CN100404670C

CN100404670C - Rice EPSP synthase mutant and its coding gene, obtaining method and application

Info

Publication number: CN100404670C
Application number: CNB2005100027397A
Authority: CN
Inventors: 朱祯; 周敏
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Institute of Genetics and Developmental Biology of CAS
Priority date: 2005-01-26
Filing date: 2005-01-26
Publication date: 2008-07-23
Anticipated expiration: 2025-01-26
Also published as: CN1810962A

Abstract

The present invention discloses a 5-enolpyruvoyl shikimic acid-3-phosphosynthase mutant, a coding gene thereof, a method for obtaining the phosphosynthase and the application of the phosphosynthase in culturing plants resisting glyphosate. The 5-enolpyruvoyl shikimic acid-3-phosphosynthase has the SEQ ID No. 2 amino acid residue sequence. The 5-enolpyruvoyl shikimic acid-3-phosphosynthase of the present invention performs important functions in culturing the plants resisting the glyphosate.

Description

A kind of rice EPSP synthase mutant and encoding gene thereof and application

Technical field

The present invention relates to 5-enol pyruvoyl shikimic acid-3-phosphate synthase (5-enolpyruvylshikimate 3-phosphate synthase, EPSP synthase) mutant and encoding gene and its application in cultivating anti-glyphosate plants in a kind of paddy rice source.

Background technology

Glyphosate is a kind of inner sucting conduction type nonselective herbicide, is present most widely used broad spectrum weeding agent, can control 76 kinds in 78 kinds of the most serious weeds of whole world harm effectively.It has animal nontoxic, and the soil longevity of residure is short, is easy to advantages such as degraded.Extensive commercially available commodity weedicide Roundup ^TMIn major ingredient be glyphosate.Since the 1980s; people hanker after cultivating the resistance glyphosate farm crop always; and a lot of glyphosate resistant crops have successfully been obtained by genetic engineering technique; the plantation of these crops not only makes the consumption that the cultivation management in field is more succinct effectively, increasing both production and income has more reduced a lot of weedicides outward, helps the protection of environment.U.S. plantation resistance glyphosate soybean in 1996, per hectare weedicide consumption has reduced 9%-39%, also makes per hectare weedicide consumption reduce 1.0 kilograms than routine in Canadian plantation.The RoundupReady of U.S. Monsanto Company exploitation ^TMThe series crop, promptly glyphosate resistant crops at some national establishing in large scale, and has produced considerable economic.

5-enol acetone shikimic acid-3-phosphate synthase (5-enolpyruvylshikimate 3-phosphatesynthase, EPSPS, the EPSP synthase) being a key enzyme in die aromatischen Aminosaeuren (comprising phenylalanine, tyrosine, the tryptophane) route of synthesis, also is the target enzyme of the single-minded inhibition of glyphosate simultaneously.EPSP synthase catalysis 3-phosphoric acid shikimic acid (Shikimate-3-phosphate, S3P) and phosphoenolpyruvic acid (phosphoenolpyrurate, PEP) be condensed into 5-enol acetone shikimic acid-3-phosphoric acid (5-enolpyruvylshikimate 3-phosphate, EPSP), and discharge an inorganic phosphorus molecule, wherein EPSP is the important precursor of synthetic aromatic amino acid.Glyphosate is similar to the substrate PEP of EPSP synthase on molecular structure, be the competitive inhibitor of PEP.It with can hinder epsp synthase and normal combining of substrate PEP after epsp synthase combines, thereby cause the epsp synthase vigor to descend and even forfeiture, this will seriously disturb the biosynthesizing of phenylalanine and tyrosine, make endocellular chromosome not normal (Steinrucken HC, Amrhein N (1980) The herbicide glyphosate is a potentinhibitor of 5-enolpyruvyl-shikimic acid-3-phosphate synthase.BiochemBiophys Res Commun 94:1207-1212).

Genetic engineering modified for the plant resistance glyphosate has two kinds of comparatively common strategies:

At first be overexpression EPSP synthase and with the competitive inhibition of this antagonism glyphosate in plant: people such as Amrhein strengthen the selective pressure of glyphosate by increasing the concentration of glyphosate gradually, separate the petunia clone that obtains a glyphosate tolerant.Analyze the epsp synthase in this clone, the result shows that the copy number of the epsp synthase gene in the nuclear of this clone has increased 20 times, make enzyme produce (Amrhein N in a large number, Johanning D, Schab J, Schulz A (1983) Biochemical basis for glyphosate-tolerance in a bacterium anda plant tissue culture.FEBS Lett 157:191-196).Be used to come from the promotor of cauliflower mosaic virus (CaMV) 35S and the epsp synthase gene cDNA of petunia has made up chimeric epsp synthase gene.The promotor of cauliflower mosaic virus (CaMV) 35S can make some encoding sequences show high-caliber constructive expression in all plant tissues, and transfer-gen plant is (the Dilip M.Shah more than 4 times that kills non-transgenic plant consumption to the tolerance degree of glyphosate amount of application; Et al, Engineering Herbicide Tolerance inTransgenic Plants, Science, New Series, Vol.233, No.4762. (Jul.25,1986), pp.478-481.).

Next is the epsp synthase gene of introducing and expressing sudden change in plant, and the EPSP synthase of this sudden change has when keeping catalytic activity the low affinity of glyphosate affinity not even.Researchists such as Stalker were separated to the bacterial strain to glyphosate performance resistance in 1985 from Salmonella typhimurium, studies show that the wherein structure gene origination point sudden change of aroA, cause the proline(Pro) of the 101st of enzyme to be replaced by Serine, the EPSP synthase that is produced has thus reduced the affinity with glyphosate herbicidal, this mutant epsp synthase gene plant transformed has produced (the Stalker DM of glyphosate resistance to a certain degree, Hiatt WR, Comai L (1985) A single amino acidsubstitution in the enzyme 5-enolpyruvylshikimate-3-phosphate synthaseconfers resistance to the herbicide glyphosate.J Biol Chem 260:4724-4728).People such as Padgette then sport alanine residue with the 96th glycine residue of the EPSP synthase protein of intestinal bacteria aroA genes encoding, epsp synthase gene after the sudden change reduces in conjunction with activity greatly to glyphosate, produced glyphosate resistance (the Padgette SR higher after in plant, expressing than its wild-type, Re DB, Gasser CS, Eichholtz DA, Frazier RB, Hironaka CM, Levine EB, Shah DM, Fraley RT, KishoreGM (1991) Site-directed mutagenesis of a conserved region of the5-enolpyruvylshikimate-3-phosphate synthase active site.J Biol Chem 266:22364-22369).

The inevitable normal growth that influences plant to a certain extent of the overexpression of certain gene, if low scale reaches that can the render transgenic plant to produce the optimal representation type will be more satisfactory in the foreign gene, therefore, filtering out the mutant gene with good glyphosate resistance is the only way of realizing this goal.

In addition, because the gene of bacterium and originated from fungus can not peculiar transit peptides (transitpeptide) sequence of coded plant albumen, and the EPSP synthase only is transported to its effect of competence exertion in the chloroplast(id), so be necessary for its artificial transit peptide sequence (Della-cioppa G of interpolation, Bauer SC, Klein BK, Shah DM, FraleyRT, Kishore GM (1986) Translocation of the precursor of 5-enolpyruvylshikimate3-phosphate synthase into chloroplasts of higher plants in vitro.Proc NatlAcad Sci U S A 83:6873-6877); Simultaneously, codon preference and the plant of bacterium or fungi differ widely, therefore, common efficient was very low when the gene transformation that derives from the bacterium fungi was expressed in plant, even be beyond expression, modification that in most cases must codon could be expressed in transgenic plant smoothly, but codon modifies very consuming time and cost is higher.

Fallibility PCR (Error-Prone PCR) is meant when carrying out the pcr amplification goal gene and introduces base mispairing by the fidelity of reproduction that reduces the Taq archaeal dna polymerase, thereby causes the goal gene random mutation.According to document (Cadwell RC, Joyce GF (1992) Randomization of genes by PCR mutagenesis.PCRMethods Appl 2:28-33) report, only need 20pmol (about 6.4 μ g) sudden change product can comprise the mutant of all 1-4 base and the mutant more than 2% 5 base, can be thereby constitute for the random mutation storehouse of screening.

Summary of the invention

5-enol pyruvoyl shikimic acid-3-phosphate synthase mutant and the encoding gene thereof that the purpose of this invention is to provide a kind of tool glyphosate resistance.

5-enol pyruvoyl shikimic acid provided by the present invention-3-phosphate synthase mutant, name is called EPSPS-MP, is to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences.

SEQ ID № in the sequence table: 2 are made up of 444 amino-acid residues, amino acid residue sequence (the SEQ ID № in the sequence table: 1) compare with itself and wild-type rice EPSP synthase, the result as shown in Figure 6, its amino acid residue sequence is held to C from N and is held the 106th to sport leucine residue by proline residue.

The encoding gene EPSPS-MP of above-mentioned 5-enol pyruvoyl shikimic acid-3-phosphate synthase mutant has SEQ ID № in the sequence table: 3 dna sequence dna.

SEQ ID № in the sequence table: 3 by 1485 based compositions, and its encoding sequence is that coding has SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence from 5 ' end the 74th to the 1408th bit base; The nucleotide sequence of itself and wild-type rice EPSP synthase gene is compared, the result as shown in Figure 6, the nucleotide sequence of this epsp synthase gene sports " T " from 5 ' end to 3 ' end the 390th bit base by " C ", causes its amino acids coding residue sequence to sport leucine residue from aminoterminal to the 106th of carboxyl terminal by proline residue.

Contain expression carrier of the present invention, transgenic cell line, host bacterium and all belong to protection scope of the present invention.

Arbitrary segmental primer is to also within protection scope of the present invention among the amplification EPSPS-MP.

Another object of the present invention provides a kind of preparation method of 5-enol pyruvoyl shikimic acid-3-phosphate synthase gene mutant of tool glyphosate resistance.

The method of acquisition 5-enol pyruvoyl shikimic acid provided by the present invention-3-phosphate synthase gene mutant, be to make up the intestinal bacteria constitutive expression carrier that contains epsp synthase gene, utilize the fallibility round pcr that the epsp synthase gene in the coli expression carrier is carried out random mutation, the coli expression carrier that will contain EPSP mutant synthase gene again imports the mutant library that the host bacterium obtains epsp synthase gene, the recon that will be integrated with EPSP mutant synthase gene is at last transferred to the recon that the enterprising row filter of the substratum that contains the different concns glyphosate obtains resistance glyphosate, and order-checking obtains 5-enol pyruvoyl shikimic acid-3-phosphate synthase gene mutant.

Utilize aforesaid method can obtain the epsp synthase gene mutant from various plants, the SEQ ID № in the sequence table for example of the present invention: 3 utilize method of the present invention to obtain in paddy rice.

Make up the low copy number carrier of carrier that set out of the described coli expression carrier that contains epsp synthase gene, as pBR322 etc. for can in intestinal bacteria, breeding.

Described coli expression carrier also should contain controlling elements such as the promotor, terminator of a composing type, and selects resistant gene such as ampicillin resistance gene, kalamycin resistance gene etc.

Described host bacterium is E.coli AB2829.The method that shifts recon adopts dull and stereotyped photolithography.Substratum adopts the restricted type substratum that does not contain aminoacid component, as M9, MOPS substratum.

Another purpose of the present invention provides a kind of method of cultivating anti-glyphosate plants.

The method of cultivation anti-glyphosate plants provided by the present invention is to make up the plant expression vector that contains EPSP synthase mutant encoding gene EPSPS-MP, and the plant expression vector that makes up is transformed the purpose plant, obtains anti-glyphosate plants through cultivation.

5 ' end of the encoding gene of the EPSP synthase mutant in the described plant expression vector also is added with transit peptide sequence, and the upstream extremity of this gene links to each other with promotor along sense orientation, and downstream end links to each other with the regulating and controlling sequence of control Transcription Termination.

The combined promoter that described promotor can be constitutive promoter, organ specific promoters, tissue-specific promoter, inducible promoter or is made up of promotor and controlling element.

The controlling element that described combined promoter comprises is for can strengthen the dna sequence dna in exogenous gene expression or regulatory gene various sources of expressive site in plant; Described controlling element can be the controlling element that enhanser maybe can carry out constitutive expression, tissue specific expression or inducible expression; The dna sequence dna of described enhancing exogenous gene expression is positioned at the promotor downstream; The sequence of described enhancing exogenous gene expression can be paddy rice Actin1 introne 1, corn Ubiquitin introne 1, corn sucrose synthase gene Sh1 introne 1, maize alcohol dehydrogenase 1-S gene intron 1, corn sucrose synthase Sh1 exon or rice EPSP synthase gene first intron.

The method of used conversion plant can be genetically engineered field method for transformation commonly used, as the method for transformation of agrobacterium-mediated transformation, particle bombardment, protoplastis mediated method, electric shocking method or integral level etc.

Behind the transgenosis individual plant that has obtained to transform with aforesaid method, can screen resistant plant by kantlex, and the biological method of binding molecule detects, identify genetically modified integration situation, and with the transformed plant that herbicide glyphosate identify to obtain, finally obtain the transgenic plant of resistance glyphosate.

Described plant can be dicotyledonss such as monocotyledonss such as paddy rice, corn, wheat, barley, Chinese sorghum or tobacco, cotton, willow, soybean, sweet potato, potato, Chinese cabbage, wild cabbage, green pepper.

Transfer-gen plant and filial generation thereof that the application aforesaid method obtains also belong to protection scope of the present invention.

The present invention is based on final formation that the orthogenesis principle promptly suddenlys change and be the random mutation results of interaction on screening pressure and the gene.Comprehensive fallibility PCR, simple molecular biology such as low-level constitutive expression EPSP synthase, dull and stereotyped photolithography and microbiological technique have been created the system of an efficient screening glyphosate resistance mutant EPSP synthase in deficient strain AB2829.Simultaneously, the present invention selects the wild-type precursor of the epsp synthase gene of plant origin as the screening mutant, for the expression of mutant gene in transgenic plant had laid a good foundation.Use method of the present invention, obtained mutant EPSPS-MP, this mutant causes glyphosate resistance by a single proline residue sudden change, and transgene tobacco experimental results show that to transform thereafter has the plant of this EPSP synthase mutant to have than the higher glyphosate resistance of wild-type EPSP synthase.This rice EPSP synthase mutant when glyphosate is produced high resistance not as EPSP synthase mutant (the Eschenburg S that was reported in the past, Healy ML, Priestman MA, Lushington GH, Schonbrunn E (2002) How the mutation glycine 96 to alanineconfers glyphosate insensitivity to 5-enolpyruvyl shikimate-3-phosphatesynthase from Escherichia coli.Planta 216:129-135) be cost with the catalytic activity of significantly sacrificing enzyme like that, but have the higher activity and the feasibility of practical application, can be used for making up the field crops of high-resistance glyphosate.

Description of drawings

Fig. 1 is the physical map of recombinant expression vector pBREP

Fig. 2 is the segmentation diagram in rice EPSP synthase transgenation zone

Fig. 3 is for screening the transformant of resistance glyphosate respectively with the solid M9 substratum that contains 5mM, 20mM, 50mM and 100mM glyphosate

Fig. 4 A-Fig. 4 D is for detecting the transformant of resistance glyphosate respectively with the liquid M9 substratum that contains 1mM, 5mM, 10mM and 20mM glyphosate

The comparison that Fig. 5 grows in containing the liquid M9 substratum of glyphosate for the transformant that contains pBREP-MP and pBREP-MG carrier respectively

Fig. 6 for the pBREP-MP sequencing result and with the sequence comparing analysis of wild-type

Fig. 7 A-Fig. 7 B is the comparison of wild-type EPSP synthase and EPSP synthase mutant EPSPS-MP active centre three-dimensional arrangement

Fig. 8 is the physical map of plant expression vector pCEP

Fig. 9 is the PCR detected result of transgene tobacco

The result that Figure 10 breaks up on the division culture medium that contains the different concns glyphosate for transfer-gen plant

Figure 11 is the experimental result of spraying transfer-gen plant with glyphosate

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment, concrete steps can be with reference to (people such as Sambrook, the molecular cloning laboratory manual, New York:Cold Spring Harbor Laboratory Press, 1989), used term and abbreviation all are general term of those skilled in the art and abbreviation.

Acquisition and the detection of embodiment 1,5-enol pyruvoyl shikimic acid-3-phosphate synthase mutant EPSPS-MP

1, the structure of the clone of rice EPSP synthase cDNA and middle cloning vector pGEP

According to cDNA complete sequence (Genbank AF413081) the design primer of rice EPSP synthase among the Genbank, primer sequence is as follows:

Primer 1:5 ' TTCTCGTCGCGGAAGCAGCT 3 '

Primer 2: 5 ' CAACAGAACCTAGACCTCAC 3 '

1) total RNA of bright extensive 63 blades of extraction rice varieties synthesizes the cDNA of paddy rice then as template;

2) be template with step 1) synthetic rice cDNA, under primer 1 and primer 2 guiding, the pcr amplification epsp synthase gene, the PCR reaction system is: the rice cDNA 2 μ L that step 1) obtains, EX-Taq archaeal dna polymerase 1U (TaKaRa company), 10 * EX-Taq DNA enzyme buffer liquid, 5 μ L, dNTPs (2.5umol/L) 5 μ L, each 10pmol of primer 1 and primer 2 adds ddH at last ₂O water mend to cumulative volume be 50 μ L; The PCR reaction conditions is: 94 ℃ of pre-sex change 5min; 94 ℃ of 1min then, 55 ℃ of 1min, 72 ℃ of 1min carry out 30 circulations altogether; Last 72 ℃ are extended 10min.Reaction is reclaimed with the low melting-point agarose gel electrophoresis after finishing, and obtains electrophoretically pure pcr amplification product.

3) with step 2) pcr amplification product that reclaims is connected on the cloning vector pGSMT-easy carrier (Promega company), to connect product then and adopt electrization (BIO-RAD company electric exciter) Transformed E .coli DH5 α, select substratum screening reorganization bacterium with the penbritin that contains X-gal and IPTG, selecting the white single bacterium colony that grows shakes bacterium upgrading grain and carries out enzyme and cut evaluation, give the order-checking of Shanghai Bo Ya biotech company with successfully transforming the reorganization bacterium that recombinant vectors is arranged, sequencing result shows that the EPSP synthase cDNA sequence of amplification is correct and obtained the correct middle cloning vector that contains epsp synthase gene, with its called after pGEP.

2, the structure that contains the coli expression carrier pBREP of EPSP synthase maturation protein encoding gene

The building process of coli expression carrier pBREP may further comprise the steps as shown in Figure 1:

According to the encoding gene design primer of rice EPSP synthase maturation protein, primer sequence is as follows:

Primer 3:5 ' ATTGAAAAAGGAAGAGTATGAGGCGGAGGAGATC 3 '

Primer 4:5 ' AAA CTGCAGCTCACTCTTTTAAAA 3 ' (line part base is the PstI recognition site)

1) the plasmid vector pGEP that obtains with step 1 is a template, under the guiding of primer 3 and primer 4, and the encoding gene of pcr amplification rice EPSP synthase maturation protein;

2) plasmid vector pBR322 is cut with restriction enzyme SspI and PstI (all available from TaKaRa company) enzyme after, it is used T ₄Dna ligase is connected with the above-mentioned PCR product of cutting through the PstI enzyme, obtains containing the recombinant expression vector pBREP of EPSP synthase maturation protein encoding gene.

3, the functional verification of coli expression carrier pBREP

Bacterial strain: E.coli AB2829 (available from E.coli Genetic Stock Center), this bacterial strain is an EPSP synthase deficient strain, has sudden change on its aroA gene, the EPSP synthase that can not express function, thereby normal synthetic aromatic amino acid.Be suppressed in the growth that does not contain (as M9, MOPS) this bacterial strain on the restricted substratum of aminoacid component, can't form normal bacterium colony; As the plasmid that changes this bacterium over to contains effable epsp synthase gene, then can complementary E.coli AB2829 in the defective of aroA-, recover the function that it is grown on restricted substratum.

Behind the recombinant expression vector pBREP Transformed E .coli AB2829 with step 2 structure, transformant is inoculated on the M9 substratum, as a result transformant can be on this restricted substratum normal growth, thereby illustrate this recombinant expression vector expressed effectively the rice EPSP synthase that function is arranged complementary the defective of aroA-among the E.coli AB2829.

4, the structure in rice EPSP synthase mutant storehouse

Adopt Error-Prone PCR method that the rice EPSP synthase gene among the recombinant expression vector pBREP is divided into front and back and carry out random mutation respectively for two sections, as shown in Figure 2, the cDNA total length 1332bp of rice EPSP synthase, wherein between the BglII and ScaI restriction enzyme site that first section is positioned on the rice EPSP synthase gene, be about 500bp, between the ScaI and PstI restriction enzyme site that second section is positioned on the rice EPSP synthase gene, be about 900bp.According to rice EPSP synthase full length gene cDNA sequences Design primer, primer sequence is as follows:

The primer sequence that is used for first section sudden change:

Primer 5 (upstream): 5 ' TTTAGATCTCCGGGGCGGTT

Primer 6 (downstream): 5 ' CAAGTACTGACTGCTGATGG

The primer sequence that is used for second section sudden change is:

Primer 7 (upstream): 5 ' TTAGTACTTGAGTGCCTTGC

Primer 8 (downstream): 5 ' AAACTGCAGCTCACTCTTTTAAAA

1) be template with recombinant expression vector pBREP, under the guiding of primer 5 and primer 6, primer 7 and primer 8, carry out the PCR reaction respectively, the PCR reaction system is: each 20pmol of upstream and downstream primer, also contain except that conventional ingredient: 5.6mM Mg ^2-, 0.2mM Mn ^2-, 1mM dTTP and 1mM dCTP; The PCR reaction conditions is: 94 ℃ 1 minute, 45 ℃ 1 minute, 72 ℃ 1 minute, carry out 30 circulations (no warm start) altogether.

2) after reaction finishes, with above-mentioned PCR product through restriction enzyme BglII and ScaI (corresponding first section saltation zone) or ScaI and PstI (corresponding second section saltation zone) respectively the digestion back with the recovery of low melting-point agarose glue, carrier pBREP is also also reclaimed with above-mentioned two cover enzymic digestions respectively, with T ₄Dna ligase is connected with corresponding saltation zone PCR product, and with linked system Transformed E .coli AB2829, the clone that coated plate obtains in the M9 flat board is the mutant library of rice EPSP synthase gene then.

5, acquisition and the detection of 5-enol pyruvoyl shikimic acid-3-phosphate synthase EPSPS-MP

When 1) transformant of step 4 being cultured to bacterium colony growing about 1mm size in 37 ℃ of incubator, promptly the colony lift that grows is screened the resistance bacterium colony to the solid M9 culture medium flat plate that contains 0-100mM progressive concentration glyphosate respectively with dull and stereotyped photolithography (replica plating) (Lederberg J, Lederberg EM (1952) Replica plating andindirect selection of bacterial mutants.J Bacteriol 63:399-406) with the wooden seal of sterilization Velveting parcel.Screened respectively above 2 * 10 for the two sections saltation zones in front and back ⁵Individual clone uses the random mutation product greater than 30ug, has covered enough big sudden change storehouse in theory.

2) with the resistance bacterium colony single culture that is sieved to and extract plasmid, then with plasmid Transformed E .coli AB2829 once more, under 37 ℃, contain shaking culture in the MOPS liquid nutrient medium of different concns (0-20mM) glyphosate, observe its upgrowth situation, and after 24 hours, measure the ultraviolet light absorption value (OD of 600nm ₆₀₀).Better resistance growth better conversion is then corresponding to have higher OD ₆₀₀Value verifies once more that by this method the glyphosate resistance of gained resistance transformant derives from the expressed EPSP synthase of plasmid vector in the host bacterium.Final screening has obtained a mutant transformant higher to glyphosate resistance, with its called after RM102, to wherein contained plasmid called after pBREP-MP, this mutant transformant RM102 is inoculated in contains 5mM, 20mM, 50mM, on the M9 solid medium of 100mM different concns glyphosate, the result is (A as shown in Figure 3, B, C, be respectively with D and contain 5mM, 20mM, 50mM, the M9 solid medium of 100mM glyphosate, 1 for containing the AB2829 transformant of wild-type EPSP synthase expression carrier pBREP, be the wild-type contrast, 2 for containing the AB2829 transformant RM102 of mutant EPSP synthase expression carrier pBREP-MP), but containing on the M9 solid medium of 10mM glyphosate still normal growth of RM102, but the growth of wild-type is suppressed fully, and containing on the 50mM glyphosate M9 substratum, RM102 still can grow, and shows that RM102 has higher glyphosate resistance than wild-type.

3) RM102 is inoculated in the M9 liquid nutrient medium that contains 1mM, 5mM, 10mM, 20mM glyphosate, 37 ℃ of following shaking culture, respectively at 0,24,48,72h measures the ultraviolet light absorption value (OD of 540nm ₅₁₀) result (Fig. 4 A shown in Fig. 4 A-Fig. 4 D, Fig. 4 B, Fig. 4 C, be respectively the M9 liquid nutrient medium that contains 1mM, 5mM, 10mM, 20mM glyphosate with Fig. 4 D), wild-type can't be grown and the mutant well-grown in containing the M9 liquid nutrient medium of 5mM glyphosate, and mutant RM102 still has growth to a certain degree in the glyphosate M9 of 20mM concentration liquid nutrient medium.

6, the EPSPS-MP mutant is to the comparison of glyphosate resistance

Improve as the expressed EPSP synthase protein glyphosate resistance of expression vector, then corresponding transformed bacteria also can be grown containing on the restriction substratum of greater concn glyphosate.According to conservative site (the Eschenburg S that can improve EPSP synthase glyphosate resistance that mentions in the existing document, Healy ML, Priestman MA, Lushington GH, Schonbrunn E (2002) How the mutation glycine96 to alanine confers glyphosateinsensitivity to 5-enolpyruvyl shikimate-3-phosphate synthase fromEscherichia coli.Planta 216:129-135) the glycine residue rite-directed mutagenesis with the 101st of the rice EPSP synthase gene on the pBREP is a L-Ala, obtain carrier pBREP-MG, and expression EPSP synthase mutant EPSPS-MG, transform AB2829 gained transformant energy normal growth on the M9 substratum that contains 0-50mM concentration glyphosate, and the growth of wild-type contrast obviously is suppressed, and has proved also that thus above-mentioned system can effectively screen the mutant with glyphosate resistance.

The E.coli AB2829 bacterial strain that will transform pBR322 (empty carrier contrast), pBREP (contrast of wild-type EPSP synthase), pBREP-MP, pBREP-MG plasmid respectively is inoculated in the liquid MOPS substratum that contains 0mM, 0.1mM, 0.2mM, 0.5mM, 1mM, 2mM, 5mM, 10mM, 20mM, 50mM concentration glyphosate respectively and measures OD with identical original bulk ₆₀₀Value (initial value) 37 ℃ of following shaking culture, is observed its upgrowth situation then, measures OD after 12 hours once more ₆₀₀The increment of value (end value) to determine that above-mentioned five kinds of bacterial strains are grown under different glyphosate concentration, the result as shown in Figure 5 (%Increment be corresponding transformant just, the ratio of the end value under the difference of end value and the 0mM), EPSPS-MG mutant speed of growth in the substratum that contains 0.5-50mM concentration glyphosate is all fast than wild-type, show that its glyphosate resistance is than wild-type height, and it is in the substratum of 0-0.2mM concentration glyphosate, growing state is then poor than wild-type, shows the enzyme reduction really alive of this mutant EPSP synthase; And RM102 mutant transformant is also better and growth velocity is higher than EPSPS-MG mutant than wild-type at 0-0.5mM glyphosate upgrowth situation; Its upgrowth situation in the substratum that contains the greater concn glyphosate is also suitable with the EPSPS-MG mutant.Above presentation of results mutant EPSP-MP still keeps higher enzymic activity than EPSP-MG when glyphosate resistance improves.

7, the order-checking of glyphosate resistance mutant

Carrier pBREP-MP among the antagonism mutant RM102 checks order, sequencing result shows that this EPSP mutant synthase gene has SEQ ID №: 3 nucleotide sequence, SEQ ID № in the sequence table: 3 by 1485 based compositions, its encoding sequence is from 5 ' end the 74th to the 1408th bit base, coding has a SEQ ID № in the sequence table: the protein of 2 amino acid residue sequence, the SEQ ID № in the sequence table: 2 are made up of 444 amino-acid residues.With SEQ ID №: 3 with the nucleotide sequence and amino acids coding residue sequence (the SEQ ID № in the sequence table: 1) compare thereof of wild-type rice EPSP synthase gene, the result as shown in Figure 6, this EPSP mutant synthase gene sports " T " from 5 ' end to 3 ' end the 390th bit base by " C ", causes its amino acids coding residue sequence to sport leucine residue from aminoterminal to the 106th of carboxyl terminal by proline residue.This mutating acid is positioned at EPSP synthase protein function conserved regions, near the active centre, nisightII simulates its structure with the computer software I, (Fig. 7 A is a wild-type EPSP synthase protein shown in Fig. 7 A-Fig. 7 B, Fig. 7 B is EPSP synthase mutant RM102), computed in software shows that this amino-acid residue variation only produces slight influence to the active centre.

The tobacco transformation experiment of embodiment 2, glyphosate resistance mutant and the functional analysis of transfer-gen plant

1, contains the acquisition of the transgene tobacco of glyphosate resistance mutant

1) make up the dicotyledons conversion carrier: according to the synthetic primer that is used for the dna fragmentation of amplification coding transit peptides part of the cDNA sequence (Genbank AF413081) of rice EPSP synthase, sequence is as follows:

Primer 9:5 ' TCTAGAATGGCGGCGACCATG

Primer 10:5 ' CAAGTACTGACTGCTGATGG

With aforementioned rice cDNA is template, and the PCR reaction conditions carries out according to special-purpose LA Taq enzyme (TaKaRa) amplification system of high-fidelity GC-rich specification sheets, and denaturation temperature is 94 ℃, and annealing temperature is 60 ℃, and elongating temperature is 72 ℃, and back 72 ℃ of insulation 10min circulate.The PCR product reclaims with the low melting-point agarose gel, and be inserted on the grand carrier pGSMT-easy carrier (Promega company), schedule of operation according to Bio-Rad company electric exciter, adopt electric shocking method Transformed E .coliDH5 α, select white colony on the ampicillin medium that contains X-gal and IPTG, screening obtains recombinant plasmid pBREPT.Errorless by Shanghai Bo Ya biotech company order-checking proof sequence.Plasmid pBREPT obtains transit peptides and EPSPs mature protein coding region leading portion through the XbaI/BglII double digestion, plasmid pBREP and pBREP-MP obtain comprising the EPSPs mature protein coding region back segment in mutational site respectively through the BglII/PstI double digestion, after with the two forward and backward two sections XbaI/PstI double enzyme site that are inserted into pBluescripKS (+) respectively, obtain recombinant plasmid pBREPE (wild-type) and pBREPE102 (mutant) by the screening of blue hickie.Obtain transit peptides and EPSPs mature protein coding region through the XbaI/KpnI double digestion respectively then, be inserted into the XbaI/KpnI double enzyme site of plant expression vector pC-GENERAL, obtain dicotyledons expression vector pCEP and pCEP102 (building process such as Fig. 8) through screening.

In pCEP and pCEP102, comprise paddy rice transit peptides encoding sequence and be added controlling element cauliflower mosaic virus 35s promotor and no gene terminator in interior wild-type and mutant EPSP synthase coding sequence.

2) transformation of tobacco: adopt the agriculture bacillus mediated Ye Panfa (Gao Yuefeng of root, Zhu Zhen, Xiao Guifang, Deng the separation of .1998 soybean kunitz trypsin inhibitor gene and the application in insect-resisting plant gene engineering thereof. Botany Gazette 40:405-411) pCEP and pCEP102 are transformed into respectively in the tobacco (Nicotiana tabacum L.cv.Xanthi), with obtaining transfer-gen plant after the kantlex screening.

3) detection of genetically modified plant

Internal sequence according to epsp synthase gene sequence and NPTII gene designs the upstream and downstream primer respectively, and primer sequence is as follows:

Primer 11:5 ' ATGAAGGCGGAGGAGATCGTG

Primer 12:5 ' TCGGCAGGAGCAAGGTGAGA

The genomic dna of the transfer-gen plant that difference extraction step 1 obtains, getting 0.1 μ g genomic dna is masterplate, respectively under the guiding of primer 11 and primer 12, identify the integration situation of foreign gene on genome with the PCR method, (swimming lane M is Marker to electrophoresis PCR product result as shown in Figure 9, swimming lane CK-is for transforming the negative control plant that empty carrier is arranged, swimming lane 2-17 is a transfer-gen plant, swimming lane CK+ is to be the PCR product (positive control) of template with plasmid pCEP (10pg), being of big or small specific fragment be can amplify about 2.5kb and epsp synthase gene sequence and NPTII gene transgenic positive plant contained simultaneously, except that swimming lane 7 and swimming lane 14 are that all the other are positive plant the false positive plant.

2, transfer-gen plant is carried out the detection of glyphosate resistance

The blade of picked at random transfer-gen plant be cut into small pieces place contain 0,0.01,0.02,0.05,0.10,0.20, (prescription is seen Gao Yuefeng to the division culture medium of 0.50mM different concns glyphosate, Zhu Zhen, Xiao Guifang, Deng the separation of .1998 soybean kunitz trypsin inhibitor gene and the application in insect-resisting plant gene engineering thereof. Botany Gazette 40:405-411) on break up, the result shows to transform the negative control that the blade differentiation situation that pCEP102 is arranged obviously is better than transforming the blade of pCEP and changes empty carrier as shown in figure 10.Farming with 2 liters of/hectare dosage reaches (the commercially available weedicide that main component is glyphosate) and sprays transfer-gen plant then, the result as shown in figure 11: this photo is photographed farming and reaches and spray the back fortnight; 1,2,3 is the adjoining tree of not spraying glyphosate, and 4,5,6 for having sprayed the plant that the farming of 2.0L/ha dosage reaches; Wherein, 1 and 4 come rotation pC-GENERAL (empty carrier, only contain kalamycin resistance gene) the same clone's of tobacco plant (wild-type tobacco contrast), 2,5 plant (commentaries on classics has wild-type rice EPSP synthase gene) that come the same clone of rotation pCEP tobacco, 3,6 plant (commentaries on classics has mutant rice EPSP synthase gene) that come the same clone of rotation pCEP102 tobacco, showing changes the plant that the plant of pCEP102 damage situations also is starkly lower than changes pCEP, and glyphosate is had higher resistance.

Sequence table

<160>3

<210>1

<211>444

<212>PRT

＜213〉Oryza paddy rice (Oryza sativa var.Lansheng)

<400>1

Lys?Ala?Glu?Glu?Ile?Val?Leu?Gln?Pro?Ile?Arg?Glu?Ile?Ser?Gly?Ala

1 5 10 15

Val?Gln?Leu?Pro?Gly?Ser?Lys?Ser?Leu?Ser?Asn?Arg?Ile?Leu?Leu?Leu

20 25 30

Ser?Ala?Leu?Ser?Glu?Gly?Thr?Thr?Val?Val?Asp?Asn?Leu?Leu?Asn?Ser

35 40 45

Glu?Asp?Val?His?Tyr?Met?Leu?Glu?Ala?Leu?Lys?Ala?Leu?Gly?Leu?Ser

50 55 60

Val?Glu?Ala?Asp?Lys?Val?Ala?Lys?Arg?Ala?Val?Val?Val?Gly?Cys?Gly

65 70 75 80

Gly?Lys?Phe?Pro?Val?Glu?Lys?Asp?Ala?Lys?Glu?Glu?Val?Gln?Leu?Phe

85 90 95

Leu?Gly?Asn?Ala?Gly?Thr?Ala?Met?Arg?Pro?Leu?Thr?Ala?Ala?Val?Thr

100 105 110

Ala?Ala?Gly?Gly?Asn?Ala?Thr?Tyr?Val?Leu?Asp?Gly?Val?Pro?Arg?Met

115 120 125

Arg?Glu?Arg?Pro?Ile?Gly?Asp?Leu?Val?Val?Gly?Leu?Lys?Gln?Leu?Gly

130 135 140

Ala?Asp?Val?Asp?Cys?Phe?Leu?Gly?Thr?Glu?Cys?Pro?Pro?Val?Arg?Val

145 150 155 160

Lys?Gly?Ile?Gly?Gly?Leu?Pro?Gly?Gly?Lys?Val?Lys?Leu?Ser?Gly?Ser

165 170 175

Ile?Ser?Ser?Gln?Tyr?Leu?Ser?Ala?Leu?Leu?Met?Ala?Ala?Pro?Leu?Ala

180 185 190

Leu?Gly?Asp?Val?Glu?Ile?Glu?Ile?Ile?Asp?Lys?Leu?Ile?Ser?Ile?Pro

195 200 205

Tyr?Val?Glu?Met?Thr?Leu?Arg?Leu?Met?Glu?Arg?Phe?Gly?Val?Lys?Ala

210 215 220

Glu?His?Ser?Asp?Ser?Trp?Asp?Arg?Phe?Tyr?Ile?Lys?Gly?Gly?Gln?Lys

225 230 235 240

Tyr?Lys?Ser?Pro?Gly?Asn?Ala?Tyr?Val?Glu?Gly?Asp?Ala?Ser?Ser?Ala

245 250 255

Ser?Tyr?Phe?Leu?Ala?Gly?Ala?Ala?Ile?Thr?Gly?Gly?Thr?Val?Thr?Val

260 265 270

Gln?Gly?Cys?Gly?Thr?Thr?Ser?Leu?Gln?Gly?Asp?Val?Lys?Phe?Ala?Glu

275 280 285

Val?Leu?Glu?Met?Met?Gly?Ala?Lys?Val?Thr?Trp?Thr?Asp?Thr?Ser?Val

290 295 300

Thr?Val?Thr?Gly?Pro?Pro?Arg?Glu?Pro?Tyr?Gly?Lys?Lys?His?Leu?Lys

305 310 315 320

Ala?Val?Asp?Val?Asn?Met?Asn?Lys?Met?Pro?Asp?Val?Ala?Met?Thr?Leu

325 330 335

Ala?Val?Val?Ala?Leu?Phe?Ala?Asp?Gly?Pro?Thr?Ala?Ile?Arg?Asp?Val

340 345 350

Ala?Ser?Trp?Arg?Val?Lys?Glu?Thr?Glu?Arg?Met?Val?Ala?Ile?Arg?Thr

355 360 365

Glu?Leu?Thr?Lys?Leu?Gly?Ala?Ser?Val?Glu?Glu?Gly?Pro?Asp?Tyr?Cys

370 375 380

Ile?Ile?Thr?Pro?Pro?Glu?Lys?Leu?Asn?Ile?Thr?Ala?Ile?Asp?Thr?Tyr

385 390 395 400

Asp?Asp?His?Arg?Met?Ala?Met?Ala?Phe?Ser?Leu?Ala?Ala?Cys?Ala?Asp

405 410 415

Val?Pro?Val?Thr?Ile?Arg?Asp?Pro?Gly?Cys?Thr?Arg?Lys?Thr?Phe?Pro

420 425 430

Asn?Tyr?Phe?Asp?Val?Leu?Ser?Thr?Phe?Val?Arg?Asn

435 440

<210>2

<211>444

<212>PRT

＜213〉Oryza paddy rice (Oryza sativa var.Lansheng)

<400>2

Lys?Ala?Glu?Glu?Ile?Val?Leu?Gln?Pro?Ile?Arg?Glu?Ile?Ser?Gly?Ala

1 5 10 15

Val?Gln?Leu?Pro?Gly?Ser?Lys?Ser?Leu?Ser?Asn?Arg?Ile?Leu?Leu?Leu

20 25 30

Ser?Ala?Leu?Ser?Glu?Gly?Thr?Thr?Val?Val?Asp?Asn?Leu?Leu?Asn?Ser

35 40 45

Glu?Asp?Val?His?Tyr?Met?Leu?Glu?Ala?Leu?Lys?Ala?Leu?Gly?Leu?Ser

50 55 60

Val?Glu?Ala?Asp?Lys?Val?Ala?Lys?Arg?Ala?Val?Val?Val?Gly?Cys?Gly

65 70 75 80

Gly?Lys?Phe?Pro?Val?Glu?Lys?Asp?Ala?Lys?Glu?Glu?Val?Gln?Leu?Phe

85 90 95

Leu?Gly?Asn?Ala?Gly?Thr?Ala?Met?Arg?Leu?Leu?Thr?Ala?Ala?Val?Thr

100 105 110

Ala?Ala?Gly?Gly?Asn?Ala?Thr?Tyr?Val?Leu?Asp?Gly?Val?Pro?Arg?Met

115 120 125

Arg?Glu?Arg?Pro?Ile?Gly?Asp?Leu?Val?Val?Gly?Leu?Lys?Gln?Leu?Gly

130 135 140

Ala?Asp?Val?Asp?Cys?Phe?Leu?Gly?Thr?Glu?Cys?Pro?Pro?Val?Arg?Val

145 150 155 160

Lys?Gly?Ile?Gly?Gly?Leu?Pro?Gly?Gly?Lys?Val?Lys?Leu?Ser?Gly?Ser

165 170 175

Ile?Ser?Ser?Gln?Tyr?Leu?Ser?Ala?Leu?Leu?Met?Ala?Ala?Pro?Leu?Ala

180 185 190

Leu?Gly?Asp?Val?Glu?Ile?Glu?Ile?Ile?Asp?Lys?Leu?Ile?Ser?Ile?Pro

195 200 205

Tyr?Val?Glu?Met?Thr?Leu?Arg?Leu?Met?Glu?Arg?Phe?Gly?Val?Lys?Ala

210 215 220

Glu?His?Ser?Asp?Ser?Trp?Asp?Arg?Phe?Tyr?Ile?Lys?Gly?Gly?Gln?Lys

225 230 235 240

Tyr?Lys?Ser?Pro?Gly?Asn?Ala?Tyr?Val?Glu?Gly?Asp?Ala?Ser?Ser?Ala

245 250 255

Ser?Tyr?Phe?Leu?Ala?Gly?Ala?Ala?Ile?Thr?Gly?Gly?Thr?Val?Thr?Val

260 265 270

Gln?Gly?Cys?Gly?Thr?Thr?Ser?Leu?Gln?Gly?Asp?Val?Lys?Phe?Ala?Glu

275 280 285

Val?Leu?Glu?Met?Met?Gly?Ala?Lys?Val?Thr?Trp?Thr?Asp?Thr?Ser?Val

290 295 300

Thr?Val?Thr?Gly?Pro?Pro?Arg?Glu?Pro?Tyr?Gly?Lys?Lys?His?Leu?Lys

305 310 315 320

Ala?Val?Asp?Val?Asn?Met?Asn?Lys?Met?Pro?Asp?Val?Ala?Met?Thr?Leu

325 330 335

Ala?Val?Val?Ala?Leu?Phe?Ala?Asp?Gly?Pro?Thr?Ala?Ile?Arg?Asp?Val

340 345 350

Ala?Ser?Trp?Arg?Val?Lys?Glu?Thr?Glu?Arg?Met?Val?Ala?Ile?Arg?Thr

355 360 365

Glu?Leu?Thr?Lys?Leu?Gly?Ala?Ser?Val?Glu?Glu?Gly?Pro?Asp?Tyr?Cys

370 375 380

Ile?Ile?Thr?Pro?Pro?Glu?Lys?Leu?Asn?Ile?Thr?Ala?Ile?Asp?Thr?Tyr

385 390 395 400

Asp?Asp?His?Arg?Met?Ala?Met?Ala?Phe?Ser?Leu?Ala?Ala?Cys?Ala?Asp

405 410 415

Val?Pro?Val?Thr?Ile?Arg?Asp?Pro?Gly?Cys?Thr?Arg?Lys?Thr?Phe?Pro

420 425 430

Asn?Tyr?Phe?Asp?Val?Leu?Ser?Thr?Phe?Val?Arg?Asn

435 440

<210>3

<211>1485

<212>DNA

＜213〉Oryza paddy rice (Oryza sativa var.Lansheng)

<400>3

ttcaaatatg?tatccgctca?tgagacaata?accctgataa?atgcttcaat?aatattgaaa 60

aaggaagagt?atgaaggcgg?aggagatcgt?gctccagccc?atcagggaga?tctccggggc 120

ggttcagctg?ccagggtcca?agtcgctctc?caacaggatc?ctcctcctct?ccgccctctc 180

cgagggcaca?acagtggtgg?acaacttgct?gaacagtgag?gatgttcact?acatgcttga 240

ggccctgaaa?gccctcgggc?tctctgtgga?agcagataaa?gttgcaaaaa?gagctgtagt 300

cgttggctgt?ggtggcaagt?ttcctgttga?gaaggatgcg?aaagaggaag?tgcaactctt 360

cttggggaac?gctggaactg?caatgcgact?attgacagca?gccgtgactg?ctgctggtgg 420

aaatgcaact?tatgtgcttg?atggagtgcc?acgaatgagg?gagagaccga?ttggtgactt 480

ggttgtcggg?ttgaaacaac?ttggtgcgga?tgtcgactgt?ttccttggca?ctgaatgccc 540

acctgttcgt?gtcaagggaa?ttggaggact?tcctggtggc?aaggttaagc?tctctggttc 600

catcagcagt?cagtacttga?gtgccttgct?gatggctgct?cctttggccc?ttggggatgt 660

ggagatcgaa?atcattgaca?aactaatctc?cattccttac?gttgaaatga?cattgagatt 720

gatggagcgt?tttggtgtga?aggcagagca?ttctgatagt?tgggacagat?tctatattaa 780

gggagggcag?aagtacaaat?ctcctggaaa?tgcctatgtt?gaaggtgatg?cctcaagcgc 840

gagctatttc?ttggctggtg?ctgcaatcac?tggaggcact?gtgacagttc?aaggttgtgg 900

tacgaccagt?ttgcagggtg?atgtcaaatt?tgctgaggta?cttgagatga?tgggagcaaa 960

ggttacatgg?actgacacca?gtgtaaccgt?aactggtcca?ccacgtgagc?cttatgggaa 1020

gaaacacctg?aaagctgttg?atgtcaacat?gaacaaaatg?cctgatgttg?ccatgaccct 1080

tgccgttgtt?gcactcttcg?ctgatggtcc?aactgctatc?agagatgtgg?cttcctggag 1140

agtaaaggaa?accgaaagga?tggttgcaat?tcggaccgag?ctaacaaagc?tgggagcatc 1200

ggttgaagaa?ggtcctgact?actgcatcat?caccccaccg?gagaagctga?acatcacggc 1260

aatcgacacc?tacgatgatc?acaggatggc?catggccttc?tccctcgctg?cctgcgccga 1320

cgtgcccgtg?acgatcaggg?acctggttgc?acccgcaaga?ccttccccaa?ctacttcgac 1380

gttctaagca?ctttcgtcag?gaactgaact?gagcttttaa?aagagtgagc?tgcagcaatg 1440

gcaacaacgt?tgcgcaaact?attaactggc?gaactactta?ctcta 1485

Claims

1. 5-enol pyruvoyl shikimic acid-3-phosphate synthase mutant, its amino acid residue sequence is shown in SEQ ID NO:2.

2. the gene of coding claim 1 described 5-enol pyruvoyl shikimic acid-3-phosphate synthase mutant.

3. gene according to claim 2 is characterized in that: the base sequence of this gene is shown in SEQ ID NO:3.

4. contain claim 2 or 3 described 5-enol pyruvoyl shikimic acid-3-phosphate synthase mutant code expression carrier.

5. the transgenic cell line that contains claim 2 or 3 described 5-enol pyruvoyl shikimic acid-3-phosphate synthase mutant code genes.

6. the host bacterium that contains claim 2 or 3 described 5-enol pyruvoyl shikimic acid-3-phosphate synthase mutant code genes.

7. a method of cultivating anti-glyphosate plants is to make up the plant expression vector that contains claim 2 or 3 described genes, again the plant expression vector that makes up is transformed the purpose plant.

8. method according to claim 7 is characterized in that: described purpose plant is paddy rice, corn, wheat, barley, Chinese sorghum, tobacco, cotton, willow, soybean, sweet potato, potato, Chinese cabbage, wild cabbage or green pepper.