CN100486994C - Nitrate transport protein of diatom and its coding gene and application - Google Patents

Abstract

The present invention is kind of nitrate transport protein of diatom and its coding gene and application in transgenic plant. The nitrate transport protein has one of the following amino acid residue sequence: 1. SEQ ID No. 1 in the sequence list; and 2. the amino acid residue sequence of SEQ ID No. 1 through substitution, deletion or addition of 1-10 amino acid residues and coding protein possessing nitrate transport function. The transgenic tobacco, rice or lawn grass with the gene of the present invention NAT3 can grow normally on the culture medium with nitrogen element content only 1/32 normal value, and this proves the capacity of NAT3 in raising the nitrogen absorption. The present invention may have wide application foreground in plant nitrogen fertilizer absorption and breeding low nitrogen resisting plant variety.

Description

Nitrate transport protein of diatom and encoding gene thereof and application

Technical field

The present invention relates to derive from the nitrate transport protein of diatom, the encoding gene of diatom nitrate transport protein, and the application in cultivating transgenic plant.

Background technology

Nitrogenous fertilizer is various crops (especially paddy rice, turfgrass, tobacco etc.) the necessary fertilizer of growing.Paddy rice is China's important crops, accounts for 44% (Ling Qihong etc., the irreplaceable effect of opinion Rice Production in China's southern economy developed regions Sustainable development, " Chinese rice ", 2004 supplementary issues) of total output of grain.Nitrogenous fertilizer is the necessary first fertilizer of paddy growth, along with the increase of amount of application of nitrogen fertilizer, the output of paddy rice, tiller number, total leaf number all become tangible increase trend (Pan Zhi are high, and the different nitrogen fertilizer amounts of rice intensification are to the pre-test that influences of output, " Chinese rice ", 2005 the 2nd phases).Therefore, for improving rice yield, a large amount of aborning applied nitrogens of people.

16 kinds of elements of the growth needs of turfgrass, wherein nitrogen plays an important role, and it all has considerable influence to color and luster, growth potential, density, resistance and the recovery dynamics of turfgrass.If do not apply enough nitrogenous fertilizer in the soil, the growth of turfgrass will slow down, and careless look also can shoal, even flavescence, must regularly apply nitrogenous fertilizer when therefore cultivating turfgrass.

Tobacco also is the important cash crop of China, and national tobacco planting area reaches 1,674 ten thousand mu, and national tobacco purchasing amount remains on about 2,100,000 tons, is the important tax revenue source of China.The amount of application of nitrogenous fertilizer directly has influence on the yield and quality of tobacco leaf.In recent years, the amount of application of China tobacco producing region nitrogenous fertilizer significantly increases.

In recent years all kinds of crops amount of application of nitrogen fertilizer constantly increase, the amount of application severe overweight, but crop is but very low to the utilization ratio of nitrogenous fertilizer in the soil, and environment is polluted, the serious eutrophication in river.NAT (Diatom NitrateTransporter) gene is to be cloned from the diatom (Cylindrothecafusiformis) of marine growth by Mark Hildebrand to obtain, and this gene does not have intron.The nitrate transport protein of NAT genes encoding and nitrate have very high bonding force, can make diatom enrichment nitrate from seawater.

Studies show that the NAT transfer-gen plant has the ability of normal growth in low levels nitrate soil, NAT can promote the growth of transgenic plant in low nitrogen soil, and under the prerequisite that does not influence crop yield, reduces or applied nitrogen not, has avoided environmental pollution.

At present, people have cloned the relevant gene of a plurality of and nitrogen transhipment from plant, for example from chrysophyceae (Isochrysis galbana) clone nitrate transport protein (IgNRT) gene, ammonia transporter (IgAMT) gene and glutaminate synthetic enzyme (IgGSII) gene, its cDNA length is respectively 540bp, 658bp and 852bp.The real-time fluorescence quantitative PCR detected result shows, exists under the situation of nitrate, and IgNRT and IgAMT transcripton quantity average out to 27.6 and 28.5, the transcripton quantity when nitrogen lacks increases by 390% and 178% respectively; When ammonium existed, IgNRT and IgAMT gene transcription were subjected to severe inhibition, and transcripton quantity reduces by 2.4% and 6.5% respectively.Compare the expression amount of IgGSII, the cell of growing in nitrate is the highest, secondly is the cell (50%) that is grown under the nitrogen shortage situation, is the cell (25%) that is grown in the ammonium once more.Nitrate transport protein expression of gene situation is found in more different diatoms and the green alga, the IgNRT of different diatoms and green alga, and IgAMT is similar with IgGSII expression of gene mode, all is subjected to adding the regulation and control of nitrogen concentration and nitrogen kind.Homology analysis is the result show, the homology of chrysophyceae IgNRT and diatom NAT is 47%, with the homology of the ammonia transporter (CylAMT) of diatom be 48%.IgGSII is 61% with the homology that derives from the glutaminate synthetic enzyme (SGSA) of middle Skeletonemacostatum (Skeletonema costatum).

Summary of the invention

The purpose of this invention is to provide a nitrate transport protein that derives from diatom.

Nitrate transport protein provided by the present invention, name is called NAT3, derives from diatom (Cylindrothecafusiformis), is one of following amino acid residue sequences:

1) the SEQ ID № in the sequence table: 1;

2) with SEQ ID № in the sequence table: the protein that 1 amino acid residue sequence has the nitrate transport function through replacement, disappearance or the interpolation of one to ten amino-acid residue.

SEQ ID № in the sequence table: 1 is made up of 482 amino-acid residues.

The encode gene (NAT3) of above-mentioned nitrate transport protein is one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 2 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: 1 dna sequence dna;

3) with sequence table in SEQ ID №: the nucleotide sequence that 2 dna sequence dnas that limit have 90% above homology and have the nitrate transport function;

4) under the rigorous condition of height can with the SEQ ID № in the sequence table: the nucleotide sequence of the 2 dna sequence dnas hybridization that limit.

The rigorous condition of described height is: (or 0.1 * SSC), the solution of 0.1%SDS is hybridized under 65 ℃ and is washed film with 0.1 * SSPE.

SEQ ID № in the sequence table: 2 by 1449 based compositions, and its encoding sequence is that coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence from 5 ' end 1-1449 bit base.

The expression vector, transgenic cell line and the host bacterium that contain described nitrate transport protein gene NAT3, and arbitrary segmental primer also belongs to protection scope of the present invention among the amplification NAT3.

Another object of the present invention provides a kind of method that improves plant nitrogen receptivity.

The method of raising plant nitrogen receptivity provided by the present invention is that described nitrate transport protein gene NAT3 is imported plant tissue or cell, obtains the plant that the nitrogen receptivity improves.

Described nitrate transport protein gene NAT3 can import plant tissue or cell by the plant expression vector that contains described nitrate transport protein gene NAT3.

The carrier that sets out that is used to make up described plant expression vector comprises the double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.Described plant expression vector also can comprise 3 ' end untranslated zone of foreign gene, promptly comprise the polyadenylic acid signal and any other participation mRNA processing or the dna fragmentation of genetic expression.The bootable polyadenylic acid of described polyadenylic acid signal joins 3 ' end of mRNA precursor, induces non-translational region that (Ti) plasmid gene (as kermes synthetic enzyme Nos gene), plant gene (as soybean storage protein gene) 3 ' end transcribes etc. all to have similar functions as the Agrobacterium crown-gall nodule.

When using NAT3 to make up plant expression vector, before its transcription initiation Nucleotide, can add any enhancement type promotor or inducible promoter, as cauliflower mosaic virus (CAMV) 35S promoter, root specific expression promoter etc., they can use separately or be used in combination with other plant promoter; In addition, when using gene constructed plant expression vector of the present invention, also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can be synthetic.Translation initiation region can be from transcription initiation zone or structure gene.

Specifically, the carrier that sets out that is used to make up described plant expression vector can be pCAMBIA2301, pBI121, pCAMBIA1301 or pCAMBIA1300 etc., is preferably pCAMBIA2301.

Be the carrier that sets out with pCAMBIA2301, the plant expression vector of structure is pNAT121.

For the ease of transgenic plant cells or plant being identified and screening, can process used plant expression vector, can produce the enzyme of colour-change or the gene of luminophor (gus gene, luciferase genes etc.) as adding the coding that in plant, to express, have the antibiotic marker thing (gentamicin marker, kantlex marker etc.) of resistance or anti-chemical reagent marker gene (as anti-weedkiller gene) etc.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.

Carry NAT3 of the present invention plant expression vector can Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, conventional biological method transformed plant cells or tissue such as agriculture bacillus mediated by using, and the plant transformed cell or tissue is cultivated into plant.

The method of above-mentioned raising plant nitrogen receptivity all is suitable for all plants, both has been applicable to monocotyledonss such as paddy rice, corn, wheat, also is applicable to dicotyledonss such as tobacco, turfgrass, Arabidopis thaliana.

The invention provides a nitrate transport protein NAT3 and an encoding gene thereof that derives from diatom.Homology analysis is the result show, (GenBank number: nucleotide sequence homology gi:5733416) is 99.31% to this gene, and the amino acid sequence homology of proteins encoded is 99.76% with the diatom NAT1 gene of announcing on GenBank.NAT3 transgene tobacco, paddy rice and turfgrass can be normal growth on the substratum of normal value 1/32 at nitrogen element content all, show that NAT3 can improve the nitrogen receptivity of plant, but make plant normal growth still under low nitrogen condition.The present invention will play a significant role in the breeding process of plant nitrogen fertilizer absorption field and breeding low nitrogen resisting plant variety, have a extensive future.

Below in conjunction with specific embodiment the present invention is described in further details.

Description of drawings

Fig. 1 is the 1% agarose gel electrophoresis detected result of the diatom nitrate transport protein gene NAT3 of pcr amplification

The BamH I enzyme of the positive cloned plasmids pNAT of Fig. 2 is cut qualification result

Fig. 3 is Sac I and the EcoR I double digestion qualification result of intermediate carrier pUC121

Fig. 4 is Hind III and the BamH I double digestion qualification result of intermediate carrier pMV121

Fig. 5 is Hind III and the EcoR I double digestion qualification result of intermediate carrier pCV121

Fig. 6 is the structure schema of intermediate carrier pCV121

Fig. 7 is the structure schema of NAT3 plant expression vector pNAT121

Fig. 8 cuts qualification result for the BamH I enzyme of NAT3 plant expression vector pNAT121

Fig. 9 is the PCR qualification result of NAT3 transgene tobacco

Figure 10 is the PCR qualification result of NAT3 transgenic paddy rice

Figure 11 is the PCR qualification result of NAT3 transgenosis butch clover

Figure 12 is that NAT1, NAT3 transgene tobacco and non-transgenic tobacco are at 1/32N MS ₀Growing state on the substratum

Figure 13 is NAT1, NAT3 transgenic paddy rice and the non-transgenic paddy rice growing state on 1/32N nutrition soil

Figure 14 is NAT1, NAT3 transgenosis butch clover and the non-transgenic butch clover growing state on 1/32N nutrition soil

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment.It is synthetic that the primer is given birth to the worker by Shanghai, and all examining orders assist to finish by three rich polygala root biotechnology limited liability companys.

The clone of embodiment 1. diatom nitrate transport protein gene NAT3

With the nitrate transport protein gene of following method clone diatom, detailed process may further comprise the steps:

1. extract total RNA of diatom

Use the TRIZOL of Invitrogen company ^RReagent test kit (Cat.No.15596-026) and reference reagent box specification sheets extract total RNA of diatom, and concrete grammar may further comprise the steps:

1) gets the 50-100mg diatom, place the liquid nitrogen grind into powder, change in the 1.5mL centrifuge tube.

2) add the abundant mixing of 1mL TRIZOL Reagent, room temperature is placed 5min.

3) add 200 μ l chloroforms, vibration 15s, room temperature is placed 2-3min, 4 ℃, the centrifugal 10min of 12000g.

4) get supernatant, add 500 μ l Virahols, room temperature is placed 10min, and 4 ℃, the centrifugal 5min of 12000g are in the RNA precipitation of the visible white plates in centrifuge tube bottom.

5) abandon supernatant, carefully add 1mL 70% ethanol, do not destroy the RNA flaky precipitate, behind the 5s with sample injector with the whole sucking-offs of liquid.

6) room temperature is placed 5-10min and is made ethanol volatilization (do not allow it dried fully, otherwise influence solvability), adds 20 μ lDEPC water dissolution precipitation, obtains the total RNA of diatom.

2. cDNA is synthesized in reverse transcription

The total RNA of diatom that obtains with step 1 is a template, and with GeneRacer test kit and synthetic its cDNA of reference reagent box specification sheets reverse transcription of Invitrogen company, concrete grammar may further comprise the steps:

1) gets the total RNA 10 μ l of diatom, add 1 μ l Gene Racer Oligo dT Primer, 1 μ l dNTPs, 1 μ l sterile distilled water.

2) 65 ℃ of temperature are bathed 5min removing the RNA secondary structure, and ice bath 5min is of short duration centrifugal.

3) add 4 μ l, 5 * the first chain damping fluids successively, 1 μ l 0.1M DTT, 1 μ l RNaseOut ^TM, 1 μ lSuperScript ^TMIII RT damping fluid to cumulative volume is 20 μ l, uses the pipettor mixing.

4) of short duration centrifugal after, 50 ℃ of temperature are bathed 50min.

5) 70 ℃ of temperature are bathed 15min, place the 2min stopped reaction on ice, and maximum speed of revolution is of short duration centrifugal.

6) add 1 μ l RnaseH, 37 ℃ of temperature are bathed 20min.

7) of short duration centrifugal, obtain cDNA, can be used for pcr amplification or-20 ℃ of preservations immediately.

3. the pcr amplification of goal gene

The cDNA that obtains with step 2 is a template, at primer P1 (upstream primer): carry out pcr amplification under the guiding of 5 '-ATGAGTGGAACTGATGTTGCA-3 ' and P2 (downstream primer): 5 '-TCTTCTCGGTATCAGGTTGGG-3 ' (primer P1 and P2 design according to NAT1), the PCR reaction conditions is: 95 ℃ of 5min; 94 ℃ of 30s, 67 ℃ of 1min, 72 ℃ of 2min, after 30 circulations, 72 ℃ are extended 10min.After reaction finishes, the PCR product is carried out 1% agarose gel electrophoresis detect, detected result is (swimming lane 1 is: λ DNA/EcoR I+Hind III molecular weight Marker, swimming lane 2 is a pcr amplification product) as shown in Figure 1, and a tangible amplified band is arranged at the 1449bp place.

4. freeze-thaw method reclaims pcr amplification product

Length with pcr amplification in the freeze-thaw method recycling step 3 is the dna fragmentation of 1449bp, and concrete grammar may further comprise the steps:

1) the purpose fragment of the about 1449bp of length is downcut from sepharose, place a new centrifuge tube.

2) add TE damping fluid 200 μ l, the 5min that vibrates on vibrator puts into the freezing 5min of liquid nitrogen again.

3) take out, at 65 ℃ of following water-bath 5min.

4) method repeated freezing set by step 2)-3), melt twice.

5) use phenol, phenol/chloroform (blending ratio 1:1), chloroform extracting successively, with dehydrated alcohol deposit D NA, add 4ul sterilized water dissolution precipitation then, precipitation is the purpose fragment of recovery.

5. segmental clone of purpose and order-checking

With carrier pMD18-T (TaKaRa, Cat.No.D504A) test kit carries out the segmental clone of purpose, concrete grammar is: fetch the pcr amplification product 4ul of receipts, add 1ul pMD18-T carrier, 5ul Ligase SolutionI successively, 16 ℃ connect 4h then.Connect product and change the bacillus coli DH 5 alpha competent cell over to, obtain positive recombinant clone through screening, the upgrading grain carries out enzyme and cuts evaluation, (swimming lane 1 is Marker to qualification result: λ DNA/EcoRI+Hind III as shown in Figure 2, swimming lane 2 is cut product for enzyme), cut the endonuclease bamhi that has obtained 1449bp through enzyme, consistent with expected results, with this recombinant plasmid called after pNAT, again it is checked order, sequencing result shows that inserting fragment has SEQ ID № in the sequence table: 2 nucleotide sequence, SEQ ID № in the sequence table: 2 by 1449 based compositions, its encoding sequence is that coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences from 5 ' end 1-1449 bit base.This gene order and amino acids coding residue sequence thereof are compared, (GenBank number: nucleotide sequence homology gi:5733416) is 99.31% to this gene with the diatom NAT1 gene of announcing on GenBank as a result, the amino acid sequence homology of proteins encoded is 99.76%, show the nitrate transport protein gene that has obtained diatom, called after NAT3 is with its proteins encoded called after NAT3.

Embodiment 2. makes up the plant expression vector of NAT3 and diatom NAT1 gene

One, the structure of intermediate carrier pCV121

Make up intermediate carrier pCV121 referring to Fig. 6, detailed process may further comprise the steps:

1. the structure of intermediate carrier pUC121

With restriction enzyme Sac I and EcoR I carrier pBI121 (Beijing Baeyer enlightening Bioisystech Co., Ltd) is carried out double digestion, reclaim the T-NOS terminator fragment of 260bp, with its be connected through the carrier pUC19 of same enzyme double digestion (available from the precious biotech firm in Dalian), obtain intermediate carrier pUC121.It is carried out double digestion with restriction enzyme Sac I and EcoR I identifies, enzyme is cut qualification result, and (swimming lane 1 is Marker: λ DNA/EcoR I+Hind III as shown in Figure 3, swimming lane 2 and 3 is cut product for enzyme), cut through enzyme and to have obtained the dna fragmentation that size is about 260bp, conform to expected results.

2. the structure of intermediate carrier pMV121

With restriction enzyme Hind III and BamH I carrier pBI121 is carried out double digestion, reclaim the P35S promoter fragment of 800bp, the carrier pUC121 that itself and step 1 through the same enzyme double digestion are made up is connected acquisition intermediate carrier pMV121.It is carried out double digestion with restriction enzyme Hind III and BamH I identifies, enzyme is cut qualification result, and (swimming lane 1 is cut product for enzyme as shown in Figure 4, λ DNA/EcoR I+Hind III) swimming lane 2 is Marker:, cut through enzyme and to have obtained the dna fragmentation that size is about 800bp, conform to expected results.

3. the acquisition of intermediate carrier pCV121

With restriction enzyme Hind III and EcoR I carrier pCAMBIA 2301 (Beijing Baeyer enlightening Bioisystech Co., Ltd) is carried out double digestion, reclaim the purpose fragment of 1.0kb, it is connected with the carrier pMV121 that makes up through the step 2 of same enzyme double digestion, obtain an intermediate carrier, called after pCV121.It is carried out enzyme with restriction enzyme Hind III and EcoRI cut evaluation, enzyme is cut qualification result, and (swimming lane 1 is cut product for enzyme as shown in Figure 5, swimming lane 2 is Marker: λ DNA/EcoR I+Hind III), enzyme is cut the product clip size and is about 1.0kb, conforms to expected results.

Two, the acquisition of NAT3 plant expression vector pNAT121

Make up the plant expression vector of NAT3 referring to Fig. 7, concrete grammar is: the plasmid vector pNAT that carries NAT3 that embodiment 1 is made up with restriction enzyme BamH I carries out enzyme and cuts, reclaim the NAT3 purpose fragment of 1449bp, its intermediate carrier pCV121 with the step 1 structure of cutting through the same enzyme enzyme is connected, the connection product is carried out enzyme with restriction enzyme BamHI cut evaluation, enzyme is cut qualification result, and (swimming lane 1 is Marker: λ DNA/EcoR I+Hind III as shown in Figure 8, swimming lane 2 is cut product for enzyme), it is 1449bp that enzyme is cut the product clip size, conform to expected results, obtained the plant expression vector of NAT3, called after pNAT121.

With same procedure with diatom NAT1 gene (GenBank number: gi:5733416) be connected into the BamH I restriction enzyme site of intermediate carrier pCV121, obtain the plant expression vector of diatom NAT1 gene, called after pNAT1121.

The nitrogen of embodiment 3.NAT3 transgene tobacco reduces the susceptibility experiment

Plant expression vector pNAT121 with embodiment 2 structures, pNAT1121 transforms agrobacterium tumefaciens lba4404 with freeze-thaw method respectively, to be integrated with the agrobacterium tumefaciens lba4404 transformant transformation of tobacco NC89 of pNAT121 again with leaf dish method, screen positive transfer-gen plant, wherein use primer P1 (upstream primer): 5 '-ATGAGTGGAACTGATGTTGCA-3 ' and P2 (downstream primer): 5 '-TCTTCTCGGTATCAGGTTGGG-3 ' carries out result that PCR identifies to the NAT3 transgene tobacco, and (swimming lane 1 is Marker: λ DNA/EcoR I+Hind III as shown in Figure 9, swimming lane 2 is the PCR product), positive transfer-gen plant can obtain the 1449bp band through pcr amplification, and the result obtains NAT3, each 10 strain of NAT1 transgene tobacco.(contrast, seed CK) is sowed at MS respectively after the strict sterilization sterilization with NAT3, NAT1 transgene tobacco and NC89 non-transgenic tobacco ₀[(concentration preparation routinely) contains: macroelement (mother liquor I:NH ₄NO ₃, KNO ₃, CaCl ₂2H ₂O, MgSO ₄7H ₂O, KH ₂PO ₄), trace element (mother liquor II:KI, H ₃BO ₃, MnSO ₄4H ₂O, ZnSO ₄7H ₂O, Na ₂MoO ₄2H ₂O, CuSO ₄5H ₂O, CoCl ₂6H ₂O), molysite (mother liquor III, FeSO ₄7H ₂O, Na ₂-EDTA2H ₂O), organic composition (mother liquor: inositol, pyridoxine hydrochloride (vitamin B6), nicotinic acid, VitB1 (VITMAIN B1), glycine), pH5.8, hydrogen ion concentration be 1.585 little rubbing/liter], (N content is MS to 1/8N ₀1/8, comprise ammonia-state nitrogen and nitric nitrogen), 1/16N, 1/32N, 1/8NO ₃ ^-(nitrate nitrogen content is MS ₀1/8) MS ₀In the substratum, observe NAT3, NAT1 transgene tobacco and non-transgenic tobacco at different N concentration MS ₀Growing state in the substratum, blade size, and dry weight, weight in wet base situation are to determine the effect of NAT3 gene in transgene tobacco.

26d after planting is at MS ₀, ammonia-state nitrogen, nitrate nitrogen content reduce and the MS that reduces of nitrate nitrogen content only simultaneously ₀The growing state (blade size) of NAT3 transgene tobacco in the substratum, NAT1 transgene tobacco and NC89 non-transgenic tobacco (experiment repeats 3 times, repeats all to establish 2 processing at every turn) as shown in table 1 is at MS ₀The upgrowth situation of NAT3 in the substratum, NAT1 transgene tobacco, non-transgenic tobacco does not have significant difference, NAT3 transgene tobacco in 1/8N, 1/16N substratum is compared with NAT1 transgene tobacco, the non-transgenic tobacco of sowing in same medium, and blade is bigger.The all serious yellow of NAT3 transgene tobacco in the 1/32N substratum, NAT1 transgene tobacco, non-transgenic tobacco, poor growth, but compare with NAT1 transgene tobacco, non-transgenic tobacco, the blade of NAT3 transgene tobacco is bigger, and color is also greener, and tobacco is at 1/32N MS ₀Growing state on the substratum is (left side bottle: non-transgenic tobacco, middle bottle: NAT1 transgene tobacco, right side bottle: the NAT3 transgene tobacco) as shown in figure 12.At 1/8NO ₃ ^-NAT3 transgenosis in the substratum, NAT1 transgene tobacco, non-transgenic tobacco are all than at MS ₀Tobacco growing in the substratum is slow, yellow leaf, but transgene tobacco is more bigger than non-transgenic tobacco leaf, and the leaf look dark is slightly, and the NAT3 transgene tobacco is more better than NAT1 transgene tobacco growing way.Generally speaking, at MS ₀Nitrogen lacks the upgrowth situation obvious difference of NAT3 transgene tobacco, NAT1 transgene tobacco and non-transgenic tobacco in the substratum, the NAT1 transgene tobacco is than the big 2-3 of blade times of non-transgenic tobacco, the NAT3 transgene tobacco is than the big 1.5-2 of blade times of NAT1 transgene tobacco, show that NAT3 of the present invention more can improve the nitrogen use efficiency of plant than NAT1, make the plant still can the normal growth situation under low nitrogen situation.

After planting 61d takes by weighing at MS ₀, ammonia-state nitrogen, nitrate nitrogen content reduce and the MS that reduces of nitrate nitrogen content only simultaneously ₀The weight in wet base of NAT3 transgene tobacco in the substratum, NAT1 transgene tobacco and NC89 non-transgenic tobacco, again each plant is put into 80 ℃ of baking oven bakings 1 hour, take by weighing the dry weight of each plant, statistics is as shown in table 2, dried, the weight in wet base of the NAT3 transgene tobacco of growing on the different nitrogen contents substratum all are significantly higher than NAT1 transgene tobacco and adjoining tree, further proof NAT3 of the present invention more can improve the nitrogen use efficiency of plant than NAT1, makes the plant still can normal growth under low nitrogen situation.

Table 1 ammonia-state nitrogen, nitrate nitrogen content reduce simultaneously and only nitrate nitrogen content reduce influence to NAT3, NAT1 transgene tobacco and non-transgenic tobacco NC89 growing state (blade size)

Table 2 after planting 61d at MS ₀, ammonia-state nitrogen, nitrate nitrogen content reduce and the MS that reduces of nitrate nitrogen content only simultaneously ₀Dried, the weight in wet base statistics of NAT3 in the substratum, NAT1 transgene tobacco and non-transgenic tobacco NC89

The low nitrogen resisting detection of embodiment 3 NAT3 transgenic paddy rices

One, the acquisition of NAT3 transgenic paddy rice

1. with plant expression vector pNAT121 rice transformation

(1) the paddy rice mature embryo callus induces

A) rice paddy seed shells, and 70% alcohol is handled 1min, uses 20% chlorine bleach liquor's surface sterilization twice then, and each 20min uses rinsed with sterile water 3 times more at every turn.

B) on the Bechtop seed of above-mentioned sterilization is being inoculated on the callus inducing medium, is secretly down cultivating about 15d and grow callus, carrying out Agrobacterium with the fresh callus of subculture 4d and infect at 22-25 ℃.

(2) preparation of Agrobacterium

A) picking contains the single bacterium colony of Agrobacterium of purpose plasmid, and it is inoculated in the YEB substratum (Yeast extract 1g/L, Tryptonc 5g/L, sucrose 5g/L, sal epsom 0.98g/L) that 2mL contains 50mg/L Streptomycin sulphate and 50mg/L penbritin

B) draw the 2mL culture and change in the YEB substratum (Yeast extract 1g/L, Tryptonc 5g/L, sucrose 5g/L, sal epsom 0.98g/L) that 50mL contains 50mg/L Streptomycin sulphate and 50mg/L penbritin, 28 ℃, 200rpm continue secretly to be cultured to OD ₆₀₀Value is about 1.0.

C) bacterium liquid is gone in the aseptic centrifuge tube the centrifugal 2min of 5000rpm.

D) with bacterial sediment with the AAM liquid nutrient medium (AA salt (20 *, 250mg/L MgSO ₄7H ₂O+150mg/LCaCl ₂2H ₂O+150mg/L NaH ₂PO ₄H ₂O+2.95g/L KCl), amino acid (glutamine (Glutamine) 876mg/L+ aspartic acid (Aspartic acid) 266mg/L+ arginine (Arginine) 174mg/L+ glycine (Glycine) 7.5mg/L), MS Vitamins, caseinhydrolysate (Casamino acid) 1g/L, glucose (Glucose) 36g/L, sucrose (Sucrose) 68.5g/L, 100 μ M Syringylethanones, pH5.2.) resuspended to OD ₆₀₀Value is about 1.0, uses for infecting the rice callus tissue.

(3) Agrobacterium-mediated Transformation paddy rice

A) select the callus particle of the diameter 0.2-0.4cm that step (1) obtains, put into AAM Agrobacterium suspension and soak 15-20min.

B) callus is placed on the folded aseptic filter paper and blots, transfer to common culture medium (the N6 substratum+100-200 μ M Syringylethanone+10g/L glucose+1mg/L 2 that is covered with two-layer aseptic filter paper, 4-D+1.0-1.2% agar, pH5.2) on, at 25 ℃ of down dark 2-3d that cultivate.

C) use rinsed with sterile water callus 5-10 time, drying at room temperature earlier.

D) blot callus with aseptic filter paper, put at room temperature dry 0.5-1h in the culture dish.

E) select the callus of bright yellow color, transfer to and select on the substratum, 25 ℃ of dark down cultivations, two all subcultures once.

F) behind 2-3 succeeding transfer culture, the resistant calli that newly grows is transferred to pre-differentiation substratum (MS substratum+2g/L caseinhydrolysate+20g/L sucrose+1mg/L 2,4-D+300-500mg/L Reflin+30mg/L Basta or 3-5mg/L Bialaphos+1.0-1.2% agar, pH5.8) on, at 25 ℃ of dark down 10d that cultivate.

G) resistant calli is forwarded to bud division culture medium (MS substratum+2-3mg/L 6BA (6-Benzyladenin)+2-3mg/L KT (Kinetin)+0.2-0.4mg/L Zeitin+1.0-1.2% agar, pH5.8) on, 25 ℃ following every day the 10-14h illumination cultivation, begin to have green point to occur behind the 10-15d on the fresh callus, every 2-3 week subculture once, wait to grow complete seedling, change over to the strong seedling culture base (1/2MS substratum+2-4mg/L paclobutrazol+1.0-1.2% agar, pH5.8).

H) peel off seedling from the strong seedling culture base, soak the root hardening in clear water, change water every day once, about 4-5d transplants after growing new root.

2.NAT3 the PCR of transgenic paddy rice identifies

Extract the genomic dna of NAT3 transgenic paddy rice blade and as template, carrying out PCR under the guiding of primer P3:5 '-CCTTCTTCATCTGGTTCGCCA-3 ' and primer P4:5 '-AGCGGCGGTGTTGTTCAT-3 ' identifies, after reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis to be detected, (swimming lane 1 is Marker to detected result: λ DNA/EcoR I+Hind III as shown in figure 10, swimming lane 2 is a pcr amplification product), the positive transfer-gen plant of NAT3 can amplify the specific band of about 700bp, show that NAT3 has imported in the rice genome and acquisition is expressed, obtained the NAT3 transgenic paddy rice.Simultaneously, obtained to transform the NAT1 transgenic paddy rice that pNAT1121 is arranged with above-mentioned same procedure.

Two, the low nitrogen resisting detection of transgenic paddy rice

NAT3 transgenic paddy rice, NAT1 transgenic paddy rice and NC89 non-transgenic rice seedling sowed respectively (full N content is about 0.2% at normal nutrition soil, quick-acting nitrogen contents are at the 60-200mg/ kilogram), in 1/8N (nitrogen content be normal nutrition soil content 1/8), 1/16N, the 1/32N nutrition soil, observe the growing state of each plant.After planting 30d observes and finds, the upgrowth situation that is implanted in NAT3 transgenosis in the normal nutrition soil, NAT1 transgenosis, non-transgenic paddy rice does not have significant difference, NAT3 transgenic paddy rice in 1/8N, the 1/16N nutrition soil is compared with NAT1 transgenic paddy rice, the non-transgenic paddy rice of sowing in identical nutrition soil, and blade is bigger.NAT3 transgenic paddy rice in the 1/32N nutrition soil, the NAT1 transgenic paddy rice, the non-transgenic rice plant diminishes gradually, poor growth, but compare with the non-transgenic paddy rice with the NAT1 transgenic paddy rice, NAT3 transgene tobacco blade is bigger, color is also greener, and the NAT3 transgenic paddy rice is more better than NAT1 transgenic paddy rice growing way, (left side: NAT3 transgenic paddy rice as shown in figure 13, middle: the NAT1 transgenic paddy rice, right side: the non-transgenic paddy rice), prove that NAT3 of the present invention more can improve the nitrogen use efficiency of plant than NAT1, is improved the low nitrogen resisting of plant.

The low nitrogen resisting detection of embodiment 5.NAT3 transgenic turf grass-butch clover

One, acquisition of NAT3 transgenic turf grass-butch clover and PCR identify

1. plant expression vector pNAT121 is transformed turfgrass

Adopt the method identical with plant expression vector pNAT121 conversion turfgrass-butch clover with embodiment 4.

2. the molecular Biological Detection of transgenosis butch clover

Extract the genomic dna of NAT3 transgenosis butch clover blade and as template, carrying out PCR under the guiding of primer P5:5 ' TGGAACTGATGTTGCAACTGG 3 ' and primer P6:5 ' TGACAAGACAGAAGACGCACA 3 ' identifies, after reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis to be detected, (swimming lane 1 is Marker to detected result: λ DNA/EcoR I+Hind III as shown in figure 11, swimming lane 2 is a pcr amplification product), the positive transfer-gen plant of NAT3 can amplify the specific band of about 1350bp, showing that NAT3 has imported in the genome of butch clover and obtained expresses, and has obtained NAT3 transgenosis butch clover.Simultaneously, obtained NAT1 transgenosis butch clover with above-mentioned same procedure.

Two, the low nitrogen resisting detection of transgenosis butch clover

The seed of NAT3 transgenosis butch clover, NAT1 transgenosis butch clover and NC89 non-transgenic butch clover is sowed at MS respectively after the strictness sterilization ₀, 1/8N, 1/16N, 1/32N, 1/8NO ₃ ^-MS ₀In the substratum, observe the growing state of each plant.After planting 30d observes and finds, at MS ₀The upgrowth situation of NAT3 transgenosis butch clover in the substratum, NAT1 transgenosis butch clover, non-transgenic butch clover does not have significant difference, 1/8N, 1/16N MS ₀NAT3 transgenosis butch clover in the substratum is compared with NAT1 transgenosis butch clover, the non-transgenic butch clover of sowing in same medium, and blade is bigger, and plant is slightly high.1/32N MS ₀The all serious yellow of NAT3 transgenosis butch clover, NAT1 transgenosis butch clover, non-transgenic butch clover, growthing lag in the substratum, but compare with NAT1 transgenosis butch clover, non-transgenic butch clover, NAT3 transgenosis butch clover blade is bigger, and color is also greener.1/8NO ₃ ^-MS ₀NAT3 transgenosis butch clover in the substratum, NAT1 transgenosis butch clover, non-transgenic butch clover are all than MS ₀Butch clover poor growth in the substratum, yellow leaf, but the transgenosis butch clover is more bigger than the blade of non-transgenic butch clover, the leaf look also dark slightly, and the NAT3 transgenic turf grass is more better than the growing way of NAT1 transgenosis butch clover, see Figure 14 (left side: NAT1 transgenosis butch clover, right side: NAT3 transgenosis butch clover), prove that further NAT3 of the present invention more can improve the nitrogen use efficiency of plant than NAT1, is improved the low nitrogen resisting of plant.

Sequence table

<160>2

<210>1

<211>482

<212>PRT

＜213〉diatom (Cylindrotheca fusiformis)

<400>1

<210>2

<211>1449

<212>DNA

＜213〉diatom (Cylindrotheca fusiformis)

<400>2

Claims (10)

1, the nitrate transport protein of diatom, its aminoacid sequence are as the SEQ ID № in the sequence table: shown in 1.

2, the gene of the described nitrate transport protein of coding claim 1.

3, gene according to claim 2 is characterized in that: described gene has SEQ ID №: 2 dna sequence dna.

4, contain claim 2 or 3 described expression carrier.

5, the transgenic cell line that contains claim 2 or 3 described genes.

6, the host bacterium that contains claim 2 or 3 described genes.

7, a kind of method that improves plant nitrogen receptivity is with claim 2 or 3 described nitrate transport protein gene transfered plant tissue or cells, obtains the plant that the nitrogen receptivity improves.

8, method according to claim 7 is characterized in that: described nitrate transport protein gene imports plant tissue or cell by the plant expression vector that contains described nitrate transport protein gene; The carrier that sets out that is used to make up described plant expression vector is pBI121, pCAMBIA2301, pCAMBIA1301 or pCAMBIA1300.

9, method according to claim 8 is characterized in that: described plant expression vector is pNAT121, plant expression vector be pNAT121 physical map as shown in Figure 7.

10, according to arbitrary described method among the claim 7-9, it is characterized in that: described plant comprises monocotyledons and dicotyledons.

Images