CN100381460C - HER-2 analogue antigen epitope and peptide containing said epitope - Google Patents

Abstract

The present invention relates to small HER-2 analogue antigen epitope peptide (with a general formula of I) separated through a bacteriophage display technology. The present invention modifies the small HER-2 analogue antigen epitope peptide in an abrupt change mode, and identifies a plurality of kinds of epitope perylene derivatives which still maintain the immunogenicity. Peptide (with the epitope or derivatives thereof) or protein fusant of the peptide can be used as a vaccine which is used for inducing the generation of body fluid and cell-mediated immune response reaction on HER-2, and then, the peptide has the prevention function and the treatment function on tumor. The present invention also synthesizes oligonucleotide for encoding the peptide, constructs an expression vector (with the oligonucleotide or the oligonucleotide and gene recombinations for encoding other proteins) and transforms cells. The present invention provides a method for treating the tumor by the oligonucleotide and the expression vector or the cells.

Description

HER-2 analogue antigen epitope and contain the peptide of this epi-position

Technical field

The present invention relates to inducing and strengthen at the active immunity of HER-2, particularly, the present invention relates to a kind ofly, but still keep the derivative of immunogenic this epitope peptide by display technique of bacteriophage isolating HER-2 analogue antigen epitope simulating peptide and through modifying.The invention still further relates to the vaccine that contains this epitope peptide or derivatives thereof.This vaccine is used for prevention and treatment to tumour by inducing generation at the body fluid of HER-2 and cell immune response.The invention still further relates to recombination fusion protein, the carrier that contains this Nucleotide and the cell of Nucleotide, Nucleotide and other molecule of these peptides of coding, and the method and the pharmaceutical composition that utilize these peptides, nucleic acid or cell therapy tumour.

Background technology

The HER-2 acceptor belongs to EGF-R ELISA (Epidermal growth factorreceptor, EGFR) family member.Structurally, it comprises glycosylated extracellular region, Tyrosylprotein kinase district [1] in aquation transmembrane domains and the born of the same parents.Do not find at present the part of HER-2 as yet.Be that HER-2 has brought into play important regulatory role in the initial signal path with EGFR family.HER-2 be by with EGFR, ErbB-3, ErbB-4 form heterodimer play a role [2].Heterodimer can form high-affinity with EGF sample part and combine, and activates downstream many A signal pathways [3] simultaneously.Proto-oncogene HER-2/c-erbB2/neu has gene amplification and crosses and express in multiple malignant tumour, particularly its expression level raises more obvious in mammary cancer, ovarian cancer, adenocarcinoma of stomach, colorectal carcinoma.HER2 crosses and expresses and cancer patients's prognosis mala, easily recurrence, survival rate low relevant [4].

Over past ten years, HER-2 is considered to one of desirable target spot of immunotherapy of tumors.This is not only because cross expressing of HER-2 sees multiple human tumor, and its cross express relevant with malignant tumour (as mammary cancer) prognosis mala.In addition, express very lowly at normal adult tissue HER-2, and the stably express [5,6] of HER-2 is arranged all in primary tumors and metastasis.Therefore anti-HER-2 immunotherapy can produce the specificity curative effect at tumour.

In passive immunotherapy, people have obtained multiple monoclonal antibody at the HER-2 extracellular region, and some antibody can suppress tumor growth.Wherein a strain antibody---Herceptin (Trastuzumab) has passed through clinical assessment at present, and is used for clinical treatment [8] in September, 1998 by drugs approved by FDA.Herceptin is first biology preparation that is used for breast cancer treatment, it separately medication or with chemotherapeutic combined utilization [7,8].Because Herceptin costs an arm and a leg, dosage is big, needs repeated multiple times to use, and causes general patient to be difficult to economically bear.

Except above-mentioned passive immunotherapy, the response to active immunization that patient is produced at HER-2 also is effective immunotherapy method.HER-2 has many advantages as the potential tumor vaccine.At first, some HER-2 express the immune response that has in male neoplastic disease human bodies at HER-2, and this just points out body can overcome immunological tolerance at oneself protein.Secondly, because HER-2 crosses expression at tumour cell, and express in that healthy tissues is low, the immune response at HER-2 that makes patient produce has the tumor tissues specificity, and very little or do not have toxicity to normal tissue toxicity.At last, HER-2 is as an important growth factor receptors, and the humoral immune reaction at HER-2 that produces in the patient body can pass through the death of number of mechanisms inducing tumor cell bag.

People such as Pupa were in reported first in 1993, and HER-2 crosses the interior serum antibody and the t cell responses [10,11] that exists at HER-2 of patient with breast cancer's body of expression.In addition, other report also proves endogenous body fluid and the cell immune response that exists in patient with breast cancer's body at HER-2.

People such as Disis discover in 127 patient with breast cancers, and the anti-HER-2 antibody titers of 14 people (11%) serum is greater than 1: 100, and none example detects anti-HER-2 antibody among 100 normal women.Particularly wherein be in 5 early stage patient's bodies of mammary cancer and have the intensive humoral immune reaction, serum antibody titer is greater than 1: 5000[12].The appearance of the anti-HER-2 antibody of high titre is crossed with early stage primary carcinoma HER-2 and is expressed relevant [12,13] in the serum.And the patient with breast cancer does not find this dependency late, can detect HER-2 extracellular region protein (ECD) [14] among the patients serum, but its intravital antibody recall rate is starkly lower than infantile tumour patient [12].Also can detect anti-HER-2 antibody [13] among the colorectal carcinoma patients serum.In addition, in dissimilar epithelium malignant tumor patient bodies, can detect antibody response [74] at all EGFR acceptors.

Helper T cell immune response at HER-2 generally can detect [10] with anti-HER-2 antibody.Anti-HER-2 antibody in the serum mainly is IgG or IgA[12,13,65], antibody from IgM to IgG or IgA transition reaction needed T cell booster action, this process need HER-2 contains the helper T cell epi-position.Potential helper T cell epi-position is generally selected by computer program algorithm (computer algorithms).By synthesizing the corresponding peptide of these epi-positions and detecting them and induce the ability that produces cytokine or stimulate peripheral blood lymphocyte to breed to assess the activity [10,16,18] of little peptide.People such as Kobayashi have discovered the helper T cell epi-position of a series of HLA-DR of having binding characteristics.One of them peptide reacts at the external special HLA-DR restricted type helper T cell of HER-2 of inducing.In addition, little peptide activated helper T cell can be discerned the HER-2 albumen [17] of the natural submission in antigen presenting cell surface.

In crossing the neoplastic disease human body of expression, HER-2 also can detect the reactive cytotoxic T cell of HER-2 (Cytotoxic T Lymphocytes, CTL) [19,20,21].These CTL cells can be in external separated cultivation, and by stimulating with self inherent tumour cell, the CTL cell obtains amplification [19,22,23].Owing to induce the HER-2 Specific CTL Cells to need the submission of little peptide and, found the little peptide epitopes of some restricted HER-2CTL of HLA kind type at present in the exposure of cell surface.These peptide sections have the homologous sequence in conjunction with specific HLA kind type.These potential CTL epi-position can excite dendritic cell, and further produces the CTL cell, immortalized cells or self inherent tumour cell [23,24,25,26] of these CTL cell cleavables HER-2 transfection.Table 1 has been listed HER-2CTL epi-position and the helper T cell epi-position found at present in detail.

HER-2 Specific CTL Cells cleavable self inherent tumour cell, this effect point out the epi-position in multiple HER-2 source to be exposed to cell surface by natural submission effect.In fact, by with acid elutriant washing tumour cell, can obtain the HER-2 antigen peptide [20,27] that exposes on the tumor cell surface HLA-I quasi-molecule.Some tumours as mammary cancer [20], ovarian cancer [20,24], nonsmall-cell lung cancer [27], carcinoma of the pancreas [75], renal cell carcinoma [23,26] and colorectal carcinoma [23], all can detect the HER-2CTL epi-position and express.In addition, some complete dissimilar epithelium tumors have identical HER-2CTL epi-position [20,23].

In a word, these research promptings HER-2 not only can be presented at tumor cell surface, also can cause the body fluid and the cell immune response of tumour patient.

The immunoreactive while in finding the patient body, people have proposed a major issue: does this immune response have antitumor action? the intravital immune response of some research prompting patients is useful.

At discovering of the above patient with breast cancer of 1000 examples, (Lymphoplasmacytic Infiltration, I phase patient LPI), HER-2 cross to express to point out prognosis preferably [28] in primary carcinoma the lymph-plasma cellular infiltration.Nearest discovers, is both the patient that lymphoglandula is not subjected to tumor invasion, if there is not the LPI reaction, HER-2 crosses and expresses the prompting prognosis mala; Then prognosis better [29] of patient with LPI.Can detect the T cell in former hair-cream gland cancer inside tumor, but do not detect HER-2 and cross expression, this is that host's immune response can be removed the tumour cell that HER-2 crosses expression because HLA-A2 male patient with breast cancer, therefore HER-2 detects the reaction [30,31] that is negative.These are found all to point out in tumour and take place in early days, and immune response can delay the tumor development process.

Yet present result of study has only been reacted small portion patient's immune response situation.Whether self inherent T cell and specific antibody reaction be really useful, also needs epidemiological studies and follow up a case by regular visits to for a long time and verify.

The immune response at HER-2 can be induced and strengthen to the immunoreactive existence prompting of anti-HER-2 vaccine in the patient body.In recent years, many animal models confirmed all that vaccine can cause the immune response at HER-2.Be applied to the intravital anti-HER-2 vaccine of animal and be proved to be and have immunogenicity, and be safely and effectively.

The main purpose of tumor vaccine is the specific immune response that causes at tumour antigen, and this immune response can avoid tumour to take place, and sets up secular immunological memory.Should consider immunogenic application form when design vaccine and immunization ways.Because HER-2 is an oneself protein, therefore also should consider tolerance and autoimmunity toxicity for anti-HER-2 vaccine.The applying transgene mouse can be assessed the immunotolerance of vaccine at HER-2.Set up two kinds of neu transgenic mouses at present, a kind of be import in the genome by mouse source property mammary tumor virus (Murine mammary tumourvirus, MMTV) the wild-type mice neu cDNA[32 of 3 ' long-terminal repeat promoter regulation and control].Because crossing of mouse neu expressed, spontaneous original position mammary cancer appears in female mouse.These tumours are similar to human breast carcinoma on histology, so transgenic mouse provides a good model for can the assessment vaccine overcome immunological tolerance.Import the neu[32 of activated form in the another kind of transgenic mouse genome, 33 with a point mutation] because the activation of neu proto-oncogene causes mouse that spontaneous lactogenesis gland cancer takes place.For these two kinds of transgenic mouses, can by detect animal whether spontaneous tumor assess the effect of vaccine.

People such as Bernards at first report, express the proteic neuroblastoma clone of rat neu of suddenling change to injected in mice, and tumour no longer takes place mouse.This research has been used the vaccinia virus recombinant of expression rat neu extracellular region as vaccine.Yet same method is applied to rat, and after the injection rat tumor clone, rat still tumour can take place, and this explanation rat has produced tolerance [34] to self neu albumen.Identical therewith, people such as Disis report that also using complete neu albumen can not cause the anti-neu immune response [15] of mouse.

In order to overcome immunotolerance, someone uses and rat neu height homologous recombinant human HER-2 extracellular region immune rat, and this immunization method of inference will cause the cross-immune reaction at rat neu, thereby after making animal injection tumour cell tumour take place no longer.Rat has produced the cross-immune reaction at HER-2 and rat neu as a result.Yet, induce the cross-immune reaction of generation very faint, tumour [35] still can take place in rat behind the rat tumor cell of subcutaneous injection neu transfection.

Recently, the applying transgene animal has obtained some gratifying results.People such as Esserman report that but using the neu extracellular region protein carries out the immune response [36] of immunity induced animal generation at oneself protein.This research has been used and has been crossed the N202 transgenic mouse system of expressing wild-type rat neu gene.Can produce anti-neu body fluid and cell immune response with neu extracellular region immune transgenic mouse, have 50% tumour [36] does not take place through the transgenic mouse of immunity.People such as Reilly also report, the transgenic mouse model of applications similar, although mouse has produced tangible tolerance to transgenosis, the neu specific immune response that mouse produces before immunity is similar to observed immune response in the breast cancer disease human body.The more important thing is that application can strengthen specificity humoral and the cellular immunization of transgenic mouse at neu through the intact cell of radiation exposure and the vaccinia virus of reorganization as the neu specificity vaccine, tumour no longer takes place in transgenic mouse behind the tumour cell that injection neu expresses, and spontaneous tumor forms and postpones [37] simultaneously.In another research, transgenic mouse model with activation rat neu gene is used the allos cell vaccine, although transgenic mouse can produce the special antitumor reaction of neu, and do not produce spontaneous tumor or form transplanted tumor, but use vaccine to the not influence [38] of established spontaneous tumor.

In a word, although body has the tolerance to HER-2, by immunity, induce and strengthen the HER-2 specific immune response also to have feasibility simultaneously.Whether immunological tolerance can be overcome and be indeterminate, but in specific transgenic mouse immunological tolerance and not exclusively existence.In addition, the main difficulty of using HER-2 or cell vaccine is the production and the preservation of vaccine, and the vaccine contamination of heavy is bigger, and this will hinder the clinical application of this type of vaccine.

The vaccine strategy that is applied as of synthetic peptide provides new prospect.Synthetic peptide has multiple advantage as vaccine: peptide is very simple, building-up process economy also can be induced special immune response.In addition, the synthetic peptide of research prompting can be avoided the generation [15] of tolerance.At present, multiple peptide vaccine is in evaluation stage.

Peptide antigen mode of transport in vivo has a significant impact its immunogenicity.The method of using has at present: peptide vaccine and immunological adjuvant share [39], make up saccharan-peptide complex or peptide is attached directly to splenocyte or dendritic cell surface [40].People such as Gu have made up hydrophobic saccharan/proto-protein compound vaccine, make the HER-2 albumen segment of 147 amino acid longs of the easier transportation of body, and this peptide section comprises the one or more t cell epitopes [72] at MHC I quasi-molecule approach.

What found at present can be the main foundation of the anti-HER-2 vaccine of design by the peptide epitopes of helper T cell or CTL cell recognition.People such as Disis discover, although whole rat neu albumen is not had an immunogenicity, use and derive from the proteic multiple helper T cell epitope peptide immune rat of rat neu and can cause intensive body fluid and helper T cell reaction [15].Recently, discover and use various human HER-2 albumen helper T cell epitope peptide that mammary cancer and ovarian cancer patients can produce at peptide and the special helper T cell reaction [76] of HER-2.

Kinds of tumors may have identical CTL epi-position, and therefore the peptide vaccine based on the CTL epi-position can be applicable to crowd widely.People such as Nagata discover, use CTL epitope peptide vaccine and can successfully induce ctl response, form thereby suppress mouse tumor, but do not cause any autoimmunization toxicity [40].Further the identical peptide of research prompting can make tumour patient or normal people's peripheral blood lymphocyte (PBMC) in external sensitization [41,73] as p63 or p780.Induce the HER-2 specificity HLA-A24 Restricted CTL reaction cleavable HER-2 of generation to cross the tumour cell of expression.Peptide p63 has been used to clinical experiment [73] at present.

People such as Dakappagari discover that using the B cell epitope also can cause the tumor suppression immune response.Application is positioned at the HER-2 extracellular region to be enough to induce near the peptide section of transmembrane domains and to produce tumor suppression antibody response [9,77].Herceptin effect epi-position also is positioned at membrane-proximal region [23], infers that thus this zone can effectively strengthen protective immunological reaction.

Dna vaccination comprises the direct inoculation expression plasmid.The DNA of injection can pass nuclear membrane and duplicate episome molecule long-term existence as non-, thereby cause the expression of foreign protein long period once absorbed by cell.Therefore, dna vaccination is for inducing the permanent immunity reaction at antigen expressed to have potential advantages [78].

Some research groups use this method and have successfully induced anti-HER-2 immune response [42,43,44].Concetti etc. at first report, rat neu full length DNA is injected to can produces anti-mouse neu autoantibody [45] in the mouse body.Neu transgenosis tumor-bearing mice is used the neu dna vaccination can stop the breast tumor growth, and reduces transfer ability [42].In another research, the dna vaccination that transgenic mouse is used coding rat neu transmembrane domains and extracellular region plasmid can cause anti-neu antibody response, although just partly suppressing tumour cell becomes knurl, tumor progression is obviously controlled [46].

Yet the effect of dna vaccination also is subjected to certain limitation [42].Discover that dna vaccination can not break through CTL tolerance [77].Whether in addition, whether dna vaccination has the possibility that sudden change is integrated, and can exert an influence to tumor development after using plasmid DNA, and these all lack the assessment [47] of system.

In the last few years, people used complicated animal model the HER-2 vaccine were carried out immunologic evaluation in the body.It is possible and effective that anti-HER-2 immune response is induced in the result of study prompting.Although people such as Disis, and some other research groups find to carry out the appearance [15 that immunity can cause immunological tolerance with complete HER-2 albumen or extracellular region, 34], but the very approaching transgenic mouse model of application and clinical condition discovers that the bigger HER-2 molecule of application can overcome immunotolerance [36,37,38].In fact, the tumour patient with the anti-HER-2 immunity of endogenous has overcome or part has overcome tolerance [10,62] at HER-2.Effective anti-HER-2 immunity comprises the activation at the endogenous natural immunity reaction of a series of self epi-position.People such as Cefai further study the anti-HER-2 vaccine of prompting can induce the specific immune response of generation at spontaneous HER-2 expressing tumor.

Obviously, if anti-HER-2 immune response produces, reply potential autoimmunization toxicity is assessed.HER-2 makes immune response only can not produce autoimmunization toxicity at tumour cell in the low expression of healthy tissues.Up to now, all research all points out the neu specific immunity of body generation can not cause autoimmune response [15,40,42,45] animal.Yet because HER-2 is in fetal tissue's wide expression, therefore whether toxic need are assessed [48] to fetus.

Experimentation on animals is the result show, vaccine is enough to cause that animal produces the ability [37,38] that suppresses transplanted tumor or spontaneous tumor formation, and delays the process [42,46] of proliferative lesion.And the tumour that has formed for body, vaccine can not be brought into play above effect [46].This has special nature with regard to the tumour that prompting has formed, and they can escape the immunity monitoring.Immunologic escape mechanism can be regulated [49,50] by the microenvironment of tumour.In addition, the HLA-I quasi-molecule may limit the vaccine that relies on ctl response play a role [37,54,55] at the down-regulated expression of many mammary cancer [51] and other tumour [52,53].

Experiment showed, that the treatment at tumour cell HER2/neu can effectively reverse the malignancy of tumor phenotype that the HER-2/neu overexpression causes.HER-2 humanized antibody Herceptin has been used for the treatment of the metastatic breast cancer of HER-2 overexpression by drugs approved by FDA, and obtains clinical effectiveness preferably.Herceptin is clinic trial at home at present, but its prices are rather stiff, most patients are difficult to bear economically.

Though use tumor suppression antibody clinical efficacy is preferably arranged, also have some problems simultaneously by the passive immunization method, as: anti-homotype antibody (idiotypic antibody) produced, tissue distributes not enough, dosage is big, costs an arm and a leg etc., and these have all limited passive immunotherapy.

In contrast to this, use vaccine-induced body and produce endogenous tumor suppression antibody, and the immune stimulatory memory, this method may the easier patient of making produce permanently effective effect, and more economical.

Summary of the invention

The contriver utilizes the Herceptin antibody gone on the market, by screening phage 12 peptide storehouses obtain can with the little peptide of Herceptin specificity bonded.

Display technique of bacteriophage is a kind of technology that developed recently gets up, it has wide practical use in the fields such as discovery of Characterization of antigenic epitopes, the research of protein molecule binding characteristic and lead compound, and utilizing display technique of bacteriophage to obtain bioactive peptide also is the common method [7] that is used for the exploitation of peptide medicine in recent years.The phage peptide library technology is the ideal tools of research macromolecule interaction.People can be under the situation that structure-functional relationship is short in understanding, utilize the phage peptide library technology, bonded polypeptide or protein such as screening can isoacceptor, enzyme, DNA are conjugated protein, cytokine, antibody, be used to study the binding characteristic of natural protein, evaluation has high-affinity and specific zymolyte, location antibodies epi-position etc.But 55 amino acid whose peptide section EP531 inducing mouses that wherein utilize anti-HER-2 antibody N21 to be separated to from HER-2 gene segment phage library produce the response to active immunization at HER-2, and the antibody that produces can effectively suppress tumor cell proliferation [60].

The Herceptin antibody that this research and utilization has gone on the market, by screening phage 12 peptide storehouses obtain can with the little peptide of Herceptin specificity bonded.Because conventional target protein bag is by in the process, protein is adsorbed on frosting by hydrophobic interaction, and this absorption can cause proteinic partially denaturing [71,58,59]; And solid phase adsorption may screen a series of small peptides that are rich in tyrosine and tryptophane, and they can combine with plastics, and can not be by BSA sealing blocking-up [79].Therefore the contriver carries out liquid phase Bio-panning process after having used the absorption of Protein A-Sepharose 4B pearl antagonist in screening process, solid phase adsorption process more in the past, this method has strengthened the touch opportunity of little peptide of phage display and antibody greatly, thereby can effectively screen positive colony.For reducing the non-special absorption in the Bio-panning process, increase the screening positive rate simultaneously, the contriver has carried out preadsorption with normal human serum IgG to original phage peptide library, to reach the purpose of removing part non-specific binding phage.In addition, phage with the target protein binding affinity can not be eluted for fear of conventional elution step, the contriver has omitted elution step, increases but Protein A-Sepharose 4B, Herceptin and phage three mixture added in the intestinal bacteria in the lump.By the improvement to the Bio-panning technological line, the screening positive rate is by the 2-8%[60 of general solid phase adsorption], reach 13.7%.

Only obtain two kinds of small peptide sequences by screening contriver, wherein a kind ofly behind prokaryotic expression, do not combine with Herceptin to Herceptin.The positive sequence that obtains is single may be relevant with library proneness.The reason of present library proneness generation is not illustrated as yet fully, but the situation of some recombinate back phage-infect ability enhancing or reduction exists really in same library.For example people such as Burritt finds that proteic displaying is less than predicated value [61], Blond-Elguindi to studies show that the clone who contains Gly in the library is easy to selected, and the clone who contains Cys is difficult for selected [62].

The contriver by screening phage 12 peptide storehouses obtain can with the little peptide H 98 of Herceptin specificity bonded, this peptide has following sequence:

LLGPYELWELSH

The little peptide H98 that the contriver screens contains a Gly, and does not have Cys to participate in.The clone who contains the odd number halfcystine in the exogenous small peptide that discovers of Kay etc. is difficult to be amplified.Reason be this halfcystine may with 8 of pIII natural halfcystines in any one form disulfide linkage, thereby influence the infection ability [63] of phage.

At present, the phage display peptide library technology is widely used in the research of identifying the antibodies epi-position.Antibody be that antigenic determinant can be divided into two kinds of continuity epi-position and discontinuity epi-positions substantially in conjunction with epi-position.The continuity epi-position is called linear epitope or sequentiality epi-position again.This class epi-position generally is made of continuously arranged several amino acid on primary structure.Can discern the continuity epi-position of metaprotein or natural antigen at the antibody of this epi-position.The discontinuity epi-position is called the conformational epitope again, can be made of but pass through the close mutually amino-acid residue in a series of folding backs apart from each other on primary structure, and this class epi-position generally is crack or the space structures such as ditch, groove that are made of a plurality of amino acid moleculars.From phage display library, generally can't screen really with natural epi-position unanimity or homologous discontinuity epi-position, and can only screen so-called " mimotope " [64] that to simulate original natural epi-position binding characteristic.The positive phage clones H98 that the contriver will screen acquisition checks order and the Blast comparison, the result shows: little peptide of H98 and HER-2 do not have obvious sequence homology, therefore the little peptide mimic native conformation " mimotope " that is HER-2, be tertiary structure, rather than a certain section aminoacid sequence of HER-2.The contriver is according to Herceptin that obtains in bibliographical information [80] and the PDB database and the interactional three-dimensional structure 1N8Z of HER-2, and utilized Homology module construction in the InsightII software package little peptide of H98 and the interactional three-dimensional structure of Herceptina.By the interaction situation of the reactive site of mimic H98 and Herceptin also as can be seen the important residue in the reactive site of H98 and Herceptin have electrostatic interaction, hydrogen bond action, ((conjugate phases mutual effect.According to bibliographical information, Herceptin at the HER-2 antigenic determinant by three ring texturees that are dispersed in different zones through folding the composition in the space, and be not to be one section continuous peptide on the peptide chain.Little peptide H98 can simulate the wherein important amino acid HER-2 of 2 ring texturees ₅₆₀D and HER-2 ₅₇₃F, HER-2 ₅₇₂P.If with H98 ₁L sports Q, promptly forms the HER-2 of interaction of hydrogen bond in the 3rd ring texture with Herceptin ₆₀₂Q can make H98 ₁Q and Herceptin A30N form interaction of hydrogen bond.May strengthen the avidity of little peptide of H98 and Herceptin by this sudden change.

Further, the contriver passes through gene engineering, and above-mentioned little peptide is suddenlyd change obtains a series of derivative.The structure of each derivative is as follows:

The little peptide that the contriver will suddenly change carries out the amalgamation and expression with GST, ELISA results suggest mutant C10, and MutN1-2, MutN1 and CyclicH98 have the avidity with Herceptin.Wherein, MutN1 sports Q with H981L, can strengthen the avidity of little peptide of H98 and Herceptin.

In addition, the contriver is to the partitioned representation that blocks body and GST fusion form of H98,2 amino acid of results suggest C-terminal and N-terminal the 3rd, 4 amino acids play a significant role in the combining of little peptide and Herceptin, and remove the little peptide fragment and the equal debond of Herceptin of this several amino acid.The little peptide H98 of this and software analysis can form electrostatic interaction with Herceptin, hydrogen bond action, and ((the interactional amino acid of conjugation is also not quite identical.

One aspect of the present invention is the peptide as the HER-2 analogue antigen epitope, it with forward or backwards continuously or the compartment of terrain comprise a plurality of or only comprise the peptide of the aminoacid sequence shown in the following general formula (I): X9X1X2GPX3X4X5X6X7X8SHX10, (I)

Wherein,

X1 can exist or not exist, and is natural amino-acid residue,

X2 can exist or not exist, and is hydrophobic amino acid residues.

X3 is a polare Aminosaeren,

X4 is a polare Aminosaeren,

X5 is a hydrophobic amino acid,

X6 is a polare Aminosaeren

X7 is a polare Aminosaeren, can be identical or different with X4,

X8 is a hydrophobic amino acid, can be identical or different with X5,

Wherein, X9 and X10 are natural amino acid, can exist or not exist, and the peptide of formula (I) can be linear or cyclisation.

Preferably,

Wherein, X1 can exist or not exist, and is L, I, and V, M, A, F, G, Q or N,

X2 can exist or not exist, and is L, I, V, M, A or F, G

X3 is Y, W, F, T or S

X4 is E or D,

X5 is L, I, V, M, A or F

X6 is W, Y or F,

X7 is E or D, can be identical or different with X4,

X8 is L, I, and V, M, A or F can be identical or different with X5,

X9 and X10 can exist or not exist, and are C or S.

More preferably,

Wherein, X1 can exist or not exist, and is L, G or Q,

X2 can exist or not exist, and is L or A,

X3 is Y,

X4 is E,

X5 is L,

X6 is W,

X7 is E,

X8 is L,

X9 and X10 can exist or not exist for C.

Wherein, several aminoacid sequences of the formula I of checking in an embodiment are

H98 LLGPYELWELSH

C10 GPYELWELSH

MutN1-2 GAGPYELWELSH

MutN1 QLGPYELWELSH or

CyclicH98 CLLGPYELWELSH C。

Usually, contain 1-10 amino acid whose aminoacid sequence and be called oligopeptides, more than 10 amino acid, but the aminoacid sequence of molecular weight below 10,000 dalton is called polypeptide, and the aminoacid sequence of molecular weight more than 10,000 dalton is called protein.And oligopeptides and short polypeptide often are called little peptide.For sake of convenience, in this article, oligopeptides, little peptide, polypeptide and albumen are referred to as peptide.

Natural amino acid of the present invention comprises polare Aminosaeren: Serine (Ser), Threonine (Thr), halfcystine (Cys), tyrosine (Tyr), aspartic acid (Asp), l-asparagine (Asn), L-glutamic acid (Glu), glutamine (Gln), Methionin (Lys), arginine (Arg) and histidine (His); Hydrophobic amino acid: glycine (Gly), L-Ala (Ala), Xie Ansuan (Val), leucine (Leu), Isoleucine (Ile), proline(Pro) (Pro), phenylalanine (Phe), tryptophane (Try) and methionine(Met) (Met).

Those of skill in the art will recognize that mutant that the conservative property of above-mentioned peptide is replaced have fully its can with Herceptin specificity bonded biologic activity.So-called conservative property is replaced, and is meant with the amino acid of similar physicochemical property and replaces existing amino acid.

Preferably, each amino acid can be replaced with the most akin amino acid, as described in following table:

Original residue	Conservative property is replaced	The most conservative replacement
			A	V，L，I	V
R	K，Q，N	K
			N	Q，H，K，R	Q
D	E	E
			C	S	S
Q	N	N
			E	D	D
G	A	A
			H	N，Q，K，R	N
I	L，V，M，A，F	L
			L	I，V，M，A，F	I
K	R，Q，N	R
			M	L，F，I	L
F	L，V，I，A，Y，W	W
			P	A	A
S	T	T
			T	S	S
W	Y，F	Y
			Y	W，F，T，S	F
V	I，L，M，F，A	L

An importance of the present invention is the peptide that comprises the plan epitope peptide of the invention described above, this peptide is able to combine with the Herceptin specificity because intending the submission of epitope peptide, induce body fluid and cellular immunization at HER-2, therefore can be used for oncotherapy, wherein, plan epitope peptide of the present invention in peptide with forward or backwards continuously or the compartment of terrain occur repeatedly or only occur once.

Peptide of the present invention can be synthetic by conventional solid phase synthesis process well known by persons skilled in the art.Peptide for example of the present invention can be pressed the solid state chemistry technology with AppliedBiosystem synthesizer or PioneerTM peptide synthesizer by the method that Steward and Young (65) describes and synthesize.Also can synthesize a plurality of fragments earlier, connecting together then forms bigger fragment.Synthesizing for solid-phase peptide can be referring to the introduction that can find many technology in (66).Generally, these methods comprise the amino acid that adds one or more amino acid or due care on the peptide chain of growth successively.Generally; first amino acid whose amino or carboxyl are protected with suitable protecting group; amino acid with protection is connected on the inertia solid phase carrier then, adds corresponding amino or carboxyl subsequently by the next amino acid in the sequence of due care under being suitable for forming the condition of amido linkage.Remove protecting group from initiate amino-acid residue then, add the next amino acid of due care in case of necessity again, so repetitive operation.After all amino acid are with correct being linked in sequence, remove any remaining protecting group and solid support in succession or simultaneously, obtain final polypeptide.By this general procedure of simple modification, can once add more than one amino acid to growing chain.

Peptide of the present invention can also suitably expressed among the host with the polynucleotide that contain peptide of the present invention or fusion rotein encoding sequence, and the expressed peptide prod of purifying obtains then.The positive and negative adopted chain of nucleotide sequence that code book is invented little peptide can synthesize on dna synthesizer by solid phase phosphorous acid acid amides triester method well known in the art.The annealing in suitable damping fluid of the synthetic positive and negative adopted chain of complementary that obtains is obtained the oligonucleotide that code book is invented little peptide.In this building-up process, can introduce the sticky end sequence that is used to clone in the oligonucleotide both sides.Then, the oligonucleotide that code book can be invented little peptide and the suitable carrier T that contains another polypeptide or albumen coded sequence with the enzymic digestion of respective limits endonuclease ₄Ligase enzyme connects, and obtains the dna sequence dna of encoding fusion protein.Described another polypeptide or proteic encoding sequence generally are known, and some can be bought with carrier format and obtain, and perhaps can synthesize according to a conventional method or clone from the known organism body to obtain.The gene of the present invention that obtains as mentioned above, perhaps available ordinary method of the mensuration of the nucleotide sequence of various dna fragmentations such as dideoxy chain termination (67).This class nucleotide sequencing is available commercial sequencing kit etc. also.Certainly, in expression vector, should contain suitable promotor, ribosome bind site, terminator etc.For the location of expression product in the cell chamber, can add suitable leader sequence in the polypeptid coding sequence upstream.Suitable carrier and promotor to be chosen as those of ordinary skills known.The effective expression carrier that bacterium is suitable for can make up like this: the structural DNA sequence of the target protein of will encoding is inserted in the steerable reading frame that has function in company with suitable translation initiation and termination signal.Those of ordinary skills are known to be used to make up and to contain nucleotide sequence of the present invention and suitable transcribing and the method for the carrier of translational control element.Those skilled in the art know, and the expression vector that dna sequence dna inserted according to the present invention or the kind of construct and characteristic select appropriate host to express target protein matter.The host who is suitable for expressing polypeptide of the present invention includes but not limited to: prokaryotic hosts, such as intestinal bacteria, bacillus, streptomyces etc.; Eucaryon host, such as: yeast belong, Aspergillus, insect cell, such as fruit bat S2 and fall army worm Sf9; Zooblast, as CHO, COS (monkey kidney fibroblast), what reach other can express the clone of compatible carrier.The method that construct is imported above-mentioned host cell is known for those skilled in the art, include but not limited to: transfection, electroporation, microinjection, particle bombardment method or the particle gun method (68 of the conversion of calcium chloride mediation, calcium phosphate transfection, the mediation of DEAE-dextran, 68,69).In suitable culture condition and substratum, cultivate through host transformed bacterial strain or cell, it is grown into after the appropriate cell density, induce selected promotor with appropriate means (for example temperature transition or pharmaceutical chemicals are induced), and cell is cultivated for some time again.At different host strains or cell select and the corresponding culture condition of character of expressed target protein matter and substratum within those skilled in the art's ken.Expressed polypeptide or fusion rotein separate and purifying from culture according to a conventional method, as centrifugal, precipitation, various chromatogram, HPLC etc.

Peptide of the present invention might be induced and be produced than stronger body fluid and the cell immune response of self HER-2, and this Herceptin of having specificity has similar epitope in conjunction with little peptide to HER-2, reacts as HER-2 antigenic epitope induction of immunity.Peptide of the present invention can be used for treating for example former or noumenal tumour and the cancer that shifts of following organ: mammary gland, colon, rectum, lung, oropharynx, laryngopharynx, oesophagus, stomach, pancreas, liver, gall-bladder, bile duct, small intestine, kidney, bladder, the urothelium uterine neck, the uterus, ovary, the sick male genetic of choriocarcinoma and pregnant occasion nutritive layer road, comprise prostate gland, seminal vesicle and testis, Tiroidina, suprarenal gland and hypophysis angiogenic knurl, melanoma, sarcoma and kaposi's sarcoma from bone or soft tissue generation; The tumour of brain, nerve, eye and meninx comprises astrocytoma, glioma, glioblastoma, retinoblastoma, neuroma, neuroblastoma, schwannoma and neu knurl; Noumenal tumour from hematopoiesis malignant disease such as leukemia generation comprises chlorosarcoma, plasmoma and skin T-glucagonoma/leukemia; Lymphoma comprises Hodgkin lymphoma and non-Hodgkin lymphoma.Peptide of the present invention also can be used for preventing the transfer of above-mentioned tumour.

Peptide of the present invention is as pharmaceutical composition, during in particular as vaccine, mixes mutually with the cytokine of this area enhancing immunity commonly used or albumen, other tumour vaccine commonly used or carrier commonly used or forms recombinant protein.Cytokine wherein is interleukin II (IL-2), interleukin 12 (IL-12), G CFS (GM-CSF), CCL2, CCL5, CCL7, CCL19, CCL21, CCL20, CXCL9, CXCL10, CXCL12, CXCL15, XCL1, FTL3L, CD40L etc., albumen wherein is heat shock protein(HSP) etc., the vaccine commonly used of tumour wherein mainly refers to cancer suppressor gene, the tumor associated antigen of oncogene, sudden change, carrier wherein is a keyhole relative hemocyanin, serum albumin, the bacteriotoxin of deactivation etc.The cancer suppressor gene of oncogene wherein such as CEA etc., sudden change such as p53 etc., tumor associated antigen such as melanic related antigen etc., serum albumin wherein can be bovine serum albumin or human serum albumin etc., and bacteriotoxin is tetanus, diphtheria toxin or tuberculin etc.

When peptide of the present invention was used for immunization, the carrier commonly used with this area mixed mutually.Can be used for carrier of the present invention such as but not limited to keyhole relative hemocyanin (KLH), serum albumin such as bovine serum albumin (BSA), the bacteriotoxin of deactivation such as tetanus (TT) or diphtheria toxin (DT) or tuberculin (PPD), also can cytokine or other tumour antigen as carrier proteins, bring into play multi-functional vaccine effect.

When peptide of the present invention was used for immunization, the adjuvant commonly used with this area mixed mutually, and adjuvant wherein includes but not limited to the oxyhydroxide or the phosphoric acid salt of Freund's complete adjuvant and Freund's incomplete adjuvant aluminium or calcium.

Immunogen of the present invention can comprise aforesaid peptide, immunogen promptly of the present invention be with the peptide that comprises plan epi-position or derivatives thereof of the present invention or with the recombinant protein of other molecule.

The present invention also comprises gene therapy, promptly by with the transgenosis of code book invention polypeptide or polypeptide amalgamation protein in patient's body, expressing polypeptide of the present invention or polypeptide amalgamation protein in vivo, thereby produce result of treatment.The known various methods that cell comes expressing gene product albumen matter that DNA is shifted or is delivered in this area are for example described in " transgenosis in the body in the mammalian somatic cell " (70).Gene therapy comprises that dna sequence dna is mixed somatocyte or sexual cell to be used for exsomatizing or interior therapeutic.

The present invention also comprises gene therapy, promptly by the Nucleotide of code book invention peptide is transferred in patient's the cell, expressing polypeptide of the present invention in vivo, thereby produces result of treatment., this Nucleotide can independently exist, and also can mix or form recombinant nucleic acid molecules mutually with the gene of the cytokine of the commonly used enhancing immunity in code book field or albumen, other tumour vaccine commonly used or carrier commonly used.Cytokine wherein is interleukin II (IL-2), interleukin 12 (IL-12), G CFS (GM-CSF), CCL2, CCL5, CCL7, CCL19, CCL21, CCL20, CXCL9, CXCL10, CXCL12, CXCL15, XCL1, FTL3L, CD40L etc., albumen wherein is heat shock protein(HSP) etc., the vaccine commonly used of tumour wherein mainly refers to cancer suppressor gene, the tumor associated antigen of oncogene, sudden change, carrier wherein is a keyhole relative hemocyanin, serum albumin, the bacteriotoxin of deactivation etc.The cancer suppressor gene of oncogene wherein such as CEA etc., sudden change such as p53 etc., tumor associated antigen such as melanic related antigen etc., serum albumin wherein can be bovine serum albumin or human serum albumin etc., and bacteriotoxin is tetanus, diphtheria toxin or tuberculin etc.

The known various methods that cell comes expressing gene product albumen matter that DNA is shifted or is delivered in this area are for example described in " transgenosis in the body in the mammalian somatic cell " (70).Gene therapy comprises that dna sequence dna is mixed somatocyte or sexual cell to be used for exsomatizing or interior therapeutic.

The gene transfer method of gene therapy is divided into three major types: (electroporation for example, direct gene shifts and particle bombardment) of (1) physics, (for example based on lipid carrier and other non-virus carrier) of (2) chemistry and (for example virus vector) of (3) biology.For example, the non-virus carrier as the liposome that is coated with DNA can be gone in patient's body in intravenous injection.The gene of carrier or " exposing " DNA also can directly inject organ, tissue or the tumour of expectation and come target to shift therapeutic DNA.

The method of basic metastatic gene comprises that ex vivo gene transfer, vivo gene transfer and outer-gene shift.In the time of in patient's body DNA is imported in patient's the cell.

Therefore, the invention further relates to the plasmid or the virus vector that contain polynucleotide of the present invention, and the cell that contains polynucleotide of the present invention or carrier.

Therefore, the present invention relates to polynucleotide, carrier or cell as the polypeptide of the present invention of gene therapy medicament.

Correspondingly, the present invention relates to a kind of pharmaceutical composition for the treatment of cancer, its contain fusion rotein, carrier or the cell of the polypeptide of Nucleotide of the present invention, nucleotide coding and polypeptide and other molecular recombination and in case of necessity medicine can accept, the vehicle that is suitable for of gene therapy particularly.

At last, the present invention relates to treat method for cancer, comprise needing the defined polypeptide of the present invention of the effective quantity of the patient treatment of this treatment, polypeptide amalgamation protein, Nucleotide, carrier or cell.

Following examples are used to illustrate the present invention, and to the scope of the invention without any limited significance.

Description of drawings

Fig. 1 Herceptin analyzes in conjunction with the Western blot of gst fusion protein or GST.

Fig. 2 albumen or little peptide are to the restraining effect of Herceptin in conjunction with HER-2.

Fig. 3 HER-2 or little peptide H98 inhibition Herceptin combine with GST-H98's.

The little peptide of Fig. 4 suppresses the influence of cell proliferation to Herceptin.

The humoral immune reaction of Fig. 5 mouse after GST-H98 or GST immunity.

Fig. 6 immunoprecipitation-Western blot detects the HER-2 antibody in the immune serum.

N. normal mouse serum dilution in 1: 100; 1-5. different mice serums dilution in 1: 100 through the GST-H98 immunity; 6. through the dilution in 1: 100 of GST mice immunized serum.As seen from the figure No. 2 GST-H98 immune mouse serums can with the HER-2 albumen test of sex change.

Fig. 7 T cell proliferation experiment.

Fig. 8 uses the structural analysis of Insight II (2000), wherein,

A.Herceptin and HER-2 bonded three-dimensional structure.B.Herceptin and little peptide H98 bonded three-dimensional structure.

Fig. 9 recombinant plasmid pGEX-4T1-X enzyme is cut evaluation figure.M.marker; 1 is that pGEX-4T1-H98 is through the EcoRV/HindIII double digestion; 2-10 is respectively pGEX-4T1-N10, N8, and N6, C10, C8, C6, M8, M6, MutN1 is through the EcoRV single endonuclease digestion; 11 is that pGEX-4T1 is through the EcoRV/HindIII double digestion.The little peptide carrier of the pGEX-4T1-X that recombinates as seen from the figure all can discharge the fragment of 1700bp after enzyme is cut, and pGEX-4T1 initial carrier enzyme does not have fragment to discharge after cutting.

The SDS-PAGE that Figure 10 fusion rotein GST-X expresses in e. coli bl21 analyzes.M, marker; The odd number swimming lane is behind the transfection plasmid without the inductive bacterial protein among the figure, and the even number swimming lane is through IPTG inductive bacterial protein.A pair of in twos successively, 1 and 2 (GST), 3 and 4 (GST-H98), 5 and 6 (GST-N10), 7 and 8 (GST-N8), 9 and 10 (GST-N6), 11 and 12 (GST-C10), 13 and 14 (GST-C8), 15 and 16 (GST-C6), 17 and 18 (GST-M8), 19 and 20 (GST-M6), 21 and 22 (GST-MutN1).By among the figure as can be known, target protein all has higher level to express.

Figure 11 SDS-PAGE analyzes the fusion rotein GST-X of purifying, wherein, and M, marker; 1, GST; 2, GST-H98; 3, GST-N10; 4, GST-N8; 5, GST-N6; 6, GST-C10; 7, GST-C8; 8, GST-C6; 9, GST-M8; 10, GST-M6; 11, GST-MutN1.

Figure 12 ELISA detection Herceptin combines with GST-X's.Wherein, 1, GST; 2, GST-H98; 3, GST-N10; 4, GST-N8; 5, GST-N6; 6, GST-C10; 7, GST-C8; 8, GST-C6; 9, GST-M8; 10, GST-M6; 11, GST-MutN3-4; 12, GST-MutC1-2; 13, GST-MutN1-2; 14, GST-MutN1; 15, GST-CyclicH98.

Figure 13 Western blot detection Herceptin combines with GST-X's.Wherein, 1, GST; 2, GST-H98; 3, GST-N10; 4, GST-N8; 5, GST-N6; 6, GST-C10; 7, GST-C8; 8, GST-C6; 9, GST-M8; 10, GST-M6; 11, GST-MutN3-4; 12, GST-MutC1-2; 13, GST-MutN1-2; 14, GST-MutN1; 15, GST-CyclicH98.

Following examples are only for illustrating the present invention better, and unrestricted the present invention.

Embodiment

One, experiment material

(1) expression vector, bacterial strain and molecular cloning reagent

Glutathione sulfydryl transferase prokaryotic expression carrier pGEX-4T1, coli strain BL21 preserve by biochemical chamber, Beijing Inst of Tumor Prevention and Treatment.The various restriction enzymes that molecular cloning is used, T4DNA ligase enzyme are New England Biolabs company product.

(2) antibody, laboratory animal and associated materials

HRP-goat anti-human igg antibody (1: 2500) purchases Yu Zhongshan company.Horseradish peroxidase-labeled mouse anti M13 phage monoclonal antibody (1: 5000) is an Amersham Biosciences company product.

Animal for research: Kunming mouse is raised by animal housing of School of Clinical Oncology, Peking University available from Chinese Academy of Medical Sciences's Experimental Animal Center.

(3) phage display at random 12 peptide storehouses and the operation reagent

1. phage display 12 peptide storehouses at random

Phage display 12 peptides small peptide storehouse test kit at random are New England Biolabs company product, comprise 12-mer phage display library 100 μ l (1.5 * 10 ¹³Pfu/ml), be kept at 50% glycerine-TBS, diversity is 2.7 * 10 ⁹M13 phage host ER2738 is the positive intestinal bacteria of F-factor, available from New England Biolabs company.

-28gIII sequencing primer: 5 ' gtatgggatttgctaaacaac 3 '

-96gIII sequencing primer: 5 ' ccctcatagttagcggaacg 3 '

2. phage is operated reagent

(1) (1) (1) LB liquid nutrient medium: bacto-tryptone 10g, yeast extract 5g, NaCl 5g, room temperature preservation behind the autoclaving.

(2) (2) (2) tsiklomitsin: be made into the storage liquid of 20mg/ml with dehydrated alcohol, after the packing ,-20 ℃ of storages.

(3) LB (Tet ⁺) the solid culture flat board: whenever go up and state adding 15g agar in the LB substratum, autoclaving, (below the C, add 1ml tsiklomitsin liquid storage (20mg/ml), 4 ℃ keep in Dark Place to treat temperature to reduce to 70.

(4) add 1.25g IPTG and 1g Xgal in the IPTG/Xgal:25ml dimethyl formamide ,-20 ℃ keep in Dark Place.

(5) LB (Tet ⁺)/IPTG/Xgal flat board: 30ulIPTG/Xgal is added in the 300ul LB nutrient solution, add to LB (Tet behind the mixing ⁺) the solid culture flat board, smoothen with glass stick, dry up back 4 ℃ and keep in Dark Place.

(6) top-agar (Agarose Top): 1000ml bacto-tryptone 10g, yeast extract 5g, NaCl 5g, MgCl ₂(6H ₂O1g, agarose 7g.

(7) TBS solution: 50mmol/L Tris-HCl pH 7.5,150mmol/L NaCl.Behind the autoclaving, be stored in 4 (C.

(8)PEG/NaCl：20％(w/v)PEG8000，2.5mol/L?NaCl。Be stored in room temperature behind the autoclaving.

(9)NaI?Buffer：10mmol/L?Tris-HCl?pH?8.0，1mmol/L?EDTA，4mol/L?NaI。

(4) escherichia coli expression protein purification reagent

1. bacterial lysate: contain 1mmol/L PMSF, the PBS solution of 1mg/mL Lysozyme.

2.Glutathione-Sepharose 4B affinity chromatography elution buffer:

15mmol/L GSH (reduced glutathione), 50mmol/L Tris-HCl (pH 8.0), 120mmol/L NaCl.

Two. embodiment:

Embodiment 1

(1) Herceptin is to the screening in phage display 12 peptide storehouses

1.ER2738 the preservation of bacterial strain and recovery

ER2738 bacterium liquid is preserved and is added 50% glycerine, is stored in-70 ℃ of refrigerators.Bacterial classification inoculation is in LB (Tet during recovery ⁺) agar plate, after cultivating 10h, 37 ℃ of incubators are stored in 4 ℃ of refrigerators.Shelf time should not surpass for 3 weeks.

2.12-mer the mensuration of phage display small peptide storehouse titre and recombination fraction

The single bacterium colony of ER2738 of the new recovery of picking is inoculated in 2ml LB (Tet ⁺), be expanded to the standby (OD of mid-log phase ₆₀₀=0.5-0.6).Original storehouse, small peptide storehouse is done 10 respectively ^-8, 10 ^-9, 10 ^-10, 10 ^-11Dilution.Each extent of dilution adds above-mentioned bacterium liquid 200 μ l.Room temperature leaves standstill 5min, adds the pre-temperature of 3ml to 45 ℃ Agarose Top, and mixing rapidly is poured over pre-temperature to 37 ℃ and scribbles the LB (Tet of 30 μ l IPTG/X-gal ⁺) on the flat board.Rock plate and make Agarose Top coating evenly.Behind 37 ℃ of about 10h of cultivation, count blue plaque, calculate original storehouse titre and external source fragment recombination fraction.

Titration results shows that phage titre is about 1.5 * 10 ¹³Pfu/ml.It is blue that all phages all are, external source fragment recombination fraction 100%.

3. the Bio-panning in phage display small peptide storehouse

The single bacterium colony of picking ER2537 increases respectively in 2ml and 20ml LB (Tet ⁺) be used for the titration and the amplification of eluate in the substratum.

Get normal human serum IgG 100 μ g, Herceptin 50 μ g shake 3h for 4 ℃ with ProteinA-Sepharose 4B pearl respectively, and TBST (0.1%Tween-20) washes 3 times.Original storehouse phage (1.5 * 10 ¹¹Pfu) carry out non-specific adsorption in the mixture of normal human IgG of adding and Protein A-Sepharose 4B pearl.4 ℃ are shaken 2h, carry out specific adsorption in the mixture of centrifuging and taking supernatant adding Herceptin and Protein A-Sepharose 4B pearl.4 ℃ are shaken 1h, centrifugal, reaction mixture is washed 5 times with TBST (0.1%Tween), reaction mixture (about 1 μ l) takes a morsel, adding 200 μ l is expanded in the ER2537 bacterium liquid of mid-log phase, room temperature is placed 5min, adds the Agarose Top of the pre-temperature of 3ml, and rapid mixing also is poured over LB (Tet with this mixture ⁺On the)/IPTG/Xgal flat board, rock plate Agarose Top is evenly distributed.Hatch 10h for 37 ℃, the counting plaque also calculates first round Output titre.

All the other eluates add the early stage (OD of 20ml logarithm ₆₀₀In=0.3-0.4) the ER2738 bacterium liquid, 37 ℃, the 225rpm 4.5h that increases.The centrifugation bacterium is got the PEG/NaCl precipitation that 80% supernatant adds 1/6 volume spend the night (or 4 ℃ precipitation 1h more than).10,000rpm, 4 ℃ of centrifugal 15min.Abandon supernatant, the of short duration once more centrifugal remaining supernatant that discards.With 1mlTBS suspension precipitation, the PEG/NaCl that adds 1/6 volume precipitates 15-60min once more on ice.4 ℃ of centrifugal 10min abandon supernatant, the of short duration once more centrifugal remaining supernatant that discards.With 200 μ l TBS suspension precipitation.Centrifugal 1min precipitates remaining insolubles.Supernatant moves in another aseptic centrifuge tube, is amplification back eluate, is used for next round Bio-Panning.First round amplification titre is measured in the supernatant that takes a morsel dilution back, promptly second takes turns the Input titre.

Repeat Bio-Panning process 3 times.Taken turns by second, progressively shortened phage library and bring up to 0.5% by the time of receptors bind and with the concentration of Tween-20 in the washing lotion with bag.

After taking turns Bio-Panning through 3, the small peptide storehouse has obtained progressively enrichment (table 1), but enrichment phenomenon and not obvious.

The enrichment in 12 peptide storehouses in the process of table 1Herceptin sieve storehouse

4. the preparation of high titre mono-clonal phage

Last takes turns the Bio-Panning eluate titration, selects plaque to be less than 100 culture dish, selects and separates good mono-clonal plaque.During the picking plaque, insert in the LB flat board,, blow in the early stage ER2537 bacterium liquid of 1ml logarithmic growth complete plaque sucking-off with haircut plastics rifle head, 37 ℃, the 225rpm 4.5h that increases.Centrifugation bacterium, supernatant are high titre mono-clonal phage solution, 4 ℃ of preservations.

The screening and the evaluation of embodiment 2 positive phage clones

1.ELISA method preliminary screening positive colony

Respectively with 5 μ l/ml Heceptin and normal human IgG bag by 96 orifice plates, 4 ℃ are spent the night.Discard coating buffer, every hole adds 200 μ l confining liquids, and 4 ℃ are spent the night.Wash plate 4 times with TBST (0.1%Tween-20) after discarding confining liquid, every hole adds 40 μ l and contains bacterium supernatant (each clone establishes two parallel holes) after the amplification of phage.Room temperature is in conjunction with 1-2h, washes to add enzyme behind the plate 6 times and mark anti-M13 monoclonal antibody (1: 5000), and room temperature is washed plate 6 times in conjunction with 1h.Every hole adds 100 μ l OPD substrate solutions, color development at room temperature 10-30min, after the termination reaction in OD ₄₉₂Reading.

Phage clone behind 300 third round Bio-Panning amplification and ELISA evaluation have been carried out.Successively obtain 41 positive phage clones altogether, can be specifically in conjunction with Herceptin, and with normal human serum IgG debond, table 2 has been listed wherein 8 positive colonies.Positive rate is about 13.7%.

Table 2ELISA detection phage clone combines with Herceptin's

2. the order-checking of positive colony

Preparation positive phage clones sequencing template.With the 1ml phage supernatant of fresh amplification, 10, the centrifugal 15min of 000rpm gets 0.5ml phage supernatant and moves in another aseptic centrifuge tube, adds 200 μ l PEG/NaCl solution, puts upside down mixing, and room temperature is placed 10min, the precipitation phage.10, the centrifugal 10min of 000rpm abandons supernatant, and is of short duration once more centrifugal, carefully remaining supernatant all inhaled and abandoned.Precipitation thoroughly suspends with 100 μ l NaI Buffer, adds 250 μ l ethanol, and room temperature is placed 10min, and the single stranded DNA of this process pnagus medius will obtain preferential precipitation, and phage protein can be retained in the solution.The centrifugation phage DNA, 10,000rpm, 10min.Precipitation is washed once with 70% ethanol.Dry up postprecipitation and add 20 μ l TE Buffer suspension.Be the precipitation that fully suspends, can after adding TE, shake centrifugal 3-5 time repeatedly.Get 10 μ l template samples and serve Hai Shenyou company and carry out dna sequencing, all the other are kept at-20 ℃.Order-checking use-96gIII sequencing primer.

In 41 positive colonies, to the evaluation of checking order of 26 phage clones wherein.Wherein 25 cloned sequences are in full accord, have only a cloned sequence different with other.Clone's called after H98 with 25 sequence unanimities.

Wherein, H98 is: LLGPYELWELSH

The prokaryotic expression and the purifying of embodiment 3GST-H98 fusion rotein

1.GST-H98 the structure of fusion protein expression vector pGEX-4T1-H98

1.1 the annealing reaction of small peptide sequence

Design little peptide H98 justice and antisense single stranded DNA fragment according to the sequencing result that screens from phage 12 peptide storehouses with the positive little peptide H98 of Herceptin bonded, and introduce BamHI and the SalI sticky end sequence that is used to clone in the primer two ends respectively, and introduce the enzyme that terminator codon and hindIII restriction enzyme site be used for recombinant plasmid and cut evaluation (table 3) in that small peptide sequence is terminal.

Primer is dissolved in TE buffer respectively, and final concentration is 1 μ g/ml.Get 1ul justice and antisense primer and add 18 μ l H ₂Among the O, mixing.75 ℃ of water-bath 5min make the DNA sex change, slowly reduce to room temperature and make the DNA renaturation.

1.2 the enzyme of carrier pGEX-4T1 is cut and with segmental connection of H98 small peptide D NA

Restriction endonuclease BamHI/SalI digested vector pGEX-4T1, reclaiming the enzyme section through QIAGEN gel DNA purification kit breaks, the 30ng H98 segment of annealing is connected with carrier pGEX-4T1 and transforms BL21 calcium chloride competence bacterium, and last little upgrading grain is also cut with the HindIII/EcoRV enzyme and to be identified recombinant plasmid pGEX-4T1-H98.

Result: owing to introduced the HindIII restriction enzyme site in the H98 oligonucleotide segment, the pGEX-4T1 carrier does not have the HindIII restriction enzyme site, but have the EcoRV restriction enzyme site, so recombinant plasmid pGEX-4T1-H98 can discharge the fragment of 1700bp size through the HIndIII/EcoRV double digestion; And not having empty carrier pGEX-4T1 that cloned sequence inserts through the HindIII/EcoRV double digestion, plasmid is cut open but does not have the release fragment, result conform to prediction (Fig. 9).

2. the short run recombinant protein inducing and expressing

(1) aseptic suction nozzle picking one mono-clonal from the conversion dish is inoculated in 2ml LB (Amp ⁺) in the nutrient solution, 37 ℃ of concussions of 225rpm overnight incubation;

(2) get above-mentioned bacterium liquid 300 μ l next day and be diluted to 3ml (1: 10 or 1: 5) LB (Amp ⁺) continue to cultivate 2h, to OD ₆₀₀About=1, sucking-off 1.5ml does not inductive negative control, and it is 0.5mmol/L or 1mmol/L to final concentration that other 1.5ml adds IPTG, and 3h is cultivated in continuation;

(3) centrifugal 30 seconds of desk centrifuge (12,000-15 000rpm), abandons supernatant, and precipitation adds PBS 50 μ l and the last sample buffer 50 μ l of 2 * SDS-PAGE, mixing, boiling water boils 3-5min;

(4) the capable 12%SDS-PAGE electrophoresis of above-mentioned sample 10 μ l, 100V, 2-3h;

(5) glue is taken off in the Coomassie brilliant blue dye liquor dye 45min-1h, destainer decolouring 30min observes the Recombinant Protein Expression situation.

3. the great expression of recombinant protein

(1) aseptic absorption is expressed the positive bacteria of identifying a little (10-20 μ l) with sample, is added to 100ml LB (Amp ⁺) nutrient solution, 37 ℃ of jolting overnight incubation;

(2) with LB (Amp ⁺) 1: 10 above-mentioned nutrient solution of dilution, continue to cultivate 2-3h, to OD ₆₀₀About=1;

(3) adding IPTG is 0.5mmol/L to final concentration, and 30 ℃ are continued to cultivate 5-6h;

(4) 5,000rpm, 4 ℃ are centrifugal 10 minutes;

(5) after precipitation was washed with PBS, packing was deposited standby for-20 ℃.

4.Glutathione-Sephorose 4B gel-purified fusion rotein GST-H98

(1) a large amount of abduction delivering bacterial sediments add bacterial lysate 20ml (10ml bacterial lysate/100ml bacterium liquid), leave standstill 30min on ice;

(2) adding Triton-X 100 is 1% to concentration, ice bath 10-30min;

(3) ultrasonic degradation intermittently on ice, 18KHz, ultrasonic 15s stops 15s, 6 times repeatedly, becomes limpid to liquid.

(4) 4 ℃, 12, the centrifugal 20min of 000rpm collects supernatant;

(5) get 200 μ l Glutathione-Sepharose 4B gels and wash 3 times, add ultrasonic back supernatant, 4 ℃ of jog 2h with PBS;

(6) 4 ℃, 5, the centrifugal 5min of 000rpm, precipitation is washed 3 times with PBS;

(7) add 200 (1 elution buffer, 4 ℃ of jog 20min;

(8) 4 ℃, 12, the centrifugal 20s of 000rpm repeats wash-out 2-3 time, and the supernatant of collection is the fusion rotein of purifying;

(9) go the 12%SDS-PAGE protein electrophoresis, quantitatively-20 ℃ of preservations in back.

The result:

Recombinant plasmid pGEX-4T1-H98 transformed into escherichia coli BL21, at 30 ℃, 0.5mmol/L IPTG induces expressed fusion protein GST-H98 under the condition of 5-6h, and molecular weight is about about 26KD, conforms to prediction; The e. coli bl21 that has transformed empty plasmid pGEX-4T1 is expressed the GST albumen (Figure 10) of 26KD.Because the concentration of inducing temperature and inductor is all lower, fusion rotein is a solubility expression, ultrasonic after all in supernatant, do not form inclusion body.The GST-H98 fusion rotein obtains the GST-H98 soluble proteins (Figure 11) of purity＞95% through Glutathione-Sepharose 4B gel-purified.

The biologic activity of embodiment 4:GST-H98 fusion rotein is identified

1.ELISA it is active with combining of GST-H98 to detect Herceptin

Wrap by 96 orifice plates with 5 μ g/ml GST-H98, GST respectively, 4 ℃ are spent the night.Discard coating buffer, every hole adds 200, and (1 confining liquid, 4 ℃ are spent the night.Wash plate 4 times with PBST (0.05%Tween) after discarding confining liquid, every hole adds the Herceptin50 μ l (each concentration is established two parallel holes) of 0,0.1,0.5,1,5 μ g/ml concentration, room temperature is in conjunction with 1-2h, add HRP-goat anti-human igg two anti-(1: 2500) after washing plate 6 times, room temperature is washed plate 6 times in conjunction with 1h.Every hole add 100 (the 1OPD substrate solution, color development at room temperature 10-30min, after the termination reaction in OD ₄₉₂Reading.

Herceptin can combine with GST-H98, increase bonding force with Herceptin concentration and strengthen gradually, and Herceptin does not combine (Figure 12) with GST.Prompting Herceptin can combine with the GST-H98 specificity.

2.Western it is active with combining of GST-H98 that blot detects Herceptin

GST albumen, GST-H98, GST-HER-2, each 2 μ g of DHFR-H98 fusion rotein add 2 (SDS-PAGE gel sample-loading buffer mixings, boil 3-5min, make protein denaturation, row 12%SDS-PAGE protein electrophoresis, it is one anti-changeing behind the film with antibody Herceptin, the goat anti-human igg of horseradish peroxidase-labeled (1: 2500) is two anti-, carries out the situation that combines that Western blot detects albumen and Herceptin.

The result shows that Herceptin and GST-H98 and DHFR-H98 are approximately the 26KD place at molecular weight one specific reaction band is arranged, and being approximately the 44KD place with positive control GST-HER-2 at molecular weight has a specific reaction band, and does not have respective reaction with GST.Anti-GST monoclonal antibody and GST albumen, GST-H98, GST-HER-2 all have the specificity association reaction; And normal human serum IgG is with above-mentioned four kinds of albumen all reactionless (Fig. 1).

3. competition suppresses experiment

Use the ELISA method, detect whether combining of Herceptin capable of blocking and HER-2 of little peptide H98, in other words, whether the binding site of Herceptin and GST-H98 can be occupied by HER-2.

Use 5 μ g/ml NIH3T3-erbB2 epicyte proteins (molten film damping fluid is 1%TritonX-100,1mM EDTA, 1mM PMSF, 1 μ g/ml aprotinin) respectively, or 5 μ g/mlGST-H98 bag is by 96 orifice plates, 4 ℃ are spent the night.Discard coating buffer, every hole adds 200 μ l confining liquids, and 4 ℃ are spent the night.H98, F56, GST, GST-H98 and the NIH3T3-erbB2 epicyte protein of 0,0.5,5,10,50 μ g/ml concentration are mixed with the Herceptin 50 μ l of 0.5 μ g/ml respectively, add 96 orifice plates (each reaction density is established two parallel holes) after sealing behind the room temperature preincubate 1h, room temperature is in conjunction with 1-2h, add HRP-goat anti-human igg (1: 2500) after washing plate 5 times, room temperature is washed plate 5 times in conjunction with 1h.Every hole adds 100 μ l OPD substrate solutions, color development at room temperature 10-30min, after the termination reaction in OD ₄₉₂Reading.Calculate the inhibition percentage according to formula: (OD _Herceptin-OD _{Herceptin with Protein})/OD _Herceptin* 100%.

ELISA results suggest GST-H98 and little peptide H98 Herceptin all capable of blocking combine with HER-2's, and increase with the concentration of GST-H98, H98, and this blocking effect is strengthened gradually.Yet GST and little peptide F56 are to the not influence (Fig. 2) of interaction of Herceptin and HER-2.

In addition, results suggest HER-2 and little peptide H98 Herceptin all capable of blocking combine with GST-H98's, and increase with HER-2 concentration, and this blocking effect is strengthened (Fig. 3) gradually.The above results proves that further H98 and HER-2 have similar epi-position.

4. little peptide H98 suppresses the influence of growth of tumour cell effect to Herceptin

Detect the little peptide of H98 suppresses the growth of tumour cell effect to Herceptin influence with the MTT colorimetry.SKBR3 cell 1 * 10 ⁴96 orifice plates are spread in/hole, cultivate 24h and make cell attachment, add the mixed solution of 1 μ g/ml Herceptin and 0,3,30,60,120 little peptides of μ g/ml H98 or the little peptide of F56 respectively, and negative control hole adds 1 μ g/ml normal mouse IgG.Add 10mg/ml MTT 5 μ g/ holes after continuing to cultivate 72h, inhale gently behind the cultivation 4h and remove supernatant, add dimethyl sulfoxide (DMSO) 150 μ l/ holes, shake up, in wavelength 492nm place's photometry density OD ₄₉₂, get the mean value of two parallel holes, and calculate inhibitory rate of cell growth.Cell inhibitory rate (%)=(OD _{The normal people IgG}-OD _{Herceptin+H98/F56})/OD _{Normal human IgG}* 100%.

Experimental results show that when Herceptin concentration is 1 μ g/ml the SKBR3 cell is had the growth-inhibiting effect, the restraining effect of little peptide H98 Herceptin cell growth capable of blocking, this effect is strengthened with the increase gradually of H98 concentration, when little peptide H98 concentration was 60 μ g/ml, Herceptin had reduced by 12.5% to the inhibited proliferation of SKBR3 cell.The nothing of same concentrations turns down the cell inhibitory effect effect not influence (Fig. 4) of peptide F56 to Herceptin.

Embodiment 5: experimentation on animals

5.1 animal immune

Buy the 6-8 female Kunming mouse in age in week from Chinese Academy of Medical Sciences animal center, initial immunity with 40ug purifying antigen GST-H98, GST and the abundant mixing of the complete freund adjuvant of equal-volume (CFA) to getting droplet indiffusion in water, subcutaneous multiple spot immune mouse.Every carrying out booster immunization 3 weeks 1 time, equivalent purifying antigen and not exclusively freund adjuvant (IFA) equal-volume mixing emulsification, same subcutaneous multiple spot immune mouse.Immunity is 5 times altogether.Before the immunity, and the 3rd time, got mouse tail vein blood in 7-10 days after the 5th immunity and detect antibody titer with the ELISA method.

5.2ELISA the antibody activity in the detection immune serum

The ELISA method detects anti-H98 and the anti-HER-2 immune response in the immune serum.Make up the pQE40-H98 expression vector, and expression and purification DHFR-H98 fusion rotein, be used for detecting the humoral immune reaction of the little peptide of the anti-H98 of immune serum.By 96 orifice plates, the sealing back adds the immune serum of dilution in 1: 1000 with 5 μ g/ml DHFR-H98 bag, carries out conventional ELISA detection with HRP enzyme mark sheep anti-mouse igg, and with the DHFR plate as negative control.

NIH3T3-erbB2 cell 1 * 10 ⁴96 orifice plates are spread in/hole, cultivate 24h and make cell attachment, with 0.25% glutaraldehyde fixed cell, the sealing back adds the immune serum of dilution in 1: 100, carry out conventional ELISA with HRP enzyme mark sheep anti-mouse igg, detect the proteic humoral immune reaction of anti-HER-2 in the immune serum, and with the negative contrast of NIH3T3 cell plate.

The result: 5 mouse have all produced the immune response of little peptide of anti-H98 (Fig. 5 A) and anti-HER-2 albumen (Fig. 5 B) after the 5th immunity.A little less than wherein a mouse anti HER-2 reacted, this individual difference with mouse was relevant.The immune response of the little peptide of wherein anti-H98 just can detect the 3rd immunity back, i.e. the 3rd the anti-H98 reaction of immunity back GST-H98 immune mouse serum has significant difference (P＜0.05) with the anti-H98 reacting phase ratio of GST immune mouse serum.And just can in mice serum, detect anti-HER-2 reaction after the 5th immunity, i.e. the anti-HER-2 reaction of GST-H98 immune mouse serum has significant difference (P＜0.05) with the anti-HER-2 reacting phase ratio of GST immune mouse serum after the 5th immunity.Do not detect the immune response of little peptide of anti-H98 and anti-HER-2 in the proteic mice serum of simple immune GST.

5.3 immunoprecipitation-Western blot detects the antibody activity in the immune serum

50 μ g Herceptin and 50 μ l Protein A-Sepharose 4B pearls shake 3h for 4 ℃, and reaction mixture is washed 3 times with PBST (0.05%Tween), again with 1.5 * 10 ⁷The epicyte protein that extracts in the NIH3T3-erbB2 cell (cell pyrolysis liquid: 1%TritonX-100,1mM EDTA, 1mM PMSF, 1 μ g/ml aprotinin) 4 ℃ of effect 4h, sediment composite is washed 3 times with PBST (0.05%Tween), and row 8%SDS-PAGE electrophoresis after the sex change changes behind the NC film different immune serums with dilution in 1: 100 and be one anti-, the HRP-sheep anti-mouse igg is the two anti-Western blot that carry out, and detects the humoral immune reaction whether anti-HER-2 is arranged in the immune serum.The negative contrast of normal mouse serum IgG.

The result: as seen wherein an immune serum is approximately the 185KD place at molecular weight one specific reaction band is arranged, similar to people HER-2 gene expression product size, and be one anti-with GST immune serum and normal mouse IgG, do not see at 185KD place and react band (Fig. 6).Illustrate in 5 mouse the wherein anti-HER-2 immune response of a generation can with the HER-2 reaction of sex change.

5.4H98 little peptide is to the effect of T cell proliferation

Little peptide H98 is with 0,1, and 10,100 μ g/ml concentration are dissolved in aseptic PBS, and bag is by 96 orifice plates, and 37 ℃ of bags are by 2h.Abandon coating buffer, wash plate 2 times with aseptic PBS.Getting 2 does not at random have the mouse that turns down peptide immunity 4 times through GST-H98 and GST-respectively, and the 7th day aseptic extracting spleen cell after the last immunity is with 2 * 10 ⁵/ porocyte concentration is seeded to wraps by in 96 orifice plates of the little peptide of H98, and 37 ℃ are continued to add 10mg/ml MTT 5 μ l/ holes behind the cultivation 72h, inhale gently behind the cultivation 4h and remove supernatant, add dimethyl sulfoxide (DMSO) 150 μ l/ holes, shake up, in wavelength 492nm place's photometry density OD ⁴⁹², get the mean value of two parallel holes, and calculate cell proliferation rate.Cell proliferation rate (%)=(OD _H98-OD _{The hole of being untreated})/OD _{The hole of being untreated}* 100%

The little peptide H98 of results suggest can stimulate GST-H98 immunized mice T cell proliferation, but this propagation hormesis is more weak, have only when little peptide concentration reaches 100 μ g/ml, with GST-do not have the peptide of turning down immunized mice T cell proliferation mutually Bizet have significant difference (P＜0.05).Tangible T cell proliferative response (Fig. 7) does not appear and GST-has the peptide of turning down immunized mice.

The three-dimensional arrangement analysis of embodiment 6 little peptide H98

According to Herceptin that obtains in bibliographical information [56] and the PDB database and the interactional three-dimensional structure of HER-2, utilized Homology module construction in the Insight II software package little peptide of H98 and the interactional model configuration figure of Herceptin.

The interactional three-dimensional structure 1N8Z of Herceptin that obtains in bibliographical information [56] and the PDB database and HER-2 prompting, the last several sections discontinuous peptides of HER-2 can with Herceptin light (A), heavy (B) chain interacts.Herceptin A, the surface of the reactive site of B chain represents that with solution accessibility surface HER-2 partly adopts secondary structure to represent, the residue that wherein has active function adopts ball-and-stick model to represent (Fig. 8 A).As seen from the figure: (1) HER-2 albumen HER-2 ₅₅₇P-HER-2 ₅₆₁HER-2 among the Q ₅₆₀D and A, the A94T of B chain, B50R has interaction of hydrogen bond.A, and the reactive site of B chain (B33Y, B50R, B59R, B52Y, B54T, B55N B57Y) forms an active pocket, HER-2 ₅₅₈E directly stretches in the active pocket, and with B50R, B59R forms interaction of hydrogen bond.(2) A, the reactive site of B chain (B102-103G, B 105Y, A92Y, A93T, A94T) active pocket of Xing Chenging and HER-2 ₅₇₀D-HER-2 ₅₇₃The ring texture that F (DPPF) sequence forms interacts, HER-2 in the ring texture ₅₇₃The F phenyl ring directly inserts in the active pocket, and with B33Y, the phenyl ring of B105Y side chain forms ((conjugate phases mutual effect.(3) HER-2 ₆₀₂Q and A ₃₀N forms interaction of hydrogen bond (concrete interaction of hydrogen bond sees Table 4).(4) on sequence of operation, from the HER-2 of HER-2 ₅₆₀D-HER-2 ₅₆₇H is one section coiled structure, HER-2 ₅₆₈Y-HER-2 ₅₇₀D is the βZhe Die lamella, and end is HER-2 ₅₇₀D is the revolution ring texture that the DPPF sequence forms afterwards, and the trend of this ring makes HER-2 ₅₇₃F and HER-2 ₅₆₀D is close mutually, from three-dimensional structure HER-2 ₅₆₀D, HER-2 ₅₇₃F, HER-2 ₅₇₂P is close mutually, forms a reactive site.

The structure of the little peptide of H98 of having utilized Homology module construction in the InsightII software package.Utilize the Docking module that the little peptide of H98 is affacted in the reactive site of Herceptin, obtain shown in Fig. 8 B in conjunction with conformation.Wherein the structure of the little peptide of H98 is represented with line style ribbon figure, and the NH3-end is LEU, and the COOH-end has interactional residue H98 for HIS with Herceptin ₅Y, H98 ₆E, H98 ₉E represents with mallet figure.The Herceptin part, blue colo(u)r streak bar is represented the A chain, the purple lines are represented the B chain.According to according to the literature, the reactive site of Herceptin be by the formed four sections loop of two chains of the A of Herceptin, B (A90-A96, B96-B109, B25-B35, B50-B60) structure constitutes.B33Y in the reactive site of Herceptin, B105Y, B50R, A94T, residues such as A30N have important effect, and these residues and acceptor HER-2 form stronger electrostatic interaction, hydrogen bond action, [56] such as (-(conjugate phases mutual effects, by mimic H98 and the interactional situation of the reactive site of Herceptin also as can be seen these residues in the reactive site of H98 and Herceptin have similar effect situation.The H98 of H98 wherein ₆E, H98 ₅Y, H98 ₄These three residues of P affact Herceptin A, form in the active pocket of B chain to be similar to HER-2 described above " DPPF " and Herceptin A, the three-dimensional action mode (H98 of B chain ₆The corresponding HER-2 of E ₅₆₀D, H98 ₅The corresponding HER-2 of Y ₅₇₃F, H98 ₄The corresponding HER-2 of P ₅₇₂P), H98 wherein ₆The replaceable HER-2 of E ₅₆₀D, H98 ₆The side chain of E compares HER-2 ₅₆₀The long methyl of D, can with Herceptin A, A94T in the B chain, B50R forms interaction of hydrogen bond; H98 ₅The replaceable HER-2 of Y ₅₇₃F, H98 ₅The phenyl ring of Y directly inserts in the active pocket, and with B33Y, the phenyl ring of B105Y forms ((conjugate phases mutual effect.H98 ₉E may act on A, in the active pocket of B chain formation, forms similar HER-2 ₅₅₈E and B50R, the interaction of hydrogen bond (table 5) between the B59R.If in addition with H98 ₁L sports Q, promptly corresponding HER-2 ₆₀₂Q can make H98 ₁Q and A30N form stronger interaction of hydrogen bond.May strengthen the avidity of little peptide H98 and Herceptin by this sudden change.

Interaction of hydrogen bond between table 4HER-2 and the Herceptin

Table?4?H?bonds?between?HER-2and?Herceptin

Interaction of hydrogen bond between table 5H98 and the Herceptin

Table5?H?bonds?between?H98?and?Herceptin

The activation analysis of the little peptide truncate of embodiment 7H98

1.H98 the partitioned representation of little peptide

1.1GST-X the structure of fusion protein expression vector pGEX-4T1-X

Design little peptide X justice and antisense single stranded DNA fragment according to the sequencing result that screens from phage 12 peptide storehouses with the positive little peptide H98 of Herceptin bonded, and introduce BamHI and the SalI sticky end sequence that is used to clone in the primer two ends respectively, and introduce the enzyme that terminator codon and EcoRV restriction enzyme site be used for recombinant plasmid and cut evaluation (table 3) in that small peptide sequence is terminal.X represents N10, N8, N6, C10, C8, C6, M8, M6, MutN3-4, MutC1-2, MutN3-4, MutN1, CyclicH98 respectively.

Primer is dissolved in TE buffer respectively, and final concentration is 1 μ g/ml.Justice and antisense primer annealing back are connected with the carrier pGEX-4T1 fragment that restriction endonuclease BamHI/SalI digests and transform BL21 calcium chloride competence bacterium, and last little upgrading grain is also cut evaluation recombinant plasmid pGEX-4T1-X with the EcoRV enzyme.

Result: according to dna sequence dna and the H98 three-dimensional structural analysis result of the little peptide H98 of the positive, justice and the antisense single stranded DNA fragment of the synthetic little peptide of brachymemma (following little peptide is all represented with X) N10, N8, N6, C10, C8, C6, M8, M6 etc., insert in the pGEX-4T1 carrier annealing back.Owing to introduced the EcoRV restriction enzyme site in the X oligonucleotide fragment, the EcoRV restriction enzyme site is also arranged among the carrier pGEX-4T1, so recombinant plasmid pGEX-4T1-X cut the fragment that can discharge the 1700bp size through the EcoRV enzyme; And the empty carrier pGEX-4T1 that does not have cloned sequence to insert cuts through the EcoRV enzyme, and plasmid is cut open but does not have the release fragment, result conform to prediction (Fig. 9).

1.2GST-X the abduction delivering of fusion rotein and purification process are with aforementioned

2.GST-X the activity identification that combines of fusion rotein and Herceptin

2.1ELISA it is active with combining of GST-X to detect Herceptin

Wrap by 96 orifice plates with 5 μ g/ml GST, GST-H98, GST-N10, GST-N8, GST-N6, GST-C10, GST-C8, GST-C6, GST-M8, GST-M6, GST-MutN3-4, GST-MutC1-2, GST-MutN1-2, GST-MutN1, GST-CyclicH98 respectively, 4 ℃ are spent the night.Discard coating buffer, every hole adds 200 μ l confining liquids, and 4 ℃ are spent the night.Wash plate 4 times with PBST (0.05%Tween) after discarding confining liquid, every hole adds the Herceptin 50 μ l (each concentration is established two parallel holes) of 0,0.1,0.5,1,2,5 μ g/ml concentration, room temperature is in conjunction with 1-2h, add HRP-goat anti-human igg (1: 2500) after washing plate 6 times, room temperature is washed plate 6 times in conjunction with 1h.Every hole adds 100 μ l OPD substrate solutions, color development at room temperature 10-30min, after the termination reaction in OD ₄₉₂Reading.

2.2Western it is active with combining of GST-X that blot detects Herceptin

GST, GST-H98, GST-N10, GST-N8, GST-N6, GST-C10, GST-C8, GST-C6, GST-M8, GST-M6, GST-MutN3-4, GST-MutC1-2, GST-MutN1-2, GST-MutN1, each 2 μ g of GST-CyclicH98 fusion rotein add 2 (SDS-PAGE gel sample-loading buffer mixings, boil 3-5min, make protein denaturation, row 12%SDS-PAGE protein electrophoresis, it is one anti-changeing behind the film with antibody Herceptin, the goat anti-human igg of horseradish peroxidase-labeled (1: 2500) is two anti-, carries out the situation that combines that Western blot detects fusion rotein and Herceptin.

ELISA and Western blot result show: Herceptin can combine with GST-H98 (original little peptide), GST-C10 (containing 10 amino acid whose little peptides of H98 carboxyl terminal), GST-MutN1-2 (the little peptides of the 1st, 2 sudden changes of aminoterminal), GST-MutN1 (the little peptide of aminoterminal the 1st amino acids sudden change) and GST-CyclicH98 (aminoterminal and carboxyl terminal are introduced the little peptide of a halfcystine respectively).The avidity of they and Herceptin by strong to a little less than be followed successively by: GST-MutN1＞GST-H98＞GST-MutN1-2＞GST-C10＞GST-CyclicH98.And Herceptin and the equal debond of the little peptide fusion protein of other multiple GST (Figure 12,13).2 amino acid of results suggest C-terminal and N-terminal the 3rd, 4 amino acids play a significant role in the combining of little peptide and Herceptin, and the result of this and software analysis is also not quite identical.In addition, by with H98 ₁L sports Q, has strengthened the avidity of little peptide of H98 and Herceptin, illustrates that software analysis has the certain guidance meaning to experimental design.

Full text is introduced the present invention owing to quote below with reference to document.

Reference

1.Coussens?L，Yang-Feng?TL，Liao?YC，Chen?E，et?al(1985)Tyrosine?kinase?receptor?with?extensive?homology?to?EGF?receptorshares?chromosomal?location?with?neu?oncogene.Science?230：1132

2.Tzahar?E，Pinkaskramarski?R，Moyer?JD，Kapper?LN，et?al(1997)Bivalence?of?EGF-like?ligands?drives?the?ErbB?signaling?network.EMBOJ?16：4938

3.Olayioye MA, Neve RM, swimming lane HA, Hynes NE (2000) TheErbB signaling network:receptor heterodimerization in development andcancer.EMBO J 19:3159

4.Klapper?LN，Kirschbaum?MH，Sela?M，Yarden?Y(2000)Biochemical?and?clinical?implications?of?the?ErbB/HER?signalingnetwork?of?growth?factor?receptors.Adv?Cancer?Res?77：25

5.Cirisano?FD，Karlan?BY(1996)The?role?of?the?HER-2/neuoncogene?in?gynecologic?cancers.J?Soc?Gynecol?Investig?3：99

6.Niehans?GA，Singleton?TP，Oykoski?D，Kiang?DT(1993)Stability?of?HER-2/neu?expression?over?time?and?at?multiple?metastaticsites.J?Natl?Cancer?Inst?85：1230

7.Shak?S(1999)Overview?of?the?trastuzumab(Herceptin)anti-HER2?monoclonal?antibody?clinical?program?inHER2-overexpressing?metastatic?breast?cancer.Herceptin?MultinationalInvestigator?Study?Group.Semin?Oncol?26：71

8.Schaller?G，Bangemann?N，Becker?C，Buhler?H，et?al(1999)Therapy?ofmetastatic?breast?cancer?with?humanized?antibodies?against?the?HER2receptor?protein.J?Cancer?Res?Clin?Oncol?125：520

9.Yip?YL，Smith?G，Koch?J，Dubel?S，et?al(2001)identification?ofepitope?regions?recognized?by?tumor?inhibitory?and?stimulatoryanti-erbb-2?monoclonal?antibodies：implications?for?vaccine?design.JImmunol?166：5271

10.Disis?ML，Calenoff?E，McLaughlin?G，Murphy?AE，et?al(1994)Existent?T-cell?and?antibody?immunity?to?HER-2Neu?protein?inpatients?with?breast?cancer.Cancer?Res?54：16

11.Pupa?SM.Menard?S，Andreola?S，Colnaghi?MI(1993)Antibodyresponse?against?the?c-erbB-2?oncoprotein?in?breast?carcinomapatients.Cancer?Res?53：5864

12.Disis?ML，Pupa?SM，Gralow?JR，Dittadi?R，et?al(1997)High-titerHER-2/neu?protein-specific?antibody?can?be?detected?in?patients?withearly-stage?breast?cancer.J?Clin?Oncol15：3363

13.Ward?RL，Hawkins?NJ，Coomber?D，Disis?ML(1999)Antibodyimmunity?to?the?HER-2/neu?oncogenic?protein?in?patients?withcolorectal?cancer.Hum?Immunol?60：510

14.Visco?V，Bei?R，Moriconi?E，Gianni?W，et?al(2000)ErbB2Immuneresponse?in?breast?cancer?patients?with?soluble?receptor?ectodomain.Am?J?Pathol?156：1417

15.Disis?ML，Gralow?JR，Bernhard?H，Hand?SL，et?al(1996)Peptide-based，but?not?whole?protein，vaccines?elicit?immunity?toHER-2/neu，an?oncogenic?selfprotein.J?Immunol156：3151

16.Fisk?B，Hudson?JM，Kavanagh?J，Wharton?JT，et?al(1997)Existentproliferative?responses?of?peripheral?blood?mononuclear?cells?fromhealthy?donors?and?ovarian?cancer?patients?to?HER-2peptides.Anticancer?Res?17：45

17.Kobavashi?H，Wood?M，Song?Y，Appella?E，et?al(2000)Definingpromiscuous?MHC?class?II?helper?T-cell?epitopes?for?HER2/neutumor?antigen.Cancer?Res?60：5228

18.Tutde?TM，Anderson?BW，Thompson?WE，Lee?JE，et?al(1998)Proliferative?and?cytokine?responses?to?class?II?HER-2/neu-associatedpeptides?in?breast?cancer?patients.Clin?Cancer?Res?4：2015

19.Ioannides?CG，Fisk?B，Fan?D，Biddison?WE，et?al(1993)Cytotoxic?Tcells?isolated?from?ovarian?malignant?ascites?recognize?a?peptidederived?From?the?HER-2/neu?proto-oncogene.Cell?Immunol?151：225

20.Peoples?GE，Goedegebuure?PS，Smith?R，Linehan?DC，et?al(1995)Breast?and?ovarian?cancer-specific?cytotoxic?T?lymphocytes?recognizethe?same?HER2/neu-derived?peptide.Proc?Natl?Acad?Sci?USA?92：432

21.Yoshino?I，Peoples?GE，Goedegebuure?PS，Maziarz?R，et?al(1994)Association?of?HER2/neu?expression?with?sensitivity?totumor-specific?CTL?in?human?ovarian?cancer.J?Immunol?152：2393

22.Kono?K，Rongcun?Y，Chard?J，Ichihara?F，et?al(1998)Identificationof?HER2/neu-derived?peptide?epitopes?recognized?by?gastriccancer-specific?cytotoxic?T?lymphocytes，Int?J?Cancer?78：202

23.Yoshino?L，Goedegebuure?PS，Peoples?GE，Parikh?AS，et?al(1994)HER2/Neu-derived?peptides?are?shared?antigens?among?humannon-small?cell?lung?cancer?and?ovarian?cancer.Cancer?Res?54：3387

24.Lustgarten?J，Theobald?M，Labadie?C，Laface?D，et?al(1997)Identification?of?HER-2/Neu?CTL?epitopes?using?double?transgenicmice?expressing?HLA-A2.1and?human?CD8.Human?Immunol?52：109

25.Rongcun?Y，Salazar-Onfray?F，Charo?J，Malmberg?KJ，et?al(1999)Identification?of?new?HER2/neu-derived?peptide?epitopes?that?canelicit?specific?CTL?against?autologous?and?allogeneic?carcinomas?andmelanomas.J?Immunol?163：1037

26.Seliger?B，Rongcun?Y，Atkins?D，Hammers?S，et?al(2000)HER-2/neuis?expressed?in?human?renal?cell?carcinoma?at?heterogeneous?levelsindependently?of?tumor?grading?and?staging?and?can?be?recognized?byHLA-A2.I-restricted?cytotoxic?T?lymphocytes，Int?J?Cancer?87：349

27.Peoples?GE，Smith?RC，Linehan?DC，Yoshino?L，et?al(1995)SharedT?cell?epitopes?in?epithelial?tumors.Cell?Immunol?164：279

28.Rilke?F，Colnaghi?MI，Cascinelli?N，Andreola?S，et?al(1991)Prognostic?significance?of?HER-2/neu?expression?in?breast?cancer?andits?relationship?to?other?prognostic?factors.Int?J?Cancer?49：44

29.Tagliabue?E，Menard?S，Robertson?JF，Harris?L(1999)c-erbB-2expression?in?primary?breast?cancer.Int?J?Biol?Markers?14：16

30.Nistico?P，Mottolese?M，Cascioli?S，Benevolo?M，et?al(1990)Hostimmunosurveiliance?contributes?to?the?control?of?erbB-2overexpression?in?HLA-A2-breast-cancer?patients，Int?J?Cancer84：598

31.Nistico?P，Mottolese?M，Mammi?C，Benevolo?M，et?al(1997)Lowfrequency?of?ErbB-2?proto-oncogene?overexpression?in?humanleukocyte?antigen-A2-positive?breast?cancer?patients.J?Natl?CancerInst?89：319

32.Guy?CT，Webster?MA，Schaller?M，Parsons?T?J，et?al(1992)Expression?of?the?neu?protooncogene?in?the?mammary?epithelium?oftransgenic?mice?induces?metastatic?disease.Proc?Natl?Acad?Sci?USA89：1057.

33.Mailer?WJ，Sinn?E，Pattengale?PK，Wallace?R，et?al(1988)Single-step?induction?of?mammary?adenocarcinoma?in?transgenicmice?bearing?the?activated?c-neu?oncogene.Cell?54：105

34.Bernards?R，Destree?A，McKenzie?S，Gordon?E，et?al(1987)Effectivetumor?immunotherapy?directed?against?an?oncogene-encoded?productusing?a?vaccinia?virus?vector.Proc?Natl?Acad?Sci?USA?84：6854

35.Taylor?P，Gerder?M，Moros?Z，Feldmann?M(1996)Humoral?andcellular?responses?raised?against?the?human?HER2?oncoprotein?arecross-reactive?with?the?homologous?product?of?the?newproto-oncogene，but?do?not?protect?rats?against?B104?tumorsexpressing?mutated?neu.Cancer?Immunol?Immunother?42：179

36.Esserman?LJ，Lopez?T，Montes?R，Bald?LN，et?al(1999)Vaccinationwith?the?extracellular?domain?of?p185neu?prevents?mammary?tumordevelopment?in?neu?transgenic?mice.Cancer?Immunol?Immunother47：337

37.Reilly?RT，Gottlieb?MB，Ercolini?AM，Machiels?JP，et?al(2000)HER-2/neu?is?a?tumor?rejection?target?in?tolerized?HER-2?neutransgenic?mice.Cancer?Res?60：3569

38.Cefai?D，Morrison?BW，Sckell?A，Favre?L，et?al(1999)TargetingHER-2/neufor?active-specific?immunotherapy?in?a?mouse?model?ofspontaneous?breast?cancer.Int?J?Cancer?83：393

39.Disis?ML，Bernhard?H，Shiota?FM，Hand SL，et?al(1996)Granulocyte-macoph-age?colony-stimulating?factor-an?effective?adjuvant?for?protein?andpeptide-based?vaccines.Blood?88：202

40.Nagata?Y，Furugen?R，Hiasa?A，Ikeda?H，et?al(1997)Peptides?derivedfrom?a?wild-type?murine?proto-oncogene?c-erbB-2/HER2/neu?caninduce?CTL?and?tumor?suppression?in?syngeneic?hosts.J?Immunol159：1336

41.Ikuta?Y，Okugawa?T，Furugen?R，Nagata?Y，et?al(2000)AHER2/NEU-derived?peptide，a?K(d)-restricted?murine?tumor?rejectionantigen，induces HER2-specific HLA-A2402-restricted CD8(+)cytotoxic?T?lymphocytes.Int?J?Cancer?87：553

42.Amici?A，Venanzi?FM，Concetti?A(1998)Genetic?immunizationagainst?neu/erbB2?transgenic?breast?cancer.Cancer?ImmunolImmunother?47：183

43.Chen?Y，Hu?D，Eling?DJ，Robbins?J，et?al(1998)DNA?vaccinesencoding?full-length?or?truncated?Neu?induce?protective?immunityagainst?Neu-expressing?mammary?tumors.Cancer?Res?58：1965

44.Wei?WZ，Shi?WP，Galy?A，Lichlyter?D，et?al(1999)Protection?againstmammary?tumor?growth?by?vaccination?with?full-length，modifiedhuman?ErbB-2DNA.Int?J?Cancer?81：748

45.Concerti?A，Amici?A，Petrelli?C，Tibaldi?A，et?al(1996)Autoantibodyto?p185(Erbb2/Neu)oncoprotein?by?vaccination?with?xenogenicDNA.Cancer?Immunol?Immunother?43：307

46.Rovero?S，Amici?A，Carlo?ED，Bei?R，et?al(2000)DNA?vaccinationagainst?rat?her-2/Neu?p185?more?effectively?inhibits?carcinogenesisthan?transplantable?carcinomas?in?transgenic?BALB/c?mice?[InProcess?Citation].J?Immunol?165：5133

47.Mahon?BP，Moore?A，Johnson?PA，Mills?KH(1998)Approaches?tonew?vaccines，Crit?Rev?Biotechnol?18：257

48.Quirke?P，Pickles?A，Tuzi?NL，Mohamdee?O，et?al(1989)Pattern?ofexpression?of?c-erbB-2?oncoprotein?in?human?fetuses.Br?J?Cancer60：64

49Costello?RT，Gastaut?JA，Olive?D(1999)Mechanisms?of?tumor?escapefrom?immunologic?response.Rev?Med?Interne?20：579

50.Hersey?P(1999)Impediments?to?successful?immunotherapy.Pharmacol?Ther?81：111

51.Cabrera?T，Angustias?Fernandez?M，Sierra?A，Garrido?A，et?al(1996)High?frequency?of?altered?HLA?class?I?phenotypes?in?invasive?breastcarcinomas.Hum?Immunol?50：127

52.Cabrera?T，Collado?A，Fernandez?MA，Ferron?A，et?al(1998)Highfrequency?of?altered?HLA?class?I?phenotypes?in?invasive?colorectalcarcinomas.Tissue?Antigens?52：114

53.Cabrera?T，Salinero?J，Fernandez?MA，Garrido?A，et?al(2000)Highfrequency?of?altered?HLA?class?I?phenotypes?in?laryngealcarcinomas[in?Process?Citation].Hum?Immunol?61：499

54.Algarra?I，Cabrera?T，Garrido?F(2000)The?HLA?crossroad?in?tumorimmunology.Hum?Immunol?61：65

55.Hicklin?DJ，Marincola?FM，Ferrone?S(1999)HLA?class?I?antigendownregulation?in?human?cancers：T-cell?immunotherapy?revives?anold?story.Mol?Med?Today?5：178

56.Baselga?J，Norton?L，Albanell?J，et?al(1998)Recombinant?humanizedanti-HER2?antibody(Herceptin)enhances?the?antitumor?activity?ofpaclitaxel?and?doxorubicin?against?(Herceptin)enhances?theantitumor?activity?of?paclitaxel?and?doxorubicin?against?HER2/neuoverexpressing?human?breast?cancer?xenografts.Cancer?Res?58：2825

57.Li?J，Wang?Y，Li?QX，et?al(1998)Cloning?of?3H11?mAb?variableregion?gene?and?expression?of?3H11?human-mouse?chimeric?lightChain.World?J?Gastroenterol?4：41

58.Cwirla?SE，Peters?EA，Barret?RW，et?al(1990)Peptides?on?phage：avast?library?for?identifying?ligands.Proc?Natl?Acad?Sci?U.S.A.87：6378

59.Devli8n?JJ，Panganiban?LC，Devlin?PE(1990)Random?peptidelibraries：a?source?of?protein?binding?molecules.Science?404-406

60. Anping, Meng Lin, Dong Zhiwei, the improvement of vegf receptor Flt-1 antagonist screening conditions in Shou Chengchao (2001) the small peptide storehouse.Peking University's journal (medicine) 33:398

61Burritt?JB，Bond?CW，Doss?KW，et?al(1996)Filamentous?phagedisplay?of?oligopeptide?libraries.Anal?Biochem?238：1

62.Blond-Elguini?S，Cwirla?SE，Dower?WJ，et?al(1993)Affinity?panningof?a?library?of?peptides?displayed?on?bacteriophages?reveals?thebinding?specificity?of?BiP.Cell?75：717

63.Kay?BK，Adey?NB，He?YS，et?al(1993)An?M13?phage?librarydisplaying?random?38-amino-acid?peptides?as?a?source?of?novelsequences?with?affinity?to?selected?targets.Gene?128：59

64.Stephen PW, Helminen P, swimming lane DP (1995) Characterization ofepitopes on human p53 using phage displayed peptide libraries:insights into antibody-phage interactions.J Mol Biol 248:58

65.Steward，J.M.and?Young，J.D.，Solid?Phase?Peptide?Synthesis，2nd?Ed.，Pierce?Chemical?Company，Rockford，I?11.，(1984))

66.Steward, J.M.and Young, J.D., Solid Phase Peptide Synthesis, W.H.Freeman Co. (San Francisco), 1963 and J.Meienhofer, HomonalProteins and Peptides, vol.2, p.46, Academic Press (New York), 1973

67 (people such as Sanger, PNAS, 1977,74:5463-5467)

68Sambroo?k，J.(1989)，Molecular?Cloning，a?Laboratory?Manual，Cold?Spring?Harbor?Press；

68Plainview，N.Y.；Ausubel，F.M.(1989)Current?Protocols?inMolecular?Biology，

69John Wiley ﹠amp; Sons, N.Y.; Hobbs, people such as S., McGraw HillYearbook of Science and Technology (1992),

70.N.Yang，Crit.Rev.Biotechn.12(4)：335-356(1992)

71.Smith?GP(1985)Filamentous?fusion?phage：vovel?expression?vectorsthat?display?cloned?antigens?on?the?viron?surface.Science?228：1315

72.Gu?XG，Schmitt?M，Hiasa?A，Nagata?Y，et?al(1998)A?novelhydrophobized?polysaccfiaride/oncoprotein?complex?vaccine?inducesin?vitro?and?in?vivo?cellular?and?humoral?immune?responses?againstHER2-expressing?murine?sarcomas.Cancer?Res?58：3385

73.Okugawa?T，Ikuta?Y，Takahashi?Y，Obata?H，et?al(2000)Anovel?human?HER2-derived?peptide?homologous?to?the?mouseK(d)-restricted?tumor?rejection?antigen?can?induce?HLA-A24-restrictedcytotoxic?T?lymphocytes?in?ovarian?cancer?patients?and?healthyindividuals.Eur?J?Immunol?30：3338

74.Bei?R，Masuelli?L，Moriconi?E，Visco?V，et?al(1999)Immuneresponses?to?all?ErbB?family?receptors?detectable?in?serum?of?cancerpatients.Oncogene?18：1267

75.Peiper?M，Goedegebuure?PS，Linehan?DC，Ganguly?E，et?al(1997)The?HER2/neu-derived?peptide?p654?662?is?a?tumor-associatedantigen?in?human?pancreatic?cancer?recognized?by?cytotoxic?Tlymphocytes.Eur?J?Immunol?27：1115

76.Disis?ML，Grabstein?KH，Sleath?PR，Cheever?MA(1999)Generationof?immunity?to?the?HER-2/neu?oncogenic?protein?in?patients?withbreast?and?ovarian?cancer?using?a?peptide-based?vaccine.ClinCancer?Res5：1289

77.Dakappagari?NK，Douglas?DB，Triozzi?PL，Stevens?VC，et?al(2000)Prevention?of?mammary?tumors?with?a?chimeric?HER-2B-cellepitope?peptide?vaccine.Cancer?Res?60：3782

78Minev?BR，Chavez?FL，Mitchell?MS(1998)New?trends?in?thedevelopment?of?cancer?vaccines，In?Vivo?12：629

79.Lowman?HB，Bass SH，Simpson?N，et?al(1991)Selectinghigh-affinity?binding?proteins?by?monovalent?phage?display.Biochemistry?30：10832

80.Cho?HS，Mason?K，Ramyar?KX，Stanley?AM，et?al(2003)Structure?ofthe?extracellular?region?of?HER2?alone?and?in?complex?with?theHerceptin?Fab.Nature?421：756

Sequence table

<110>Chengchao，Shou

Beihai.Jiang

＜120〉HER-2 analogue antigen epitope and contain the peptide of this epi-position

<130>CID042510

<160>5

<170>PatentIn?version?3.1

<210>1

<211>12

<212>PRT

＜213〉artificial sequence

<400>1

Leu?Leu?Gly?Pro?Tyr?Glu?Leu?Trp?Glu?Leu?Ser?His

1 5 10

<210>2

<211>10

<212>PRT

＜213〉artificial sequence

<400>2

Gly?Pro?Tyr?Glu?Leu?Trp?Glu?Leu?Ser?His

1 5 10

<210>3

<211>12

<212>PRT

＜213〉artificial sequence

<400>3

Gly?Ala?Gly?Pro?Tyr?Glu?Leu?Trp?Glu?Leu?Ser?His

1 5 10

<210>4

<211>12

<212>PRT

＜213〉artificial sequence

<400>4

Gln?Leu?Gly?Pro?Tyr?Glu?Leu?Trp?Glu?Leu?Ser?His

1 5 10

<210>5

<211>14

<212>PRT

＜213〉artificial sequence

<400>5

Cys?Leu?Leu?Gly?Pro?Tyr?Glu?Leu?Trp?Glu?Leu?Ser?His?Cys

1 5 10

Claims (22)

1. With forward or backwards continuously or the compartment of terrain comprise a plurality of or only comprise the aminoacid sequence shown in the following general formula (I) and can induce the immunoreactive peptide of generation at HER-2: X9X1X2GPYELWELSHX10, (I)

   Wherein,

   X1 can exist or not exist, and is natural amino-acid residue,

   X2 can exist or not exist, and is hydrophobic amino acid residues,

   Wherein, X9 and X10 are natural amino acid, can exist or not exist, and the peptide of formula (I) can be linear or cyclisation.
2. 2. the peptide of claim 1,

   Wherein, X1 can exist or not exist, and is L, I, and V, M, A, F, G, Q or N,

   X2 can exist or not exist, and is L, I, and V, M, A, F, or G,

   X9 and X10 can exist or not exist, and are C or S.
3. 3. the peptide of claim 2,

   Wherein, X1 can exist or not exist, and is L, G or Q,

   X2 can exist or not exist, and is L or A,

   X9 and X10 can exist or not exist, and are C.
4. 4. the peptide of claim 3, the aminoacid sequence shown in its formula of (I) is:

   H98 LLGPYELWELSH (SEQ?ID?NO：1)

   C10 GPYELWELSH (SEQ?ID?NO：2)

   MutN1-2 GAGPYELWELSH (SEQ?ID?NO：3)

   MutN1 QLGPYELWELSH (SEQ ID NO:4) or

   CyclicH98? CLLGPYELWELSH C(SEQ?ID?NO：5)。
5. 5. arbitrary peptide of claim 1-4 is used for inducing the purposes of generation at the medicine of the body fluid of HER-2 and cell immune response in preparation.
6. 6. arbitrary peptide of claim 1-4 is used for the purposes of the medicine of treatment and prevention of tumour in preparation.
7. 7. pharmaceutical composition, it comprises peptide arbitrary among the claim 1-4 and pharmaceutically acceptable carrier.
8. 8. the pharmaceutical composition of claim 7, it is former or the tumour of transfer and the pharmaceutical composition of cancer that is used for the treatment of and prevents following organ: mammary gland, colon, rectum, lung, oropharynx, laryngopharynx, oesophagus, stomach, pancreas, liver, gall-bladder, bile duct, small intestine, kidney, bladder, the urothelium uterine neck, the uterus, ovary, choriocarcinoma, pregnant occasion nutritive layer disease, prostate gland, seminal vesicle, testis, Tiroidina, suprarenal gland, hypophysis angiogenic knurl, melanoma, sarcoma from bone or soft tissue generation, kaposi's sarcoma, brain, neural, the tumour of eye and meninx is from the tumour of hematopoiesis malignant disease generation.
9. 9. claim 7 or 8 pharmaceutical composition, the cytokine of the enhancing immunity that the arbitrary peptide among the claim 1-5 in this pharmaceutical composition and this area are commonly used or albumen, other tumour vaccine commonly used or carrier commonly used mix mutually or form recombinant protein.
10. 10. the pharmaceutical composition of claim 9, cytokine wherein is interleukin II (IL-2), interleukin 12 (IL-12), G CFS (GM-CSF), CCL2, CCL5, CCL7, CCL19, CCL21, CCL20, CXCL9, CXCL10, CXCL12, CXCL15, XCL1, FTL3L, CD40L, albumen wherein is heat shock protein(HSP), the vaccine commonly used of tumour wherein is cancer suppressor gene, the tumor associated antigen of oncogene, sudden change, carrier wherein is a keyhole relative hemocyanin, serum albumin, the bacteriotoxin of deactivation.
11. 11. the pharmaceutical composition of claim 10, oncogene wherein is that the cancer suppressor gene of CEA, sudden change is that p53, tumor associated antigen are melanic related antigens, serum albumin wherein is bovine serum albumin or human serum albumin, and bacteriotoxin is tetanus, diphtheria toxin or tuberculin.
12. 12. arbitrary pharmaceutical composition of claim 7-11, this pharmaceutical composition are a kind of vaccine.
13. 13. the nucleotide sequence of the arbitrary peptide among the coding claim 1-4, this Nucleotide can independently exist, and also can mix or form recombinant nucleic acid molecules mutually with the gene of the cytokine of the commonly used enhancing immunity in code book field or albumen, other tumour vaccine commonly used or carrier commonly used.
14. 14. contain the plasmid or the virus vector of the Nucleotide of claim 13.
15. 15. contain the plasmid of claim 14 or the cell of carrier.
16. 16. a pharmaceutical composition, it contains the Nucleotide of claim 13, the plasmid of claim 14 or the cell of virus vector or claim 15 and pharmaceutical carrier.
17. 17. the pharmaceutical composition of claim 16, cytokine wherein is interleukin II (IL-2), interleukin 12 (IL-12), G CFS (GM-CSF), CCL2, CCL5, CCL7, CCL19, CCL21, CCL20, CXCL9, CXCL10, CXCL12, CXCL15, XCL1, FTL3L, CD40L, albumen wherein is heat shock protein(HSP), the vaccine commonly used of tumour wherein is cancer suppressor gene, the tumor associated antigen of oncogene, sudden change, carrier wherein is a keyhole relative hemocyanin, serum albumin, the bacteriotoxin of deactivation.
18. 18. the pharmaceutical composition of claim 17, oncogene wherein is that the cancer suppressor gene of CEA, sudden change is that p53, tumor associated antigen are melanic related antigens, serum albumin wherein is bovine serum albumin or human serum albumin, and bacteriotoxin is tetanus, diphtheria toxin or tuberculin.
19. 19. arbitrary pharmaceutical composition of claim 16-18, it is to be used to induce generation at the body fluid of HER-2 and the pharmaceutical composition of cell immune response.
20. 20. arbitrary pharmaceutical composition of claim 16-19, it is the pharmaceutical composition that is used for the control of tumour.
21. 21. the pharmaceutical composition of claim 20, the tumour of sarcoma, kaposi's sarcoma, brain, nerve, eye and meninx that tumour that is used to prevent and treat and cancer be the cancer that takes place of mammary gland, colon, rectum, lung, oropharynx, laryngopharynx, oesophagus, stomach, pancreas, liver, gall-bladder, bile duct, small intestine, kidney, bladder, urothelium uterine neck, uterus, ovary, choriocarcinoma, pregnant occasion nutritive layer disease, prostate gland, seminal vesicle, testis, Tiroidina, suprarenal gland or tumour, hypophysis angiogenic knurl, melanoma, take place from bone or soft tissue is from the tumour of hematopoiesis malignant disease generation.
22. 22. arbitrary pharmaceutical composition of claim 16-21, it is a kind of vaccine, and this vaccine can be a nucleotide vaccine.

Images