CN101168063A - Spring viremia of carp virus DNA vaccine and preparation method thereof - Google Patents

Abstract

The invention discloses a DNA vaccine of the Spring Viremia of carp virus and a process for preparing the DNA vaccine of the Spring Viremia of carp virus. The DNA vaccine of the spring viremia of carp virus is composed of SVCV G protein full-length genes and pronucleus expression vector pET32a (+) plasmid. The preparing method of the DNA vaccine of the spring viremia of carp virus includes steps of (1) cloning the SVCV G protein full-length genes, (2) pronucleus expression of the SVCV G gene and preparation of antibodies and (3) constructing the DNA vaccine of the SVCV G genes. The invention creatively enables the DNA vaccine technique to be applied in prevention and cure of the spring viremia of carp. Compared with other vaccines, the DNA vaccine is capable of inducing a body to generate humoral immune response and cellular immune response, and simultaneously has the advantages of high efficiency, safety, convenient storage and transportaion, easy mass production and the like.

Description

A kind of spring viremia of carp virus DNA vaccine and preparation method thereof

Technical field

The present invention relates to the dna vaccination and the technology of preparing of SVCV.

Background technology

Cloned gene inserted import escherichia coli behind the suitable carrier and be used to express a large amount of method of protein and be called prokaryotic expression.Escherichia coli are used for express recombinant protein following characteristics: escherichia coli fast growth, processing ease and be easy to control; But cost is low and High Density Cultivation; The genetic background of host bacterium is clear, can transform it according to various objectives; The plasmid of the tool various characteristics that various coli strains is arranged and match is available.Expression vector has a very important role in genetic engineering, and prokaryotic expression carrier is generally plasmid, and the expression general procedure is as follows:

Obtain genes of interest-preparations expression vector-genes of interest is inserted (sequence verification) in the expression vector-conversions expressive host bacterium-induce analysis-amplification, purification, the further detection of the expression-expressing protein of target protein.

Dna vaccination is coding immunogen or the eukaryon expression plasmid DNA relevant with immunogen.It can enter in the animal body through certain approach, can be transcribed with accurate translation after the picked-up of animal host cell to go out antigen protein, and this antigen protein can stimulate body to produce non-specific and two kinds of immune responses of specificity, thereby plays immanoprotection action.

The basic design of dna vaccination is also uncomplicated.Normally we are wanted certain gene of the pathogenic microorganism that prevents, utilize appropriate carriers to send in the body and both can.The most frequently used design of dna vaccination is to utilize bifilar cyclic plastid Come to be used as carrier, microorganism is had antigenic gene clone go in the plastid.For making this plastid can show this gene in a large number, produce the amounts of protein product, this plastid must have a very strong promoter.The plastid that then this is contained pathogenic microorganism DNA is dissolved in normal saline or other solution, sends in the muscle cell in modes such as intramuscular injection then.After the intramuscular injection, the myocyte can absorb this plastid and bring in the cell, and the work of transcribing and translating, and gives expression to the reaction of antigen protein and then induction of immunity.

Summary of the invention

The objective of the invention is to the deficiency that treatment upward exists at SVCV, a kind of dna vaccination that is highly resistant to SVCV is provided.

Another object of the present invention provides the preparation method of above-mentioned dna vaccination.

To achieve these goals, the present invention adopts following technical scheme:

A kind of SVCV vaccine dna vaccination is made of SVCV G albumen full-length gene and prokaryotic expression carrier pET32a (+) plasmid.

The preparation method of above-mentioned SVCV vaccine dna vaccination comprises the steps:

(1) SVCV G albumen Cloning of Entire Gene;

(2) SVCV G Prokaryotic Expression and Antibody Preparation;

(3) structure of SVCV G gene DNA vaccine.

The described SVCV G of step (1) albumen Cloning of Entire Gene primer sequence is (sequence is a restriction enzyme site in the square frame):

SVC-Gly-Full-F：5′-CCG

AAAACTAACAGACATCATGT-3′

(Kpn I site)

SVC-Gly-Full-R：5′-GCC

ACTCTCAAACTAAAGACCGCA-3′

(Xba I site)

The described SVCV G of step (2) Prokaryotic Expression primer sequence is (sequence is a restriction enzyme site in the square frame):

SVC-Gly-Full-F：5′-CG CAGCCTGTAATTCAGCCATTT-3′

(EcoR I site)

SVC-Gly-Full-R：5′-GCG CAGCCATCTAACTCCCAGTCGTC-3′

(Hind III site)

The reaction temperature of the described SVCV G of step (2) Prokaryotic Expression is 37 ℃.

The inductive condition of the described SVCV G of step (2) Prokaryotic Expression is 0.4mM IPTG, 5h.

The structure primer sequence of the described SVCV G of step (3) gene DNA vaccine is

pSVCV-Sig.-F：CGGGTACCAAAACTAACAGACATCATGGCT

pSVCV-Sig.-R：CGTCTAGAATTATAGACTAGTTCCCCACCCACTG

pSVCV-Trans.-F：CAGGTACCATGGCCATATTTGTTCCATCC

pSVCV-Trans.-R：CGTCTAGACTCAAACTAAAGACCGCATTTCG

pSVCV-Null-F：CAGGTACCATGGCCATATTTGTTCCATCC

pSVCV-Null-R：CGTCTAGAATTATAGACTAGTTCCCCACCCACTG

The check primer sequence that is used to assess SVCV dna vaccination immune effect is

D-SVC-Gly-F：5′-TCTGTTCATTTGGAGCCG-3′

D-SVC-Gly-R：5′-GGATTTCATCGTCGTCAT-3′

The specific amplified sequence of assessment SVCV dna vaccination immune effect is the sequence of the 853bp of the 451st nucleotide to 1303 nucleotide of SVCV G albumen.

Compared with prior art, the present invention has following beneficial effect:

The present invention creatively is applied to the dna vaccination technology control of spring viremia.Compare with other vaccines, dna vaccination can induce body to produce humoral immunoresponse(HI) and cellullar immunologic response simultaneously, have simultaneously efficiently, safely, be convenient to storing and be easy to advantage such as mass production.

Description of drawings

Fig. 1 is plasmid pcDNA 3.0 physical maps;

Fig. 2 A is pET32a (+) plasmid map;

Fig. 2 B is near the sequence pET32a (+) the plasmid multiple clone site;

Fig. 3 is a SVCV glycoprotein gene pcr amplification electrophoresis result;

Fig. 4 is the pcr amplification electrophoresis result of SVCV G gene prokaryotic sequence;

Fig. 5 is that the SDS-PAGE of recombiant plasmid pET-SVCV-Gly abduction delivering in escherichia coli analyzes;

Fig. 6 induces the SDS-PAGE of different time different IP TG concentration for the reorganization bacterium and analyzes;

Fig. 7 is that sero-fast Western-blot analyzes;

Fig. 8 is a SVCV glycoprotein gene fragment PCR amplification electrophoresis result;

Fig. 9 is glued fruit for the RT-PCR product runs;

Figure 10 is the RT-PCR testing result of transfection FHM cell;

Figure 11 is fish body injection site (drawing the al. from Lorenzen N et, 2002);

Figure 12 is the counteracting toxic substances experimental result.

Wherein, among Fig. 3, M:Marker-DL2000; The PCR product of 1:SVCV G gene; The 2:RT negative control; The 2:PCR negative control.Among Fig. 4, M:Marker-DL2000; The PCR product of 1:SVCV G gene prokaryotic sequence; The 2:PCR negative control.Among Fig. 5, M: protein Marker; The 1:37 ℃ of ultrasonic back of inductive reorganization bacterium supernatant; The 2:37 ℃ of ultrasonic postprecipitation of inductive reorganization bacterium; 3: without inductive pET-SVCV-Gly reorganization bacterium whole bacterial protein.Among Fig. 6, M: protein Marker; 1-6 is respectively the inductive whole bacterial protein of 0.01mM, 0.05mM, 0.1mM, 0.4mM, 1mM and 0mM; 7-12: be respectively pET-SVCV-Gly and induce 5h, 4h, 3h, 2h, 1h and 0h.Among Fig. 7, M: pre-dsred protein Marker; +: the whole bacterial protein after inducing;-: not inductive whole bacterial protein.Among Fig. 8, M:Marker-DL2000; 1:pSVCV-Sig. primer is to amplified production; 2.PCR negative control; 3.pSVCV-Trans. primer is to amplified production; 4.PCR negative control; 5.pSVCV-Null primer is to amplified production; 6.PCR negative control.Among Fig. 9, M:Marker-DL15,000; 1,3,5: the Brachydanio rerio RNART-PCR result of extraction; 2,4,6:PCR negative control; The 7:RT negative control; +: positive control.Among Figure 10, M:Marker-DL2,000; 1～5: be respectively the unloaded pcDNA3.0 of transfection, the FHM cell total rna RT-PCR result of recombiant plasmid pSVCV-Sig., pSVCV-Trans., pSVCV-Null and pSVCV-Full; The 6:RT negative control; The 7:PCR negative control; +: positive control.

The specific embodiment

Embodiment 1 SVCV G albumen Cloning of Entire Gene

1.1 materials and methods

1.1.1 material

1.1.1.1 virus and cell

SVCV (SVCV) A1 strain is separated by this laboratory, is stored in-80 ℃.

(Grass carp ovaries CO) is gone down to posterity by this laboratory and cultivate to preserve the Ctenopharyngodon idellus ovary cell line.

1.1.1.2 cell culture related reagent

Antibiotic: penicillin (800,000 unit/bottle) and streptomycin (1,000,000 unit/bottle) melt with the sterilization distilled water, and 0.22 μ m membrane filtration degerming is made into the two anti-mixed liquor that final concentration respectively is 10,000 U/mL.

(Medium 199, and GIBCO) compound method is seen description for culture medium: M199.0.22 after the degerming of μ m membrane filtration, add in proportion two anti-to final concentration respectively be 100U/mL.

Hyclone (fetal bovine serum, FBS): Gibco.

0.05% trypsin contains EDTA): GIBCO ,-20 ℃ of preservations before using, 4 ℃ of preservations after the uncork.

1.1.1.3 antibacterial culturing related reagent

The LB fluid medium: peptone (trytone) 10g, yeast extract (yeast extract) 5g, NaCl10g adds the 800mL distilled water, regulates pH to 7.2～7.4 with 5M NaOH, is settled to 1000mL, packing, autoclaving, 4 ℃ of preservations.

The LB solid medium: adding agar powder to final concentration in the LB fluid medium is 1.5%, autoclaving, dull and stereotyped back 4 ℃ of preservations.

The ampicillin storage liquid: available from MBCHEM, aquesterilisa dissolving back 0.22 μ m membrane filtration degerming.-20 ℃ of preservations after the aliquot packing.Storage liquid concentration is 100mg/mL.Be added in culture medium at 1: 1000 during use.

1.1.1.4 plasmid vector and F-strain

Plasmid vector: pcDNA 3.0 (Fig. 1).

Recipient bacterium: coli strain DH5 α, genotype: F- 80d lacZ Δ M1 5 Δs (lacZYA-argF) U169 endA 1 recA 1 hsdR17 (rk-, mk+) supE44 λ ^-Thi ^-1 gyrA96phoA.

1.1.1.5 enzyme and other reagent

Pyrobest ^TMArchaeal dna polymerase, Taq archaeal dna polymerase, dNTP, MMLV (RNase H ^-) reverse transcription, RNase inhibitor, DL-2000 and DL-15,000 all available from TaKaRa company.

Trizol reagent (Invitrogen): 4 ℃ of preservations; Phenol: 4 ℃ of preservations; Chloroform, isopropyl alcohol, dehydrated alcohol, room temperature keeps in Dark Place.

Random primer (N) ₆: the Shen can lottery industry biotech firm.

Dna gel reclaims test kit and the PCR product reclaims test kit available from TaKaRa company.

H.Q.﹠amp; Q. the plasmid trace extracts test kit available from the excellent brilliant biological engineering company limited in Anhui.

0.1M calcium chloride: 1.47g CaCl ₂2H ₂Be settled to 100mL after O is water-soluble, 0.22 μ m membrane filtration, 4 ℃ of preservations.

1.1.2 method

1.1.2.1 the extraction of total RNA

1.1.2.1.1 the propagation of virus

SVCV infects its sensitive cells CO, 25 ℃ of cultivations, when treating that cytopathic effect (CPE) appears in 30%～40% cell, abandon stock solution, add the ice-cold DEPC of 2mL and handle PBS and wash lightly once, blow and beat repeatedly with 1mL TRIzol then, until cell come off fully (about 10min), cell suspension is transferred to the centrifugal pipe of 1.5mL, is used for the extraction of viral RNA.

1.1.2.1.2 the extraction of viral RNA

In the relevant experimentation of RNA, all centrifuge tubes, rifle head and water all handled with DEPC water logging bubble and through autoclaving, pipettor is the RNA special use.Operational approach is undertaken by the test kit description, is summarized as follows:

1) add the viral suspension of Trizol, 15-30 ℃ leaves standstill 5min, thoroughly lytic virus albumen;

2) add the 0.2mL chloroform, firmly shake Eppdorf pipe 15s, 15-30 ℃ leaves standstill 2-3min;

3) 2-8 ℃ is no more than the centrifugal 15min of 12000g;

4) carefully take out the upper strata water in another clean Eppendorf pipe, add isopyknic isopropyl alcohol mixing, 15-30 ℃ leaves standstill 10min;

5) 2-8 ℃ is no more than the centrifugal 10min of 12000g;

6) 1mL 75% precooled ethanol cleans twice, and 2-8 ℃ is no more than the centrifugal 5min of 7500g;

7) the about 10min of air drying notes not making the precipitation overdrying, otherwise RNA is difficult for dissolving;

8) add 20 μ L DEPC treating water ,-80 ℃ of preservations are standby.

1.1.2.2 the segmental pcr amplification of design of primers and purpose

1.1.2.2.1 design of primers

According to SVCV A1 strain (accession number:DQ097384) G gene order design primer.For making things convenient for subsequent operation, introduce restriction enzyme site at 5 ' end, and add 3 protection bases at 5 ' end.

1.1.2.2.2 the segmental pcr amplification of purpose

1.1.2.2.2.1 cDNA first chain is synthetic

The synthetic of cDNA first chain carries out to specifications, and concrete steps are as follows:

1, configuration following template ribonucleic acid/primer mixed liquor in microcentrifugal tube, full dose 6 μ L.

Table 1

Reagent name	Use amount
		Template ribonucleic acid Random Primer (25 μ M) RNase free dH 2O	1ng～1μg * 1μL up to 6μL

^*The use amount of Total RNA is generally 1ng～1 μ g; The use amount of mRNA is generally 10pg～1 μ g.

2, with above composition mixing, wink from, 65 ℃ the insulation 5 minutes after rapidly on ice more than the chilling 2min.

3, the centrifugal several seconds makes the denaturing soln of template ribonucleic acid/primer be gathered in the microcentrifugal tube bottom.

4, the following inverse transcription reaction liquid of configuration in above-mentioned microcentrifugal tube.

Table 2

Reagent name	Use amount
		Above-mentioned template ribonucleic acid/primer denaturing soln 5 * M-MLV Bffer	6μL 2μL

dNTP Mixture(10mM) Rnase Inhibitor(10U/μL) Retra(M-MLV)(100U) RNase free dH 2O

0.5μL 0.5μL 0.5μL up to 10μL

5,37 ℃ of insulation 1h.

6,70 ℃ the insulation 10min after cooled on ice, the cDNA solution that obtains is directly used in pcr amplification.

1.1.2.2.2.2 the pcr amplification of genes of interest

Press following system configurations reactant liquor at microcentrifugal tube:

Table 3

Above-mentioned cDNA solution 10 * Pyrobest Buffer II dNTPs (each 2.5mM) Primer SVC-Gly-Full-F (10 μ M) Primer SVC-Gly-Full-R (10 μ M) Pyrobest DNA Polymerase (5U/ μ L)

1μL 5μL 4μL 0.8μL 0.8μL 0.25μL

Above system complements to 50 μ L with the sterilization distilled water.

Pcr amplification, loop parameter is:

Table 4

Period	Degeneration	Renaturation	Polymerization
				The wheel circulation of the follow-up circulation of opening rotation (33) end	95℃ 5min，94℃ 45s 94℃ 45s 94℃ 45s	53℃ 45s 53℃ 45s 53℃ 45s	72℃ 95s 72℃ 95s 72℃ 7min

After the loop ends, 4 ℃ of preservations of product.

1.1.2.3 the enzyme action of PCR product and plasmid DNA and purification

To pcDNA 3.0 carriers, construction recombination plasmid pcDNA-SVC-Gly-Full carrier (for conveniently writing, is designated as: pSVCV-Full) with the PCR product cloning.

1.1.2.3.1 the purification of PCR product and enzyme action

1.1.2.3.1.1 the purification of PCR product

The PCR product carries out electrophoresis with 1% agarose/ethidium bromide gel, and band is single, with TaKaRa DNAFragment Purification Kit purification target DNA fragment.

Operational approach is summarized as follows:

1. the DB Buffer that adds 3 times of volumes in the PCR reactant liquor, mixing;

2. Spin Column is placed on the Collection Tube, above-mentioned solution changes Spin Column over to, and 12, the centrifugal 1min of 000rpm abandons filtrate;

3. Spin Column puts back among the former Collection Tube, adds 500 μ L Rinse A, and 12, the centrifugal 30s of 000rpm abandons filtrate;

4. Spin Column puts back among the former Collection Tube, adds 700 μ L Rinse B, and 12, the centrifugal 30s of 000rpm abandons filtrate;

5. repetitive operation step 4.;

6. Spin Column is placed the 1.5mL centrifuge tube of a cleaning, add 25 μ L～30 μ L sterilization distilled water or Elution Buffer in silica film central authorities, room temperature leaves standstill 1min.The centrifugal 1min eluted dna of 12000rpm.-20 ℃ of preservations.

1.1.2.3.1.2 the enzyme action of PCR product

According to the concentration (electrophoresis detection or the absorption value calculating of surveying OD260nm) of purified pcr product, with KpnI and Xba I double digestion.Enzyme action system cumulative volume is 50 μ L, presses following formulated reaction system:

Table 5

PCR purified product 10 * M Buffer Kpn I Xba I

15μL 5μL 2μL 2μL

The sterilization distilled water complements to 50 μ L, 37 ℃ of water-bath enzyme action 3h, and endonuclease bamhi reclaims and uses test kit, and method is seen 1.1.2.3.1.2, and purified product-20 ℃ preservation is standby.

1.1.2.3.2 the extraction of plasmid DNA, enzyme action and purification

1.1.2.3.2.1 the extraction of plasmid DNA

The escherichia coli of streak inoculation band pcDNA 3.0 plasmids, the next day choose monoclonal in the culture tube that 5mL LB/Amp fluid medium is housed, 37 ℃ of 200rpm shaking tables are cultivated 12h～16h.Use H.Q.﹠amp; Q. the plasmid trace extracts test kit and extracts plasmid, and its step is as follows:

1. get the bacterium liquid of 1.5mL～5mL incubated overnight, 10, the centrifugal 1min of 000g, most culture fluid is abandoned in final step;

2. bacterial precipitation fully suspends to add 250 μ L Buffer ZL-I/RnaseA (4 ℃ of preservations);

3. add 250 μ L Buffer ZL-II in resuspended liquid, gentle but spin upside down fully and mix 4～6 times, to the solution clarification, this step should not surpass 5min;

4. add 350 μ L Buffer ZL-III, the centrifuge tube several that leniently turns upside down is until forming white flocculent deposit, 10, the centrifugal 10min of 000g;

5. clean Mu-Pu plasmid trace detached dowel is placed on the 2-mL Microfuge Tube, the centrifugal supernatant of step in 4. moved in the Mu-Pu plasmid trace detached dowel, 10, the centrifugal 1min of 000g abandons filtrate;

6. Mu-Pu plasmid trace detached dowel is put back among the former 2-mL Microfuge Tube, added 500 μ LBuffer ZL, 10, the centrifugal 1min of 000g abandons filtrate;

7. Mu-Pu plasmid trace detached dowel is put back among the former 2-mL Microfuge Tube, added 720 μ LDNA cleaning mixture, 10, the centrifugal 1min of 000g abandons filtrate;

8. repetitive operation step 7.;

9. Mu-Pu plasmid trace detached dowel is put back among the former 2-mL Microfuge Tube, 10, the centrifugal 1min of 000g;

10. Mu-Pu plasmid trace detached dowel is placed the 1.5mL centrifuge tube of a cleaning, add 50 μ L～100 μ L sterilization distilled water or Elution Buffer in silica film central authorities, room temperature leaves standstill 2min, and 10, the centrifugal 1min eluting of 000g plasmid DNA ,-20 ℃ of preservations.

1.1.2.3.2.2 the enzyme action of plasmid DNA and purification

According to the concentration (electrophoresis detection or the absorption value calculating of surveying OD260nm) of extraction plasmid DNA, use Kpn I and Xba I to carry out double digestion.Enzyme action system cumulative volume is 50 μ L, and concrete operations are with reference to the description of Restriction Enzyme.Enzyme action is got 3 μ L therebetween and is carried out agarose gel electrophoresis with monitoring enzyme action degree in 37 ℃ of water-bath digestion 4h～6h.Endonuclease bamhi reclaims with test kit (TaKaRa Agarose Gel DNA PurifocationKit), and operational approach is summarized as follows:

1. under uviol lamp, cut out the gel that contains target DNA,, weigh, press 1mg=1 μ L conversion gel volume with the liquid of napkin exhaustion gel surface;

2. add DR-I Buffer by 3 times of gel weight;

3. in 75 ℃ of heating,, melt (6min～10min) fully until gel piece every 1min～2min mixing that vibrates;

4. two/a volume of DR-II the Buffer that adds DR-I Buffer amount, mix homogeneously;

5. Spin Column is placed 2mL Collection Tube, the mixed liquor of step in 4. moved among the Spin Column, 12, the centrifugal 1min of 000rpm abandons filtrate;

6. Spin Column is put back among the former 2mL Collection Tube, add 500 μ L Rinse A, 12, the centrifugal 30s of 000rp abandons filtrate;

7. Spin Column is put back among the former 2mL Collection Tube, add the Rinse B that 700 μ L have added dehydrated alcohol, 12, the centrifugal 30s of 000rpm.Abandon filtrate;

8. repetitive operation step 7.;

9. Spin Column is put back among the former 2mL Collection Tube the centrifugal 1min of 12000rpm;

10. Spin Column is placed the 1.5mL centrifuge tube of a cleaning, add 25 μ L～30 μ L sterilization distilled water or Elution buffer in silica film central authorities, room temperature leaves standstill 1min.The centrifugal 1min eluted dna of 12000rpm.-20 ℃ of preservations.

1.1.2.4 the preparation of competent cell

Adopt CaCl ₂Legal system is equipped with competent escherichia coli cell.The streak inoculation recipient bacterium, the next day choose monoclonal in the test tube that the LB fluid medium is housed, 37 ℃, 200rpm shake overnight incubation; Be inoculated in fresh LB fluid medium by 1: 100 volume ratio next day, and 37 ℃, the about 3h of 200rpm concussion cultivation are to OD ₆₀₀Value about 0.6; Bacterium liquid ice bath 30min, then in 10, the centrifugal 1min of 000rpm abandons most supernatant, adds the 0.1M CaCl of the pre-cooling of original volume 1/2nd ₂Resuspended precipitation, the centrifugal 1min of 10000rpm abandons most supernatant behind the ice bath 20min, at last with the 0.1M CaCl of the pre-cooling of original volume 1/25th ₂Resuspended precipitation, glycerol adding to final concentration is 15%, is distributed into some pipes, every pipe 100 μ L ,-80 ℃ of preservations are standby.

1.1.2.5 connect and conversion

1.1.2.5.1 being connected of dna fragmentation and carrier

The following coupled reaction liquid of preparation in miniature centrifuge tube:

Table 6

10 * T4 DNA Ligase Buffer dna fragmentation carrier DNA T4 DNA Ligase ddH 2O

The about 0.03pmol 1 μ L up to of the about 0.3pmol of 2 μ L 20 μ L

Connect under 16 ℃ and spend the night.

1.1.2.5.2 connect the conversion of product

5 μ L are connected product add in the 100 μ L competence mixing, ice bath 30min; 42 ℃ of water-bath heat shock 90s, horse back ice bath 5min then.Add fresh LB fluid medium to 1mL, 37 ℃ of 200rpm recoveries of shaking table 1h.Room temperature 8, the centrifugal 1min of 000rpm siphons away the 1mL supernatant, remains 100 μ L mixings, coats the LB/Amp flat board.Be inverted in 37 ℃ of incubators cultivation 12h～16h after leaving standstill dull and stereotyped 30min～40min, deposit for 4 ℃.

1.1.2.6 the screening of positive colony and evaluation

Picking colony is in the LB/Amp fluid medium from flat board, and 37 ℃, 200rpm concussion cultivation 12h～16h carry out pcr amplification by aforementioned PCR system, get 5 μ L PCR product electrophoresis detection.

The positive recombinant that bacterium liquid PCR screens shakes bacterium and extracts plasmid, and Kpn I and Xba I double digestion are further identified.

Send order-checking according to bacterium liquid PCR and enzyme action result with the positive colony that filters out, examining order is responsible for finishing by Shanghai Ying Jun Bioisystech Co., Ltd.

1.2 interpretation of result

According to SVCV A1 strain (accession number:DQ097384) G gene order design primer.For making things convenient for subsequent operation, introduce restriction enzyme site at 5 ' end, and add 3 protection bases at 5 ' end.Primer is synthetic in match hundred victory bio-engineering corporations, and the expected sequence size of glycoprotein gene behind pcr amplification is 1568bp.

Sequence following (sequence is a restriction enzyme site in the square frame):

SVC-Gly-Full-F：5′-CCG AAAACTAACAGACATCATGT-3′

(KpnI site)

SVC-Gly-Full-R：5′-GCC

ACTCTCAAACTAAAGACCGCA-3′

(Xba I site)

Successfully amplified the total length of SVCV A1 strain G gene according to selected primer, this zone is 1568bp (Fig. 3) altogether.

Embodiment 2 SVCV G Prokaryotic Expression and Antibody Preparation

2.1 materials and methods

2.1.1 material

2.1.1.1 plasmid vector and F-strain

Plasmid vector: prokaryotic expression carrier pET-32a (+) (Fig. 2 A, Fig. 2 B).

Recipient bacterium: coli strain DH5 α, genotype is seen before; Coli strain BL21 (DE3), genotype: F-ompT hsdsB (rB-mB-) gal dcm (DE3).

2.1.1.2 enzyme and other reagent

Restriction endonuclease is available from TaKaRa company.

Other toolenzymes and test kit are the same.

2.1.1.3 the used solution of protein electrophoresis

30% acrylamide stock solution: with 29g acrylamide and 1g N, the N-methylene bisacrylamide is dissolved in the 80mL distilled water, 37 ℃ of dissolvings, and standardize solution is to 100mL, and 4 ℃ keep in Dark Place behind the filter paper filtering.

4 * separation gel buffer (pH8.8): 18.15g Tris alkali dissolution is adjusted to pH8.8 with concentrated hydrochloric acid in the 80mL distilled water, add 0.4g SDS, is settled to 100mL.

4 * concentrating glue buffer (pH6.8): 12.11g Tris alkali dissolution is adjusted to pH6.8 with concentrated hydrochloric acid in the 80mL distilled water, add 0.4g SDS, is settled to 100mL.

5 * electrophoretic buffer (pH8.3): 15.1g Tris alkali, the 94g glycine is dissolved in the 800ml distilled water, regulates pH to 8.3, adds 50ml 10%SDS, is settled to 1000mL.

2 * sample buffer: 100mM Tris-Cl (pH6.8), 20% (V/V) glycerol, 200mM dithiothreitol, DTT (DTT), 0.2% bromophenol blue, 4%SDS (electrophoresis level).

10% Ammonium Persulfate 98.5 (Ap): the 0.1g Ammonium Persulfate 98.5 is dissolved in the 1mL deionized water, and 4 ℃ keep in Dark Place.

Dyeing liquor: 2.5g Coomassie brilliant blue R-250 is dissolved in 450mL methanol, 100mL glacial acetic acid and the 450mL deionized water and is made into 1000mL, and fully dissolving is used behind the filter paper filtering.

Destaining solution: methanol, glacial acetic acid and distilled water are formulated according to 3: 1: 6 ratio.

The prescription that concentrates glue (5%) and various concentration separation gel (12%, 15%) is with reference to " molecular cloning experiment guide ".

2.1.1.4 handle the reagent of inclusion body

Lysis buffer: 50mmol/L TrisCl (pH 8.0), 1mmol/L EDTA, 100mmol/L NaCl;

Cleaning mixture A: in lysis buffer, add Triton X-100 to final concentration be 0.5%;

Cleaning mixture B:0.1mmol/L TrisCl (pH 8.0), 1mol/L carbamide is transferred pH to 8.0;

Cleaning mixture C:0.1mmol/L TrisCl (pH 8.0), 2mol/L carbamide is transferred pH to 8.0;

Cleaning mixture D:0.1mmol/L TrisCl (pH 8.0), 4mol/L carbamide is transferred pH to 8.0.

2.1.1.5 Western is hybridized used solution and reagent

The Western-Blot transfering buffering liquid: 2.9g glycine, 5.8g Tris alkali, 0.37g SDS, 200mL methanol, adding water to total amount is 1L.

0.1M TBS:32g sodium chloride, 0.8g potassium chloride, 12g Tris alkali add the dissolving of 800mL distilled water, regulate pH to 7.4, are settled to 1000mL, room temperature preservation behind the autoclaving.

0.1M add among the TTBS:0.1M TBS TWEEN20 to final concentration be 0.1%.

Confining liquid: the 0.1M TTBS that contains 5% defatted milk powder.After defatted milk powder dissolves fully, filter 4 ℃ of preservations.

DAB colour reagent box is available from Wuhan Boster Biological Technology Co., Ltd..

The sheep anti-mouse igg of HRP-labelling: Boster company product.

Nitrocellulose filter (NC): Pall-Gelman company product.

2.1.1.6 immunity mice and immunological adjuvant

Immunity is with male BALB/cA mice in 7 ages in week, available from Zhongshan University, North School Park zoopery center.

Complete Freund's adjuvant and not exclusively not the formula adjuvant be Sigma company product.

2.1.2 method

2.1.2.1 construction of recombinant plasmid

The letter of construction of recombinant plasmid strategy is chatted as follows.Be template promptly, obtain the purpose fragment, be connected with the carrier of EcoR I/HindIII double digestion with special primer amplification with the total length pSVCV-Full plasmid that builds, obtain recombinant expression plasmid called after pET-SVCV-Gly.

2.1.2.1.1 the segmental pcr amplification of design of primers and purpose

2.1.2.1.1.1 design of primers

Sequential design primer according to the pSVCV-Full clone who makes up.The SVCV G gene prokaryotic primer that contains EcoR I, two restriction enzyme sites of HindIII has respectively been synthesized in design, and adds 2～3 protection bases at 3 ', 5 ' end, amplification N end about 1000bp sequence (removing signal peptide).Primer is synthetic in Shanghai Ying Jun Bioisystech Co., Ltd, and the expected sequence size behind pcr amplification is 1072bp.

2.1.2.1.1.2 the segmental pcr amplification of purpose

Method is seen 1.1.2.2.2.2.

2.1.2.1.2 dna fragmentation is connected with pET-32a (+) carrier

The enzyme action purification process of PCR product is seen 1.1.2.3.1; The extraction of plasmid, enzyme action and purification process are seen 1.1.2.3.2.

Plasmid vector pET-32a (+) behind the double digestion is connected with PCR product behind the double digestion.Concentration and molecular weight size according to genes of interest and linearization plasmid DNA connect with T4 Ligase in the linked system of both mole ratios 1: 3～10.Connecting cumulative volume is 10 μ L.16 ℃ of connections are spent the night, and-20 ℃ of preservations are standby.Be transformed into DH5 α and screening positive clone 2.1.2.1.3 connect product

Method is seen 1.1.2.5.2 and 1.1.2.6.

2.1.2.2 recombiant plasmid changes expression vector BL21 (DE3) over to

The competent manufacture method of BL21 (DE3) is seen 1.1.2.4.

PET-SVCV-Gly recombinant plasmid transformed: add 0.5-1 μ L plasmid in the 100 μ L competent cells, mixing, ice bath 30min; 42 ℃ of water-bath heat shock 90s, horse back ice bath 5min then.Add fresh LB fluid medium 1mL, 37 ℃ of 200rpm recoveries of shaking table 10min.Room temperature 8, the centrifugal 1min of 000rpm siphons away the 1mL supernatant, remains 100 μ L mixings, coats on the LB/Amp flat board.Leave standstill dull and stereotyped 5min～10min, be inverted in 37 ℃ of incubators then and cultivate 12h～16h, deposit for 4 ℃.

2.1.2.3 the abduction delivering of recombiant protein

2.1.2.3.1 abduction delivering and the expression condition of recombiant plasmid pET-SVCV-Gly in escherichia coli groped

2.1.2.3.1.1 the abduction delivering of recombiant plasmid pET-SVCV-Gly in escherichia coli

Choosing single colony inoculation to 3～5mL from transform flat board contains in the LB/Amp culture medium of Amp, 37 ℃, the 200rpm jolting is spent the night, next day, the ratio in 1: 100 was inoculated in the fresh fluid medium that contains Amp, be cultured to OD600 in 37 ℃ and be about 0.6, adding IPTG is 1mM to final concentration, and 37 ℃ are continued to jolt and cultivate behind the 5h 10, and the centrifugal 1min of 000rpm receives bacterium.Ultrasonication, supernatant and precipitation are carried out SDS-PAGE respectively and are analyzed.

2.1.2.3.1.2 the expression condition of recombiant plasmid pET-SVCV-Gly in escherichia coli groped

Under the constant situation of other conditions (refer step 2.1.2.2.1.1), at different induction time 1h, 2h, 3h, 4h, 5h is centrifugal collection thalline respectively, carries out SDS-PAGE and analyzes.

Under the constant situation of other conditions (refer step 2.1.2.2.1.1), under different IPTG concentration 0.01mM, 0.05mM, 0.1mM, 0.4mM and 1mM, induce, centrifugal collection thalline carries out SDS-PAGE and analyzes respectively.

2.1.2.3.2 the ultrasonication of thalline

It is resuspended that the thalline of centrifugal collection adds the PBS of 1/10th volumes, carries out ultrasonic disruption to bacterium liquid and become till the clarification in ice bath, and the condition of ultrasonic Treatment is: 300W, and the 5s ultrasonication, 5s is intermittently.4 ℃, 12000g, centrifugal 15min; Collect supernatant, precipitation is used with the isopyknic 1 * PBS of supernatant heavy molten ,-20 ℃ of preservations.

2.1.2.3.3 SDS-polyacrylamide gel electrophoresis (SDS-PAGE)

Carry out the constant voltage electrophoresis on the small-sized protein electrophoresis device of BIO-RAD, used resolving gel concentration is 12%, and concentrated glue is 5%.Run concentrated glue with 45V voltage, 100V runs separation gel.Powered-down when running at the bottom of the glue to bromophenol blue carefully takes off blob of viscose, and more than the dyeing liquor dyeing 30min, destaining solution decolours clean to background.Observe strip type of albumen, Taking Pictures recording.

2.1.2.5 recombiant protein Polyclonal Antibody Preparation

2.1.2.5.1 the preparation of immunizing antigen

2.1.2.5.1.1 slightly carrying and purification of inclusion body

The expression strain that will contain recombiant plasmid pET-SVCV-Gly is inoculated in a large amount of abduction deliverings among the 100mL LB/Amp, thalline behind the centrifugal collection abduction delivering, take by weighing weight in wet base, and with the resuspended thalline of ratio of every gram weight in wet base 5mL PBS, ultrasonicly make lysis (method is seen 2.1.2.2.2), the centrifugal collecting precipitation precipitation is the inclusion body of slightly carrying.

With the inclusion body lysis buffer inclusion body is fully dissolved, can make it dissolving, 4 ℃, 12000g, centrifugal 15 minutes collecting precipitations by ultrasonic Treatment or homogenate method etc. when being difficult for dissolving.With inclusion body cleaning mixture A, B, C, D washing inclusion body respectively once, reuse 1 * PBS washs once successively, and centrifugal collection inclusion body adds an amount of 1 * PBS dissolving, gets 10 μ L and carries out the SDS-PAGE electrophoretic analysis.

2.1.2.5.1.2 recombiant protein cut glue purification

Inclusion body behind the purification runs SDS-PAGE glue, and the band that contains destination protein on the SDS-PAGE glue is cut off, and after 1 * PBS rinsing, adds an amount of 1 * PBS and fully grinds pulping and isopyknic Freund's complete adjuvant or Freund mixing immune animal with mortar.

2.1.2.5.2 immune animal

Get 7 ages in week eight of male BALB/c mouse, the antigen of the protein Preparation of seven injection SDS-PAGE glue purifications, an injection PBS/ adjuvant in contrast.Subcutaneous multi-point injection is adopted in injection, and every immunity in seven days once, immunity is four times altogether.Zhu She antigen is the homomixture of recombiant protein or PBS and Freund's complete adjuvant first, and the antigen of three injections is the homomixture of recombiant protein or PBS and Freund afterwards.

2.1.2.5.3 sero-fast preparation

Got blood in the 7th day behind the 4th immune animal, and changed in the 1.5mL centrifuge tube, placed 30 minutes under the room temperature or under 37 ℃.After treating that it solidifies, 4 ℃ are spent the night and make blood clot retraction.Sucking-off supernatant (serum) precipitates centrifugal 30 minutes of 4 ℃ of 2500g, and getting supernatant is that serum mixes with the supernatant of front.4 ℃, the centrifugal whole isolating serum parts of 1500g.Cryopreservation.

2.1.2.5.4 antiserum specific detection

After reorganization bacterium behind the abduction delivering carried out the SDS-PAGE electrophoresis, the serum that contrasts with injections of antigens and injection adjuvant PBS carried out the Western-blot analysis respectively.

Albumen transfer device with BIO-RAD company carries out Western Blot detection.Carrying out albumen according to a conventional method shifts.4 ℃, the about 2h of 70mA transfer printing.

Take out nitrocellulose filter with clean blunt-ended forceps, be soaked in the confining liquid, put on the decolorization swinging table that room temperature is shaken a few hours gently or place and spend the night, clean four times each 10min then with TTBS in 4 ℃ of refrigerators.The antiserum that adds preparation, incubated at room 2h cleans four times with TTBS then, each 10min.The sheep anti-mouse igg incubated at room 2h of reuse HRP-labelling cleans four times with TTBS then, each 10min.It is existing to there being clearly target protein take out of to add the colour developing of DAB colour developing liquid, uses ddH ₂The O cessation reaction, and flushing 10min places film on the filter paper natural drying with color development stopping.

2.2 interpretation of result

2.2.1 construction of prokaryotic expression vector

Sequential design primer according to the pSVCV-Full clone who makes up.The SVCV G gene prokaryotic primer that contains EcoR I, two restriction enzyme sites of HindIII has respectively been synthesized in design, and adds 2～3 protection bases at 3 ', 5 ' end, amplification N end about 1000bp sequence (removing signal peptide).Primer is synthetic in Shanghai Ying Jun Bioisystech Co., Ltd, sequence following (sequence is a restriction enzyme site in the square frame):

SVC-Gly-Full-F：5′-CG

CAGCCTGTAATTCAGCCATTT-3′

(EcoRI site)

SVC-Gly-Full-R：5′-GCG

CAGCCATCTAACTCCCAGTCGTC-3′

(Hind III site)

With plasmid pSVCV-Full is template, according to the selected primer purpose band (Fig. 4) that successfully increased.

PET 32a carrier with the corresponding endonuclease digestion of warp behind the PCR product enzyme action purification is connected, and send after bacterium colony PCR screening is positive and checks order to such an extent that correctly clone.

2.2.2. prokaryotic expression and condition optimizing

2.2.2.1, induce through IPTG with pET-SVCV-Gly plasmid transformation escherichia coli BL21 (DE3), can give expression to the about 57.4kDa of molecular weight (Fig. 5) recombiant protein, conform to size that prediction is come out (57348Da).Wherein the proteic estimated molecular weight expressed of recombiant plasmid pET-SVCV-Gly is 37.0kDa, and the fusion tag that pET-32a (+) expresses is 20.4 kDa.Before adding IPTG and inducing, take out 1mL bacterium liquid as negative control.From following electrophoretogram as can be seen, very strong protein band is arranged, conform to, the successful expression of destination protein has been described with expection in the position of 57KDa.

37 ℃ of inductive recombiant proteins are solvable hardly, all exist with the inclusion body form, because the main purpose of subsequent experimental is the special antibody of preparation SVCV G albumen, albumen exists with the inclusion body form and makes things convenient for the back purification, and can not influence the specificity of antibody, therefore just select for use 37 ℃ of expressing proteins to prepare antibody.

Induction time is the key factor that influences the expression of recombinant proteins amount, has compared the expression of 5 induction time 1h, 2h, 3h, 4h and 5h.SDS-PAGE result shows (Fig. 6), and induction time is in the 5h that is analyzed, and with the growth of induction time, the Recombinant Protein Expression amount increases, so the induction time that we select is 5h.

From Fig. 6, the IPTG of selected concentration all can induce Recombinant Protein Expression significantly, but from expression, the inductive recombiant protein of 0.4mM IPTG is maximum relatively, so finally we select 0.4mM IPTG as best IPTG concentration.

Therefore the optimum condition of recombiant protein abduction delivering in escherichia coli is: 37 ℃, 0.4mM IPTG abduction delivering 5h.

2.2.2.2 the blood sampling in the 7th day after the 4th immunity.Carry out Western-blot with antiserum and analyze to find, the antiserum that has only immune to prepare behind the recombinant protein antigen could react with the 57.4kDa protein band (Fig. 7).

The structure of embodiment 3 SVCV G gene DNA vaccines

3.1 materials and methods

3.1.1 material

PrimeSTAR ^The HS archaeal dna polymerase is available from TaKaRa company.

The same first of antibacterial culturing related reagent, plasmid vector and recipient bacterium.

3.1.2 method

3.1.2.1 the pcr amplification of design of primers and target gene fragment

3.1.2.1.1 design of primers

Three pairs of primers have been synthesized in design altogether, all add the Kozak sequence in the forward primer of every pair of primer, so that target protein can obtain to efficiently express in the fish body.Primer is synthetic in Shanghai Ying Jun Bioisystech Co., Ltd.

The segmental pcr amplification method of purpose is seen 1.1.2.2.2.2; The enzyme action purification process of PCR product is seen 1.1.2.3.1; The extraction of plasmid, enzyme action and purification process are seen 1.1.2.3.2.1.1.2.5.1 is seen in plasmid pET behind the double digestion and the PCR product method of attachment behind the double digestion; The connection product is transformed into DH5 α and the screening positive clone method is seen 1.1.2.5.2 and 1.1.2.6.

3.2 interpretation of result

Three pairs of primers have been synthesized in design altogether, all add the Kozak sequence in the forward primer of every pair of primer, so that target protein can obtain to efficiently express in the fish body.Primer is synthetic in Shanghai Ying Jun Bioisystech Co., Ltd, sequence following (sequence is a restriction enzyme site in the square frame) (table 7).

Table 7 SVCV G genetic fragment dna vaccination primer

Primer title primer sequence (5 ' → 3 ')

pSVCV-Sig.-F CG AAAACTAACAGACATCATGGCT

pSVCV-Sig.-R CG

A TTATAGACTAGTTCCCCACCCACTG

pSVCV-Trans.-F CA

ATGGCCATATTTGTTCCATCC

pSVCV-Trans.-R CG

C TCAAACTAAAGACCGCATTTCG

pSVCV-Null-F CA

ATGGCCATATTTGTTCCATCC

pSVCV-Null-R CG

A TTATAGACTAGTTCCCCACCCACTG

Annotate: the sequence that adds frame is a restriction enzyme site, and that wherein forward primer is used is Kpn I, and that downstream primer is used is XbaI; The runic labelled sequence is a start codon; The underscore labelled sequence is a termination codon.

In three pairs of primers, the pSVCV-Sig. primer is the SVCV G gene of disappearance signal peptide to amplification; PSVCV-Trans. primer is the SVCV G gene that disappearance is striden film district and back sequence thereof to what increase; The pSVCV-Null primer is the SVCV G gene that removes signal peptide simultaneously and stride the film district to amplification.Sequence size behind pcr amplification is respectively: 1431bp, 1493bp, 1361bp (Fig. 8).

The assessment of embodiment 4 SVCV dna vaccination immune effects

4.1 materials and methods

4.1.1 material

(fathead minnow FHM) is gone down to posterity by this laboratory and cultivate to preserve big head caudal peduncle cell line.

Culture medium: the MEM compound method is seen description.0.22 after the degerming of μ m membrane filtration, add in proportion two anti-to final concentration respectively be 100U/mL.

Lipofectamine ^TM2000, Invitrogen company; Opti-MEM  I Reduced SerumMedium, GIBCO company.

0.05%MS-222 (alkylsulfonate coordination benzocaine): available from SIGMA, 1g MS-222 adds suitable quantity of water dissolving back standardize solution to 2000mL.

Potassium permanganate, Tianjin good fortune chemical reagent in morning factory.

Brachydanio rerio: body weight 0.2～0.4g available from birds and flowers fish market, virtue village, Guangzhou, is used for immunization experiment after laboratory is supported a week temporarily.

Fish jar: 34cm * 22cm * 27cm (length * wide * height); Fish grain: golden rainbow microparticle fish grain, Guangzhou gold rainbow Shui nationality articles for use company limited.

Endofree ^Plasmid Max kit, QIAGEN company.

50 μ L microsyringes, her glass/glass apparatus company limited of Shanghai.

All the other are the same.

4.1.2. method

4.1.2.1 go the extraction of endotoxin plasmid DNA and the mensuration of concentration

4.1.2.1.1 go the extraction of endotoxin plasmid DNA

Going the endotoxin plasmid DNA to extract in the relevant experimentation, all glass drying ovens, the spoon of using as graduated cylinder, beaker and weighing all toasts 8h at 180 ℃, to destroy endotoxin.

Streak inoculation recombiant plasmid pSVCV-Full, pSVCV-Sig., pSVCV-Trans., pSVCV-Null and pcDNA3.0, the next day choose monoclonal in the culture tube that 2～5mL LB/Amp fluid medium is housed, 37 ℃ of 300rpm shaking tables are cultivated about 8h.Bacterium colony PCR is accredited as positive back 1/500～1/1000 and is inoculated in the 1000mL conical flask that contains 100mL LB/Amp fluid medium, and 37 ℃ of 300rpm shaking tables are cultivated about 12h～16h.Use QIAGEN Endofree ^Plasmid Max kit extracts, and concrete steps are as follows:

(1) 4 ℃, the centrifugal 15min of 6000g receives bacterium;

(2) reagent bottle that acutely rocks Sheng Buffer P1 is with the LyseBlue granule that suspends fully, and bacterial precipitation fully suspends to add 10mLBuffer P1/Rnase A (4 ℃ of preservations);

(3) add 10mL Buffer P2 in resuspended liquid, gentle but spin upside down fully and mix 4～6 times, room temperature is placed 5min.Because the cause of LyseBlue, add solution turned blue behind the Buffer P2, mix fully that to present a slice until whole solution blue uniformly;

(4) add the Buffer P3 that 10mL ices pre-cooling, the centrifuge tube several that leniently turns upside down immediately is until can't see blueness;

(5) a clean QIAlilter Maxi Cartridge is placed on the suitable support, the nut of screwing on is poured the lysate of step 4 among the QIAlilter Maxi Cartridge into, and room temperature is placed 10min;

(6) remove nut, lightly piston (plunger) is inserted among the QIAlilter Maxi Cartridge, be filtered in the clean 50mL centrifuge tube, this step approximately can be collected 25mL filtrate;

(7) add 2.5mL Bffer ER in filtrate, gentle but spin upside down fully and mix 10 times, place 30min on ice;

(8) add 10mL Buffer QBT in QIAGEN-tip 500, allow it drain off naturally with the equilibrium adsorption post;

(9) 30mL Bffer QC washes QIAGEN-tip 500 posts;

(10) repeating step (9);

(11) 15mL Bffer QN eluting;

(12) add 10.5mL isopropyl alcohol (room temperature placement) precipitation plasmid DNA, behind the mixing 4 ℃, 〉=15, the centrifugal 30min of 000g abandons supernatant;

(13) ethanol of 5mL 70% (room temperature placement) washing, 4 ℃, 〉=15, the centrifugal 10min of 000g abandons supernatant;

(14) air drying 5min～10min, an amount of endotoxin-free Buffer TE dissolving ,-20 ℃ of preservations are standby.

4.1.2.1.2 the mensuration of plasmid DNA concentration

Plasmid DNA concentration is determined by measuring its absorption value at OD260.

5 plasmids that extract are done 100 times and 50 times of dilutions with endotoxin-free Buffer TE respectively, measure OD260 to determine the concentration of each plasmid at two different ultraviolet spectrophotometers.

4.1.2.2 the mensuration of virus titer

Measure virus titer with the plaque method, concrete steps are as follows:

Pass the FHM cell in 24 orifice plates, cell grows up to monolayer behind 20～22h.With serum-free medium viral SVCV to be measured is carried out 10 times of gradient dilutions to 10 ^-8Discard the culture fluid in the cell plates, add the viral dilution liquid of 100 μ L in every hole, each concentration is established 3 multiple holes, and sets up negative control.25 ℃ of following absorption 1h, during jog cell plates frequently.Discard hole inner virus diluent behind the absorption 1h, add sterilization agarose (final concentration 0.7%)-M199 culture medium mixed liquor of 650 μ L, after room temperature (15-20min) condensation, add the M199 culture fluid that 1mL contains Herpes.The number of plaque in the every hole of counting after 5 days.The virus-virus titre is represented with PFU/mL.Calculate its titre with the sum of the plaque in minimum dilution factor average.

4.1.2.3 the check of SVCV in the Brachydanio rerio body before the inoculation dna vaccination

Before the injection dna vaccination carries out immunological experiment, need to be carried out the check of SVCV to exempting from fish.

9 Brachydanio rerio of picking are got liver,spleen,kidney at random, and three fishes are extracted total RNA of tissue as a sample with TRIzol  Reagents.Tissue adds the Trizol of 10 times of volumes after liquid nitrogen freezes crisp the grinding.Grind the back and move in the 1.5mL centrifuge tube of no RNase the same 2.1.2.1.2 of following step with liquid-transfering gun.

RNA extracts the back and reverses and pcr amplification according to 2.1.2.2.2, establishes RT and PCR negative control, the RNA that positive control uses the Brachydanio rerio of definite SVCV of infection to extract.

4.1.2.4DNA the cell inner expression of vaccine

Recombiant plasmid transfection FHM cell is adopted in the research of the cell inner expression of dna vaccination, extract total RNA after RT-PCR detect.Concrete grammar is as follows:

Transfection the previous day, inoculation 2～6 * 10 ⁵Individual cell has 90～95% degree of converging in 6 orifice plates during to transfection; 4.0 μ g plasmid and 10 μ L Lipofectamine 2000 are diluted to 250 μ L with the Opti-MEM culture medium respectively, mixing gently, incubated at room 5min; With both mixings gently, incubated at room 20min; Abandon the culture fluid in the former cultivation plate hole, add the MEM culture medium of 1mL serum-free, add the mixed liquor of DNA and Lipofectamine2000 again, the jog culture plate so that mixed liquor fully contact with cell; After cultivating 4～6h in 25 ℃ of constant incubators, siphon away mixed liquor, add the MEM culture medium that 2mL contains 10% hyclone, take out culture plate behind the 30h ,-80 ℃ of preservations.

Total RNA extracts and the RT-PCR detection method is seen 1.1.2.1.2,1.1.2.2.2.PCR detects with the check primer of primer with SVCV in the Brachydanio rerio body among the 4.1.2.3.

4.1.2.5 immune fish body experiment

4.1.2.5.1 the preparation before the immunity

Before supporting Brachydanio rerio, all fish jars are all used the potassium permanganate solution soaked overnight.

According to the result that ultraviolet spectrophotometer is measured, it is 0.1 μ g/ μ L that each plasmid is diluted to final concentration with PBS.

4.1.2.5.2 immune fish body experiment

Brachydanio rerio is put into 0.05% MS-222 solution, treat to carry out immunity inoculation immediately, every fish intramuscular inoculation 5 μ L after the fish anesthesia.Experiment is divided into 7 groups: 1, do not inject matched group; 2, injection PBS matched group; 3, injection pcDNA 3.0 matched groups; 4, injection pSVCV-Full recombiant plasmid experimental group; 5, injection pSVCV-Sig. recombiant plasmid experimental group; 6, injection pSVCV-Trans. recombiant plasmid experimental group; 7, injection pSVCV-Null recombiant plasmid experimental group.About 30 fishes of the 1st winding kind wherein; Respectively inoculate about 60 fishes for the 2nd～7 group.Except the 1st group, other every group of fish branch supported in two fish jars.Water temperature maintains 21 ℃ in the whole experiment, and inoculation stops feeding the previous day, and inoculation was designated as the 0th day the same day, and water and feeding are normally changed in beginning in second day.

4.1.2.6 counteracting toxic substances experiment

Fish in two cylinders of every group of Brachydanio rerio will separately supporting before the counteracting toxic substances lumps together, and carries out the counteracting toxic substances experiment behind the inoculation dna vaccination on the 7th day.The 1st group in contrast, the virus stock solution used 10 μ L of 1000 times of dilutions of all the other every group every fish belly chamber injection PBS.The fish that injection back is every group still is divided into two fish jars to be cultured, and supports being designated as 1. of former cylinder, and all 1. fish jars of being designated as are as first group; Support being designated as 2. of new cylinder, all 1. fish jars of being designated as are as second largest group.Counteracting toxic substances stops feeding the previous day, and counteracting toxic substances was designated as the 0th day the same day, and water and feeding are normally changed in beginning in second day behind the counteracting toxic substances.Add up dead fish number every day, counted on the 6th day.

4.2 interpretation of result

4.2.1 the check of SVCV in the Brachydanio rerio body before the inoculation

Check is with the sequence of the 853bp of the 451st nucleotide to 1303 nucleotide of primer specific amplification SVCV G albumen, and primer sequence is as follows:

D-SVC-Gly-F：5′-TCTGTTCATTTGGAGCCG-3′

D-SVC-Gly-R：5′-GGATTTCATCGTCGTCAT-3′

PCR finishes back 1% agarose gel electrophoresis and detects.If the RNA that RT and PCR negative control, positive control use the Brachydanio rerio of definite SVCV of infection to extract.

Fig. 9 is the RT-PCR result of the Brachydanio rerio RNA of randomization.From scheming as seen, the Brachydanio rerio of randomization does not all amplify the purpose band.Prove that thus the Brachydanio rerio of randomization does not all infect SVCV, therefore can be used for the immune effect evaluation experimental of SVCV dna vaccination.

4.2.2 the cell inner expression of dna vaccination

The RT-PCR testing result is seen Figure 10, and visible transfectional cell has amplified the fragment of about 850bp, proves that the dna vaccination that makes up can be at cell inner expression.

4.2.3 immune fish body experiment

Water temperature is progressively reduced when supporting temporarily, reduces to 21 ℃ during to inoculation, keeps this temperature and finishes until whole experiment.Intramuscular injection 5 μ L recombiant plasmid, the concrete position of injection are from the place of fish body head 60% (Figure 11) between back central authorities, dorsal fin and side line.

Carry out counteracting toxic substances experiment after 7 days, the death toll of adding up fish every day, dead fish is considered to injection or reason such as coerces cause death in the 12h of injection back.Draw bar diagram (Figure 12) according to experimental data.

With injection pcDNA3.0 group is matched group; mortality rate according to each group that comes out; (Relative percentage survival, RPS): protective rate (RPS)=[1-(immune group mortality rate/matched group mortality rate)] * 100% application SPSS 10.0 carries out x relatively to calculate relative protective rate according to following formula ²Check.That calculates the results are shown in Table 8.X to experimental group ²Check shows that each organizes difference with insignificance (P=0.486).

The relative protective rate that table 8 is every group

The injection plasmid	Survival rate	Relative protective rate (RPS)	x 2	The P value
					pcDNA 3.0 PBS pcSVCV-Sig. pcSVCV-Trans. pcSVCV-Null pcSVCV-Full	5.26％ 6.67％ 26.32％ 21.67％ 21.67％ 18.97％	0 1.48％ 22.22％ 17.32％ 17.32％ 14.47％	- 0.077 15.125 10.704 10.704 8.167	- 0.782 0.0001 0.001 0.001 0.004

Claims (7)

1. a SVCV vaccine dna vaccination is characterized in that being made of SVCV G albumen full-length gene and prokaryotic expression carrier pET32a (+) plasmid.

2. the preparation method of the described SVCV vaccine of claim 1 dna vaccination is characterized in that comprising the steps:

(1) SVCV G albumen Cloning of Entire Gene;

(2) SVCV G Prokaryotic Expression and Antibody Preparation;

(3) structure of SVCV G gene DNA vaccine.

3. according to the described preparation method of claim 2, it is characterized in that the described SVCV G of step (1) albumen Cloning of Entire Gene primer sequence is:

SVC-Gly-Full-F： 5′-CCGGGTACCAAAACTAACAGACATCATGT-3′

SVC-Gly-Full-R： 5′-GCCTCTAGAACTCTCAAACTAAAGACCGCA-3′。

4. according to the described preparation method of claim 2, it is characterized in that the described SVCV G of step (2) Prokaryotic Expression primer sequence is:

SVC-Gly-Full-F：5′-CGGAATTC CAGCCTGTAATTCAGCCATTT-3′

SVC-Gly-Full-R：5′-GCGAAGCTT CAGCCATCTAACTCCCAGTCGTC-3′。

5. according to the described preparation method of claim 2, it is characterized in that the reaction temperature of the described SVCV G of step (2) Prokaryotic Expression is 37 ℃.

6. according to the described preparation method of claim 2, it is characterized in that the inductive condition of the described SVCV G of step (2) Prokaryotic Expression is 0.4mM IPTG, 5h.

7. according to the described preparation method of claim 2, it is characterized in that the structure primer sequence of the described SVCV G of step (3) gene DNA vaccine is:

pSVCV-Sig.-F：CGGGTACCAAAACTAACAGACATCATGGCT

pSVCV-Sig.-R：CGTCTAGAATTATAGACTAGTTCCCCACCCACTG

pSVCV-Trans.-F：CAGGTACCATGGCCATATTTGTTCCATCC

pSVCV-Trans.-R：CGTCTAGACTCAAACTAAAGACCGCATTTCG

pSVCV-Null-F：CAGGTACCATGGCCATATTTGTTCCATCC

pSVCV-Null-R：CGTCTAGAATTATAGACTAGTTCCCCACCCACTG。

Images