CN100567490C - RNA interference fragment and application thereof - Google Patents

Abstract

The invention discloses a kind of RNA and disturb (RNAi) fragment at people β-thalassemia α-Zhu Danbai mRNA, by the carrier of its structure and the K562 cell mixing system that produces, by sxemiquantitative RT-PCR analyze, real-time quantitative RT-PCR detects that to find that each interference fragment carrier can make the alpha globin expression amount reduce about more than 30%.Therefore, RNAi fragment of the present invention and expression vector thereof are applied to clinical gene therapy and have important value.

Description

RNA interference fragment and application thereof

Technical field

The invention belongs to molecular genetic and gene therapeutics field, specifically, the invention relates to a kind of RNA interference fragment and application thereof that can suppress β-thalassemia α-chain.

Background technology

Thalassemia is because certain or some protein chain synthesis rates reduce, and cause some peptide chains to lack, and other peptide chains increases relatively, so that the imbalance of quantity of peptide chains resulted occurs and the hemolytic anemia that causes.β-thalassemia (β ground is poor) is wherein one type, and the whole world has hundreds of different poor types in β ground.

A large amount of research datas show, β-thalassemia is because genetically deficient causes except that minority, and the overwhelming majority is because due to the dissimilar point mutation (comprising the replacement of single base, the insertion or the disappearance of indivedual bases) of beta-globin gene.These point mutation cause respectively transcribing being obstructed, mRNA precursor montage processing mistake, and it is invalid to translate, and makes α/beta globin chain imbalance etc.The β chain is synthetic to be subtracted scarcely, and the α chain is too much relatively, unnecessary α chain formation α inclusion body.In the red corpuscle of differentiation and maturation not, α chain inclusion body can make cytolemma sustain damage, and makes it most of destroyed in marrow.Though part red corpuscle energy maturation also is released in the peripheral blood, because α chain inclusion body attached on the erythrocyte membrane, makes red corpuscle stiff, it easily is torn by microcirculation the time; The inclusion body red corpuscle that comes off then forms teardrop shaped, and this red blood cell life span is short, and easily the destroyed symptoms such as anaemia, hepatosplenomegaly that cause should disease not have specific therapy at present, and eventually because of overtransfusion, irony deposition, cardiac failure are deadly.

At present, the poor treatment in β ground mainly contains pharmacological agent, and it is synthetic not enough to induce HbF (fetal type oxyphorase) to increase with the substituted beta globin gene as hydroxyurea, butyric acid etc.; Bone marrow transplantation therapy (but lacking effective donor); Therapeutic transgene (as the beta-globin gene); Inverted defined gene is corrected the method for unusual β chain etc.But above-mentioned method is defectiveness all, can not reach satisfactory therapeutic effects.

Summary of the invention

Purpose of the present invention just is to overcome the above-mentioned shortcoming and defect of the poor methods of treatment in existing β ground, thus provide a kind of based on RNA interference (RNAi) technology at the poor RNA interference fragment in β ground.

Another object of the present invention is to provide a kind of expression vector to make up at the poor RNAi fragment in β ground.

The cDNA sequence of human alpha globin gene is in the existing announcement of GeneBank, use some principles in the RNAi design, contain chain greater than 45% as the GC base, seeking AA sequence sequence afterwards is target site, length 19-23 bp etc., artificial design is at 3 of the RNAi fragments of α chain, two ends design restriction enzyme site, the specificity of Blast aligned sequences is better, and sequence is:

α1：GAC CTA CTT CCC GCA CTT C

α2：GTT CCT GGC TTC TGT GAG C

α3：ATA CCG TTA AGC TGG AGC C

RNAi fragment construction of expression vector with above-mentioned α 1, α 2 and α 3:

Increasing from human embryo kidney (HEK) 293T cell by nest-type PRC obtains the H1 promotor of dependenc RNA polymerase III, and the PCR primer is:

1、5’-TATCTAGAGAATTCGAACGCTGACG-3’；

2、5’-TGAAGCTTGTGGTCTCATACAGAAC-3’；

3,5 '-TCTAGACTGACGTCATCAACCCGCTCCA-3 ' (antisense strand).

Wherein primer 2,3 has XbaI and HindIII restriction enzyme site respectively.

The H1 promotor that obtains is cloned into (invitrogen) on the pREP4 carrier, obtains the PH carrier; By HindIII and NheI restriction enzyme site, after above-mentioned RNAi fragment annealing, be connected on the PH carrier afterwards, be built into P α 1, P α 2,3 three kinds of carriers of P α respectively, and correct through checking order.

With the expression vector that above-mentioned structure obtains, transfection human erythorleukemia cell line (K562), and set up and mix clonal cell line:

1, transfection: K562 cell (available from Shanghai cell institute of the Chinese Academy of Sciences) is with the DMEM substratum (GIBCO) of 15% foetal calf serum, in 37 ℃, 5%CO ₂Condition is cultivated.Adopt liposome 2000 (Invitrogen) to carry out cell transfecting.During transfection, with 1 μ g RNAi carrier transfection K 562 cell (10 ⁵/ hole, 24 well culture plates);

2, set up the mixing clonal cell line: because transfection efficiency is low, in order to get rid of the impact cell of negative cells (untransfected interference plasmid), in transfection after 48 hours, adding concentration is the hygromycin (Totomycin of 800 μ g/ml, sigma company) screen, about two weeks set up and mix clonal cell line.

The experiment proved that three kinds of interference plasmids of the present invention's design can both reduce the expression of α chain in the K562 cell, it is about more than 30% that each disturbs chain to lower α chain expression amount.Because the alpha globin expression amount descends, the tetrameric amount of synthetic alpha globin lowers, so just reduced the generation of α inclusion body, can solve the imbalance problem of α/β chain, make normal α/β relative proportion rising, haemolysis sx, and might stimulate the compensatory mechanism of patient's hemopoietic system, HbF is increased, treatment or alleviation patient's clinical symptom.

Description of drawings

Fig. 1 is the structure synoptic diagram of RNAi carrier of the present invention;

Fig. 2 is a quantitative RT-PCR result schematic diagram of the present invention;

Embodiment

Below the invention will be further described by specific embodiment.Should be understood that following examples only are used to illustrate the present invention, and be not used in the scope of the present invention that limits.

Employed technology in following examples, comprise gene sequencing, pcr amplification and detection, cell transfecting, vector construction equimolecular biology techniques, and cell cultures, detection technique etc., unless stated otherwise, be the known routine techniques of those skilled in the art; Employed plant and instrument, reagent, plasmid and carrier, clone etc., only this specification sheets is dated especially, is that the research of general this area and technician can obtain by public approach.

Embodiment 1The segmental design of RNAi

Use some principles (Berns K, Nature.2004 in the RNAi design; 428 (6981): 431-7): (1) is sought " AA " two and is connected sequence, and write down 19-23 base sequence of its 3 ' end, as potential siRNA target site from the AUG initiation codon of transcript (mRNA).(2) potential sequence and corresponding genome database (people or mouse, rat or the like) are compared, get rid of those and other encoding sequences/EST homologous sequence, for example use BLAST (www.ncbi.nlm.nih.gov/BLAST/); (3) select suitable target sequence and synthesize, artificial three RNAi fragments that design at the α chain:

α1：GAC CTA CTT CCC GCA CTT C

α2：GTT CCT GGC TTC TGT GAG C

α3：ATA CCG TTA AGC TGG AGC C

These three RNAi fragment lengths are 19bp, in view of being easy to accomplish for segmental synthesizing of such weak point in the prior art, so locate to repeat no more.

Embodiment 2Construction of expression vector

With α 1, α 2 and 3 three RNAi fragments of α construction of expression vector of above-mentioned design, concrete steps are as follows respectively:

1, the acquisition of PH carrier

Increasing from human embryo kidney (HEK) 293T cell (Shanghai cell institute of the Chinese Academy of Sciences) by nest-type PRC obtains the H1 promotor of dependenc RNA polymerase III, specific as follows:

The PCR primer:

1：5’-TATCTAGAGAATTCGAACGCTGACG-3’；

2：5’-TGAAGCTTGTGGTCTCATACAGAAC-3’；

3:5 '-TCTAGACTGACGTCATCAACCCGCTCCA-3 ' (antisense strand).

Wherein primer 2,3 has XbaI and HindIII restriction enzyme site respectively.

Amplification condition:

One expands: 94 ℃ of 4min, 1 circulation; 94 ℃ of 30second, 53-57 ℃ of 45second, 72 ℃ of 30second, 30 circulations; 72 ℃ of 10min, 1 circulation;

Two expand: 94 ℃ of 4min, 1 circulation; 94 ℃ of 30second, 55 ℃ of 45second, 72 ℃ of 30second, 32 circulations; 72 ℃ of 10min, 1 circulation.

The H1 promotor that obtains is cloned on the T carrier (Invitrogen company), obtains control vector TH1.Show that through order-checking the H1 promoter sequence is correct.By XbaI and SalI double digestion carrier TH1, the H1 promotor is cloned into (invitrogen) on the pREP4 carrier then, obtains the PH carrier.

2, the structure of expression vector

Cut the PH carrier with Hind III and NheI enzyme, after two chain annealing of above-mentioned RNAi fragment α 1 (containing Hind III and NheI restriction enzyme site), using the T4 ligase enzyme is connected on the PH carrier, be built into P α 1 expression vector (as shown in Figure 1), and be accredited as correctly through order-checking, its sequence is shown in SEQ ID NO:1.

With α 2 and α 3 construction of expression vector P α 2 and P α 3, and identify that through order-checking its sequence is respectively shown in SEQ ID NO:2 and 3 with identical method.

Embodiment 3Transfection human erythorleukemia cell line K562, and set up and mix clone strain

1, transfection: K562 cell (available from Shanghai cell institute of the Chinese Academy of Sciences) is with the DMEM substratum (GIBCO) of 15% foetal calf serum, in 37 ℃, 5%CO ₂Condition is cultivated.Adopt liposome 2000 (Invitrogen) to carry out cell transfecting, method can be fully according to producer's explanation.During transfection, use 1 μ g RNAi carrier P α 1, P α 2 and P α 3 transfection K 562 cells (10 respectively ⁵/ hole, 24 well culture plates), plasmid and liposome ratio are 1ug: 2.5ul.

2, set up the mixing clonal cell line: because transfection efficiency is low, in order to get rid of the impact cell of negative cells (untransfected interference plasmid), in transfection after 48 hours, add concentration for the hygromycin (Totomycin, sigma company) with 600～800 μ g/ml screened more than two weeks, obtain positive cell clone, about two weeks back foundation mixes clonal cell line, and the RNA that extracts cell analyzes, with the purity (pollute if any DNA, need to handle with the DNA enzyme) that guarantees RNA.

Embodiment 4Interference effect detects

1, sxemiquantitative RT-PCR analyzes: extract the RNA (RNA of Gentra company extracts test kit) that uses in the mixing K562 cell clone of setting up after P α 1, P α 2 and P α 3 transfections, the laggard performing PCR reaction of reverse transcription.

The reverse transcription condition is: with 70 ℃ of RNA, RNase inhibitor, Oligo dT, 10min; Behind the ice bath 2min, add dNTP, reversed transcriptive enzyme and buffer, 37 ℃, 1hr.

The PCR condition is: 94 ℃ of 4min, 1 circulation; 94 ℃ of 1min, 55 ℃ of 45second, 72 ℃ of 1min, 23～29 circulations; 72 ℃ of 10min, 1 circulation, the α chain that increases simultaneously, γ chain (because α chain, the ratio of γ chain in the K562 cell are about 1, thus the α chain that increases simultaneously, γ chain, and with the γ chain as confidential reference items).

Primer is:

α chain: forward, 5 ' CCACCACCAAGACCTACTTC3 '

Oppositely, 5 ' TACCGAGGCTCCAGCTTAAC3 '

γ chain: forward, 5 ' GTATCTGGAGGACAGGGCACT3 '

Oppositely, 5 ' ACTCGCTTCTGGAACGTCTGA3 '

The agargel electrophoresis (80V) of amplified production in 1.5% is after 2 hours, and (STRATAGENE company) carries out photodensitometry with Qscan software, according to the optical density(OD) ratio of α chain optical density(OD) band with the optical density(OD) band of γ chain, calculates the relative content of mRNA.Electrophoresis result is as shown in table 1.As seen, the amount of each interference group α chain mRNA, Reinhoit Zahl (α chain/γ chain) all are starkly lower than the normal control group.

Table 1: the amount of interference group α chain mRNA, Reinhoit Zahl (α chain/γ chain)

Grouping	Reinhoit Zahl (α chain/γ chain)
		Normal control	0.86±0.01
1 group of P α	0.56±0.02
		2 groups of P α	0.54±0.009
3 groups of P α	0.61±0.01

2, real-time quantitative RT-PCR detects: extract total RNA, and the laggard performing PCR reaction of reverse transcription, specific as follows:

Extract total RNA: extract the RNA that uses in the mixing K562 cell clone of setting up after P α 1, P α 2 and P α 3 transfections, step is extracted the test kit explanation with reference to the RNA of Gentra company.

Reverse transcription: with 70 ℃ of RNA, RNase inbibitor, Oligo dT, 10min; Behind the ice bath 2min, add dNTP, reversed transcriptive enzyme and Buffer, 42 ℃, 1hr.

PCR: respectively get 4 μ l as pcr template, make and respectively organize RNA total amount unanimity, in reaction system, add primer (1:CCACCACCAAGACCTACTTC; 2:TACCGGAGGCTCCAGCTTAAC) 2 μ l, ddH ₂O 9 μ l, 10 μ l SYBR ^RGreen (GENE company is used to detect the amount of DNA) quantitative PCR system, total system 25 μ l.Each sample increase respectively α chain, γ chain.Reaction conditions is: 95 ℃ of pre-sex change 3min, 95 ℃ of sex change 30s, extend 30s, totally 25 circulations at 59 ℃ of annealing.Gather fluorescence in the time of 59 ℃.Reaction finishes the back, and (CORBETTRESEARCH, analysis software RG3000) (comparative quantity) is analyzed experimental result with the quantitative PCR instrument.In the experiment, as confidential reference items, the result as shown in Figure 2 with the γ globin chain for we.

As seen each interference group (α 1, α 2, α 3) is because the effect of RNAi reduces the synthetic of α chain relatively, and it is about more than 30% that each disturbs chain to lower α chain expression amount, and the odds ratio control group N of α/γ chain mRNA has tangible minimizing.

Sequence table

＜110〉The Children's Hospital Attached to Shanghai Jiaotong Univ.

＜120〉RNA interference fragment and application thereof

<130>041382C

<160>3

<170>PatentIn version 3.1

<210>1

<211>700

<212>RNA

<213>unsure

<220>

<221>plasmid

<222>(1)..(700)

<223>

<400>1

tggtaccagc tgctagcttt ccaaaaagac ctacttcccg cacttctctc ttgaagaagt 60

gcgggaagta ggtcgggagc ttgtggtctc atacagaact tataagattc ccaaatccaa 120

agacatttca cgtttatggt gatttcccag aacacatagc gacatgcaaa tattgcaggg 180

cgccactccc ctgtccctca cagccatctt cctgccaggg cgcacgcgcg ctgggtgttc 240

ccgcctagtg acactgggcc cgcgattcct tggagcgggt tgatgacgtc agtctagagg 300

atcgatcccc gccccggacg aactaaacct gactacgaca tctctgcccc ttcttcgcgg 360

ggcagtgcat gtaatccctt cagttggttg gtacaacttg ccaactgggc cctgttccac 420

atgtgacacg gggggggacc aaacacaaag gggttctctg actgtagttg acatccttat 480

aaatggatgt gcacatttgc caacactgag tggctttcat cctggagcag actttgcagt 540

ctgtggactg caacacaaca ttgcctttat gtgtaactct tggctgaagc tcttacacca 600

atgctggggg acatgtacct cccaggggcc caggaagact acgggaggct acaccaacgt 660

caatcagagg ggcctgtgta gcttccgata agcggaccct 700

<210>2

<211>680

<212>RNA

<213>unsure

<220>

<221>plasmid

<222>(1)..(680)

<223>

<400>2

tggtaccagc tgctagcttt ccaaaaagtt cctggcttct gtgagctctc ttgaagctca 60

cagaagccag gaacgggagc ttgtggtctc atacagaact tataagattc ccaaatccaa 120

agacatttca cgtttatggt gatttcccag aacacatagc gacatgcaaa tattgcaggg 180

cgccactccc ctgtccctca cagccatctt cctgccaggg cgcacgcgcg ctgggtgttc 240

ccgcctagtg acactgggcc cgcgattcct tggagcgggt tgatgacgtc agtctagagg 300

atcgatcccc gccccggacg aactaaacct gactacgaca tctctgcccc ttcttcgcgg 360

ggcagtgcat gtaatccctt cagttggttg gtacaacttg ccaactgggc cctgttccac 420

atgtgacacg gggggggacc aaacacaaag gggttctctg actgtagttg acatccttat 480

aaatggatgt gcacatttgc caacactgag tggctttcat cctggagcag actttgcagt 540

ctgtggactg caacacaaca ttgcctttat gtgtaactct tggctgaagc tcttacacca 600

atgctggggg acatgtacct cccaggggcc caggaagact acgggaggct tacaccaacg 660

tcaatcagag gggcctgtgt 680

<210>3

<211>660

<212>RNA

<213>unsure

<220>

<221>plasmid

<222>(1)..(660)

<223>

<400>3

ggtaccagct gctagctttc caaaaaatac cgttaagctg gagcctctct tgaaggctcc 60

agcttaacgg tatgggagct tgtggtctca tacagaactt ataagattcc caaatccaaa 120

gacatttcac gtttatggtg atttcccaga acacatagcg acatgcaaat attgcagggc 180

gccactcccc tgtccctcac agccatcttc ctgccagggc gcacgcgcgc tgggtgttcc 240

cgcctagtga cactgggccc gcgattcctt ggagcgggtt gatgacgtca gtctagagga 300

tcgatccccg ccccggacga actaaacctg actacgacat ctctgcccct tcttcgcggg 360

gcagtgcatg taatcccttc agttggttgg tacaacttgc caactgggcc ctgttccaca 420

tgtgacacgg ggggggacca aacacaaagg ggttctctga ctgtagttga catccttata 480

aatggatgtg cacatttgcc aacactgagt ggctttcatc ctggagcaga ctttgcagtc 540

tgtggactgc aacacaacat tgcctttatg tgtaactctt ggcttgaagc tcttacacca 600

atgctggggg acatgtacct cccaggggcc caggaagact acgggaggct tacacccaac 660

Claims (3)

1, a kind of at β-thalassemic RNA interference fragment, it is characterized in that the sequence of described RNA interference fragment is as follows:

α2：GTT CCT GGC TTC TGT GAG C。

2, a kind of expression vector of RNA interference fragment is characterized in that, this expression vector is cloned the requirement 1 described RNA interference fragment of having the right.

3, expression vector as claimed in claim 2 is characterized in that, this expression vector has the sequence shown in the SEQ ID NO:2.

Images