CN101248172A

CN101248172A - Methods for production of mesodermal lineage cells

Info

Publication number: CN101248172A
Application number: CNA2006800086862A
Authority: CN
Inventors: 萨基斯·曼塔拉里斯; 韦斯利·兰德尔
Original assignee: Imperial College Innovations Ltd; Novathera Ltd
Current assignee: Novathera Ltd; Ip2ipo Innovations Ltd
Priority date: 2005-01-28
Filing date: 2006-01-30
Publication date: 2008-08-20

Abstract

The invention relates to a method of cell culture comprising providing a pluripotent ES ceil encapsulated within a support matrix to form a support matrix structure, maintaining the encapsulated cell in 3-D culture in maintenance medium, and optionally differentiating the encapsulated cell in 3-D culture in differentiation medium. The invention further relates to screening methods incorporating the use of encapsulated cells.

Description

Methods for production of mesodermal lineage cells

Technical field

The present invention relates to cultivate multipotential cell to promote the method for the self that cell is controlled.The present invention further provides from the integrated approach of the cell colony of multipotential cell amplification and differentiation homogeneous.In addition, the invention provides screening method influences multipotential cell with identification, as condition, substratum and the stimulus of embryonic stem cell growth and differentiation.

Background technology

What term " stem cell " was described is the cell that can form multiple types of organization cell.There is dissimilar stem cells.When sperm fertilizes an egg, form single totipotent cell, this totipotent cell has the ability that forms whole organism.In first hour of after fertilization, this cell fission is identical totipotent cell.After about four days of after fertilization and the process cell fission in several cycles, these myeloid-lymphoid stem cells begin specialization.When totipotent cell became more specialization, they were called as " (pluripotent) of pluripotency " thereupon.Multipotential cell can be divided into every kind of cell type in the health, but can not form placenta or the necessary sustentacular tissue of fetation.Because the differentiation potential of pluripotent stem cell is not " all ", therefore this cell is not called " all-round ", and they is not the embryo.The further specialization of pluripotent stem cell is multipotency (multipotent) stem cell, and it is exclusively used in the cell that is divided into to the specific kind system of specific function specialization.Pluripotent cell can be divided into the cell type that contains in the tissue that they are derived from; For example blood stem cell is merely able to be divided into red blood cell, white cell and thrombocyte.

Pluripotent stem cell, as the embryo do (ES) cell, embryonic germ is done (EG) cell and multipotential stem cell, as umbilical cord stem cell and adult stem because of the ability of its self and plasticity-ability but be proposed as the strong instrument that is used for organizational project.Pluripotent stem cell, as embryonic stem cell, can be at the external pluripotent cell that is induced to differentiate into mesoderm, ectoderm and endoderm cell's pedigree.The cell of mesoderm pedigree, as scleroblast, chondrocyte and myocardial cell respectively form bone, become under cartilage and the influence that becomes the flesh fill-in to produce.Now, pluripotent stem cell is subject to as the medicinal use of embryonic stem cell and pluripotent cell and lacks about organizing knowledge that spline structure forms to be divided into different cytophyletic tendencies with spontaneous; Even this multispectral be that potential can show as the risk that forms ectopic tissue.For clinical application, highly purified homogeneous cell colony may be essential.

For effectively using multipotential cell to carry out clinical treatment, the primary cell that is used for relevant clinical application that provides sufficient amount.Undifferentiated embryonic stem cell is the source likely that produces crucial differentiated cell types; But for many undifferentiated cells colony, existing cultural method or be not suitable for amplification perhaps can not provide the noble cells of useful output.

The existing people of keeping embryo do the method for (hES) cell need use feeder layer, raise conditioned medium (feeder-conditioned media) or in substratum supply human or animal cell extract with the amplification human embryo stem cell with prevent spontaneous differentiation.As plan subsequently cell is being used for the human treatment, this method is unaccommodated.The clinical application of human embryo stem cell need be in the method for the middle culturing cell of standardized, as to be subjected to the no animal product of good control environment (therefore be called as the culture environment of " no xenobiotics (xeno-free) ", it reduces the risk of transmission disease).In addition, need be under the situation that does not have feeder layer or sustenticular cell the method for cultivator embryonic stem cell to reduce feeder cell or to be derived from the risk of the contaminants human embryo stem cell treatment product of feeder cell.In theory, the method for the human embryo stem cell of production sufficient amount should be standardized and regulatable.So far also do not have such method, and use traditional method to separate and keep human embryo stem cell to be the process that needs very much technology, to be unsuitable for clinical application (1).Therefore the cultural method that need develop improvement is to be used for amplification and to follow the differentiation of human embryonic stem cell when needed.

Changing undifferentiated mouse embryonic stem cell (mES) is known for the method for cell type of more differentiation.But, use existing two-dimensional flat plate or culturing bottle (flask) culture scheme, this process is a sectional, relates to the high maintenance expense, it is very variable that sample is had destructiveness and result.

Traditionally, the embryonic stem cell culture scheme relates to three distinct stages in two-dimentional culture, at first to keep (be self to embryonic stem cell, be also referred to as amplification, to form stem cell colonies), being the initial differentiation that causes embryoid (EB) to form then, is further pedigree specificity differentiation subsequently.Each stage all needs skilled operation and specific scheme of stage.

Keeping for embryonic stem cell, is to separate the embryonic stem cell cell at first, carries out common cultivation then on feeder layer.Find that subsequently but the working conditions substratum substitutes feeder layer (2; 3), and for the mouse embryonic stem cell, when with purified form supply LIF (by feeder cell excretory nutritional factor), it can keep multipotency (4).

Evaluate and test the pluripotency of embryonic stem cell by the expression of monitoring Octamer binding factor 3/4 (being expressed as Oct-4).Oct-4 is Pit-Oct-Unc (POU) the family's transcriptional regulator (5) that is limited to body early embryo, reproductive tract cell and undifferentiated embryonic stem cell (embryonal carcinoma), embryonic germ stem cell and embryonic stem cell.Oct-4 expression in vivo is the pluripotency ability necessary (6) of development inner cell mass (ICM) cell, is controlled to keep multipotency (7) by chemical stable state ground at external its.

In traditional differentiation method, through forming the stage of embryoid (EB), the embryonic stem cell that is derived from inner cell mass (ICM) is divided into various cell types.The formation of embryoid, i.e. the initial differentiation of embryonic stem cell can start by various stimulations, for example removes contacting (for the mouse embryonic stem cell) or eliminating and the contacting of raising conditioned medium of feeder cell, elimination and LIF.Be developed embryoid (EB) suspension process (8) that is used for embryonal carcinoma (EC) cell by forming whole three germinal layers: mesoderm, ectoderm and entoderm cause forming multiple differentiation structure, and it is similar to the embryonic tissue (9) after the implantation.In 2 to 4 days of suspension culture, form ectoderm on the ICM surface, its formation is called the structure of " simple embryoid ".At about the 4th day of differentiation, the cylindrical epithelium with stratum basale was grown, and formed central cavity.These structures are called as " cryptomere embryoid (cystic EB) ", and by cultivating in external continuation, entoderm and mesoblastema (10) occur.

Ectoderm cell is polyenergic, can be divided into nervous tissue, epithelium and dental tissue.The endoderm cell is polyenergic, can be divided into gi tract, respiratory tract and incretory gland.Mesoblastema is polyenergic, can be divided into hematopoiesis and bone pedigree, and the latter comprises the cell that forms cardiac muscle (cardiomyogenic), forms cartilage (chondrogenic) and formation bone (osteogenic).At mesoderm, the differentiation of known formation heart is initial and main atomization.It has been generally acknowledged that the differentiation that forms heart can stop and postpone other atomization, for example form the differentiation of cartilage and formation bone.

Realized forming the differentiation of bone by in two-dimentional culture functional osteoblastic differentiation, promptly in the brief summary of external formation mineralising, on the form of the interlacing bone that forms in its display body, on the ultrastructure and the feature on the biochemistry.Yet the two dimension of carrying out in culturing bottle and porose flat board is cultivated and can only be made small amounts of cells break up the extracellular matrix that can make them to be organized into degree (11-13) with the similar structure of bone.In addition, it is sectional that two dimension is cultivated, labour-intensive and need operator " judgement " during included different culturing steps.

There is the chondrocyte of function to realize the differentiation of one-tenth cartilage by differentiation in culture, promptly in the brief summary of external formation cartilage, the chondrocyte's who forms in its display body form, ultrastructure and biochemical character.Now, having carried out a lot of inducing embryo stem cell vitro differentiation is the trial that cartilage generates pedigree.It is reported by adding various one-tenth cartilage fill-ins between the differentiation phase at embryoid (EB), as BMP-2 and BMP-4 (people such as Kramer, (2000) .Embryonic stem cell-derived chondrogenicdifferentiation in vitro:activation by BMP-2 and BMP-4 Mech.Dev.92,193-205), TGF-b3 (people such as Kawaguchi., (2005) .Osteogenic and chondrogenicdifferentiation of embryonic stem cells in response to specific growth factorsBone 36,758-769.), dexamethasone (people such as Tanaka, (2004) .Chondrogenicdifferentiation of murine embryonic stem cells:effects of culture conditions anddexamethasone J.Cell Biochem.93, but 454-462.) the one-tenth cartilage of inducing embryo stem cell differentiation.As other approach, it is reported by supply IGF-I, TGF-b3, BMP-4 and PDGF obtain macroscopic cartilage and form (people such as Nakayama in the embryoid culture of the mesoderm progenitor cell that is derived from the FACS sorting, (2003) .Macroscopic cartilage formation with embryonicstem-cell-derived mesodermal progenitor cells J.Cell Sci.116,2015-2028.).Yet although have a large amount of successful method for the one-tenth cartilage differentiation of embryonic stem cell, these methods of having set up need form embryoid.Forming cartilage from embryonic stem cell realizes two-dimentional culture systems.Cartilage tissue engineered for embryonic stem cell is used for, must exploitation clear and definite and effective scheme, being used for instructing in dimensional culture system vitro differentiation integrated and that do not relate to operator's decision is cartilage generation pedigree.

Leave standstill cultivation, be used for the two-dimension method that embryonic stem cell is kept, cultivated and breaks up, have several restrictions, for example lack mixing, shortage control option and frequent the feeding of needs and raise as tradition.In the test of two-dimentional culturing cell, be twisted with the normal three-dimensional relationship of extracellular matrix and other cell, it causes unusual cell behavior and therefore produces wrong conclusion.The suspension culture system that stirs has scalability and relative simple these attracting advantages, and this can influence viability and the utilization ratio (14) of the stem cell of specified phase and type.Yet, in the stirring of suspension cell is cultivated, will cause cell injury owing to stir the upheaval and the shearing force that are produced.Now developing the method for using the bioreactor culture cell, so that the dynamic culture systems with controlled culture condition to be provided, its can be in three-dimensional environment amplifying cells.Analyzing the cell interaction in setting of more natural three-dimensional can provide the condition (15 of more approaching in vivo condition; 16).It is on the books that bio-reactor is used for the human embryo stem cell cultivation, and provide some preliminary evidences to show that dynamic, three-dimensional condition will provide suitable environment (17) for cultivating embryonic stem cell formation embryoid.

People such as Chang (18) have started biological pack in nineteen sixties, and people such as Lim (19) finally wrap up the heterograft islet cells and are used for being transplanted to rat to improve diabetes.The application of alginate parcel mainly is limited to into somatocyte.People such as Magyar (20) are wrapped in the mouse embryonic stem cell in the miniature globule of 1.1% alginate, and two dimension is cultivated on tissue culture plate then, promptly leaves standstill cultivation.This causes forming " plate-like " colony, and further differentiation is to produce the cryptomere embryoid in globule for it, and formation subsequently contains the embryoid in spontaneous beat zone.When people such as Magyar are wrapped in embryonic stem cell in the miniature globule of 1.6% alginate and during dimensional culture, find that differentiation is suppressed in the morula sample stage, so do not form the cryptomere embryoid in the globule; Though when the embryonic stem cell colony being discharged also two dimension cultivation from globule, they can further be divided into the cryptomere embryoid with the myocardial cell of beating.Existing people attempts the mouse embryonic stem cell is wrapped in the alginate globule producing embryoid from the mouse embryonic stem cell, but fails to produce enough one-tenth cartilage differentiation (21).To be wrapped in mescenchymal stem cell (MSC) dimensional culture in the alginate globule, wherein thereby the cell globule is placed in to leave standstill in the culturing bottle culture and with growth medium and covers the one-tenth cartilage differentiation that realizes producing hyaline cartilage, though find that the multiplication capacity of mesenchymal stem cells is suppressed (22) in the alginate culture.The verified one-tenth cartilage differentiation in the dimensional culture, its use be seeded in alginate or the agarose aquogel with the people in porous gelatin support (Surgifoam) adipose-derived become soma (hADAS) cell (32).

Need integrate embryonic stem cell each step cultivating from stem cell scale operation noble cells.Existing from multipotential cell, the method that forms noble cells as embryonic stem cell is a sectional, the labour-intensive and high-caliber training of needs, and it inevitably can introduce the difference between operator and the operator; And these methods are carried out in two-dimentional culture, and it does not have the three-dimensional environment of existence in the analogue body.This does not meet requirements for clinical application, because the existing method of cultivating with differentiation of keeping can not produce clinical relevant cell quantity.

Therefore, need improvement stem cell cultured method with amplification and integrated amplification and differentiated stem cells, as embryonic stem cell.Multipotential cell is not effectively kept growth and differentiation to this method and the further differentiation of pluripotent cell that ectoderm, mesoderm and entoderm pedigree are partly broken up is necessary for breaking up.Use for clinical bone tissue engineer, need to form the method for " bone brief summary (bone nodules) " (osteoid tissue) or other types of organization.According to the present invention, this can realize in dimensional culture, wherein uses the single or multiple cells that are wrapped in the supported matrix.

Individual cells or clone's cultivation, and single clone amplification and differentiation subsequently is called as " clonality ".Known it broke up in vivo when vegetative embryonic stem cell was transplanted in the mouse when deriving from, but up to the present, all was proved to be unsuccessful (23 in the trial of the single undifferentiated embryonic stem cell of vitro culture; 24).In the research that these have been reported, two dimension is cultivated individual cells, and this cell finally is not divided into mature cell.

Now, not can be used for screening the method for cell culture environment to the influence of single pluripotency or pluripotent cell.Therefore need recognizing cells culture condition, substratum and test compound (for example the material of synthetic chemical entity or natural origin, as conditioned medium, somatomedin) method to the influence of individual cells.In addition, the ability of carrying out a large amount of this screening experiments simultaneously makes it possible to carry out a large amount of screenings of a large amount of processing parameters (chemical preparations, concentration, combination).

Detailed Description Of The Invention

The invention provides the method for cell cultures, it comprises:

(a) provide the people embryo of parcel (encapsulate) in supported matrix do (ES) cell with form the supported matrix structure and,

(b) keep cultivation by in keeping substratum, keeping the cell that is wrapped that is arranged in three-dimensional (3D) culture.

In cultural method of the present invention, the embryonic stem cell that is provided can be a plurality of individual cells and/or the cell aggregation that is wrapped in the supported matrix structure, or is wrapped in the individual cells that is used for asexual amplification in the supported matrix structure.

Be used for keeping the cell growth and depend on type and their demands of the cell that uses with the selection of keeping substratum that increases supported matrix structure cell quantity (i.e. amplification, wherein cell carries out self by cell fission) growing.The growth of any sustenticular cell, and it is desirable to have substratum minimum or that do not have cytodifferentiation and all be fit to be used as in the method for the invention keep substratum.The multiple suitable substratum of keeping known in the art.

In preferred embodiment, keep to cultivate to be not included in and keep the cell extract that uses feeder cell, conditioned medium or human or animal in the substratum, keep therefore that to cultivate be to carry out not having feeder cell and do not exist under the situation of feeder cell conditioned medium.

The method of existing cultivator embryonic stem cell need be used feeder cell keeping or working conditions substratum (1) with the human embryo stem cell of supporting undifferentiated state.In addition, in existing method, cell need often go down to posterity to remove the human embryo stem cell of spontaneous differentiation.In addition, if the human embryo stem cell that is produced is used for clinical treatment, culture condition may need to be derived from the product of animal, and such product has the risk of transmission disease.The investigator just be devoted to develop be suitable for scale operation keep and the method for the human embryo stem cell that increases thinks that clinical application provides human embryo stem cell or its differentiation derivative of sufficient amount.The inventor has developed wonderful simple method, its displaying duplication the physical environment of the body early embryo of embryo before implanting, and can cultivate the human embryo stem cell that is wrapped of undifferentiated state for a long time, and not need to go down to posterity.Surprisingly, the contriver finds that the method human embryo stem cell of the application of the invention can not keep differentiation at as many as under the situation that does not have feeder cell in 130 days time in non-conditioned medium.The physical environment that supported matrix provided that contriver hypothesis is wrapped up human embryo stem cell has in the methods of the invention been eliminated the demand to feeder cell support or working conditions substratum.Method of the present invention is suitable for the production of treatment standardization of application, regulation and control and expansion human embryo stem cell.

The substratum of keeping that is fit to human embryo stem cell comprises and is supplemented with 20%v/v KNOCKOUT ^TMSR, the 2mM L-glutaminate, 0.1mM non-essential amino acid solution (all derives from Gibco Invitrogen, Life Technologies, Paisley, UK), 0.1mM 2 mercapto ethanol (2ME) (Sigma-Aldrich, Dorset is UK) with 4ng/ml people's recombination basic fibroblast growth factor (bFGF, FGF-2) (157 amino acid) (R﹠amp; D Systems, Oxon, DMEM/F12 substratum UK).Be supplemented with the VitroHES of 4ng/ml people's recombination basic fibroblast growth factor (hrbFGF) ^TM(VitrolifeAB, Kungsbacka, Sweden, Http:// www.vitrolife.com) also be the substratum that is fit to the cultivator embryonic stem cell, these two kinds of substratum all use with feeder cell usually jointly, but in the cultural method that cell of the present invention is wrapped, can not follow these substratum of use under the situation of using feeder layer.The no feeder layer of the human embryo stem cell that can not wrap up with the somatomedin that conditioned medium and other add is cultivated.Yet people such as Xu (2005) (25) have shown contains KNOCKOUT ^TMThe non-conditioned medium of SR (unconditioned media) can activate the BMP signaling activity in the human embryo stem cell that does not wrap up, its degree surpasses the MEF conditioned medium, therefore can't obtain now definite ingredients the human embryo stem cell that is used for not wrapping up no feeder layer keep substratum.

The time of using the specific cell signaling molecule in no feeder layer environment, to keep the human embryo stem cell of parcel not only can to realize lacking relatively (people (2004) Nat.Med. such as Sato, 10,55-63).Surprisingly, in the method for the invention, human embryo stem cell is maintained at undifferentiated state does not need special signaling molecule.Yet,, can use the external environment of these molecules in the method for the invention with the human embryo stem cell cultivation of further enhancing parcel when this research continues the branch period of the day from 11 p.m. to 1 a.m of keeping and increasing that identification improves the human embryo stem cell of undifferentiated state.

In the method for the invention, the embryonic stem cell of parcel can be grown in non-conditioned medium.In (1), summarized and be used to keep the various substratum that do not wrap up human embryo stem cell and the details of combinations of. growth factors now.These substratum can be used to or be modified to be used for method of the present invention, wherein do not have feeder cell and do not need substratum by conditioning.

Aspect preferred, the invention provides the method for cell cultures, it comprises:

(a) provide the human embryo stem cell that is wrapped in the supported matrix forming the supported matrix structure,

(b) by keeping the cell that is wrapped that is arranged in the dimensional culture thing in the substratum and keep cultivation being fit to keep under the condition that cell keeps,

(c) be fit under the condition of cytodifferentiation the cell that be wrapped of differentiation in the dimensional culture thing in division culture medium.

The cell type of use is depended in the selection that is used to break up the division culture medium of pluripotency human embryo stem cell, they are to the demand of growth and break up required stimulus.The substratum of any support differentiation all is suitable as the division culture medium in the inventive method.In fact, division culture medium can be with to keep substratum similar on composition, do not keep contained one or more materials of suppressing to break up of being used in the substratum but division culture medium does not contain.The division culture medium that is fit to human embryo stem cell comprises substratum [Alpha-Modified Eagles Medium (α MEM), 10% (v/v) foetal calf serum, 100 units/mL penicillin and 100 μ g/mL Streptomycin sulphates].By add the stimulus of differentiation in keeping substratum, for example somatomedin can produce division culture medium.

The multipotential stem cell that is adapted at the pluripotent stem cell that is wrapped in the dimensional culture thing or is wrapped is kept and/or the condition of breaking up comprises type culture condition for used cell type, for example, cultivate for embryonic stem cell, appropriate condition comprises uses embryonic stem cell to keep and/or division culture medium and for example 37 ℃ and 5%CO ₂Envrionment conditions.

Use of the present invention keeping (amplification) and/or differentiation method, the formation of colony or tissue is carried out in dimensional culture, and it can be static, for example in the tissue culture ware or in suspension, for example in flask or bio-reactor.In dimensional culture, can form organized structure and more substantial cell, because its condition more approaches to meet the physical environment in the situation in the body.Cell three-dimensional growth in the dimensional culture thing.

Can realize being suitable for carrying out the three-dimensional condition of suspension culture of cell culture processes of the present invention by using low shearing, high blended " dynamically " environment.This makes the gentle body of enough nutrition can penetrate in the employed supported matrix structure.For providing the suitable bio-reactor of low shearing, high blended dynamic environment, dimensional culture comprises NASA HARV bio-reactor (Synthecon, USA), European Space Agency bio-reactor (Fokker, Netherlands), RWV bio-reactor (Synthecon, USA) or other simulated microgravity or filling system, for example airlift bioreactor.For the method that relates to the differentiation that forms bone, NASA HARV bio-reactor is suitable.

The suitable method that is used as integrated (integrated) with cultural method of keeping is carried out, and wherein single, keeps continuously and differentiation step in the promptly same container.Keep in the suspension culture of integrated approach in flask or bio-reactor with differentiation method and suitably carry out.Keeping growth phase, one or more pluripotency embryonic stem cell divisions that are wrapped, cell quantity increases, therefore in the supported matrix structure, form cell colony, the cytodifferentiation that is wrapped subsequently forms the cell that breaks up further differentiation or last eventually, and all these is in the three dimensional matrix structure.In the method for the present invention, then can keep further differentiation or the last eventually cell that breaks up, thereby it makes cell fission increase cell quantity and form cell colony in the supported matrix structure.

Using fully integrated method makes it possible to carry out from the amplification of undifferentiated cell to continuously changing by the periodic and in check differentiation that triggered by the key signal molecule that increases or reduce the substratum.Used the demand of the pair cell operation that the inventive method causes to reduce to limit contacting of cell and potential pollutant that may influence cell survival and environment.In addition, make it possible to set up the required standard of clinical prods with real-time mode monitoring cell culture condition.

In keeping growth, spontaneous differentiation appears in some cells after the cell fission of several cycles, particularly when condition does not suppress to break up.The condition that is fit to cytodifferentiation can comprise the stimulus that makes the pluripotency embryonic stem cell be divided into pluripotent cell.The stimulus that embryonic stem cell is divided into pluripotent cell can be the stimulus that embryoid forms, and for example eliminates or reduces and the contacting of the material that suppresses to break up; And/or add or increase and the contacting of the material that promotes embryoid formation.The condition that is fit to cytodifferentiation comprises makes the further stimulus of differentiation of pluripotent cell; For example, its can be before the stimulus of embryonic stem cell differentiation, simultaneously or be provided afterwards.The method that relates to differentiation of the present invention can be carried out under the situation of the stimulus that does not provide embryoid to form, and the opposite condition that is fit to differentiation simply comprises and being divided into, for example the stimulus of ectoderm, entoderm or mesoblastema system.

The stimulus of differentiation can be the stimulus that is divided into ectoderm, entoderm or mesoderm pedigree.Following listed, suitable stimulus is known in the art, and is discussed in for example reference (1).

Preferably, the stimulus of differentiation is the stimulus that is divided into mesoderm bone pedigree cell, for example forms stimulus bone or that form the differentiation of cartilage.

The stimulus that forms the differentiation of bone can be the fill-in that provides in substratum, for example one or more in xitix, β-phospho-glycerol or the dexamethasone.

Becoming the stimulus of cartilage differentiation can be the fill-in that provides in substratum, for example monothioglycerol (MTG) and IGF-1, TGF β 1, BMP 2 or BMP 4.

Keep the purpose that depends on institute's cultured cells type and cell cultures with the lasting time of differentiation step.The contriver has proved the method for the application of the invention, and the human embryo stem cell that is wrapped can be kept 130 days under not differentiation situation under the situation of feeder cell that do not have routine to be used to keep pluripotency or conditioned medium.In keeping cultivation, may expect to cultivate when needed the human embryo stem cell as many as 130 days that is wrapped or longer time so that the undifferentiated cell of accelerating to be provided.Therefore, the invention provides the method that long term maintenance is cultivated the human embryo stem cell that is wrapped that can be used in, for example surpass 8 days, 14,21,28,35,42,49,56 days according to appointment, as many as 130 days and more.

Integrated keep with differentiation method in, the initial maintenance of the cell that is wrapped in the step (b) is cultivated and be reached the sufficiently long time to form cell cluster, for example 1 to 6 day, preferred 2 to 5 days, most preferably 3 or 4 days.Differentiation culture can as many as 40 days.Cultural methods more of the present invention are included in and exist embryoid to form initial differentiation period under the situation of stimulus, be pluripotent cell to be divided into the cell lineage of differentiation more existing subsequently, as the further differentiation period under the situation of scleroblast or chondrocyte's stimulus.Suitably, initially differentiation period is 3 to 7 days, preferred 4 to 6 days, and most preferably from about 5 days.When carrying out further differentiation phase, further differentiation is generally 14 to 28 days period, and suitable about 20 to 22 days, as 21 days.

For the differentiation according to the formation bone of the embryonic stem cell that is wrapped of the inventive method, initial maintenance was generally 2 to 4 days period, as 3 days; Initial differentiation was generally 4 to 6 days period, as 5 days; Further differentiation period was 14 to 28 days, as 20,21 or 22 days; These incubation times are suitable for usually realizing that bone induces and three-dimensional bone forming.

Use comprises the method for the present invention of differential period, and the pluripotent cell that is wrapped can be divided into the cell of differentiation more, for example last eventually cell that breaks up.For the suitable cytodifferentiation condition of using of cell that pluripotent cell is divided into differentiation more or end differentiation eventually realizes that described condition comprises the further stimulus of differentiation of pluripotent cell.

Method of the present invention also is used to keep and/or break up the individual cells that is wrapped in the supported matrix external, thereby homogeneous colony or tissue for example are provided.Therefore, in some embodiments of the present invention, the supported matrix structure is that single embryonic stem cell is wrapped in the supported matrix to form the supported matrix structure in step (a).

Embryonic stem cell can be wrapped in the supported matrix, so that the supported matrix that contains individual cells structure, for example globule to be provided.Subsequently, the individual cells that is wrapped can be grown to cell colony, optionally forms the embryoid structure, and is final, and the cell of part differentiation can be divided into the cell lineage of expection.This is useful for obtaining to be derived from vegetative cell colony, and these cell colonys are useful for pure homogeneous cell colony is provided for clinical application.And this is useful for the screening purpose, because it makes it possible to detect the formation of three-dimensional embryoid, the cell fission of embryonic stem cell, perhaps studies the influence of microenvironment to single multipotential cell.Can also study of the differentiation of single embryonic stem cell, thereby the proof embryonic stem cell is in external multipotency potentiality to the mature cell type of differentiation.

Optionally, in step (a), a plurality of cells are wrapped in the supported matrix structure.These can be with a plurality of independent cells or cell aggregation (being piece/colony) or the existence of its mixture.These aspects still also can be used in the screening purpose for particularly useful for producing a large amount of noble cellss such as organizational project application, research or clinical application.

Usually, in cell culture processes of the present invention, in step (a), provide a plurality of supported matrix structures.

The invention provides and be used for the integrated three-dimensional culture method that embryonic stem cell is kept, optional embryoid forms and breaks up.The mesoblastema that is derived from embryonic stem cell can be divided under the influence of the stimulus that forms cardiac muscle, that form cartilage or formation bone respectively and form cell cardiac muscle, that form cartilage or that form bone.

Use method of the present invention, in dimensional culture, realized forming the differentiation of bone, cause forming " bone brief summary (osteoid tissue) ", perhaps in dimensional culture, can realize being used for other types of organization that clinical bone tissue engineer is used.Method of the present invention can be adjusted for the automatization of culture systems, thereby providing low keeps expense, system is used to produce noble cells efficiently.For example, these methods can be used to form cell cardiac muscle, that form cartilage or that form bone from mouse embryonic stem cell or hES (the people embryo does) cells produce.

Therefore, in optional embodiment, cultural method of the present invention is effective especially for the differentiation of the formation bone of embryonic stem cell, and particularly preferred cell culture processes comprises:

(a) provide the single embryonic stem cell that is wrapped in the supported matrix or a plurality of embryonic stem cell forming the supported matrix structure,

(b) under the condition that suitable embryonic stem cell is kept, in keeping substratum, keep the one or more cells that are wrapped that are arranged in the dimensional culture thing,

(c) cell that is wrapped that is arranged in the dimensional culture thing by differentiation in division culture medium under the condition of the differentiation that be fit to form bone forms the differentiation of bone.

Preferred mouse of embryonic stem cell or human embryo stem cell, but the differentiation method of formation bone of the present invention is applicable to the embryonic stem cell in people, non-human primates, horse, dog, ox, pig, goat, sheep, fish, rodent, mouse or bird source.

Preferred supported matrix comprises alginate, especially preferably contains those supported matrixes of alginate and gelatin.Preferred supported matrix structure is the globule form.Present method can be carried out in the suspension culture that leaves standstill, but preferably for example by bio-reactor, carry out in the low shearing that is provided as NASA HARV bio-reactor, the high blended dynamic environment.

As above-mentioned other substratum, the substratum of keeping that is generally used for two dimension cultivation embryonic stem cell is fit to use in the method.Appropriate condition is 37 ℃, 5%CO ₂Keep to cultivate and carried out 1 to 6 day, preferred 2 to 4 days, more preferably from about 3 days.

The differentiation of the formation bone of the cell that is wrapped is undertaken by following:

(i) in division culture medium, cultivate the stimulus that is arranged in the embryonic stem cell that is wrapped of dimensional culture thing and provides embryoid to form, then,

(ii) in division culture medium, cultivate the cell that is wrapped that produces in (i) and the stimulus of the differentiation that forms bone is provided.

For example, division culture medium can be to be used for any substratum that embryonic stem cell forms the differentiation of bone usually in two dimension is cultivated.The division culture medium that uses in the condition that is fit to embryoid formation and the differentiation that forms bone subsequently can be different.For the mouse cell, the stimulus that embryoid forms can be to eliminate and the contacting of LIF, and perhaps when carry out the maintenance stage with cultivation form altogether, elimination contacts with the cell of secreting LIF.

For the differentiation that forms bone to form the bone brief summary, the incubation in the step (i) generally carried out about 1 to 6 day, preferred about 2 to 5 days, most preferably from about 3 to 4 days, the incubation of step in (ii) generally carried out 21 to 28 days, preferred 20 to 22 days, for example 21 days.

In differentiation method of the present invention, the step that forms embryoid is always unessential, therefore, omitted the stimulus that forms with embryoid in some embodiments and contacted, the differentiation of the formation bone of the cell that is wrapped is in this respect suitably undertaken by following:

(i) embryonic stem cell that be wrapped of incubation in the dimensional culture thing in division culture medium, then,

The (ii) cell that is wrapped that in division culture medium, produces in the incubation (i) and the stimulus of the differentiation that forms bone is provided.

Suitable, embryonic stem cell contacts about 1 to 6 day with division culture medium in step (i), preferred about 2 to 5 days, most preferably from about 3 or 4 days, and after step provides the stimulus of the differentiation that forms bone in (ii), cultivate and generally carried out 21 to 28 days, preferred 20 to 22 days, for example 21 days.

Optionally, can be by in division culture medium, cultivating the cell be wrapped and the differentiation of the formation bone of the cell that the stimulus of the differentiation that forms bone is wrapped being provided.

In this case, cell can be cultivated 21 to 28 days in division culture medium under the situation of the stimulus that has the differentiation that forms bone.

Can use the external evoked thing of the differentiation of known formation bone, preferably step (ii) in further differentiation pluripotent cell.Concise and to the point, serum, ascorbate salt (xitix) or L-xitix-2-phosphoric acid salt (long-acting ascorbic acid analogs), the known external evoked thing as the differentiation that forms bone of each in β-phospho-glycerol and the dexamethasone works.In the prior art, serum, ascorbate salt and dexamethasone are that brief summary forms institute's absolute demand, and β-phospho-glycerol promotes or strengthen mineralising (26).Uniquely be specific to osteoblastic morphological feature and be positioned at the extracellular with the form of the extracellular matrix of mineralising.Formation at external joint is subdivided into three phases: (i) propagation, (ii) ECM secretion/maturation and (iii) mineralising (mineralisation).

Method of the present invention can be carried out to produce special differentiated cell types with industrially scalable.For example, from being wrapped in alginate or based on the embryonic stem cell the globule of alginate with in bio-reactor, cultivate beginning, can realizing bone forming.This automatic, integrated process be effectively, be easy to control and compare obvious the minimizing with three-dimensional method with two-dimension method of the prior art and form the spent time of osseous tissue.

One or more embryonic stem cells are wrapped in the supported matrix,, cause generation to be of value to embryonic stem cell and keep, break up for example to form globule, optional by embryoid formation and further differentiation, for example form the environment of the differentiation of bone.Method of the present invention makes this process automation, may command, optimization and reinforcement, thereby the cell of can the production clinical application required clinical correlated measure for example forms the cell of bone.

The method of formation bone of the present invention is applicable to the multipotential cell in any source, for example the multipotential cell in people, non-human primates, horse, dog, ox, pig, goat, sheep, fish, rodent, mouse or bird source.

By can provide screening method to method adjustment of keeping human embryo stem cell of the present invention with the influence of assessment cellular environment (culture condition, substratum, trial stimulus factor, compound) to keeping growth and/or breaking up.Therefore, the invention provides the human embryo stem cell that is wrapped in the supported matrix evaluation test compound or stimulus pair cell keep and/or the influence broken up in purposes.The present invention also further provide the human embryo stem cell that is wrapped in the supported matrix assessment substratum and/or condition pair cell keep and/or the influence broken up in application.

Also provide identification can regulate and control that human embryo stem cell is kept and/or the method for the compound that breaks up, it comprises:

(b) keeping the human embryo stem cell that cultivation is wrapped in the substratum under the situation of test compound existing,

(c) evaluation test compound influence that human embryo stem cell is kept and/or broken up.

Using screening method of the present invention might discern by suppressing the differentiation of pluripotency or pluripotent cell promotes the compound that cell is kept and discerns the compound that promotes differentiation.The mixture of test compound or compound can be natural generation or chemosynthesis.

Provide identification can regulate and control the method for the stimulus of human embryo stem cell differentiation in addition, it comprises:

(b) be suitable under the situation that has the trial stimulus factor that cell is kept and/or the substratum that breaks up and condition in the human embryo stem cell that is wrapped of incubation,

(c) the evaluation test stimulus is to the influence of human embryo stem cell differentiation.

Use method of the present invention can discern the stimulus that suppresses or promote differentiation, for example compound and/or condition.

On the other hand, the invention provides that assessment substratum and/or condition are kept human embryo stem cell and/or the method for the influence broken up, it comprises:

(b) human embryo stem cell that incubation is wrapped under the situation that has test medium and/or test compound,

(c) evaluation test substratum and/or test conditions influence that human embryo stem cell is kept and/or broken up.

Present method can be used for optimizing culture condition and keeps, suppresses differentiation or promote differentiation to strengthen cell.In this appraisal procedure, there is incubation cell under the situation of test compound/stimulus alternatively, and the influence that the evaluation test compound/the stimulus pair cell is kept/broken up.

Carry out screening method in step (a), in each supported matrix structure, to wrap up a plurality of cells, perhaps in step (a), in each supported matrix structure, wrap up individual cells.

In the preferred screening method of the present invention, for example use the individual cells that is wrapped with the form of globule, wherein each globule contains individual cells, for example embryonic stem cell.By separately cultivating the globule that contains individual cells, suitably in porous flat board (it can be an array format, and porous flat plate for example is as 96 hole flat boards) or miniature organism reactor.Can carry out multiplex screening simultaneously evaluating and optimizing substratum and condition, and the influence of cell growth such as the compound of screening chemosynthesis, multiple somatomedin, extracellular matrix protein and differentiation.

Can set screening method, making provides the cell that is wrapped in one group of culture vessel, for example as porous or multicell array.Preferably in step (a), there are a plurality of cells that are wrapped in each culture vessel, this can realize as globule by the single supported matrix structure that contains a plurality of cells is provided, and is perhaps preferred by providing a large amount of supported matrix structures to realize in step (a) in each culture vessel.In this second approach, each supported matrix structure can contain individual cells or a plurality of cell as globule.In optional screening method, there is a cell that is wrapped in each culture vessel.

Use method of the present invention can be in check environment the one human embryo stem cell of fast culture.The many different culture environment of this high flux screening that makes it possible to walk abreast, or the many different cell types of high flux screening that in identical culture environment, walk abreast.At single culture vessel, as adding 5 to 20 globules in the hole of porous plate, each globule contains single human embryo stem cell aptly.Because the individual cells in the globule can be is not directly contacted with the individual cells that wraps up near the globule, so each globule constitutes independent growing environment.In single hole, place a plurality of globules and can carry out the time study analysis, because each globule will face identical condition.Cultivation makes it possible to multiple condition is screened in porous flat plate, and is convenient to result's statistical study.Use robot technology to advance the automatization of this process, for example raise culture by feeding.In the globule parcel of individual cells guaranteed feed or other operating period single culture without being interrupted.

Screening method of the present invention can carry out in the two-dimentional culture (static state or suspension) in culture vessel, perhaps at bio-reactor, as carrying out in the dimensional culture thing in the HARV bio-reactor.The miniature organism reactor that use has a microchannel can carry out that constant is dabbling feeds to the dimensional culture thing, thereby is convenient to carry out meticulousr shaker test and automatization.Screening method of the present invention can carry out with high-throughout form.

For screening purposes of the present invention and method, test compound, trial stimulus factor, substratum and/or condition pair cell are kept and/or the influence broken up can be assessed by one or more methods that are selected from down group: the detection of microscopy, one or more phasic specificity detection of antigens, gene expression dose, and for example by RT-PCR or use DNA or RNA microarray.

The supported matrix that is used to wrap up has perviousness, can allow the amplification and the mass transfer of nutrition, metabolite and somatomedin.One or more cells that are wrapped in the supported matrix can be with globule, as the form of spherical bead provide.The one or more cells of " parcel " expression are embedded in the supported matrix fully.The shape of globule is not relevant especially, as long as its size, makes nutrition, metabolite, cytokine etc. can be easy to diffuse into/go out globule as the ratio of surface-area and volume, reaches the one or more cells that are embedded in the globule.

Preferred especially supported matrix structure is made of the supported matrix material that is kept perfectly in the training period as globule, and wherein can be 3 to 4 months or longer time keep being used to incubation time; Perhaps as many as in the example of the differentiation and cultivation process that forms bone 30 to 40 days.One or more cells that are wrapped in the supported matrix are placed the dimensional culture container, as RWV bio-reactor (Synthesis, USA) or in other simulated microgravity or dabbling (perfused) bio-reactor, under the situation that does not have obviously damage, keeping and/or the division culture medium long term culture then.

Hydrogel material formed or comprised by preferred supported matrix material by hydrogel material, for example form the polysaccharide of gel, as agarose or alginate (be generally about 0.5 to about 2%w/v scope, be preferably about 0.8 to about 1.5%w/v, more preferably from about 0.9 arrive 1.2%v/v).Matrix can be made up of alginate separately, maybe can comprise more composition, as gelatin (be generally about 0.05 to about 1%w/v, be preferably about 0.08 to about 0.5%v/v).Comprise that gelatin can help to obtain identical bead sizes and structural integrity is kept in help.This is important, because the alginate hydrogel can lose Ca after long-term cultivation ²⁺Positively charged ion, this will weaken the structural integrity of globule.Comprise gelatin in the alginate supported matrix globule and make it possible to carry out the cell-mediated contraction and the packing of timbering material.

Alginate are the water-soluble linear polysaccharide that extract from brown seaweed, and it is made up of α-L-glucuronic acid and beta-D-mannuronic acid residue that the 1-4 of alternate cells connects.Alginate can form gel with most of divalence and polyvalent cation, but Ca ²⁺Be the most frequently used.The calcium positively charged ion participates in the interchain bond between the G-piece (G-blocks), forms the three-dimensional network of gel form.Land between the G-piece is typically expressed as " egg-BOX Model (egg-box model) " (27).

We find alginate and based on the supported matrix of alginate, and the form (adding the gelatin globule as alginate) that suitable is with globule is particularly suitable for using in the method for the invention, because they keep its integrity in used culture condition.

Can be with various signals (as ln, collagen or somatomedin) improvement supported matrix to improve required cell performance.Therefore, supported matrix can comprise one or more materials that is selected from down group: ln, Bioglass ^TM, hydroxyapatite, extracellular matrix, extracellular matrix protein, somatomedin; From the extract of other cell culture, and for the differentiation that forms bone, from the extract of scleroblast culture.

Extracellular matrix (ECM) has been used as differentiation (the Hausemann ﹠amp of stimulus with the formation bone of realization embryonic stem cell in two dimension is cultivated; Pauken, 2003, Differentiation of embryonicstem cells to osteoblasts on extracellular matrix, 10 ^ThAnnual Undergraduateresearch Poster Symposium, Arizona State University: Http:// lifesciences.asu.edu/ubep2003/participants/hausmann).Known in the artly can stimulate pluripotent stem cell in a large number, somatomedin as the embryonic stem cell differentiation, Delicious peptide 4 (BMP4) for example, it strengthens mesoderm and forms and bone forming, people such as Nakayama. (2003) J CellSci 116 (10): 2015. ( Http:// jcs.biologists.org/cgi/reprint/116/10/2015); Vitamin A acid, it stimulates mesoderm to form, hedgehog albumen, sonic hedgehog for example, it stimulates mesoderm to osteoprogenitor cells differentiation and bone morphogenic protein BMP-2 1-3 and 5-9, and it stimulates bone to induce.

Protanal TXF 200 or help forming the cultivation and the differentiation of bone based on the supported matrix of Protanal TXF 200.Calcium ion is used as sequestrant in the formation of globule, the source, this locality that calcium can be provided is to offer help to the mineralising that forms bone.

Be wrapped to form the globule that each globule has individual cells at individual cells, cultivate in the method that forms colony then, the preferred especially alginate that contain gelatin that use to form the supported matrix structure, for example form globule as the supported matrix material that is used to wrap up.

Suitable, the diameter that contains the globule of individual cells is about 20 to 150 microns, preferred about 40 to about 100 microns.Contain a plurality of cells globule typically have a diameter from about 2.0 to about 2.5 millimeters, preferred about 2.3 millimeters.

Aspect some of invention, preferred used supported matrix is easy to dissolved to discharge cell, need not use trypsin treatment.Remove supported matrix when discharging cell in hope, hydrogel matrix, alginate and be favourable based on the matrix of alginate for example are because by using Trisodium Citrate and sodium chloride solution to be easy to they dissolvings.

One or more cells can be wrapped in the biocompatible materials, thereby make the cell that is wrapped (as forming the cell of bone) of acquisition can directly be administered to and be tried the patient, and not need harvested cell from lapping.For this purpose, use alginate or be favourable based on the supported matrix parcel cell of alginate, because the alginate material is a biocompatibility, and alginate are FDA approvals.The cell that is wrapped, particularly be wrapped in alginate or based in the material of alginate those, can by for example the injection or endoscopy directly be administered to the patient.

Method of the present invention or purposes can comprise further that the freezing cell that is wrapped is used for storing.It is freezing that the cell that is wrapped can use standard scheme to carry out, and can cultivate in keeping of usefulness or the division culture medium freezing at it.The method that is suitable for the freezing cell that is wrapped comprises people such as using Stensvaag. the described slow freezing program of (2004) Cell Transplantation 13 (1): 35-44 low temperature storage in dimethyl sulfoxide (DMSO) (DMSO).

Method of the present invention further comprises the one or more cells of release from supported matrix.Therefore the present invention provides one or more cells of acquisition like this.When wrapping up, can realize the release of cell by the alginate dissolving when the use alginate or based on the matrix of alginate.Participant influences the standard enzymatic means of cell performance in the extended culture, compares as trypsin treatment, and the dissolving method of this gentleness has more advantage.

The present invention also provide can by or one or more cells that are wrapped of obtaining by cell culture processes of the present invention; This cell that is wrapped can be polyenergic, as the cell formation bone, that form cartilage or that form cardiac muscle, or whole last differentiation, as sophisticated scleroblast or chondrocyte.

The purposes of the cell that is wrapped of the present invention as medicine further is provided.The cell of the formation bone that is wrapped that obtains by the inventive method is rebuild (bone reconstruction) at bone, for example at therapeutic decorative sursery (maxifacial surgery) or be useful in esthetic surgery (cosmetic surgery).The cell that the present invention also provides the formation bone that is wrapped is selected from down the purposes of the medicine of the disease of group or illness as treatment: osteoporosis, the bone fracture, fracture, osteocarcinoma disease, osteocarcinoma, osteogenesis imperfecta (osteogenesis imperfecta), Paget ' s disease, fibrous dysplasia (fibrous dysplasia), the osteopathia relevant with hearing disability, hypophosphatasia, the myelomatosis osteopathy, osteopetrosis, bone excessively uses damage (over-use injury to bone), the sport injury of bone, periodontal (gums) disease.

The cell that the formation cartilage that is wrapped of the present invention further is provided is as the purposes that is used for the treatment of the medicine that is selected from down the disease organized or illness: sacroiliitis, cartilage disease or disorder, repair of cartilage, lift face plastic surgery.Cartilage disease comprises special rheumatoid arthritis and osteoarthritis in joint cartilage; Described disorder comprises congenital or hereditary defect, for example needs to rebuild those for the treatment of by the face of nose and nasal septal cartilage.

The cell that one or more formation bones that are wrapped of the present invention also further are provided is used for the treatment of purposes in the medicine that needs disease that bone rebuilds or illness that is selected from group down in preparation, and for example following disease or illness: osteoporosis, bone fracture, fracture, osteocarcinoma disease, osteocarcinoma, osteogenesis imperfecta, Paget ' s disease, fibrous dysplasia, osteopathia, hypophosphatasia, myelomatosis osteopathy, osteopetrosis, the bone relevant with hearing disability excessively use the sport injury of damage, bone, periodontal (gums) disease.

The cell that the one or more formation cartilages that are wrapped are provided in addition is used for the treatment of purposes in the medicine of the disease that is selected from group down or illness in preparation: sacroiliitis, cartilage disease or disorder, repair of cartilage, plastic surgery, lift face plastic surgery, rheumatoid and osteoarthritis.

On the other hand, the invention provides treatment experimenter's method, it comprises uses the cell that is wrapped of the present invention.The cell of the formation bone that is wrapped of the present invention can be applied disease or the illness that needs bone to rebuild with treatment to the experimenter: osteoporosis, bone fracture, fracture, osteocarcinoma disease, osteocarcinoma, osteogenesis imperfecta, Paget ' s disease, fibrous dysplasia, osteopathia, hypophosphatasia, myelomatosis osteopathy, osteopetrosis, the bone relevant with hearing disability excessively use the sport injury of damage, bone, periodontal (gums) disease.The cell of the formation cartilage that is wrapped of the present invention can be applied disease or the illness that is selected from down group to the experimenter with treatment: sacroiliitis, cartilage disease or disorder, repair of cartilage, rheumatoid and osteoarthritis.

The present invention also provides the method for plastic surgery, and it can be curative or esthetic surgery (cosmetic surgery), comprises and uses one or more cell that is wrapped of the present invention, the cell of formation bone that preferably is wrapped or formation cartilage.

Can prepare the cell that is wrapped of the present invention so that pharmaceutical composition to be provided, it contains one or more cells that are wrapped and pharmaceutically acceptable carrier or thinner.Preferred pharmaceutical compositions is used for using by injection or endoscopy by preparation.

Also the scope of the invention, it provides on cytoskeleton or in the cytoskeleton aptly for bone that obtains from the cell that is wrapped of the present invention or cartilaginous tissue.The cell that is wrapped can be inoculated on the cytoskeleton, and/or inculcates in the cytoskeleton, and the transplanted subsequently so that cell of described cytoskeleton is growth in situ in vivo.This support is particularly useful in the plastic surgery of bone and cartilaginous tissue.

Description of drawings

Fig. 1 and 2: the immunofluorescence of using the antibody staining of Oct4

Human embryo stem cell (hESC) aggregate of paraffin embedding/section of 130 days shows the positive immunostaining of Oct-4.(the little figure of embedding---feminine gender and positive control)

Fig. 3 and 4: with anti--painted immunofluorescence of TRA-1-81

The immunostaining of 130 days human embryo stem cell aggregate of paraffin embedding/section shows the strong immunoreactivity to this antibody, shows to have kept multipotency.(the little figure of embedding---feminine gender and positive control)

Fig. 5 and 6: with anti--painted immunofluorescence of SSEA-4

Undifferentiated human embryo stem cell aggregate, the positive immunostaining of demonstration SSEA-4 antibody.(the little figure of embedding---feminine gender and positive control)

Fig. 7: RT-PCR analyzes

RT-PCR analyzes the expression of pluripotency marker Oct4 and Nanog in the human embryo stem cell aggregate be presented at 175 days and 260 days.Swimming lane A is the human embryo stem cell aggregate in 175 day age, and swimming lane B is the human embryo stem cell aggregate in 260 day age, and swimming lane C is a negative control.The expression of GAPDH is used as internal reference.

Fig. 8: dried (mES) cell of single mouse embryo that is wrapped in the hydrogel globule (1.1%w/v alginate, 0.1%v/v gelatin) was grown 10 days in the M2 substratum in static dimensional culture thing.Scale is 50 μ m.Single embryonic stem cell divides, and forms the microcolony of cell in the time of about 10 days.

Fig. 9: the synoptic diagram of the differentiation strategy of keeping and form bone of integration.Step is:

A) add the undifferentiated mouse embryonic stem cell of parcel in the miniature globule of gelatin at alginate, import in the three-dimensional bioreactor then;

B) in keeping substratum (M2), cultivate 3 days with increase mouse embryonic stem cell quantity, and form suitable cell mass, so that form three-dimensional many progenitor cells (multiprogenitors);

C) in EB formation substratum (M1), cultivated 5 days;

D) cultivation 21 days is induced and three-dimensional bone forming so that carry out bone in forming the substratum (Buttery) of bone.

Figure 10: the tissue morphology in the alginate globule.The alginate globule keeps its sphere, and it is obvious that cell cluster becomes: (a) the 3rd day (scale length=1000 μ m); (b) the 7th day (scale length=500 μ m); (c) the 21st day (graduated scale length=500 μ m).Grow at the painted hydrogel thin section of phenodin/eosin of each time display organization: (d) the 3rd day (scale length=20 μ m); (e) the 8th day (scale length=20 μ m); (f) the 22nd day (scale length=20 μ m).

Figure 11: by survival ability (the little figure of embedding) (green expression viable cell, the red expression dead cell of cell in the alginate globule of survival/death dyeing expression; Scale length=100 μ m).By use MTS at Metabolic activity analyze (▲; N=24) and the alkaline phosphatase analysis (●; N=6) and be used for quantitatively (■ of sodium alizarinsulfonate that mineralized tissue forms; N=6) the biological chemistry performance of each globule in the assessment dimensional culture thing.Error bar is represented standard error.*/and #: significantly increase/reduction (p＜0.05).

Figure 12: to the sign of the mouse embryonic stem cell that is wrapped.Undifferentiated state was kept in the immunocytochemistry confirmation at the 3rd day: (a) DAPI (blueness) and CD9 (redness), and (b) DAPI (blueness), (c) Oct-4 (green).When the dimensional culture thing is grown in EB formation substratum (3-8 days), the obviously as seen generation of mesoderm tissue at the 8th day: (d) DAPI (blueness) and Flk-1 (green).The little figure that embeds represents the negative control that obtains from the mouse embryonic stem cell of tissue culture plate (two dimension) cultivation.Scale length=20 μ m.

Figure 13: to the sign of mineralized tissue formation.(a) Balb/c mouse bone alizarin red S positive control and, (b) Balb/c mouse von Kossa positive control.By (c) alizarin red S and (d) von Kossa dyeing proof form at the mineralized tissue in the 22nd day alginate globule.The medisection of the painted alginate globule of phenodin/eosin shows that the 29th day tissue at hydrogel core forms (e-f).Detect the bone forming of same section at the 29th day, show more significantly alizarin red S (g) and von Kossa (h) dyeing.The immunocytochemistry of carrying out at the 29th day confirms the osteoblastic existence of end differentiation eventually: (i) use the 29th day section of DAPI painted (blueness) and Bone Gla protein immunostaining (green), and the little figure (j) that embeds shows with the painted Balb/c mouse of the same manner bone negative control; (k) higher enlargement ratio with DAPI painted (blueness) with to (green) section of the 29th day of Bone Gla protein immunostaining, the little figure (l) of embedding shows Balb/c mouse bone positive control; (m) with DAPI painted (blueness) with to (green) section of the 29th day of the immunostaining of OB-cadherin, the little figure of embedding shows: (n) Balb/c mouse bone positive control and (o) Balb/c mouse bone negative control; (p) with DAPI painted (blueness) with to (green) section of the 29th day of the immunostaining of collagen-I, the little figure of embedding shows: (q) Balb/c mouse bone positive control and (r) Balb/c mouse bone negative control.(a-f) scale length is 100 μ m, (g-j) be 20 μ m.

Figure 14: during bone forming at the 15th day (d15), the 22nd day (d22) and the 29th day (d29) gene expression analysis to the bone forming marker.L=100bp dna ladder degree.RT-ve=the 29th day is at the RT-negative control that does not have under the situation of reversed transcriptive enzyme with the GapDH primer.The PCR negative control with the GapDH primer of-ve=water consumption substitution template.+ ve=uses the MC-3T3-E1 cell to cultivate 10 days positive control in the bone forming substratum.

Figure 15: use minicomputer x-ray tomography art (minitype CT) assessment to organize mineralising.Bone aggregate mineralization degree at the 29th day assessment alginate globule.(a-b) false color (false colour), the single alginate globule of Xuan Zeing reproduces (3D sectorreconstruction) at the 29th day 3D region at random.The little figure that embeds represents and uses the femoral false color positive control of Balb/c mouse.To the Reduction Level of purple to minimum (black), it represents to arrive firmly soft tissue respectively from the highest (yellow) in the painted demonstration of false color image.(c) the gray scale transitive graph picture of the 29th day alginate globule of demonstration (soft tissue around the red arrow indication mineralising aggregate).The little figure that embeds shows the negative control gray scale transitive graph picture (dotted line represent globule edge) of use without any the alginate globule of cell.(d) false color, the two-dimentional square section of the 29th day alginate globule.Scale length=100 μ m.

Embodiment

Embodiment 1: wrap up human embryo stem cell in the alginate globule

1.1 cell cultures

1.1.1 feeder layer

Former generation rat embryo fibroblast cell (MEF)

Concise and to the point, passed through progress chart I execution method (schedule I killing) in conceived the 13rd day with its execution at female mice (Swiss MF1 strain).Take out the embryo then, and remove their internal organ.At trypsinase/EDTA solution (0.05% trypsinase among the 0.1MPBS/0.53mM EDTA, not calcic or magnesium; Gibco Invitrogen, Life Technologies, Paisley, UK) careful chopping embryo corpse in, it is inoculated in culturing bottle is supplemented with the hot deactivation FBS of 10%v/v, 0.1mM MEM non-essential amino acid solution, 100 U/ml penicillin, 100 μ g/ml Streptomycin sulphates (all derive from GibcoInvitrogen, Life Technologies, Paisley is among high glucose DMEM UK).When cell reaches when being paved with, be gathered into fibrocyte, freezing hot deactivation FBS (all derives from Gibco Invitrogen in containing the high glucose DMEM of 60%v/v, 20%v/v with it, Life Technologies, Paisley, UK) and 20%v/v dimethyl sulfoxide (DMSO) Hybri-Max  (DMSO) (Sigma-Aldrich, Dorset is in the freezing substratum of MEF UK).Be the cultivator embryonic stem cell, preferably be no more than the MEF in three or four generations.

In other substratum same as described above except that penicillin and Streptomycin sulphate, cultivate the MEF cell that thaws in the culture vessel surface of gelatin bag quilt.As before the feeder layer, eliminate the mitogen activation of MEF cell with ametycin.Use the 0.05% trypsinase/0.53mM EDTA among the trypsin 0.1MPBS then, not calcic or magnesium; Gibco Invitrogen, Life Technologies, Paisley, the UK) cell of processing deactivation, and or it is freezing, perhaps transfer to the feeder layer of growing as human embryo stem cell in the 6 hole flat boards.Freezing MEF in the freezing substratum of MEF (scheme is from WiCellResearch Institute Inc, Madison, July 2000).

The cultivation of human embryo stem cell

1.1.2.1 the cultivation of undifferentiated cell

With at least one sky of the former generation MEF cell inoculation of deactivation, then undifferentiated human embryo stem cell is thawed in above-mentioned substratum.Second day, (WiCell ResearchInstitute Inc Madison), was inoculated in it on MEF cell the undifferentiated people H1 cell that thaws, and adopts the cell of the scheme cultivation undifferentiated state of supplier's suggestion.Substratum is by being supplemented with 20%v/v KNOCKOUT ^TMSR, 2mM L-glutaminate, 0.1mM non-essential amino acid solution (all derive from Gibco Invitrogen, LifeTechnologies, Paisley, UK), 0.1mM 2 mercapto ethanol (2ME) (Sigma-Aldrich, Dorset, UK) and 4ng/ml people's recombination basic fibroblast growth factor (bFGF, FGF-2) (157 amino acid) (R﹠amp; D Systems, Oxon, DMEM/F12 substratum UK) is formed.Fed in per two days and raise cell.

The growth rate of these cells is more a lot of slowly than the growth rate of mouse embryo stem cell.Because the meeting in 7-10 days in culture of the MEF cell of deactivation is dead, therefore human embryo stem cell is transferred on the new feeder layer in every 7-10 days.Behind the cell thawing, need about 4-6 week of cost to obtain the inferior culture hole that is paved with, divide plate with cell then.Have only when cell is in the colony, they just grow and keep their undifferentiated state.Individual cells is not grown.Once in a while, some colonies carry out spontaneous differentiation.

1.2 parcel human embryo stem cell in alginate globule (alginate bead)

1.2.1 encapsulation process

, 4-5 undifferentiated with tryptic digestion days human embryo stem cell at room temperature is resuspended in the low viscosity alginic acid of 1.1% (w/v) then ^*(Sigma, UK) (Sigma UK) (all is dissolved among the PBS, pH7.4) in the solution with 0.1% (v/v) pig gelatin.Low viscosity alginic acid is substantially by having 1 → 4 anhydrous-straight chain that the beta-D-mannuronic acid residue is formed, hydrophilic, the colloidal state polyuronide that connects.Adopt Pharmacia peristaltic pump [Amersham Biosciences, UK (Model P-1)], flow velocity with * 20, the drop of 30mm [(carry out autoclaving to pipeline, it is inferior to give a baby a bath on the third day after its birth with 1M NaOH sterilization 30 minutes and with aseptic PBS then)], make cell-gelating soln by peristaltic pump (peristaltic pump), (Becton Dickinson UK) splashes into it CaCl aseptic, room temperature with the pin of 25 bores ₂[100mM calcium chloride (the CaCl in distilled water in the solution ₂) (Sigma, UK) and 10mM N-(2-hydroxyethyl) piperazine-N-(2 ethane sulfonic aicd) (HEPES) (Sigma, UK), pH7.4].Coagulate for colloidal cell-gelating soln at once with CaCl ₂The solution contact forms spherical bead (back diameter 2.3mm expands).Under the room temperature with globule at the CaCl that stirs gently ₂Kept 6-10 minute in the solution.It is inferior that globule is given a baby a bath on the third day after its birth in PBS, puts into then and keep substratum.

Keep culture bag in the substratum at human embryo stem cell and be rolled in not differentiation of human embryonic stem cell in the alginate globule, described human embryo stem cell is kept substratum for being supplemented with 20%v/v KNOCKOUT ^TMSR, 2mM L-glutaminate, 0.1mM non-essential amino acid solution (all derive from Gibco Invitrogen, Life Technologies, Paisley, UK), 0.1mM 2 mercapto ethanol (2ME) (Sigma-Aldrich, Dorset, UK) and 4ng/ml people's recombination basic fibroblast growth factor (bFGF, FGF-2) (157 amino acid) (R﹠amp; D Systems, Oxon, DMEM/F12 substratum UK).The condition of growth is in the moistening incubator, 37 ℃, 5%CO ₂, globule is cultivated under static conditions in the plastics tissue culture ware of standard.The every 3-4 days cells of feeding.Use with colored CoolPix 950 digital cameras (Nikon, Kingston-upon-Thames, inverted microscope UK) (Olympus, Southall, UK) assessment and interrecord structure and morphologic any change.Globule had both contained the aggregate of human embryo stem cell, also contained single human embryo stem cell, and single human embryo stem cell forms colony in globule.

In keeping substratum, after 130 days, in PBS, wash globule twice, then it is dissolved to discharge cell/colony.

1.2.2 the dissolving of alginate globule

To be used to dissolve aseptic depolymerization damping fluid [(Ca2+ exhausts) (50mM two hydration trisodium citrate (Fluka of globule, UK), 77mM sodium-chlor (BDH Laboratory Supplies, UK) and 10mM HEPES)] (20) joined in the globule of washing with PBS 15-20 minute, and stirred gently simultaneously.Solution under 400g centrifugal 10 minutes is used the PBS washing precipitate, and then under 300g centrifugal 3 minutes.

1.3 histology

1.3.1 paraffin embedding

With the human embryo stem cell aggregate in 4% Paraformaldehyde 96 (PFA) fixing 130 day age from globule one hour, remain on then in 0.1% sodiumazide under the room temperature to carry out short-term or prolonged preservation (4 ℃).Before the dehydration, the human embryo stem cell aggregate was placed PBS 15 minutes.Remove all water through the program that improves alcohol concn successively subsequently.Then with pure dimethylbenzene wholly replace ethanol to remove all trace ethanol.At room temperature replacing dimethylbenzene with the saturated dimethylbenzene of paraffin then spends the night.To place baking box (60 ℃) 20 minutes at the human embryo stem cell aggregate in the saturated dimethylbenzene of paraffin then.Use whiteruss wholly replace dimethylbenzene then.The embedding sample is cut into slices (4 μ m) then, spends the night to adhere to Vectabonded under the room temperature ^TM(Vector Laboratories is UK) on the slide glass.

1.3.2 immunocytochemistry

By the alcohol concn that in dimethylbenzene, immerses, reduce gradually, immerse with tap water then, remove deparaffnize from section.Then, will cut into slices and immerse two hydration trisodium citrate damping fluids (10mM carries out high-temperature sterilization in pH6.0), and cooling and dry then is to fetch (retrieve) antigen.Use 3% (v/v) sealing goat or rabbit anteserum (Vector Laboratories) at room temperature as 0.05% among the PBS of one-level thinner (primarydiluent) (w/v) bovine serum albumin (BSA subsequently; Sigma), 0.01% (w/v) NaN ₃(Sigma) the incubation sample is 30 minutes in.

For carrying out immunofluorescence dyeing, use embryonic stem cell marker sample reagent box (Chemicon, International according to the scheme of manufacturers; Cat.no.SCR002).Employed monoclonal antibody is: anti--SSEA-4, and anti--TRA-1-60 and anti--TRA-1-81 (providing in the test kit).For Oct-4 antibody (Santa Cruz Biotechnology), being used in the one-level antibody (1: 300) that dilutes in the one-level thinner spends the night in 4 ℃ of incubation samples, wash subsequently twice, be used in the secondary antibody of diluting in the secondary thinner (goat anti--rabbit 1: 300) (Santa Cruz, International) at room temperature incubation 1 hour in dark, second thinner is made up of 0.05% (w/v) BSA among the PBS.Subsequently, in PBS, wash sample twice, use Vectashield ^TMFixing.(Olympus, Southall UK) observe goods down at IX70 fluorescence inverted microscope.

1.3.2.1 negative control

As in indirect two layers of fluorescent mark, can obtain the negative control sample by saving one-level antibody to detect the background fluorescence of employed secondary antibody.Can accurately explain positive sample with these data subsequently.Negative control can be used for marker is positioned on the fluorescence histogram, thereby discerns the definite position of negative colony and the quantity of estimate sheet clone or polyclonal antibody and cell-surface antigens non-specific binding.

Positive control

For positive control, human embryo stem cell is grown on MEF, uses embryonic stem cell marker test kit immunostaining then.Use the specificity of cell-surface antigens on positive control identification form clone and polyclonal antibody and the positive sample to combine.

RNA extracts and reverse transcription

According to the explanation of manufacturers, use TRIzol reagent (Life Technologies, UK) and RNeasyMini test kit (Qiagen, the total RNA of extraction in 175 days of UK) from the alginate globule, forming and the 260 days human embryo stem cell aggregates.(Invitrogen UK) synthesizes cDNA from the total RNA of 1 μ g in 20 μ l final volume to use reverse transcriptase polymerase chain reaction (RT-PCR).Use few (dt) ₂₀Cause (prime) and carry out the RT reaction, the same cDNA of gene specific primer pcr amplification of the enough different loci of its energy.Under the situation that does not have the cDNA template, carry out negative control.Use Primer Express2 software (Applied Biosystems, UK) design primer.

The RT-PCR sequence is as follows:

Gene	Primer sequence (5 '-3 ')	Annealing temperature (℃)	Amplicon size (bp)
Gene	Primer sequence (5 '-3 ')	Annealing temperature (℃)	Amplicon size (bp)	Oct4	?F：TCTGCAGAAAGAACTCGAGCAA?R：AGATGGTCGTTTGGCTGAACAC	54	?127
Nanog	?F：TGCAGTTCCAGCCAAATTCTC?R：CCTAGTGGTCTGCTGTATTACATTAAGG	55	?91	Oct4	?F：TCTGCAGAAAGAACTCGAGCAA?R：AGATGGTCGTTTGGCTGAACAC	54	?127
Nanog	?F：TGCAGTTCCAGCCAAATTCTC?R：CCTAGTGGTCTGCTGTATTACATTAAGG	55	?91	GAPDH	?F：GTTCGACAGTCAGCCGCATC?R：GGAATTTGCCATGGGTGGA	54	?182

For the mRNA that runs one's home, use glyceraldehyde 3-phosphate dehydro-genase (GAPDH) because according to the show in the embryonic stem cell culture of differentiation GAPDH mRNA more stable than other mRNA sequences of running one's home.By BLAST ( Http:// www.ncbi.nl m.nih.gov/BLAST/) similarity of check primer annealing site and amplicon sequence and other people DNA and cDNA sequence.Find that paired primer annealing site and amplicon sequence are unique for the target human sequence.

In 50 μ l PCR reaction mixtures, MgCl ₂Be respectively 3 and 10mM with the final concentration of dNTP.At Mastercycler  ep (Eppendorf AG, Germany) carry out DNA cloning in: the activation of double-stranded DNA sex change and AmpliTaq Gold archaeal dna polymerase was carried out 10 minutes at 94 ℃, carry out 40 round-robin templates sex change (5 seconds) at 94 ℃ then, carry out primer annealing (for Oct4 and GAPDH at 55 ℃; For Nanog is 55 ℃) and carry out primer extension (30 seconds) at 72 ℃.On 3% (w/v) sepharose, separate the PCR product,, use 100bp gradient (Fermentas) to estimate the size of product by the ethidium bromide fluorescent imaging.

(this system is made up of appended flat UV-light scanning device and CCD camera for Bio-Rad, UK) the digital image of the gel of seizure ethidium bromide staining to use the Fluor-S MultiImager system that is connected with computer.(Bio-Rad UK) analyzes image, and this software can detect single band and subtracting background noise, obtains the complete intensity level that is produced by the product of gene specific amplification to use Bio-Rad Quantity One software.

RT-PCR analyzes the expression of pluripotency marker Oct4 and Nanog in the human embryo stem cell aggregate that (Fig. 7) be presented at 175 days and 260 days.Swimming lane A is the human embryo stem cell aggregate in 175 day age, and swimming B is the human embryo stem cell aggregate in 260 day age, and swimming lane C is a negative control.Use GAPDH to express as internal reference.These results are presented at and surpass in 100 days stage the human embryo stem cell aggregate and still kept the multipotency of human embryo stem cell and do not go down to posterity.These results also support previous immunocytochemistry observed result to the pluripotency marker.

Conclusion and discussion

The embryonic stem cell of reference as a result that obtains can keep undifferentiated state at least 130 days not having feeder cell and do not exist under the situation of feeder cell conditioned medium.The human embryo stem cell encapsulation process provides physical environment, and this physical environment makes no longer needs this feeder cell support.This process of being developed makes it possible to adopt the method cultivator embryonic stem cell that is similar to the Mouse Embryonic Stem Cell Culture method.The cultivation program that is used for human embryo stem cell that the present invention developed makes it possible to realize human embryo stem cell differentiation scheme, this scheme is based on the scheme of now having verified with mouse embryo stem cell, but still do not have to study at human embryo stem cell owing to obtaining the undifferentiated embryonic stem cell that quantity enough is used for these experiments so far.The human embryo stem cell culture systems of being developed provides useful platform for the stdn adjustable systems of the therapeutic product that is used to develop end user's embryonic stem cell.

Embodiment 2: single mouse embryo does the differentiation of (mES) cell

One mouse embryonic stem cell is wrapped in the hydrogel globule (diameter 40-100 μ m), keeping substratum M2[Dulbecco ' s Modified Eagles Medium (DMEM) then, 10% (v/v) foetal calf serum, 100 units/mL penicillin and 100 μ g/mL Streptomycin sulphates, the 2mM L-glutaminate is (by Invitrogen, UK provides), (Sigma is UK) with 1000 units/mLEsgro for the 0.1mM 2 mercapto ethanol ^TM(LIF) (Chemicon, UK)] the middle growth 10 days.Single embryonic stem cell divides, and forms little cell colony (Fig. 8) about 10 days.By being that specific signals stimulates and can make these cytodifferentiation be the mature cell of system of the same race not with fixed kind.For example, for the differentiation that forms bone, adopt following scheme.

Embodiment 3: comparative approach, traditional two-dimentional mouse embryonic stem cell routine are kept and are gone down to posterity and (join Examine document 2 and 3)

E14Tg2a mouse embryo does (mES) clone and is being set at 37 ℃ and 5%CO ₂In the moistening incubator of (h3 7/5) on the tissue culture vessel of 0.1% gelatin bag quilt routine go down to posterity.Undifferentiated mouse embryonic stem cell (＜p20) went down to posterity in per 2 or 3 days, and feed every day raise fresh M2 substratum [Dulbecco ' s Modified Eagles Medium (DMEM), 10% (v/v) foetal calf serum, 100 units/mL penicillin and 100 μ g/mL Streptomycin sulphates, the 2mM L-glutaminate is (by Invitrogen, UK provides), (Sigma is UK) with 1000 units/mL Esgro for the 0.1mM 2 mercapto ethanol ^TM(LIF) (Chemicon, UK)].For separating the mouse embryonic stem cell, (TE) (PBS with preheating washes once then for Invitrogen, UK) 3-5 minute (h37/5) at the trypsinase-ethylenediamine tetraacetic acid (EDTA) (EDTA) that adds requirement behind the sucking-off substratum in the mouse embryonic stem cell.

The two dimension embryoid forms

Embryoid (embryoid body) forms the meticulous preparation that relates to the preceding mouse embryonic stem cell of suspension culture, and this has had detailed record (8; 9; 24; 28-30).Yet the experience of correct condition was measured before the present invention had determined to suspend with E14Tg2a clone.Cell in the monolayer culture thing should be～80% is paved with, and it is 2 or 3 days a culture, and undifferentiated very high with ratio that broken up on morphology.As normally using trypsin treatment mouse embryonic stem cell, but after trypsin acting 2-3 minute rather than 5 minutes the cell mass of visible 100-200 cell.Cell is subsequently at room temperature with centrifugal 3 minutes of 300g (22 ℃, (RT)).Growth produces about 5-7x10 after 2 or 3 days usually in the T75 culturing bottle that is paved with in the M2 substratum ⁶Individual cell, it is suspended in M1 substratum [the Alpha-Modified Eagles Medium (α MEM) of 30mL again, 10% (v/v) foetal calf serum, 100 units/mL penicillin and 100 μ g/mL Streptomycin sulphates] in, then uniformly dispersing the culture dish of the bacteriology grade of two 90mm diameters (Bibby Sterilin, UK) in.For correctly forming embryoid by this method, the cell mass of 10-20 cell is essential, because the three-dimensional aggregate that the maxicell group of individual cells suspension or thousands of cells can lead to errors.At the 3rd day replacing substratum of embryoid formation (h37/5), therefore essential somatomedin exhausts (as L-glutaminate), and toxic metabolite has begun to gather (as ammonia).At the 5th day that cultivates, gather in the crops embryoid by suction from the bacteriology flat board, centrifugal 4 minutes then with 66g.The sucking-off substratum uses the PBS of preheating to replace with flush away trace serum.Cell centrifugal 4 minutes once more with 66g, sucking-off PBS.Wash 3-5 minute (h37/5) back adds 1mL in embryoid TE.The M1 substratum (1mL) that adds preheating then is suspended in the substratum that needs cell as being used for the individual cells suspension that the bone brief summary forms analysis again to stop the tryptic digestion effect.

The brief summary of two dimension bone is analyzed

The bone brief summary of the standard of (31) (bone nodule) forms to analyze and is to use the M1 substratum to carry out as mentioned previously, it constantly mended β adex[10mM β-phospho-glycerol, the dexamethasone (final concentration) of 50 μ g/ml xitix and 1 μ M from the 8th day to the 29th day].The embryoid (dEB) of depolymerization is cultivated 21 days (h37/5) on plastics tissue culture vessel or slide glass, per 2 or 3 days replacing substratum.The bed board density of dEB is every square centimeter 5.208 * 10 ³Individual cell, per 25 cells, 1 μ L substratum.

Embodiment 4: the alginate globule parcel of mouse embryonic stem cell

Undifferentiated mouse embryonic stem cell (mESC) is wrapped in the hydrogel globule (d=2.3mm) of low viscosity alginic acid and 0.1% (v/v) the pig gelatin of 1.1% (w/v).Direction ratio container (aspect ratio vessel) in the 50mL level (HARV) is cultivated about 600 globules in the bio-reactor, contains 10,000 mouse embryonic stem cells in each globule.The velocity of rotation of setting the bioreactor culture thing is 17.5rpm, cultivated 3 days containing keeping in the substratum of leukaemia inhibitory factor (LIF), replace with embryoid then and form substratum, cultivated 5 days, then with containing 2-phosphoric acid-L-xitix (50 μ g/mL), the substratum of the formation bone of β-phospho-glycerol (10mM) and dexamethasone (1 μ M) was cultivated 21 days again.Observe after 29 days that the cell quantity of each globule has increased by 84 times in the culture, and in the alginate globule, formed (mineralised) matrix of mineralising.Osteogenesis is by the immunocytochemistry of von Kossa and alizarin red S dyeing, alkaline phosphatase activities, Bone Gla protein (osteocalcin), and OB-cadherin and type i collagen, RT-PCR and microcomputer x-ray tomography art (little CT) are assessed.These discoveries provide a kind of simple, integrated biological method, are used for producing three-dimensional (3D) mineralized tissue with potential clinical application from the mouse embryonic stem cell renewablely.

Material and method

The mouse embryonic stem cell is cultivated and embryoid forms

The carrying out (32) that the cultivation of E14Tg2a cell and the formation of embryoid are as discussed previously.Concise and to the point, every 2-3 days undifferentiated mouse embryonic stem cells that go down to posterity (＜p20), and feed and raise with keeping substratum every day, substratum kept by being supplemented with 10% (v/v) foetal calf serum (FCS; Invitrogen), 100 units/mL penicillin (Invitrogen), 100 μ g/mL Streptomycin sulphates (Invitrogen), 2mM L-glutaminate (Invitrogen), 0.1mM 2 mercapto ethanol (Sigma, UK) and 1000 units/mL LIF (Chemicon, Chandlers Ford, Dulbecco ' s Modified Eagle ' s Medium (DMEM UK); Invitrogen, Paisley UK) forms.The division embryoid places (the α MEM by alpha-Modified Eagle ' s Medium with cell mass (10-20 cell); Invitrogen), suspended 5 days in the embryoid division culture medium that 10% (v/v) FCS (Invitrogen), 100 units/mL penicillin (Invitrogen) and 100 μ g/mL Streptomycin sulphates (Invitrogen) are formed.

Mineralized tissue and bone brief summary are analyzed

As discussed previously, use the α-MEM (Invitrogen) that is supplemented with 50 μ g/mL 2-phosphoric acid-L-xitix (Sigma), 10mM β-phospho-glycerol (Sigma) and 1 μ M dexamethasone (Sigma) from the 8th day to the 29th day culture, remaining on 37 ℃ and 5%CO ₂In the plastics tissue culture vessel under the condition or carry out the formation (13) of mineralized tissue on the slide glass.Bed board density is 5.2 * 10 ³Individual cell/cm ², per 2 or 3 days replacing substratum.

Parcel and bioreactor culture

Undifferentiated mouse embryonic stem cell is with 1.56 * 10 ⁶Individual cell/mL is suspended in the low viscosity alginic acid (Sigma) of 1.1% aseptic (w/v), 0.1% (v/v) pig gelatin (Sigma) phosphate buffered saline (PBS; PH7.4) in.Cell-gelating soln is passed through peristaltic pump (Model P-1; AmershamBiosciences, Amersham UK), uses the 25-bore that it is splashed into 100mMCaCl from 30mm then ₂, the sterile solution (HEPES of 10mM N-(2-hydroxyethyl) piperazine-N-(2 ethane sulfonic aicd); PH7.4) (all derive from Sigma).At room temperature gelation 6-10 minute formed globule is spherical (the back diameter that expands=2.3mm).(Cellon, Bereldange cultivated 3 days in keeping substratum in LUX) the mouse embryonic stem cell of parcel, changed substratum every day at the direction ratio container bio-reactor of level.Each reactor contains 600 globules, rotates with 17.5rpm at 0-21 days that cultivate, and rotates with 20rpm at 22-29 days that cultivate.Improve speed of rotation to offset the formation of mineralized tissue in the alginate globule, it causes globule to become heavier.From the 3rd day up to the 8th day, with embryoid division culture medium (α MEM, as discussed previously) to feed and raise the bioreactor culture thing, this substratum was mended full at the 6th day, carried out osteoplastic inducing (mending full in every 2-3 days) at the 8th day as previous described fill-in with the formation bone then.

Survival/death is analyzed

Suspension cell or alginate globule at room temperature in the dark place with 4 μ M EthD-1 among the PBS and 2 μ M fluorexon AM solution (Invitrogen) incubations 30 minutes, wash with PBS then.Dead cell is used as negative control.

Cell sample is handled

Will (Nalgene, Hereford UK) go up the contrast two dimension cell culture of growth in 4% (w/v) Paraformaldehyde 96 (PFA at the Flaskette slide glass; BDH Laboratory Supplies) fixes 20 minutes in, in PBS, wash then.At room temperature with the alginate globule in 4% (v/v) Paraformaldehyde 96 (PFA; By BDH Laboratory Supplies, Poole fixes 30 minutes in UK), dewaters in the ethanol that concentration increases gradually then, handles with dimethylbenzene (BDH Laboratory Supplies), then uses paraffin embedding.With the sample serial section (4 μ m) of embedding to Vectabond ^TMThe slide glass of-Bao quilt (VectorLaboratories, Orton Southgate, UK) on.For immunocytochemistry, before fetching antigen, 10mM two hydration trisodium citrate damping fluid (pH6.0 are immersed in the section of dehydration by heating; Sigma) in.Balb/c mouse bone uses the mode identical with the alginate globule to process, with comparing.

Histology

Phenodin by routine/eosin dyeing detects aqueous two-dimentional cell culture or the histology of taking off paraffin section of the cell of growing in the alginate globule.

Alizarin red S and von Kossa dyeing

As described in other places, moisture (hydrated) two-dimentional cell culture and paraffin section are with alizarin red S or von Kossa tinting material dyeing (33).The painted section of Von Kossa Kernechrot counterstaining, continuously dehydrating is removed in dimethylbenzene, and is fixing in DPX then.Balb/c mouse bone is used as contrast, uses the mode identical with the alginate globule that it is processed.

Immunocytochemistry

Moisture two-dimentional cell culture or paraffin section are immersed 10mM two hydration trisodium citrate damping fluid (pH6.0; Sigma) in, autoclaving is at room temperature used 0.2% (v/v) Triton-X-100 (BDH Laboratory Supplies) incubation 45 minutes subsequently to fetch antigen then.As shown in table 1, sample is used following incubation successively: a) as 0.01% among the PBS of one-level thinner (w/v) NaN ₃(Sigma) in, under room temperature, be used in 0.05% (w/v) bovine serum albumin (BSA; Sigma) 3% in (v/v) sealing goat or rabbit anteserum (Vector Laboratories) incubation 30 minutes; B) be incubated overnight in 4 ℃ with the one-level antibody that in the one-level thinner, dilutes at some stem cells and scleroblast marker; C) with secondary antibody in secondary thinner [0.05% among the PBS (w/v) BSA] at room temperature in dark place incubation 1 hour.Wash sample with PBS then, again with containing 1.5 μ g/mL 4 ', the Vectashield of 6 diamidines-2-phenylindone (DAPI) ^TM(Vector Laboratories) is fixing.Balb/c mouse bone is used as contrast, uses the mode identical with the alginate globule that it is processed.

Reverse transcription-pcr

(Qiagen Ltd, Crawley UK) extract total RNA to use total RNA separating kit.Use the total RNA of 1 μ g, random primer and have the AMV reversed transcriptive enzyme of Rnase inhibitor that (Promega UK) carries out the synthetic of strand cDNA.The PCR reaction buffer is by 1xAmplitaq Gold damping fluid, 2mMMgCl ₂, 200 μ M dNTPs, (AppliedBiosystems, Warrington UK) form with every kind of primer (Invitrogen) of 500nM the Amplitaq Gold archaeal dna polymerase of 1.25 units.(32) as discussed previously use the cDNA of 2 μ L (from 20 μ L) to carry out the RT-PCR analysis; Listed in primer sequence such as the table 1.Use the positive control of MC-3T3-E1 cell in the substratum that forms bone, to cultivate 10 days.Remove reversed transcriptive enzyme as negative control.

Table 1:

Antigen	One-level	Secondary	Sealing serum	1	Sealing serum 2
Antigen	One-level	Secondary	Sealing serum	1	Sealing serum 2	Oct-4	1: 80 rabbit polyclonal (Santa Cruz Biotech, Calne, UK)	1: 80 goat antirabbit FITC (Chemicon, Chandlers Ford, UK)	3% normal goats serum (Vector Laboratories, UK)	Inapplicable
CD9	1: 750 rat mono-clonal (Research Diagnostics, Concord, MA, USA)	1: 80 goat Chinese People's Anti-Japanese Military and Political College mouse rhodamine. (Chemicon)	3% normal goats serum (Vector Laboratories)	1.5% normal mouse serum (Serotec, Kidlington, UK)		Oct-4	1: 80 rabbit polyclonal (Santa Cruz Biotech, Calne, UK)	1: 80 goat antirabbit FITC (Chemicon, Chandlers Ford, UK)	3% normal goats serum (Vector Laboratories, UK)	Inapplicable
CD9			3% normal goats serum (Vector Laboratories)	1.5% normal mouse serum (Serotec, Kidlington, UK)	Flk-1	1: 200 mouse monoclonal (Santa Cruz biotech)	1: 80 anti-mouse FITC of rabbit (Dako, High Wycombe, UK)	3% normal rabbit serum (Vector Laboratories)	1.5% normal mouse serum (Serotec)
The OB-cadherin	1: 50 goat polyclone (Santa Cruz Biotech)	1: 100 anti-goat FITC of rabbit (Sigma)	3% normal rabbit serum (Vector Laborato ries)	Inapplicable	Flk-1	1: 200 mouse monoclonal (Santa Cruz biotech)	1: 80 anti-mouse FITC of rabbit (Dako, High Wycombe, UK)	3% normal rabbit serum (Vector Laboratories)	1.5% normal mouse serum (Serotec)
The OB-cadherin	1: 50 goat polyclone (Santa Cruz Biotech)	1: 100 anti-goat FITC of rabbit (Sigma)	3% normal rabbit serum (Vector Laborato ries)	Inapplicable	Bone Gla protein	1: 50 goat polyclone (Santa Cruz biotech)	1: 100 anti-goat FITC of rabbit (Sigma)	3% normal rabbit serum (Vector Laboratories)	Inapplicable
Type i collagen	1: 50 rabbit polyclonal (Santa Cruz biotech)	1: 100 goat antirabbit FITC (Chemicon)	3% normal goats serum (Vector Laborato ries)	Inapplicable	Bone Gla protein	1: 50 goat polyclone (Santa Cruz biotech)	1: 100 anti-goat FITC of rabbit (Sigma)	3% normal rabbit serum (Vector Laboratories)	Inapplicable
Type i collagen	1: 50 rabbit polyclonal (Santa Cruz biotech)	1: 100 goat antirabbit FITC (Chemicon)	3% normal goats serum (Vector Laborato ries)	Inapplicable	Gene	FWD 5 '-3 '	RVS 5 '-3 '	Length (bp)	The PCR condition
Gapdh	CATCACCATCTTC CAGGAGC	ATGCCAGTGAGCT TCCCGTC	474	94 ℃ following 10 minutes, 35 round-robin: 94 ℃ 30 seconds, 60 ℃ 40 seconds, 72 ℃ 60 seconds and 72 ℃ 10 minutes.	Gene	FWD 5 '-3 '	RVS 5 '-3 '	Length (bp)	The PCR condition
Gapdh	CATCACCATCTTC CAGGAGC	ATGCCAGTGAGCT TCCCGTC	474		Cbfa-1	CAGTTCCCAAGCA TTTCATCC	TCAATATGGTCGC CAAACAG	444	94 ℃ 10 minutes, 36 round-robin: 94 ℃ 60 seconds, 45 ℃ 60 seconds, 72 ℃ of 60 seconds and 72 ℃ 10 minutes.
Collagen I	GAACGGTCCACGA TTGCATG	GGCATGTTGCTAG GCACGAAG	167	94 ℃ following 10 minutes, 30 round-robin: 94 ℃ 60 seconds, 60 ℃ 60 seconds, 72 ℃ of 60 seconds and 72 ℃ 7 minutes.	Cbfa-1	CAGTTCCCAAGCA TTTCATCC	TCAATATGGTCGC CAAACAG	444

Collagen I I	CTGCTCATCGCCGCGGTCCTA	AGGGGTACCAGG TTCTCCATC	432 (montage A, early developments) 225 (montage B, ripe cartilage)	94 ℃ following 10 minutes, 30 round-robin: 94 ℃ 60 seconds, 60 ℃ 60 seconds, 72 ℃ of 60 Miao ﹠amp; 72 ℃ following 7 minutes
Collagen I I	CTGCTCATCGCCGCGGTCCTA	AGGGGTACCAGG TTCTCCATC			Bone Gla protein (OCN)	CGGCCCTGAGTCTGACAAA	ACCTTATTGCCCT CCTGCTT	193	94 ℃ 10 minutes, 30 round-robin: 94 ℃ 60 seconds, 60 ℃ 60 seconds, 72 ℃ of 60 seconds and 72 ℃ 7 minutes.

MTS analyzes

Adopt CellTiter 96  AQueous One Solution Reagent to analyze (Promega, Southampton, UK) Metabolic activity between the whole incubation period of assessment.Use grows in culturing bottle culture (two dimension) or is wrapped in the mouse embryonic stem cell generation typical curve of the dose known amounts in the alginate globule (three-dimensional).Carry out negative control (acellular).All tests are all three different occasions, carry out in duplicate, and for each test, all measure in quadruplicate.Concise and to the point, the mouse embryonic stem cell that two dimension is cultivated is at 37 ℃ of MTS reagent incubations 2 hours of keeping substratum and 40 μ L in 24 hole flat boards with 200 μ L no phenol red.Have only the two dimension reaction to stop by 10% (v/v) sodium lauryl sulphate (SDS) that adds 50 μ L.Similarly, select three alginate globules at random, put it in the different holes of 24 hole flat boards, then at 37 ℃ of MTS reagent incubations 4 hours of keeping substratum and 60 μ L with 300 μ L no phenol red.Get 100 μ L and be transferred in the 96 hole flat boards from each reaction, (Dynex Technologies, Worthing is UK) in the 450nm reading to use MRX II plate reader then.

DNA is quantitative

Use the total dna content of DNA specificity dyestuff Hoechst 33258 (Sigma) mensuration, with its indirect method as cell quantity in the assessment alginate globule with the sample of protease K digesting.Concise and to the point, globule dissolving 20 minutes in depolymerization damping fluid (20) at room temperature, with 400g centrifugal 10 minutes then, collecting cell precipitated, and washs with PBS.Be deposited in quick-frozen in the liquid nitrogen, preserve up to analyzing down at-80 ℃ then.For carrying out DNA analysis, be deposited in 100mM dipotassium hydrogen phosphate (Sigma) solution that contains 50 μ g/mL Proteinase Ks (Sigma), to digest under 37 ℃ and spend the night.After the hot inactivated proteases K and with 12, centrifugal 10 minutes of 000g, 100 μ L supernatant liquors are mixed with Hoescht 33258 solution (2 μ g/mL) of 100 μ L.At last, use MFX microtitre panel fluorescent meter (Dynex Technologies) with 365nm excitation wavelength, 460nm emission wavelength to 100 μ L sample readings.Use height polymeric calf thymus DNA (Sigma) to produce working curve.At the 0th day and the 29th day that cultivates, sample is bipartite to be used for three and independently to test.

The quantitative sodium alizarinsulfonate analysis of mineralising

The alizarin red S (ARS) of the mineralising of the mouse embryonic stem cell that is wrapped is analyzed in whole culturing process and is undertaken quantitatively by the method (34) of transforming people such as Gregory.Concise and to the point, 100 globules with 10% (v/v) formaldehyde fixed 30 minutes, were dissolved 20 minutes in depolymerization damping fluid (20) then.By reclaiming cell precipitation in centrifugal 10 minutes, in the mode identical it is dyeed then with two-dimentional culture with 400g.

Alkaline phosphatase (ALPase) activity

By 37 ℃ in the dark place alkaline phosphatase damping fluid (pNPP with 150 μ L; Sigma) and the phosphoric acid p-nitrophenol solution incubation cell of 150 μ L or globule detected the alkaline phosphatase activities that is incubated in the culturing bottle culture or is wrapped in the mouse embryonic stem cell in the alginate globule (n=6) in 30 minutes.By in every hole, adding the 0.5N NaOH solution termination reaction of 100 μ L, from each reaction, get 100 μ L then and transfer in the hole of 96 hole flat boards, use MRX II plate reader (DynexTechnologies) in the 410nm reading.

Imaging

Use dispose CoolPix 950 digital cameras (Nikon, Kingston-upon-Thames, IX70 inverted microscope UK) (Olympus, Southall, UK) or BX60 vertical (Olympus) microscope that disposes Axiocam (Zeiss) obtain image.Image does not manually strengthen; But be to use 7.0 pairs of images of Adobe Photoshop to gather (crop).The color card of survival/death uses Bio-Rad MRC600 confocal microscope in 30 minutes preparation process (COMOS software (Bio-Rad, UK) processing are used in UK) imaging then for Bio-Rad/Zeiss, Welwyn-Garden-City.

Miniature-CT

Use is set at Phoenix x-ray v|tome|x computed tomography machine (the Phoenix x-ray 3D Imaging System of 70kV, 160 μ A and respective alignment, Fareham UK) carries out miniature-CT and analyzes to reproduce the three-dimensional mineralising aggregate that (reconstruct) forms in the alginate globule.Use a detector acquisition image, and at 360 ° of internal rotation, each cross section 6.75 μ m of being separated by.Use at first by Siemens, the Sixtos software of Germany exploitation produces 3-d reproduction.Use the negative control of the alginate globule that does not contain the cell that is wrapped and the positive control of use Balb/c mouse pup bone chip.

Statistical study

The result is expressed as mean value ± standard error of the mean (SEM), and user's difference analysis (ANOVA) is analyzed to the result.O'clock think to have significance,statistical in P＜0.05.

The result

To carrying out the assessment of form, phenotype (surface and molecule) and functional (mineralization degree) from being wrapped in the three-dimensional mineralized tissue that alginate globule neutralization is incubated at the mouse embryonic stem cell in the HARV bio-reactor.In contrast, we cultivate the mouse embryonic stem cell according to traditional scheme that forms the bone brief summary in culturing bottle (two dimension) culture, have repeated before result displayed (31), thereby have confirmed to take place to form the differentiation (data not shown) of bone.

The morphology of the mouse embryonic stem cell that is wrapped characterizes

Dispersive is not broken up the mouse embryonic stem cell be wrapped in (approximately 10,000 cells of each globule) in the alginate hydrogel globule that mean diameter is 2.3mm.In keeping substratum, cultivate after 3 days, be dispersed in mouse embryonic stem cell in the alginate globule at the beginning and formed that number of cells is a 4-10 cell, (Fig. 1 a) for the colony of diameter between 20-50 μ m.These clusters are for sphere, dish type or fusiformis, are evenly distributed everywhere at globule, and (Fig. 1 a) but seldom be positioned at the place that is close to the globule outside surface.Removed in the 3rd day LIF, then EB form cultivate 5 days in the substratum after, most of colony shows consistent outward appearance, and being presented at cell quantity and all increases (Fig. 1 b) to some extent of whole size in " pocket (pockets) " discrete in the alginate matrices, the magnitude range of colony is at diameter 50-400 μ m.By the 22nd day that cultivates, colony was very closely piled up.Most of big colony is positioned at globule center (Fig. 1 c), can see the zone that does not contain any cell material in the periphery.Cultivate after 29 days, the diameter of colony has surpassed 500 μ m.

Cell growth and Metabolic activity

Along with the colony size increases, the cell survival of the mouse embryonic stem cell that is wrapped does not obviously reduce along with incubation time.At the 3rd day, limited necrocytosis sign appears, and it shows as a little red cell (Fig. 2); But most cells begin to form colony discrete, survival.Though the colony size increases along with incubation time, significantly do not increase in the quantity of initial 3 all colonies of cultivating, although viability very high (Fig. 2) in fact.Finally, cultivate after 29 days, when obviously visible survival colony is quantitatively more than the 22nd day, also bigger when cultivation is more early stage than them.Have quantity metabolic activity, undifferentiated mouse embryonic stem cell in each globule when detecting the 0th day that the amount of DNA in the single globule assesses and be 10,287 ± 228 cell (mean value ± SE in each globule; N=2, each revision test is analyzed 150 globules).In the HARV bio-reactor, cultivate after 29 days, 859,716 ± 13,492 cell (mean value ± SE are arranged in each globule; N=6), it shows from cultivation and begins to have increased by 84 times.The change of metabolic activity demonstrates with the stage of cultivating, employed type of culture medium and to feed the time of raising relevant.From the 0th day to the 3rd day, globule is incubated to be kept in the substratum, the Metabolic activity of each globule remain unchanged (Fig. 2).At the 3rd day, form the substratum replacement with embryoid and keep substratum, as shown in Figure 2, the metabolic activity that can observe each globule obviously increases (p＜0.05).At the 8th day, add division culture medium, as shown in Figure 2, the Metabolic activity to the of each globule slightly reduced in 15 days, was only obviously increasing (p＜0.05) by the 29th day.But owing to the quantity of cell in the 29th day alginate globule of cultivating has increased by 84 times, so the metabolic activity of each cell does not increase.

ALPase amount active and mineralising is used to indicate in the substratum of formation bone during the bone forming differentiation of the formation bone of (cultivation the 15th day to the 29th day).The ALPase activity has reduced by 3 times (p＜0.05) (Fig. 2) between the 15th day and the 29th day that cultivates.On the contrary, as shown in Figure 2, the amount of mineralising in each globule (based on the light absorption ratio of 410nm) obviously increases (p＜0.05), from the 15th day 0.0021 ± 0.0003 be increased to the 29th day 0.0999 ± 0.0035 (mean value ± SE).The light absorption ratio reading is standardized as each globule, but actual read number is to use the mineralising amount of 100 globules to obtain at each reading.

The sign of not breaking up mouse embryonic stem cell and embryoid

Expression at the 3rd day Oct-4 (in the nucleus) that cultivates and CD9 (on cell surface) proves that the mouse embryonic stem cell that is wrapped between the initial 3 days incubation period of keeping in the substratum keeps not phenotypic differentiation (Fig. 3 a-c).In addition, form the stage at embryoid, the mouse embryonic stem cell that is wrapped showed at the 8th day expresses Flk-1, a kind of mesoderm marker (Fig. 3 d).

Three-dimensional mineralized tissue forms

By detecting a series of sections of alginate globule, the character of the three-dimensional mineralized tissue that detail knowledge was formed in the alginate hydrogel by the mouse embryonic stem cell that is wrapped in the formation bone stage (15-29 days) of cultivating.Fig. 4 a-h shows that shown in dark alizarin red S and von Kossa dyeing, three-dimensional mineralized tissue just obviously formed as far back as the 22nd day, and further developed to the 29th day in the alginate globule.Obviously, sample contains a high proportion of mineralized tissue, and it is penetrated into whole section.Between the 22nd day and the 29th day that cultivates, observe the variation of staining power.Especially at bone forming mid-term (the 22nd day), painted being organized in of alizarin red S is the redness of homogeneous (Fig. 4 c-d) on the color, but do not reach the red/black degree shown in the mouse bone positive control.In addition, the 22nd day sample contains the tissue that diameter range is 1 00 to 300 μ m, and wherein the width in mineralising zone is at 50-100 μ m.On the contrary, in the latter stage (the 29th day) in bone forming stage, shown in the dyeing of Hematorylin/eosin, the alginate globule contains the bigger aggregate (Fig. 4 e-f) of organizing; The size of maximum tissue slice is greater than 500 * 500 μ m.As the confirmation of viability dyeing institute, some region list of formed tissue reveals necrosis, but major part all is (Fig. 2) of surviving.In addition, the tissue that is produced trends towards occupying the center of globule, and highly neat, has the edge (Fig. 4 e) of cylindricality cell.At last, at the 29th day (Fig. 4 g-h), formed mineralized tissue reached the red/black alizarin red S staining power as shown in positive control (Fig. 4 a-b).

Also by the formation of immunocytochemistry by mineralized tissue in the expression study alginate hydrogel of assessment bone specific marker thing OB-cadherin, type i collagen and Bone Gla protein.Detected the expression (Fig. 4 i-k) of the OB-cadherin of sign scleroblast (35) at the 15th, 22 and 29 day that cultivates, it is widespread distribution in the bulk zone of formed tissue.The edge that most dyeing is confined to organize, here groups of cells is made into the column form.Mineralising section periphery at the same tissue samples of OB-cadherin stained positive detects Bone Gla protein dyeing (Fig. 4 m).At last, also detect type i collagen, though to compare level lower with mouse bone positive control, and only at the 29th day visible (Fig. 4 p), this may be because the sensitivity of employed polyclonal antibody is lower.Express confirmation immunocytochemistry result by analyzing gene.Especially, RT-PCR proves that (Fig. 5) Cbfa-l and type i collagen in the 15th, 22 and 29 day globule express.Found IIA Collagen Type VI (it is of short duration embryo's form (21)) and Bone Gla protein expression at the 15th, 22 and 29 day; The similar intensity of the expression demonstration of Bone Gla protein and positive control (MC-3T3-E1 cell) in the 29th day globule.

Organize mineralising by miniature-CT analysis and evaluation.Miniature-CT image by the negative control that places the alginate globule of keeping the mouse embryonic stem cell that is wrapped not containing of substratum to form produces the image with very little contrast, and this shows the dense material (Fig. 6) that shortage can attenuate X-rays.On the contrary, the mineralized tissue that is formed by the mouse embryonic stem cell in the alginate globule provides suitable contrast.Except that the bone aggregate of densification, in the 15th, 22 day (data not shown) and the 29th day (Fig. 6), also detect the surface " shell " of alginate globule by miniature-CT, it draws out the profile of alginate globule periphery.The globule shell contains low-level dense material (purple), and the mineralising bone aggregate in the globule itself shows high-caliber decay (yellow) at their center, and along with the increase of bone aggregate core distance, decay reduces.To the degree (Fig. 6) of the femoral positive control imaging of mouse with the comparison mineralising.Thereby the alginate globule of selecting is at random carried out the 3-d reproduction that complete scanning provides mineralising tissue regions in the alginate globule.At the 15th day, do not see the mineralized tissue aggregate, but, can see the discrete little aggregate of 14 diameters less than 50 μ m by the 22nd day.But at the 29th day, 44 ± 7 (mean value ± SE of magnitude range from 50 to 250 μ m; N=2) individual mineralized tissue aggregate (Fig. 6) exists.These mineralising aggregates are surrounded by soft tissue as shown in Figure 4, its in Fig. 6 (red arrow) can by faint be identified as around the mineralising aggregate than dark areas.

Discuss

The cultivation of embryonic stem cell is hindered by the high maintenance expense, and this is that it keeps is the sectional process, need and depend on operator's decision through the operator of specialized training.Now, with monolayer culture, its residing microenvironment is owing to batch-type is cultivated, frequent user gets involved and cultivate exhausting fast of zone and variation to some extent on tissue culturing plastic's container for the mouse embryonic stem cell.Recently, other investigator has also emphasized the problem that traditional embryonic stem cell is cultivated, and complete solution (36) is provided.In this report, we have confirmed new bioprocess, and undifferentiated by this mouse embryonic stem cell forms three-dimensional mineralized tissue in the alginate globule in complete procedure, and it uses the HARV bio-reactor, does not need to get involved and cultivate operation.

In the maintenance stage that the mouse embryonic stem cell is cultivated, it is essential keeping multipotency and cell survival, and it realizes (4) by there being LIF.Therefore, must guarantee LIF infiltration alginate globule, it is considered to " semisolid ", and calcium distributes and the unitary arrangement of polysaccharide is all inhomogeneous.Have calcium and alginate gradient in the globule, this gradient is launched (37) from surperficial shell (maximum concentration) to globule center (weak gelling zone).As if what colony is these concentration gradients can be interpreted as is being grown from globule shell 500 μ m places.The prepared permeable molecular weight of alginate globule is the albumen (38) of 68kDa, can allow for example diffusion (39 of LIF; 40).By in calcium chloride solution, carrying out gelation 6 to 10 minutes, 600 globules of every batch of preparation.The gelation of alginate is reaction-diffusion processes, and wherein calcium and alginate are crossed the borderline phase mutual diffusion of forming constant (constant constituting) and are called Ca to form ⁺⁺The rock steady structure of-alginate jelly network.Have reason to think that the surperficial shell on the globule forms (because all globules are kept perfectly) all the time, therefore with calcium chloride solution duration of contact short globule form the time less of calcium-alginate gradient, have the zone (37) of bigger weak gel at the center of globule.

Cultivate 5 days in embryoid formation substratum after, the colony size significantly increases in the alginate globule, and diameter reaches 400 μ m in some cases, and viability does not have obviously to reduce.Colony evenly grows in " pocket " discrete in the globule, it is reported that this more is of value to growth (37).Even we have wrapped up undifferentiated mouse embryonic stem cell, and use traditional suspension process not form embryoid, but the expression proof of Flk-1 antigen in culture grown mesoderm (23 during cultivating 3-8 days; 41).

Show in the expression of early stage (the 15th day) the OB-cadherin of osteogenesis and in the dimensional culture thing, to have scleroblast (42).These scleroblasts were (esterase activity) of survival at the 15th day and have metabolic activity (dehydrogenase activity).Metabolic activity comes and go in the training period.When the differentiation that forms bone begins (the 8th day), the metabolic activity height of each globule reached low spot at the 15th day, and it reaches highest level with the ALPase activity and mineralising is relevant near its minimum level.Along with osteogenesis progress (15 to 29 days), observe that (each globule) ALPase is active to be reduced, mineralising strengthens, this with other model of osteoblast differentiation and growth in shown consistent (43).Except that other function, the ALPase activity is considered to increase local inorganic phosphate salt level in the bone tissue, destroys the hydroxyapatite crystal growth inhibitor and helps phosphate cotransporter (44).The osteogenesis later stage may be that scleroblast is captured in the excretory matrix, thereby and significantly reduces the stage that its Metabolic activity turns to resource mineralising.The active reduction of ALPase in 22 and 29 days, the low metabolic activity of the growth of mineralising and each cell showed that this stage cell phenotype may be the osteoblastic phenotype of maturation.(the 29th day) detects Bone Gla protein, OB-cadherin and the proteic fact of type i collagen and further confirmed this point when osteogenesis finishes.People such as Shimko (45) induce the mouse embryonic stem cell not have embryoid to form towards the bone differentiation, the osteogenesis that is not considered to routine that the mineralising that causes such as themselves are admitted.The generation that they report Bone Gla protein and type i collagen all is delayed, and ALPase is active inconsistent with the normal bone generation.On the contrary, conventional three-dimensional osteogenesis has taken place in our digital proof, and the level that shows as ALPase reduces and expression bone specific proteins, and the OB-cadherin was early promptly being expressed to the 15th day.

The expression of Bone Gla protein is of short duration in embryonic bone, but it is one of albumen the abundantest in the adult bone, and combines (46 in calcium dependent mode with hydroxylapatite; 47).The bone of (woven) of interweaving shows as irregular collagenous fiber bundle, huge and numerous osteocytes, and the delay that occurs with the small pieces of irregular distribution, mixed and disorderly calcification (48).In this research, with annular with at three-dimensional tissue's aggregate marginal existence, this was consistent with miniature-CT result at the 22nd and 29 day Bone Gla protein.Mineralized tissue is formed by concentrate (bone development) of phosphorite crystal in these observations prompting alginate globules, and may be positioned at the leading edge (adult's lamellar bone) in bone sample forward position.It is most of for to have the scleroblast (49) of multiplication capacity that our data are known cell by inference, and piled up hydroxylapatite.It is generally acknowledged that the multipotency progenitor cell is divided into sophisticated osteocyte and carries out according to the stage of propagation, extracellular matrix formation and mineralising, it is with a small amount of apoptosis (50) that sees in the ripe bone brief summary.

RT-PCR analyzes the mineralising osseous tissue of further alleged occurrence differentiation in latter stage, and it has the obvious phenotype of osteogenetic terminal point, and this phenotype is for expressing Cbfa-l, the ripe scleroblast (49 that the mitotic division of type i collagen and Bone Gla protein is active; 51).Expressing embryo's II Collagen Type VI (splice variant A) between the differentiation phase of the formation bone of mouse embryonic stem cell is normal (21; 52), and similarly, also once reported 7th day to the 21st day expression (53) of Bone Gla protein, be equivalent to the 15th day to the 29th day in this research in the differentiation that forms bone.Lack any sophisticated II Collagen Type VI (splice variant B) and show and do not have to become human cartilage, and osseous tissue mainly is made up of type i collagen.

This method reorganization is used for human embryo stem cell causes its clinical application probably.Especially, for operation technique, for example lumbar vertebra breaks away from, it needs the spongy bone graft to repair the lysis (54) of 3-4mm, contain from 10,44 ± 7 (mean value ± SE, n=2) the single alginate globule of individual mineralising aggregate (diameters=2.3mm) can provide enough materials to be used to repair this defective of 000 embryonic stem cell.In addition, the possible direct injection alginate jelly that is full of mineralized tissue enters into defect area (55-57).Present method provides and has been different from the noticeable useful optional method that traditional embryonic stem cell is cultivated, and the bottleneck that provides extensive three-dimensional tissue to be used for clinical application has been provided.In a word, we provide a kind of simple, integrated method that the mouse embryonic stem cell produces three-dimensional mineralized tissue that is used for never breaking up, and its minimal dependence operator's intervention provides repeatably result, is easy to expansion scale and on-line monitoring.

Embodiment 5: the cryopreservation of the cell that is wrapped

Use the method (59) of people (2004) records such as Stensvaag, before freezing step, increase DMSO concentration gradually.With the further undercooling of low temperature test tube to-7.5d ℃, nucleation then.Thereafter, sample cools off with 0.25 ℃/minute speed, is stored in the liquid nitrogen then.The viability of the cell that quantitative (CLSM) technology of use confocal microscope and NITS analysis and evaluation are wrapped.

Reference

(1)Ulloa-Montoya?F，Verfaillie?CM，Hu?WS.Culture?systems?for?pluripotent?stem?cells.J?BiosciBioeng?2005?Jul；100(1)：12-27.

(2)Smith?TA，Hooper?ML.Medium?conditioned?by?feeder?cells?inhibits?the?differentiation?ofembryonal?carcinoma?cultures.Exp?Cell?Res1983?May；145(2)：458-62.

(3)Smith?AG，Hooper?ML.Bufalo?rat?liver?cells?produce?a?diffusible?activity?which?inhibits?thedifferentiation?of?murine?embryonal?carcinoma?and?embryonic?stem?cells.Dev?Biol?1987?May；121(1)：1-9.

(4)Smith?AG，Heath?JK，Donaldson?DD，Wong?GG，Moreau?J，Stahl?M，et?al.Inhibition?ofpluripotential?embryonic?stem?cell?differentiation?by?purified?polypeptides.Nature?1988?Dec15；336(6200)：688-90.

(5)Pesce?M，Gross?MK，Scholer?HR.In?line?with?our?ancestors：Oct-4?and?the?mammalian?germ.Bioessays?1998?Sep；20(9)：722-32.

(6)Nichols?J，Zevnik?B，Anastassiadis?K，Niwa?H，Klewe-Nebenius?D，Chambers?I，et?al.Formationof?pluripotent?stem?cells?in?the?mammalian?embryo?depends?on?the?POU?transcription?factor?Oct4.Cell?1998Oct?30；95(3)：379-91.

(7)Niwa?H，Miyazaki?J，Smith?AG.Quantitative?expression?of?Oct-3/4?defines?differentiation，dedifferentiation?or?self-renewal?of?ES?cells.Nat?Genet?2000?Apr；24(4)：372-6.

(8)Manin?GR，Evans?MJ.Differentiation?of?clonal?lines?of?teratocarcinoma?cells：formation?ofembryoid?bodies?in?vitro.Proc?Natl?Acad?Sci?U?S?A?1975?Apr；72(4)：1441-5.

(9)Desbaillets?I.Embryoid?Bodies：an?in?vitr?omodel?of?mouse?embryogenesis.ExperimentalPhysiology?2000.

(10)Leahy?A，Xiong?JW，Kuhnert?F，Stuhlmann?H.Use?of?developmental?marker?genes?to?definetemporal?and?spatial?patterns?of?differentiation?during?embryoid?body?formation.J?Exp?Zool?1999?Jun15；284(1)：67-81.

(11)Sottile?V，Thomson?A，McWhir?J.In?vitro?osteogenic?differentiation?of?human?ES?cells.Cloning?Stem?Cells?2003；5(2)：149-55.

(12)Phillips?BW，Belmonte?N，Vernochet?C，Ailhaud?G，Dani?C.Compactin?enhancesosteogenesis?in?murine?embryonic?stem?cells.Biochem?Biophys?Res?Commun?2001?Jun?8；284(2)：478-84.

(13)Buttery?LD，Bourne?S，Xynos?JD，Wood?H，Hughes?FJ，Hughes?SP，et?al.Differentiation?ofosteoblasts?and?in?vitro?bone?formation?from?murine?embryonic?stem?cells.Tissue?Eng?2001?Feb；7(1)：89-99.

(14)Zandstra?PW，Nagy?A.Stem?cell?bioengineering.Annu?Rev?Biomed?Eng?2001；3：275-305.

(15)Abbott?A.Cell?culture：biology′s?new?dimension.Nature?2003?Aug?21；424(6951)：870-2.

(16)Yamada?KM，Clark?K.Cell?biology：survival?in?three?dimensions.Nature?2002?Oct24；419(6909)：790-1.

(17)Gerecht-Nir?S，Cohen?S，Itskovitz-Eldor?J.Bioreactor?cultivation?enhances?the?efficiency?ofhuman?embryoid?body(hEB)formation?and?differentiation.Biotechnol?Bioeng?2004?Jun?5；86(5)：493-502.

(18)Chang?TM.SEMIPERMEABLE?MICROCAPSULES.Science?1964?Oct?23；146：524-5.

(19)Lim?F，Moss?RD.Microencapsulation?of?living?cells?and?tissues.J?Pharm?Sci?1981Apr；70(4)：351-4.

(20)Magyar?JP，Nemir?M，Ehler?E，Suter?N，Perriard?JC，Eppenberger?HM.Mass?production?ofembryoid?bodies?in?microbeads.Ann?N?Y?Acad?Sci?2001?Nov；944：135-43.

(21)Tanaka?H，Murphy?CL，Murphy?C，Kimura?M，Kawai?S，Polak?JM.Chondrogenicdifferentiation?of?murine?embryonic?stem?cells：Effects?of?culture?conditions?and?dexamethasone.J?CellBiochem?2004?Oct?15；93(3)：454.

(22)Ma?HL，Hung?SC，Lin?SY，Chen?YL，Lo?WH.Chondrogenesis?of?human?mesenchymal?stemcells?encapsulated?in?alginate?beads.J?Biomed?Mater?Res?2003?Feb?1；64A(2)：273-81.

(23)Dang?SM，Kyba?M，Perlingeiro?R，Daley?GQ，Zandstra?PW.Efficiency?of?embryoid?bodyformation?and?hematopoietic?development?from?embryonic?stem?cells?in?different?culture?systems.Biotechnol?Bioeng?2002?May?20；78(4)：442-53.

(24)Reubinoff?BE，Pera?MF，Fong?CY，Trounson?A，Bongso?A.Embryonic?stem?cell?lines?fromhuman?blastocysts：somatic?differentiation?in?vitro.Nat?Biotechnol?2000?Apr；18(4)：399-404.

(25)Xu?C，Inokuma?MS，Denham?J，Golds?K，Kundu?P，Gold?JD，et?al.Feeder-free?growth?ofundifferentiated?human?embryonic?stem?cells.Nat?Biotechnol?2001?Oct；19(10)：971-4.

(26)Beresford?JN，Graves?SE，Smoothy?CA.Formation?of?mineralized?nodules?by?bone?derivedcells?in?vitro：a?model?ofbone?formation？Am?J?Med?Genet?1993?Jan?15；45(2)：163-78.

(27)Grant?GT，Morris?ER，Rees?DA，Smith?PJC，Thom?D.BiologicalInteractions?BetweenPolysaccharides?and?Divalent?Cations：The?Egg-Box?Model.FEBS?Lett?1973；32：195-8.

(28)Hooper?M，Hardy?K，Handyside?A，Hunter?S，Monk?M.HPRT-deficient(Lesch-Nyhan)mouse?embryos?derived?from?germline?colonization?by?cultured?cells.Nature?1987?Mar?19；326(6110)：292-5.

(29)Johansson?BM，Wiles?MV.Evidence?for?involvement?of?activin?A?and?bone?morphogeneticprotein?4?in?mammalian?mesoderm?and?hematopoietic?development.Mol?Cell?Biol?1995?Jan；15(1)：141-51.

(30)Wiles?MV，Johansson?BM.Embryonic?Stem?Cell?Development?in?a?Chemically?DefinedMedium.ExpCell?Res?1999?Feb?25；247(1)：241-8.

(31)Bielby?RC，Boccaccini?AR，Polak?JM，Buttery?LDK.In?Vitro?Differentiation?and?In?VivoMineralization?of?Osteogenic?Cells?Derived?from?Human?Embryonic?Stem?Cells.Tissue?Engineering2004；10(9-10)：1518-25.

(32)Hwang?YS，Randle?WL，Bielby?RC，Polak?JM，Mantalaris?A.Enhanced?derivation?ofosteogenic?cells?from?murine?embryonic?stem?cells?following?treatment?with?HepG2?conditioned?mediumand?modulation?of?the?embryoid?body?formation?period：application?toskeletal?tissue?engineering.Tissue?Engineering?2006；X(X)：X.

(33)Hale?LV，Ma?YF，Santerre?RF.Semi-quantitative?fluorescence?analysis?of?calcein?binding?asa?measurement?ofin?vitro?mineralization.CalcifTissue?Int?2000?Jul；67(1)：80-4.

(34)GregoryCA，Gunn?WG，Peister?A，Prockop?DJ.?An?Alizarin?red-based?assay?ofmineralization?by?adherent?cells?in?culture：comparison?with?cetylpyridinium?chloride?extraction.AnalBiochem?2004?Jun?1；329(1)：77-84.

(35)Okazaki?M，Takeshita?S，Kawai?S，Kikuno?R，Tsujimura?A，Kudo?A，et?al.Molecular?cloningand?characterization?of?OB-cadhe?rin，a?new?member?of?cadherin?family?expressed?in?osteoblasts.J?BiolChem?1994?Apr?22；269(16)：12092-8.

(36)Fok?EY，Zandstra?PW.Shear-Controlled?Single-Step?Mouse?Embryonic?Stem?Cell?Expansionand?EB-Based?Differentiation.Stem?Cells?2005?Aug?4.

(37)Bienaime?C，Barbotin?JN，Nava-Saucedo?JE.How?to?build?an?adapted?and?bioactive?cellmicroenvironment？A?chemical?interaction?study?of?the?structure?of?Ca-alginate?matrices?and?theirrepercussion?on?confined?cells.J?Biomed?Mater?Res?2003?Nov?1；67A(2)：376-88.

(38)Guo?JF，Jourdian?GW，MacCallum?DK.Culture?and?growth?characte?ristics?of?chondrocytesencapsulated?in?alginate?beads.Connect?Tissue?Res?1989；19(2-4)：277-97.

(39)Gascan?H，Godard?A，Ferenz?C，Naulet?J，Praloran?V，Peyrat?MA，et?al.Characterization?andNH2-terminal?amino?acid?sequence?of?natural?human?interleukin?for?DA?cells：leukemia?inhibitory?factor.Differentiation?inhibitory?activity?secreted?by?a?T?lymphoma?cell?line.J?Biol?Chem?1989?Dec25；264(36)：21509-15.

(40)Hilton?DJ，Nicola?NA，Metcalf?D.Specific?binding?of?murine?leukemia?inhibitory?factor?tonormal?and?leukemic?monocytic?cells.Proc?Natl?Acad?Sci?U?S?A?1988?Aug；85(16)：5971-5.

(41)Kataoka?H，Takakura?N，Nishikawa?S，Tsuchida?K，Kodama?H，Kunisada?T，et?al.Expressions?of?PDGF?receptor?alpha，c-Kit?and?Flk?1?genes?clustering?in?mouse?chromosome?5?define?distinctsubsets?ofnascent?mesodermal?cells.Dev?Growth?Differ?1997?Dec；39(6)：729-40.

(42)Okazaki?M，Takeshita?S，Kawai?S，Kikuno?R，Tsujimura?A，Kudo?A，et?al.Molecular?cloningand?characterization?of?OB-cadherin，a?new?member?of?cadherin?family?expressed?in?osteoblasts.J?BiolChem?1994?Apr?22；269(16)：12092-8.

(43)Siggelkow?H，Rebenstorff?K，Kurre?W，Niedhart?C，Engel?I，Schulz?H，et?al.Development?ofthe?osteoblast?phenotype?in?primary?human?osteoblasts?in?culture：comparison?with?rat?calvarial?cells?inosteoblast?differentiation.J?Cell?Biochem?1999?Oct?1；75(1)：22-35.

(44)Whyte?MP.Hypophosphatasi.In：Bilezikian?JP，Raisz?LG，Rodan?GA，editors.Principles?ofBone?Biology.2nd?ed.London：Academic?Press；2002.p.1229-48.

(45)Shimko?DA，Burks?CA，Dee?KC，Nauman?EA.Comparison?of?in?vitro?mineralization?bymurine?embryonic?and?adult?stem?cells?cultured?in?an?osteogenic?medium.Tissue?Eng?2004Sep；10(9-10)：1386-98.

(46)Benayahu?D，Shamay?A，Wientroub?S.Osteocalcin(BGP)，gene?expression，and?proteinproduction?by?marrow?stromal?adipocytes.Biochem?Biophys?Res?Commun?1997?Feb?13；231(2)：442-6.

(47)Raymond?MH，Schutte?BC，Torner?JC，Burns?TL，Willing?MC.Osteocalcin：genetic?andphysical?mapping?of?the?human?gene?BGLAP?and?its?potential?role?in?postmenopausal?osteoporosis.Genomics?1999?Sep?1；60(2)：210-7.

(48)Baron?R.Anatomy?and?ultrastructure?of?bone-histogenesis，growth?and?remodelling.WWW2002[cited?2005?Jun?28]；Available?from：URL： http://www.endotext.org/parathyroid/parathyroid1/parathyroidframel.htm

(49)Komori?T，Kishimoto?T.Cbfa1?in?bone?development.Curr?Opin?Genet?Dev?1998Aug；8(4)：494-9.

(50)Aubin?JE，Triffitt?JT.Mesenchymal?Stem?Cells?and?Osteoblast?Differentiation.In：BilezikianJP，Raisz?LG，Rodan?GA，editors.Principles?of?Bone?Biology(VOL?I).Second?ed.London：AcademicPress；2002.p.59-81.

(51)Zur?Nieden?NI，Kempka?G，Ahr?HJ.In?vitro?differentiation?of?embryonic?stem?cells?intomineralized?osteoblasts.Differentiation?2003?Jan；71(1)：18-27.

(52)Hegert?C，Kramer?J，Hargus?G，Muller?J，Guan?K，Wobus?AM，et?al.Differentiation?plasticityof?chondrocytes?derived?from?mouse?embryonic?stem?cells?J?Cell?Sci?2002?Dec?1；115(Pt?23)：4617-28.

(53)Tai?G，Polak?JM，Bishop?AE，Ch?ristodoulou?I，Buttery?LD.Differentiation?of?osteoblastsfrom?murine?embryonic?stem?cells?by?overexpression?of?the?transcriptional?factor?osterix.Tissue?Eng?2004Sep；10(9-10)：1456-66.

(54)Debnath?UK，Freeman?BJ，Gregory?P，de?la?HD，Kerslake?RW，Webb?JK.Clinical?outcomeand?return?to?sport?after?the?surgical?treatment?of?spondylolysis?in?young?athletes.J?Bone?Joint?Surg?Br?2003Mar；85(2)：244-9.

(55)Yang?WD，Cao?Q，Qian?QC，Tang?LH，Yang?LJ，Mao?TQ.[A?study?of?injectable?autogenoustissue-engineered?bone].Zhonghua?Kou?Qiang?Yi?Xue?Za?Zhi?2003?Sep；38(5)：393-5.

(56)Park?DJ，Choi?BH，Zhu?SJ，Huh?JY，Kim?BY，Lee?SH.Injectable?bone?usingchitosan-alginate?gel/mesenchymal?stem?cells/BMP-2?composites.J?Craniomaxillofac?Surg?2005Feb；33(1)：50-4.

(57)Leblond?FA，Simard?G，Henley?N，Rocheleau?B，Huet?PM，Halle?JP.Studies?on?smaller(approximately?315?microM)microcapsules：IV.Feasibility?and?safety?of?intrahepatic?implantations?of?smallalginate?poly-L-lysine?microcapsules.Cell?Transplant?1999?May；8(3)：327-37.

(58)Lwigale?PY，Thurmond?JE，Norton?WN，Spooner?BS，Wiens?DJ.Simulated?microgravity?andhypergravity?attenuate?heart?tissue?development?in?explant?culture.Cells?Tissues?Organs2000；167(2-3)：171-83.

(59)Stensvaag?V，Furmanek?T，Lonning?K，Terzis?AJ，Bjerkvig?R，Visted?T.Cryopreservation?ofalginate-encapsulated?recombinant?cells?for?antiangiogenic?therapy.Cell?Transplant?2004；13(1)：35-44.

(33)Eisenberg，L.M.and?C.A.Eisenberg.″Stem?cell?plasticity，cell?fusion，and?transdifferentiation.″ Birth?Defects?Res.Part?C.Embryo.Today?69.3(2003)：209-18.

Claims

1. the method for cell cultures, it comprises:

(a) provide the people embryo that is wrapped in the supported matrix do (ES) cell with form the supported matrix structure and,

(b) keep cultivation by in keeping substratum, keeping the cell that is wrapped in the dimensional culture thing.

2. the process of claim 1 wherein that keeping cultivation carries out under the situation of feeder cell conditioned medium not having feeder cell and do not have.

3. the method for claim 1 or claim 2 further is included in and breaks up the cell that is wrapped in the dimensional culture thing under the condition that is fit to cytodifferentiation in division culture medium.

4. the method for claim 3, wherein said keeping with differential period carried out in same container.

5. the method for claim 3 or claim 4 wherein provides the stimulation to differentiation.

6. the method for claim 5 wherein comprises the stimulation that embryoid is formed to the stimulation of breaking up.

7. the method for claim 6, wherein the stimulation that embryoid is formed is to eliminate or reduce and the contacting of the material that suppresses to break up; And/or add or increase and the contacting of the material that promotes embryoid formation.

8. each method of claim 3 to 7 wherein provides the stimulation that is divided into ectoderm, entoderm or mesoderm pedigree.

9. each method of claim 3 to 7 wherein provides the stimulation that is divided into mesoderm bone pedigree.

10. each method of claim 3 to 7 wherein provides the stimulation that bone forming differentiation or cartilage is formed differentiation.

11. the method for cell cultures comprises:

(b) under being fit to the condition that embryonic stem cell keeps, maintaining the one or more cells that wrap up in the dimensional culture thing in the substratum and keep cultivation by keeping,

(c) under the condition that is fit to the bone forming differentiation, carry out the bone forming differentiation by the cell that is wrapped of differentiation in the dimensional culture thing in division culture medium.

12. the method for claim 11, the bone forming differentiation of the wherein said cell that is wrapped comprises:

(i) embryonic stem cell that incubation is wrapped in the dimensional culture thing in division culture medium, and the stimulation that embryoid is formed is provided, then,

The (ii) cell that is wrapped that in division culture medium, produces in the incubation (i), and stimulation to the bone forming differentiation is provided.

13. the method for claim 11, the bone forming differentiation of the wherein said cell that is wrapped comprises:

14. the method for claim 11, the bone forming differentiation of the wherein said cell that is wrapped comprises: the embryonic stem cell that incubation is wrapped in division culture medium, and the stimulation that bone forming is broken up is provided.

15. each method of claim 11 to 14, wherein said embryonic stem cell are people, non-human primate, horse, dog, ox, pig, goat, sheep, fish, rodent, mouse or birds source.

16. the method for aforementioned each claim wherein provides a plurality of cells that are wrapped in each supported matrix structure.

17. the method for aforementioned each claim wherein provides the individual cells that is wrapped in each supported matrix structure.

18. the method for aforementioned each claim wherein provides a plurality of supported matrix structures in step (a).

19. the method for aforementioned each claim, wherein the supported matrix structure is the form of globule.

20. being wrapped in human embryo stem cell in the supported matrix is used for evaluation test and stimulates pair cell to keep and/or the purposes of the influence broken up.

Be used to assess that substratum and/or culture condition pair cell are kept and/or the purposes of the influence broken up 21. be wrapped in human embryo stem cell in the supported matrix.

22. the method for claim 1, it also is included in the influence that incubation is wrapped in keeping substratum under the situation that has test compound cell and evaluation test compound pair cell are kept and/or broken up.

23. the method for claim 1, its also be included under the situation that has trial stimulus be fit to that cell is kept and/or the substratum that breaks up and condition under the influence that stimulates the pair cell differentiation of the cell that is wrapped of incubation and evaluation test.

24. the method for claim 1, it also is included in the influence that incubation is wrapped under the situation that has test medium and/or test conditions cell and evaluation test substratum and/or test conditions pair cell are kept and/or broken up.

25. the method for claim 24 wherein provides trial stimulus to cell, and the evaluation test influence that stimulates pair cell to keep and/or break up.

26. each method of claim 22 to 25, wherein in step (a) in each supported matrix structure a plurality of cells of parcel.

27. each method of claim 22 to 25 is wherein wrapped up individual cells in each supported matrix structure in step (a).

28. each method of claim 22 to 27 wherein provides the cell that is wrapped in the array of culture vessel.

29. the method for claim 28, wherein the array of culture vessel is porous or multitube array.

30. each method of claim 22 to 29 wherein provides a plurality of cells that are wrapped in each culture vessel in step (a).

31. each method of claim 22 to 30 wherein provides a plurality of supported matrix structures in each culture vessel in step (a).

32. wherein there is the one cell that is wrapped in each method of claim 22 to 29 in each culture vessel in step (a).

33. each method of claim 22 to 32, wherein said supported matrix structure is the form of globule.

34. each purposes or method of claim 20 to 33 wherein assessed the influence that pair cell is kept and/or broken up by one or more methods that are selected from down group: the detection of microscopy, one or more phasic specificity detection of antigens and genetic expression.

35. the method for aforementioned each claim, wherein said supported matrix are formed or are comprised hydrogel by hydrogel.

36. the method for aforementioned each claim, wherein said supported matrix are formed or are comprised alginate by alginate.

37. the method for claim 36 or claim 37, wherein supported matrix also comprises gelatin.

38. each method of claim 35 to 37, wherein supported matrix further comprises one or more materials that are selected from down group: gelatin, ln, Bioglass ^TM, hydroxyapatite, extracellular matrix, extracellular matrix protein, somatomedin, from the extract of another kind of cell culture, from the extract of scleroblast culture.

39. the method for aforementioned each claim or purposes, it also comprises the freezing cell that is wrapped.

40. the method for each or claim 39 in the claim 1 to 19, it also comprises discharge one or more cells from supported matrix.

41. pass through one or more cells that the method for claim 40 obtains.

42. can by or one or more cells that are wrapped of obtaining by each method of claim 1 to 19.

43. one or more human embryo stem cells that are wrapped that the method by claim 1 obtains.

44. the one or more pluripotent cells that are wrapped that obtain by each method of claim 3 to 19.

45. can by or the cell of one or more formation bones that are wrapped of obtaining by each method of claim 3 to 19, form the cell of cartilage or form the cell of cardiac muscle.

46. can by or one or more terminally differentiated cellses that are wrapped of obtaining by each method of claim 3 to 19.

47. claim 42 to 46 each the cell that is wrapped or the cell of claim 41 as the purposes of medicine.

48. the cell of one or more formation bones that are wrapped of claim 45 needs the purposes of the medicine of disease that bone rebuilds or illness as treatment.

49. the cell of one or more formation bones that are wrapped of claim 45 is selected from down the disease of group or the purposes of the medicine of illness as treatment: osteoporosis, the bone fracture, fracture, osteocarcinoma disease, osteocarcinoma, osteogenesis imperfecta, Paget ' s disease, fibrous dysplasia, the osteopathia relevant with hearing disability, hypophosphatasia, the myelomatosis osteopathy, osteopetrosis, bone excessively uses damage, the sport injury of bone, periodontal (gums) disease, with plastic surgery such as therapeutic decorative sursery, or esthetic surgery.

50. the cell of one or more formation cartilages that are wrapped of claim 45 is selected from down the disease of group or the purposes of the medicine of illness as treatment: sacroiliitis, cartilage disease or disorder, repair of cartilage, lift face plastic surgery, rheumatoid and osteoarthritis.

51. the cell of one or more formation bones that are wrapped of claim 45 is used for the treatment of purposes in the medicine that needs disease that bone rebuilds or illness in preparation.

52. the cell of one or more formation bones that are wrapped of claim 45 is used for the treatment of purposes in the medicine of the disease that is selected from following group or illness in preparation: osteoporosis, bone fracture, fracture, osteocarcinoma disease, osteocarcinoma, osteogenesis imperfecta, Paget ' s disease, fibrous dysplasia, osteopathia, hypophosphatasia, myelomatosis osteopathy, osteopetrosis, the bone relevant with hearing disability excessively use the sport injury and periodontal (gums) disease of damage, bone.

53. the cell of one or more formation cartilages that are wrapped of claim 45 is used for the treatment of purposes in the medicine of the disease that is selected from following group or illness in preparation: sacroiliitis, cartilage disease or disorder, repair of cartilage, plastic surgery, lift face plastic surgery, rheumatoid and osteoarthritis.

54. treatment experimenter's method comprises to the experimenter and uses each the cell that is wrapped of claim 42 to 46.

55. treatment needs the disease of bone reconstruction or the method for illness, comprises cell from the formation bone that is wrapped of one or more claims 45 to the experimenter that use.

56. treatment is selected from down the disease of group or the method for illness, comprise the cell of the formation bone of the parcel of using one or more claims 45: osteoporosis, bone fracture, fracture, osteocarcinoma disease, osteocarcinoma, osteogenesis imperfecta, Paget ' s disease, fibrous dysplasia, osteopathia, hypophosphatasia, myelomatosis osteopathy, osteopetrosis, the bone relevant with hearing disability excessively use the sport injury and periodontal (gums) disease of damage, bone.

57. treatment is selected from down the disease of group or the method for illness, comprises the cell that is wrapped from one or more claims 45 to the experimenter that use: sacroiliitis, cartilage disease or disorder, repair of cartilage, rheumatoid and osteoarthritis.

58. be selected from the plastic surgery method of therapeutic or esthetic surgery, comprise the cell that is wrapped from one or more claims 45 to the experimenter that use.

59. be selected from the plastic surgery method of therapeutic or esthetic surgery, it comprises to the experimenter uses the cell of the one or more formation bones that are wrapped of claim 45 or the cell of one or more formation cartilages.

60. pharmaceutical composition, it comprises each one or more cells that are wrapped and pharmaceutically acceptable carrier or thinner of claim 42 to 46.

61. the pharmaceutical composition of claim 60, it is configured to by injection or by endoscopy and uses.

62. the bone or the cartilaginous tissue that obtain by each the cell that is wrapped of one or more claims 42 to 46.

63. cytoskeleton, it has plantation thereon or inculcate in each the cell that is wrapped of claim 42 to 46 wherein.

64. the application device of prefill, as syringe, it contains the pharmaceutical composition of claim 62 or claim 63.