg acgaaatact tgagacccac tctagaccct tccctggagc 240
ctggcggacc caacccatcc gataactcta aaaggtgaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>116
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d12 (5U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>116
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc ccc ttt cgt cgg tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Pro Phe Arg Arg Tyr
20 25 30
cgg atg agg tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Arg Met Arg Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca ggt att tct ccg ggt ggt aag cat aca acg tac gca gac tcc gtg 192
Ser Gly Ile Ser Pro Gly Gly Lys His Thr Thr Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65v70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa ggt gag ggg ggg gcg agt tct gcg ttt gac tac tgg ggc cag 336
Ala Lys Gly Glu Gly Gly Ala Ser Ser Ala Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>117
<211>119
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d12 (5U connexon)
<400>117
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Pro Phe Arg Arg Tyr
20 25 30
Arg Met Arg Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Gly Ile Ser Pro Gly Gly Lys His Thr Thr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Gly Glu Gly Gly Ala Ser Ser Ala Phe Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser
115
<210>118
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d12 (5U connexon)
<400>118
cgagacggtg accagggttc cctggcccca gtagtcaaac gcagaactcg cccccccctc 60
acctttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
cgttgtatgc ttaccacccg gagaaatacc tgagacccac tctagaccct tccctggagc 240
ctggcggacc cacctcatcc gataccgacg aaaggggaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>119
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d13 (5U connexon)
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>119
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt tag cgg tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Tyr
20 25 30
ggg atg gtt tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Gly Met Val Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gct att agt ggt agt ggt ggt agc aca tac tac gca gac tcc gtg 192
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgc gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
80 85 90 95
gcg aaa cgg cat agt tct gag gct agg cag ttt gac tac tgg ggc cag 336
Ala Lys Arg His Ser Ser Glu Ala Arg Gln Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg 357
Gly Thr Leu Val Thr Val Ser
115
<210>120
<211>29
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d13 (5U connexon)
<400>120
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
20 25
<210>121
<211>89
<212>PRT
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d13 (5U connexon)
<400>121
Arg Tyr Gly Met Val Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
1 5 10 15
Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp
20 25 30
Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr
35 40 45
Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
50 55 60
Tyr Cys Ala Lys Arg His Ser Ser Glu Ala Arg Gln Phe Asp Tyr Trp
65 70 75 80
Gly Gln Gly Thr Leu Val Thr Val Ser
85
<210>122
<211>357
<212>DNA
＜213〉artificial sequence
<220>
＜223〉mating partner dAb monomer is present in TAR2h-5d13 (5U connexon)
<400>122
cgagacggtg accagggttc cctggcccca gtagtcaaac tgcctagcct cagaactatg 60
ccgtttcgca cagtaatata ccgcggtgtc ctcggcacgc aggctgttca tttgcagata 120
cagcgtgttc ttggaattgt cgcgggagat ggtgaaccgg cccttcacgg agtctgcgta 180
gtatgtgcta ccaccactac cactaatagc tgagacccac tctagaccct tccctggagc 240
ctggcggacc caaaccatcc cataccgcta aaaggtgaat ccggaggctg cacaggagag 300
acgcagggac cccccaggct gtaccaagcc tcccccagac tccaacagct gcacctc 357
<210>123
<211>720
<212>DNA
＜213〉artificial sequence
<220>
＜223〉bi-specific antibody
<220>
<221>CDS
<222>(1)..(720)
<223>
<400>123
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg aga ctc tcc tgt gca gcc tct gga ttc acc ttt agc agc tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
gcc atg agc tgg gtc cgc cag gct cca ggg aag ggg ctg gag tgg gtc 144
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gct att agt ggt agt ggt ggt agc aca tac tac gca gac tcc gtg 192
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg aga gcc gag gac acg gcc gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa agt tat ggt gct ttt gac tac tgg ggc cag gga acc ctg gtc 336
Ala Lys Ser Tyr Gly Ala Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
acc gtc tcg agc ggt gga ggc ggt tca ggc gga ggt ggc agc ggc ggt 384
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125
ggc ggg tcg acg gac atc cag atg acc cag tct cca tcc tcc ctg tct 432
Gly Gly Ser Thr Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser
130 135 140
gca tct gta gga gac aga gtc acc atc act tgc cgg gca agt cag agc 480
Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser
145 150 155 160
att agc agc tat tta aat tgg tat cag cag aaa cca ggg aaa gcc cct 528
Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro
165 170 175
aag ctc ctg atc tat gct gca tcc agt ttg caa agt ggg gtc cca tca 576
Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser
180 185 190
agg ttc agt ggc agt gga tct ggg aca gat ttc act ctc acc atc agc 624
Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
195 200 205
agt ctg caa cct gaa gat ttt gca act tac tac tgt caa cag agt tac 672
Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr
210 215 220
agt acc cct aat acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 720
Ser Thr Pro Asn Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
225 230 235 240
<210>124
<211>240
<212>PRT
＜213〉artificial sequence
<220>
＜223〉bi-specific antibody
<400>124
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Ser Tyr Gly Ala Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
115 120 125
Gly Gly Ser Thr Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser
130 135 140
Ala Ser Val Gly Asp Arg Val Thr lle Thr Cys Arg Ala Ser Gln Ser
145 150 155 160
lle Ser Ser Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro
165 170 175
Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser
180 185 190
Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser
195 200 205
Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr
210 215 220
Ser Thr Pro Asn Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
225 230 235 240
<210>125
<211>332
<212>DNA
＜213〉artificial sequence
<220>
＜223〉be present in variable region in carrier 1 and 2
<220>
<221>CDS
<222>(69)..(332)
<223>
<400>125
caggaaacag ctatgaccat gattacgcca agcttgcatg caaattctat ttcaaggaga 60
cagtcata atg aaa tac cta ttg cct acg gca gcc gct gga ttg tta tta 110
Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu
1 5 10
ctc gcg gcc cag ccg gcc atg gcc gag gtg ttt gac tac tgg ggc cag 158
Leu Ala Ala Gln Pro Ala Met Ala Glu Val Phe Asp Tyr Trp Gly Gln
15 20 25 30
gga acc ctg gtc acc gtc tcg agc ggt gga ggc ggt tca ggc gga ggt 206
Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly
35 40 45
ggc agc ggc ggt ggc ggg tcg acg gac atc cag atg acc cag gcg gcc 254
Gly Ser Gly Gly Gly Gly Ser Thr Asp Ile Gln Met Thr Gln Ala Ala
50 55 60
gca gaa caa aaa ctc atc tca gaa gag gat ctg aat ggg gcc gca tag 302
Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Gly Ala Ala
65 70 75
act gtt gaa agt tgt tta gca aaa cct cat 332
Thr Val Glu Ser Cys Leu Ala Lys Pro His
80 85
<210>126
<211>77
<212>PRT
＜213〉artificial sequence
<220>
＜223〉be present in variable region in carrier 1 and 2
<400>126
Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala
1 5 10 15
Ala Gln Pro Ala Met Ala Glu Val Phe Asp Tyr Trp Gly Gln Gly Thr
20 25 30
Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
35 40 45
Gly Gly Gly Gly Ser Thr Asp Ile Gln Met Thr Gln Ala Ala Ala Glu
50 55 60
Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Gly Ala Ala
65 70 75
<210>127
<211>10
<212>PRT
＜213〉artificial sequence
<220>
＜223〉be present in variable region in carrier 1 and 2
<400>127
Thr Val Glu Ser Cys Leu Ala Lys Pro His
1 5 10
<210>128
<211>27
<212>DNA
＜213〉artificial sequence
<220>
＜223〉only insert at V district carrier 2
<220>
<221>CDS
<222>(1)..(27)
<223>
<400>128
cat cat cat cac cat cac ggg gcc gca 27
His His His His His His Gly Ala Ala
1 5
<210>129
<211>9
<212>PRT
＜213〉artificial sequence
<220>
＜223〉only insert at V district carrier 2
<400>129
His His His His His His Gly Ala Ala
1 5
<210>130
<211>116
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain K8
<400>130
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser His Ile Ser Pro Tyr Gly Ala Asn Thr Arg Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Gly Leu Arg Ala Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser Ser
115
<210>131
<211>116
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain VH2
<400>131
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Asp Ile Gly Ala Thr Gly Ser Lys Thr Gly Tyr Ala Asp Pro Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Lys Val Leu Thr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser Ser
115
<210>132
<211>55
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain VH4
<400>132
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Arg Ile Asn Gly Pro Gly
50 55
<210>133
<211>60
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain VH4
<400>133
Ala Thr Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg
1 5 10 15
Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Ile Asn Ser Leu Arg Ala
20 25 30
Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys His Gly Ala Pro Phe Asp
35 40 45
Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser
50 55 60
<210>134
<211>116
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain VHC11
<400>134
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ser Ile Pro Ala Ser Gly Leu His Thr Arg Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Pro Gly Leu Gly Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser Ser
115
<210>135
<211>56
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain VHA10sd
<400>135
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Asp Ile Glu Arg Thr Gly Tyr
50 55
<210>136
<211>59
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain VHA10sd
<400>136
Thr Arg Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp
1 5 10 15
Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu
20 25 30
Asp Thr Ala Val Tyr Tyr Cys Ala Lys Lys Val Leu Val Phe Asp Tyr
35 40 45
Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser
50 55
<210>137
<211>116
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain VHA1sd
<400>137
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Glu Ile Ser Ala Asn Gly Ser Lys Thr Gln Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Leu Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Lys Val Leu Gln Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser Ser
115
<210>138
<211>55
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain vha5sd
<400>138
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Thr Ile Pro Ala Asn Gly
50 55
<210>139
<211>60
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain VHA5sd
<400>139
Val Thr Arg Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg
1 5 10 15
Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala
20 25 30
Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Ser Leu Leu Gln Phe Asp
35 40 45
Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser
50 55 60
<210>140
<211>116
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain VHC5sd
<400>140
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Asp Ile Ala Ala Thr Gly Ser Ala Thr Ser Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Lys Ile Leu Lys Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser Ser
115
<210>141
<211>116
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH chain VHC11sd
<400>141
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Thr Ile Ser Ser Val Gly Gln Ser Thr Arg Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Asn Leu Met Ser Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser Ser
115
<210>142
<211>108
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Vkappa chain K8
<400>142
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Arg Ala Ser His Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Pro Trp Arg Ser Pro Gly
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>143
<211>108
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Vkappa chain E5sd
<400>143
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Leu Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Asn Trp Trp Leu Pro Pro
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>144
<211>49
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Vkappa chain C3
<400>144
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr
<210>145
<211>58
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Vkappa chain C3
<400>145
Ala Ser Leu Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly
1 5 10 15
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp
20 25 30
Phe Ala Thr Tyr Tyr Cys Gln Gln Arg Val Tyr Asp Pro Leu Thr Phe
35 40 45
Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
50 55
<210>146
<211>348
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the simulation VH sequence in library 1
<220>
<221>CDS
<222>(1)..(348)
<223>
<400>146
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt agc agc tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
gcc atg agc tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gct att agt ggt agt ggt ggt agc aca tac tac gca gac tcc gtg 192
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgt gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa agt tat ggt gct ttt gac tac tgg ggc cag gga acc ctg gtc 336
Ala Lys Ser Tyr Gly Ala Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
acc gtc tcg agc 348
Thr Val Ser Ser
115
<210>147
<211>116
<212>PRT
＜213〉artificial sequence
<220>
＜223〉the simulation VH sequence in library 1
<400>147
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Ser Tyr Gly Ala Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser Ser
115
<210>148
<211>348
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the simulation VH sequence in library 1
<400>148
gctcgagacg gtgaccaggg ttccctggcc ccagtagtca aaagcaccat aacttttcgc 60
acagtaatat accgcggtgt cctcggcacg caggctgttc atttgcagat acagcgtgtt 120
cttggaattg tcacgggaga tggtgaaccg gcccttcacg gagtctgcgt agtatgtgct 180
accaccacta ccactaatag ctgagaccca ctctagaccc ttccctggag cctggcggac 240
ccagctcatg gcatagctgc taaaggtgaa tccggaggct gcacaggaga gacgcaggga 300
ccccccaggc tgtaccaagc ctcccccaga ctccaacagc tgcacctc 348
<210>149
<211>360
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the simulation VH sequence in library 2
<220>
<221>CDS
<222>(1)..(360)
<223>
<220>
<221>misc_feature
<222>(307)..(308)
＜223〉n=a or t or c or g
<220>
<221>misc_feature
<222>(310)..(311)
＜223〉n=a or t or c or g
<220>
<221>misc_feature
<222>(313)..(314)
＜223〉n=a or t or c or g
<220>
<221>misc_feature
<222>(316)..(317)
＜223〉n=a or t or c or g
<400>149
gag gtg cag ctg ttg gag tct ggg gga ggc ttg gta cag cct ggg ggg 48
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
tcc ctg cgt ctc tcc tgt gca gcc tcc gga ttc acc ttt agc agc tat 96
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
gcc atg agc tgg gtc cgc cag gct cca ggg aag ggt cta gag tgg gtc 144
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
tca gct att agt ggt agt ggt ggt agc aca tac tac gca gac tcc gtg 192
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
aag ggc cgg ttc acc atc tcc cgt gac aat tcc aag aac acg ctg tat 240
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
ctg caa atg aac agc ctg cgt gcc gag gac acc gcg gta tat tac tgt 288
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
gcg aaa agt tat ggt gct nnk nnk nnk nnk ttt gac tac tgg ggc cag 336
Ala Lys Ser Tyr Gly Ala Xaa Xaa Xaa Xaa Phe Asp Tyr Trp Gly Gln
100 105 110
gga acc ctg gtc acc gtc tcg agc 360
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>150
<211>120
<212>PRT
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(103)..(103)
＜223〉in the position 103 places exist by the nnk coding ' Xaa ', this nnk encode all amino acid and TAG codon
<220>
<221>misc_feature
<222>(104)..(104)
＜223〉in the position 104 places exist by the nnk coding ' Xaa ', this nnk encode all amino acid and TAG codon
<220>
<221>misc_feature
<222>(105)..(105)
＜223〉in the position 105 places exist by the nnk coding ' Xaa ', this nnk encode all amino acid and TAG codon
<220>
<221>misc_feature
<222>(106)..(106)
＜223〉in the position 106 places exist by the nnk coding ' Xaa ', this nnk encode all amino acid and TAG codon
<220>
＜223〉the simulation VH sequence in library 2
<400>150
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Ser Tyr Gly Ala Xaa Xaa Xaa Xaa Phe Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>151
<211>360
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the simulation VH sequence in library 2
<220>
<221>misc_feature
<222>(44)..(45)
＜223〉n=a or t or c or g
<220>
<221>misc_feature
<222>(47)..(48)
＜223〉n=a or t or c or g
<220>
<221>misc_feature
<222>(50)..(51)
＜223〉n=a or t or c or g
<220>
<221>misc_feature
<222>(53)..(54)
＜223〉n=a or t or c or g
<400>151
gctcgagacg gtgaccaggg ttccctggcc ccagtagtca aaknnknnkn nknnagcacc 60
ataacttttc gcacagtaat ataccgcggt gtcctcggca cgcaggctgt tcatttgcag 120
atacagcgtg ttcttggaat tgtcacggga gatggtgaac cggcccttca cggagtctgc 180
gtagtatgtg ctaccaccac taccactaat agctgagacc cactctagac ccttccctgg 240
agcctggcgg acccagctca tggcatagct gctaaaggtg aatccggagg ctgcacagga 300
gagacgcagg gaccccccag gctgtaccaa gcctccccca gactccaaca gctgcacctc 360
<210>152
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the simulation V κ sequence in storehouse 3
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>152
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att agc agc tat 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr
20 25 30
tta aat tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat gct gca tcc agt ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag agt tac agt acc cct aat 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro Asn
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>153
<211>108
<212>PRT
＜213〉artificial sequence
<220>
＜223〉the simulation V κ sequence in storehouse 3
<400>153
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro Asn
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>154
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉the simulation V κ sequence in storehouse 3
<400>154
ccgtttgatt tccaccttgg tcccttggcc gaacgtatta ggggtactgt aactctgttg 60
acagtagtac gtagcaaaat cttcaggttg cagactgctg atggtgagag tgaaatctgt 120
cccagatcca ctgccactga aacgtgatgg gaccccactt tgcaaactgg atgcagcata 180
gatcaggagc ttaggggctt tccctggttt ctgctggtac caatttaaat agctgctaat 240
gctctgactt gcccggcaag tgatggtgac acggtctcct acagatgcag acagggagga 300
tggagactgg gtcatctgga tgtc 324
<210>155
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉anti-MSA dAb MSA 16
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>155
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att att aag cat 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ile Lys His
20 25 30
tta aag tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Lys Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat ggt gca tcc cgg ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Gly Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag ggg gct cgg tgg cct cag 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Arg Trp Pro Gln
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>156
<211>108
<212>PRT
＜213〉artificial sequence
<220>
＜223〉anti-MSA dAb MSA 16
<400>156
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ile Lys His
20 25 30
Leu Lys Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Gly Ala Ser Arg Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ala Arg Trp Pro Gln
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>157
<211>324
<212>DNA
＜213〉artificial sequence
<220>
＜223〉anti-MSA dAb MSA 26
<220>
<221>CDS
<222>(1)..(324)
<223>
<400>157
gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta gga 48
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
gac cgt gtc acc atc act tgc cgg gca agt cag agc att tat tat cat 96
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Tyr Tyr His
20 25 30
tta aag tgg tac cag cag aaa cca ggg aaa gcc cct aag ctc ctg atc 144
Leu Lys Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
tat aag gca tcc acg ttg caa agt ggg gtc cca tca cgt ttc agt ggc 192
Tyr Lys Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
agt gga tct ggg aca gat ttc act ctc acc atc agc agt ctg caa cct 240
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
gaa gat ttt gct acg tac tac tgt caa cag gtt cgg aag gtg cct cgg 288
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val Arg Lys Val Pro Arg
85 90 95
acg ttc ggc caa ggg acc aag gtg gaa atc aaa cgg 324
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>158
<211>108
<212>PRT
＜213〉artificial sequence
<220>
＜223〉anti-MSA dAb MSA 26
<400>158
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Tyr Tyr His
20 25 30
Leu Lys Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Lys Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val Arg Lys Val Pro Arg
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>159
<211>5
<212>PRT
＜213〉artificial sequence
<220>
＜223〉polypeptide connexon
<400>159
Gly Gly Gly Gly Ser
1 5
<210>160
<211>10
<212>PRT
＜213〉artificial sequence
<220>
＜223〉polypeptide connexon
<400>160
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10
<210>161
<211>15
<212>PRT
＜213〉artificial sequence
<220>
＜223〉polypeptide connexon
<400>161
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10 15
<210>162
<211>20
<212>PRT
＜213〉artificial sequence
<220>
＜223〉polypeptide connexon
<400>162
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
1 5 10 15
Gly Gly Gly Ser
20
<210>163
<211>25
<212>PRT
＜213〉artificial sequence
<220>
＜223〉polypeptide connexon
<400>163
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
1 5 10 15
Gly Gly Gly Ser Gly Gly Gly Gly Ser
20 25
<210>164
<211>30
<212>PRT
＜213〉artificial sequence
<220>
＜223〉polypeptide connexon
<400>164
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
1 5 10 15
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
20 25 30
<210>165
<211>35
<212>PRT
＜213〉artificial sequence
<220>
＜223〉polypeptide connexon
<400>165
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
1 5 10 15
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
20 25 30
Gly Gly Ser
35
<210>166
<211>40
<212>PRT
＜213〉artificial sequence
<220>
＜223〉polypeptide connexon
<400>166
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
1 5 10 15
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
20 25 30
Gly Gly Ser Gly Gly Gly Gly Ser
35 40
<210>167
<211>45
<212>PRT
＜213〉artificial sequence
<220>
＜223〉polypeptide connexon
<400>167
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
1 5 10 15
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
20 25 30
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
35 40 45
<210>168
<211>50
<212>PRT
＜213〉artificial sequence
<220>
＜223〉polypeptide connexon
<400>168
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
1 5 10 15
Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly
20 25 30
Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly
35 40 45
Gly Ser
50
<210>169
<211>22
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>169
cggccatggc gtcaacggac at 22
<210>170
<211>23
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>170
atgtgcgctc gagcgtttga ttt 23
<210>171
<211>15
<212>PRT
＜213〉artificial sequence
<220>
＜223〉human IgG C1 hinge modified forms
<400>171
Glu Pro Lys Ser Gly Asp Lys Thr His Thr Cys Pro Pro Cys Pro
1 5 10 15
<210>172
<211>357
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR1-5-19CYS
<220>
<221>CDS
<222>(1)..(357)
<223>
<400>172
tgg agc gcg tcg acg gac atc cag atg acc cag tct cca tcc tct ctg 48
Trp Ser Ala Ser Thr Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
1 5 10 15
tct gca tct gta gga gac cgt gtc acc atc act tgc cgg gca agt cag 96
Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
20 25 30
agc att gat agt tat tta cat tgg tac cag cag aaa cca ggg aaa gcc 144
Ser Ile Asp Ser Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala
35 40 45
cct aag ctc ctg atc tat agt gca tcc gag ttg caa agt ggg gtc cca 192
Pro Lys Leu Leu Ile Tyr Ser Ala Ser Glu Leu Gln Ser Gly Val Pro
50 55 60
tca cgt ttc agt ggc agt gga tct ggg aca gat ttc act ctc acc atc 240
Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
65 70 75 80
agc agt ctg caa cct gaa gat ttt gct acg tac tac tgt caa cag gtt 288
Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val
85 90 95
gtg tgg cgt cct ttt acg ttc ggc caa ggg acc aag gtg gaa atc aaa 336
Val Trp Arg Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys
100 105 110
cgg tgc taa taa gga tcc ggc 357
Arg Cys Gly Ser Gly
115
<210>173
<211>114
<212>PRT
＜213〉artificial sequence
<220>
<223>TAR1-5-19CYS
<400>173
Trp Ser Ala Ser Thr Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
1 5 10 15
Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
20 25 30
Ser Ile Asp Ser Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala
35 40 45
Pro Lys Leu Leu Ile Tyr Ser Ala Ser Glu Leu Gln Ser Gly Val Pro
50 55 60
Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
65 70 75 80
Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Val
85 90 95
Val Trp Arg Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys
100 105 110
Arg Cys
<210>174
<211>357
<212>DNA
＜213〉artificial sequence
<220>
<223>TAR1-5-19CYS
<400>174
gccggatcct tattagcacc gtttgatttc caccttggtc ccttggccga acgtaaaagg 60
acgccacaca acctgttgac agtagtacgt agcaaaatct tcaggttgca gactgctgat 120
ggtgagagtg aaatctgtcc cagatccact gccactgaaa cgtgatggga ccccactttg 180
caactcggat gcactataga tcaggagctt aggggctttc cctggtttct gctggtacca 240
atgtaaataa ctatcaatgc tctgacttgc ccggcaagtg atggtgacac ggtctcctac 300
agatgcagac agagaggatg gagactgggt catctggatg tccgtcgacg cgctcca 357
<210>175
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>175
tggagcgcgt cgacggacat ccagatgacc cagtctcca 39
<210>176
<211>39
<212>DNA
＜213〉artificial sequence
<220>
＜223〉primer
<400>176
ttagcagccg gatccttatt agcaccgttt gatttccac 39
<210>177
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>VκCDR1
<400>177
Ser Ser Tyr Leu Asn
1 5
<210>178
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>178
Phe Lys Ser Leu Lys
1 5
<210>179
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>179
Tyr Tyr His Leu Lys
1 5
<210>180
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>180
Arg Arg Tyr Leu Lys
1 5
<210>181
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>181
Tyr Asn Trp Leu Lys
1 5
<210>182
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>182
Leu Trp His Leu Arg
1 5
<210>183
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>183
Phe Arg Tyr Leu Ala
1 5
<210>184
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>184
Phe Tyr His Leu Ala
1 5
<210>185
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>185
Ile Trp His Leu Asn
1 5
<210>186
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>186
Tyr Arg Tyr Leu Arg
1 5
<210>187
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>187
Leu Lys Tyr Leu Lys
1 5
<210>188
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>188
Leu Arg Tyr Leu Arg
1 5
<210>189
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>189
Leu Arg Ser Leu Lys
1 5
<210>190
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>190
Phe Arg His Leu Lys
1 5
<210>191
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>191
Arg Lys Tyr Leu Arg
1 5
<210>192
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>192
Arg Arg Tyr Leu Asn
1 5
<210>193
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>193
Ile Lys His Leu Lys
1 5
<210>194
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR1
<400>194
Tyr Lys His Leu Lys
1 5
<210>195
<211>6
<212>PRT
＜213〉artificial sequence
<220>
<223>VH CDR1
<400>195
Trp Val Tyr Gln Met Asp
1 5
<210>196
<211>6
<212>PRT
＜213〉artificial sequence
<220>
<223>VH CDR1
<400>196
Trp Ser Tyr Gln Met Thr
1 5
<210>197
<211>7
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Vkappa simulation CDR2
<220>
<221>MISC_FEATURE
<222>(1)..(1)
＜223〉by the Xaa of nnk coding, nnk encode whole amino acid and TAG codon
<220>
<221>MISC_FEATURE
<222>(4)..(4)
＜223〉by the Xaa of nnk coding, nnk encode whole amino acid and TAG codon
<400>197
Xaa Ala Ser Xaa Leu Gln Ser
1 5
<210>198
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>198
Arg Ala Ser Pro Leu Gln Ser
1 5
<210>199
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>199
Asn Ala Ser Tyr Leu Gln Ser
1 5
<210>200
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>200
Lys Ala Ser Thr Leu Gln Ser
1 5
<210>201
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>201
Gln Ala Ser Val Leu Gln Ser
1 5
<210>202
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>202
Arg Ala Ser Ser Leu Gln Ser
1 5
<210>203
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>203
His Ala Ser Leu Leu Gln Ser
1 5
<210>204
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>204
His Ala Ser His Leu Gln Ser
1 5
<210>205
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>205
Pro Ala Ser Lys Leu Gln Ser
1 5
<210>206
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>206
Arg Ala Ser Arg Leu Gln Ser
1 5
<210>207
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>207
Lys Ala Ser Ser Leu Gln Ser
1 5
<210>208
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>208
Asn Ala Ser His Leu Gln Ser
1 5
<210>209
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>209
Lys A1a Ser Trp Leu Gln Ser
1 5
<210>210
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>210
Ala Ala Ser Arg Leu Gln Ser
1 5
<210>211
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>211
Thr Ala Ser Ser Leu Gln Ser
1 5
<210>212
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>212
Ala Ala Ser Ser Leu Gln Ser
1 5
<210>213
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR2
<400>213
Gly Ala Ser Arg Leu Gln Ser
1 5
<210>214
<211>17
<212>PRT
＜213〉artificial sequence
<220>
＜223〉VH simulation CDR2
<220>
<221>MISC_FEATURE
<222>(1)..(1)
＜223〉by the Xaa of nnk coding, nnk encode whole amino acid and TAG codon
<220>
<221>MISC_FEATURE
<222>(3)..(5)
＜223〉by the Xaa of nnk coding, nnk encode whole amino acid and TAG codon
<220>
<221>MISC_FEATURE
<222>(7)..(8)
＜223〉by the Xaa of nnk coding, nnk encode whole amino acid and TAG codon
<220>
<221>MISC_FEATURE
<222>(10)..(10)
＜223〉by the Xaa of nnk coding, nnk encode whole amino acid and TAG codon
<400>214
Xaa Ile Xaa Xaa Xaa Gly Xaa Xaa Thr Xaa Tyr Ala Asp Ser Val Lys
1 5 10 15
Gly
<210>215
<211>17
<212>PRT
＜213〉artificial sequence
<220>
<223>VH CDR2
<400>215
Ser Ile Ser Ala Phe Gly Ala Lys Thr Leu Tyr Ala Asp Ser Val Lys
1 5 10 15
Gly
<210>216
<211>17
<212>PRT
＜213〉artificial sequence
<220>
<223>VH CDR2
<400>216
Ser Ile Ser Ser Phe Gly Ser Ser Thr Leu Tyr Ala Asp Ser Val Lys
1 5 10 15
Gly
<210>217
<211>9
<212>PRT
＜213〉artificial sequence
<220>
＜223〉Vkappa simulation CDR3
<220>
<221>MISC_FEATURE
<222>(3)..(6)
＜223〉by the Xaa of nnk coding, nnk encode whole amino acid and TAG codon
<220>
<221>MISC_FEATURE
<222>(8)..(8)
＜223〉by the Xaa of nnk coding, nnk encode whole amino acid and TAG codon
<400>217
Gln Gln Xaa Xaa Xaa Xaa Pro Xaa Thr
1 5
<210>218
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>218
Gln Gln Thr Tyr Ser Val Pro Pro Thr
1 5
<210>219
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>219
Gln Gln Thr Tyr Arg Ile Pro Pro Thr
1 5
<210>220
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>220
Gln Gln Val Val Tyr Trp Pro Val Thr
1 5
<210>221
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>221
Gln Gln Val Arg Lys Val Pro Arg Thr
1 5
<210>222
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>222
Gln Gln Gly Leu Tyr Pro Pro Ile Thr
1 5
<210>223
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>223
Gln Gln Asn Val Val Ile Pro Arg Thr
1 5
<210>224
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>224
Gln Gln Ser Ala Val Tyr Pro Lys Thr
1 5
<210>225
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>225
Gln Gln Arg Leu Leu Tyr Pro Lys Thr
1 5
<210>226
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>226
Gln Gln Arg Ala Arg Trp Pro Arg Thr
1 5
<210>227
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>227
Gln Gln Val Ala Arg Val Pro Arg Thr
1 5
<210>228
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>228
Gln Gln Tyr Val Gly Tyr Pro Arg Thr
1 5
<210>229
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>229
Gln Gln Thr Thr Tyr Tyr Pro Ile Thr
1 5
<210>230
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>230
Gln Gln Val Leu Tyr Tyr Pro Gln Thr
1 5
<210>231
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>231
Gln Gln Val Val Tyr Trp Pro Ala Thr
1 5
<210>232
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>232
Gln Gln Val Ala Leu Tyr Pro Lys Thr
1 5
<210>233
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>233
Gln Gln Asn Leu Phe Trp Pro Arg Thr
1 5
<210>234
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>234
Gln Gln Met Leu Phe Tyr Pro Lys Thr
1 5
<210>235
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>235
Gln Gln Gly Ala Arg Trp Pro Gln Thr
1 5
<210>236
<211>9
<212>PRT
＜213〉artificial sequence
<220>
<223>Vkappa CDR3
<400>236
Gln Gln Val Gly Arg Tyr Pro Lys Thr
1 5
<210>237
<211>7
<212>PRT
＜213〉artificial sequence
<220>
<223>VH CDR3
<400>237
Leu Ser Gly Lys Phe Asp Tyr
1 5
<210>238
<211>11
<212>PRT
＜213〉artificial sequence
<220>
<223>VH CDR3
<400>238
Gly Arg Asp His Asn Tyr Ser Leu Phe Asp Tyr
1 5 10
<210>239
<211>27
<212>DNA
＜213〉artificial sequence
<220>
＜223〉HA mark
<400>239
tatccttatg atgttcctga ttatgca 27
<210>240
<211>9
<212>PRT
＜213〉artificial sequence
<220>
＜223〉HA mark
<400>240
Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
1 5

Claims (68)

1. dual specific part, it comprises the single variable region of first immunoglobulin (Ig) and the complementary that have first epi-position or antigenic binding specificity has second epi-position or antigenic in conjunction with the single variable region of active second immunoglobulin (Ig), one of wherein said antigen or epi-position or both bring into play the effect that prolongs the transformation period in the part body, and wherein said first and second variable regions shortage has mutually homospecific common complementary district, and condition is that described dual specific part is not by anti--HSA V HDistrict and anti--beta galactosidase enzyme V κ district form.
2. the dual specific part of claim 1, it comprises an one antibody heavy chain variable region and the one antibody chain variable region of complementary at least, cause these two zones can in conjunction with and formation complementary V H/ V LRight.
3. the dual specific part of claim 2, V wherein HAnd V LProvide by the antibody scFv fragment.
4. the dual specific part of claim 2, V wherein HAnd V LThe district provides by monoclonal antibody.
5. chain IgG immunoglobulin (Ig) part, it comprises the dual specific part in the claim 2.
6. four chain IgG immunoglobulin (Ig) parts of claim 5, wherein said IgG comprises two dual specific parts, and described dual specific part is identical in their variable region.
7. four chain IgG immunoglobulin (Ig) parts of claim 5, wherein said IgG comprises two dual specific parts, and described dual specific part is different in their variable region.
8. the part of aforementioned each claim, the first and second epi-position independence combinations wherein cause the dual specific part can be simultaneously in conjunction with first and second epi-positions or antigen.
9. the part in the claim 8, dual specific part wherein are included in balanced first kind of form and second kind of form that exists in the solution, and two kinds of epi-positions wherein or antigen is all independently in conjunction with first kind of form, but the combining of competition and second kind of form.
10. the part of aforementioned each claim, variable region wherein is derived from described epi-position or antigenic immunoglobulin (Ig).
11. the part of aforementioned each claim, wherein said first and second epi-positions are present on the different antigen.
12. the part of any one claim among the claim 1-8, wherein said first and second epi-positions are present on the identical antigen.
13. the part of aforementioned each claim, it comprises the variable region that is derived from storehouse, single antibody function territory.
14. the part in the claim 13, wherein said storehouse is showed in the filobactivirus surface, and single antibody function territory is wherein selected with antigenic the combination by phage library.
15. the part of aforementioned each claim, wherein the sequence of at least one variable region is through sudden change or DNA reorganization modified.
16. the dual specific part of aforementioned each claim, wherein said variable region right and wrong are covalently bound.
17. the dual specific part of any one claim among the claim 1-15, variable region wherein is covalently bound.
18. the dual specific part in the claim 17, covalent attachment wherein mediates by disulfide linkage.
19. the part of any one claim among the claim 1-18, it comprises the dAb monomer part of TNF alpha specific, its dissociation constant with 50nM to 20pM (Kd) and 5 * 10 -1To 1 * 10 -7S -1K OffRate constant and human TNF alpha dissociate, and this draws surely by surface plasmon resonance measurement.
20. the part in the claim 19, dAb wherein are V κ.
21.TNF the specific dAb monomer of acceptor 1 (p55) part, it is with the dissociation constant (K of 50nM to 20pM d) and 5 * 10 -1To 1 * 10 -7S -1K OffRate constant and people TNF acceptor 1 dissociate, and this draws surely by surface plasmon resonance measurement.
22. the part among the claim 19-21, monomer wherein in the standard cell lines assay method with among the ND50 of 500nM to 50pM and human TNF alpha or TNF acceptor 1.
23. the part of any one claim among the claim 1-18, it comprises the specific dAb monomer of TNF acceptor 1 (p55) part, dAb wherein in the standard cell lines assay method with the activity of the ND50 antagonism TNF acceptor 1 of≤100nM, and dAb in this assay method the concentration of≤10 μ M stimulate TNF acceptor 1 activity reach≤5%.
24. the part of any one claim among the claim 1-18, it comprises the specific dAb monomer of serum albumin (SA) part, and its dissociation constant with 1nM to 500 μ M (Kd) is dissociated with SA, and this draws surely by surface plasmon resonance measurement.
25. the part in the claim 24, monomer wherein in standard part binding assay with the IC50 of 1nM to 500 μ M in conjunction with SA.
26. the part of any one claim among the claim 1-18, it comprises the dAb monomer part of TNF alpha specific, wherein dAb comprise TAR1-5-19 aminoacid sequence or with its at least 80% homologous sequence.
27. the part of any one claim among the claim 1-18, it comprises the dAb monomer part of TNF alpha specific, wherein dAb comprise TAR1-5 aminoacid sequence or with its at least 80% homologous sequence.
28. the part of any one claim among the claim 1-18, it comprises the dAb monomer part of TNF alpha specific, wherein dAb comprise TAR1-27 aminoacid sequence or with its at least 80% homologous sequence.
29. the part of any one claim among the claim 1-18, it comprises TNF acceptor 1 specific dAb monomer part, wherein dAb comprise TAR2-10 aminoacid sequence or with its at least 80% homologous sequence.
30. the part of any one claim among the claim 1-18, it comprises TNF acceptor 1 specific dAb monomer part, wherein dAb comprise TAR2-10 aminoacid sequence or with its at least 90% homologous sequence.
31. the part of any one claim among the claim 1-18, it comprises TNF acceptor 1 specific dAb monomer part, wherein dAb comprise TAR2-5 aminoacid sequence or with its at least 80% homologous sequence.
32. the part of any one claim among the claim 1-18, it comprises TNF acceptor 1 specific dAb monomer part, wherein dAb comprise TAR2-5 aminoacid sequence or with its at least 90% homologous sequence.
33. the part of any one claim among the claim 1-18, it comprises the specific dAb monomer of SA part, wherein dAb comprise MSA-16 aminoacid sequence or with its at least 80% homologous sequence.
34. the part of any one claim among the claim 1-18, it comprises the specific dAb monomer of SA part, wherein dAb comprise MSA-26 aminoacid sequence or with its at least 80% homologous sequence.
35. the part of any one claim among the claim 26-34, wherein TNF α, TNF acceptor 1 or SA are the forms in people source.
36. the part of any one claim among the claim 1-18, it comprises the dAb monomer, and this dAb monomer comprises terminal Cys residue.
37. the part of any one claim among the claim 26-35, it also comprises terminal Cys residue.
38. the dual specific part of claim 1, it is a dimer.
39. the dual specific part of claim 1, dimer wherein comprise anti-human TNF alpha dAb and anti-SAdAb.
40. the dual specific part in the claim 1, it is a tripolymer.
41. the part of aforementioned each claim, it comprises general framework.
42. the part in the claim 41, general framework wherein comprises the V that is selected from DP47, DP45 and DP38 HFramework; And/or V LFramework is DPK9.
43. the part of aforementioned each claim, it comprises the binding site that belongs to the class part.
44. the part in the claim 43, genus class ligand-binding site point wherein is selected from albumin A, albumen L and Protein G.
45. the part of aforementioned each claim, part wherein comprises the variable region with one or more framework regions, it is the same aminoacid sequence in respective frame district of antibody gene fragment coding that described framework region comprises with ethnic group, and perhaps the aminoacid sequence integral body of described one or more framework regions comprises 5 of as many as and is different from the amino acid of aminoacid sequence that ethnic group is the respective frame district of antibody gene fragment coding.
46. the part of any one claim among the claim 1-45, part wherein comprises the variable region, wherein the aminoacid sequence of FW1, FW2, FW3 and FW4 and ethnic group are that the aminoacid sequence in respective frame district of antibody gene fragment coding is identical, and perhaps the aminoacid sequence integral body of FW1, FW2, FW3 and FW4 comprises 10 of as many as and is different from the amino acid of aminoacid sequence that described ethnic group is the respective frame district of antibody gene fragment coding.
47. the part of claim 45 or 46, it comprises the antibody variable region that contains FW1, FW2 and FW3 zone, and the aminoacid sequence of described FW1, FW2 and FW3 and ethnic group are that the aminoacid sequence in respective frame district of antibody gene fragment coding is identical.
48. each part of claim 45-47, wherein said ethnic group is that the antibody gene fragment is selected from DP47, DP45, DP48 and DPK9.
49. the part of aforementioned each claim, it comprises V HThe district, this district is not the Camelid immune globulin variable region.
50. the part in the claim 49, it comprises V HThe district, this district does not comprise the V with the people HIt is special one or more amino acid that the district compares the Camelid immune globulin variable region.
51. method for preparing the part in the claim 1, this part comprises the single variable region of first immune globulin with first binding specificity and has the single variable region of second immunoglobulin (Ig) of second binding specificity, one of described binding specificity or both are specificitys at prolonging the proteinic of transformation period in the part body, this method comprises the steps: that (a) is according to selecting first variable region with the first epi-position bonded ability, (b) according to selecting second variable region with the second epi-position bonded ability, (c) make up these variable regions, and (d) according to selecting part with the above-mentioned first and second epi-position bonded abilities.
52. the method in the claim 51 is not selected in conjunction with described first epi-position when wherein said first variable region does not exist according to complementary variable region.
53. select in conjunction with described first epi-position when method in the claim 51, wherein said first variable region exist according to the 3rd complementary variable region, described the 3rd variable region is different from described second variable region.
54. the nucleic acid of the dual specific part of any one claim among the coding claim 1-50.
55. in the claim 54 coding part nucleic acid, described part is the TNF alpha specific, described nucleic acid comprise TAR1-5-19 nucleotide sequence or with its at least 70% homologous sequence.
56. in the claim 54 coding part nucleic acid, described part is the TNF alpha specific, described nucleic acid comprise TAR1-5 nucleotide sequence or with its at least 70% homologous sequence.
57. in the claim 54 coding part nucleic acid, described part is the TNF alpha specific, described nucleic acid comprise TAR1-27 nucleotide sequence or with its at least 70% homologous sequence.
58. in the claim 54 coding part nucleic acid, described part is that TNF acceptor 1 is specific, described nucleic acid comprise TAR2-10 nucleotide sequence or with its at least 70% homologous sequence.
59. in the claim 54 coding part nucleic acid, described part is that TNF acceptor 1 is specific, described nucleic acid comprise TAR2-10 nucleotide sequence or with its at least 80% homologous sequence.
60. in the claim 54 coding part nucleic acid, described part is that TNF acceptor 1 is specific, described nucleic acid comprise TAR2h-5 nucleotide sequence or with its at least 70% homologous sequence.
61. in the claim 54 coding part nucleic acid, described part is that TNF acceptor 1 is specific, described nucleic acid comprise TAR2h-5 nucleotide sequence or with its at least 80% homologous sequence.
62. in the claim 54 coding part nucleic acid, described part is that SA is specific, described nucleic acid comprise MSA-16 nucleotide sequence or with its at least 70% homologous sequence.
63. in the claim 54 coding part nucleic acid, described part is that SA is specific, described nucleic acid comprise MSA-26 nucleotide sequence or with its at least 70% homologous sequence.
64. a carrier, it comprises the nucleic acid of any one claim among the claim 54-63.
65. the carrier in the claim 64, it also comprises expresses the necessary composition of dual specific part.
The host cell of the carrier of requirement a 65 66. transfection is had the right.
67. the part of any one claim among the claim 1-50, it is used for the treatment of.
68. a pharmaceutical composition, it comprises part and pharmaceutically acceptable vehicle, carrier or the thinner of any one claim among the claim 1-50.
CNA2008100085659A 2002-06-28 2003-06-30 Immunoglobulin single variant antigen binding domain and specific construct thereof Pending CN101260156A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBPCT/GB02/03014 2002-06-28
PCT/GB2002/003014 WO2003002609A2 (en) 2001-06-28 2002-06-28 Dual-specific ligand and its use
GB0230202.4 2002-12-27

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CNA038204584A Division CN1678634A (en) 2002-06-28 2003-06-30 Immunoglobulin single variable antigen combination area and its opposite constituent

Publications (1)

Publication Number Publication Date
CN101260156A true CN101260156A (en) 2008-09-10

Family

ID=39893908

Family Applications (2)

Application Number Title Priority Date Filing Date
CNA2008100085659A Pending CN101260156A (en) 2002-06-28 2003-06-30 Immunoglobulin single variant antigen binding domain and specific construct thereof
CNA2008100085663A Pending CN101255196A (en) 2002-06-28 2003-06-30 Immune globulin single variant antigen bonding land and specificity construction body thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
CNA2008100085663A Pending CN101255196A (en) 2002-06-28 2003-06-30 Immune globulin single variant antigen bonding land and specificity construction body thereof

Country Status (1)

Country Link
CN (2) CN101260156A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105307676A (en) * 2013-04-05 2016-02-03 豪夫迈·罗氏有限公司 Anti-il-4 antibodies and bispecific antibodies and uses thereof

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103384831B (en) * 2010-12-23 2016-02-10 霍夫曼-拉罗奇有限公司 Polypeptide dimer is detected by bivalent binders
AU2013353763B2 (en) * 2012-12-03 2018-09-13 Novimmune S.A. Anti-CD47 antibodies and methods of use thereof
CN111116752B (en) * 2019-12-24 2021-09-03 北京纽安博生物技术有限公司 Immunoglobulin-binding single domain antibody, anti-avian influenza single domain antibody, bifunctional antibody and application thereof
CN113444170B (en) * 2020-06-04 2023-11-10 山东宽和正生物医药有限公司 Monoclonal antibody F10 against novel coronavirus SARS-CoV-2

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105307676A (en) * 2013-04-05 2016-02-03 豪夫迈·罗氏有限公司 Anti-il-4 antibodies and bispecific antibodies and uses thereof

Also Published As

Publication number Publication date
CN101255196A (en) 2008-09-03

Similar Documents

Publication Publication Date Title
AU2003244817B2 (en) Antigen-binding immunoglobulin single variable domains and dual-specific constructs
KR101205643B1 (en) Compositions and methods for treating inflammatory disorders
AU2005291017B2 (en) Single domain antibodies against TNFRl and methods of use therefor
US20060257406A1 (en) Ligand
US20090258012A1 (en) Compositions and methods for treating inflammatory disorders
CN101724071A (en) Single domain antibodies against TNFRl and methods of use therefor
CN101965364A (en) Antibody single variable domains against serum albumin
CN101426815A (en) Ligands that have binding specificity for egfr and/or vegf and methods of use therefor
CN101084014A (en) Single domain antibodies against tnfr1 and methods of use therefor
US20080008713A1 (en) Single domain antibodies against tnfr1 and methods of use therefor
US20080233130A1 (en) Ligand that has binding specificity for IL-4 and/or IL-13
US9028822B2 (en) Antagonists against TNFR1 and methods of use therefor
CN101260156A (en) Immunoglobulin single variant antigen binding domain and specific construct thereof
CN1745102A (en) Dual specific single domain antibodies specific for a ligand and for the receptor of the ligand
US20130216538A1 (en) Compositions and Methods for Treating Inflammatory Disorders
JP2008504356A6 (en) Compositions and methods for treating inflammatory diseases
JP2008504356A (en) Compositions and methods for treating inflammatory diseases
US20110223168A1 (en) Ligand that has binding specificity for il-4 and/or il-13
KR20050024397A (en) Ligand

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20080910