CN100334112C - Interfusion protein of human interleukin 15 and Fe - Google Patents

Abstract

The present invention relates to fusion protein comprising a human immunoglobulin Fc fragment and an interleukin 15, wherein the human immunoglobulin Fc fragment is connected with the interleukin 15 by a connecting peptide section. The present invention also discloses ribonucleic acid for encoding the fusion protein and contains the expression vector of the ribonucleic acid, a medical composition containing the fusion protein, pharmacy purposes for resisting micro organism infection and a method for generating the fusion protein, which comprises the step: the expression vector is expressed in host cells.

Description

Human interleukin 15 and Fc fusion rotein

Technical field

The present invention relates to utilize the recombinant DNA technology field, more specifically, the present invention relates to the genetically engineered human interleukin 15 (Interleukin-15, IL-15) with the Fc fusion rotein, its purposes and preparation method.

Background of invention

Interleukin 15 (IL15) is the newfound a kind of cytokine of interleukin-class, (IL-2) has similar biologic activity to interleukin II, can promote the differentiation and proliferation of B cell, induce N K cell proliferation, cytotoxic activity, cytokine to produce, the collaborative N K cell that can impel of it and IL12 produces IFN-γ, for function and the immunity of organisms of regulating N K cell play an important role [1-7].

At first, the part that IL-15 replys as anti-microbial infection early immune in the body, it can continue to play a role under the environment that cytokine in inflammation early stage (as IL-1 etc.) is expressed being unfavorable for, and, fill up the system of engulfing and by the space between the α β T cell-specific immunne response by activating gamma delta T cells.By activating the killing activity of NK cell, in the body anti-virus infection process, play crucial effect.IL-15 expresses in multiple tissue, as placenta, skeletal muscle, kidney, lung, the heart, mononuclearcell, scavenger cell, but when being subjected to multiple stimulation abduction delivering.But the abduction delivering IL-15 after being upset of monocyte/macrophage system particularly, and play a part important [8-10] in the process of opening holding of the body natural immunity and acquired immunity.

Patient's peripheral blood mononuclear cell that HIV infects, NK cell and ADCC are active obviously to be reduced.And in the vitro culture process, add reorganization IL-15, can obviously improve the killing activity of NK cell, and this effect does not need induce [11] of other cytokine (as IL2, IL12, IFN-γ etc.).

The propagation that while IL15 can regulate hiv infected patient CD8+T cell, it can keep the anti-HIV immunne response of the cell-mediated extravascular tissue of CD8+T.This prompting utilizes the immunoregulation effect of IL-15 when IL2 and functional CD4+T cell shortage, make CTL carry out the possibility of proliferation in vivo.IL15 can activate lung's scavenger cell during inflammation, hiv infected patient alveolar M φ and T cell expressing IL15, IFN γ, and IL15 is conjugated protein, raises costimulating factor B7 simultaneously, and CD72 is relevant with M Ф antigen presentation, and they can cause that the T cell breeds strongly.This shows play an important role in the cell-mediated defense mechanism of IL15 tissue T outside the HIV patient's blood vessel [12].Lin etc. [13-14] think that recently the circulation CD4+T cytosis intermittent, that low dosage rIL2 treatment HIV1 infected patient causes may be a kind of improvement of immune status; Yet this treatment is but complicated because of rIL2 injection time endochylema instantaneous rising of HIV1 rna level, infer that IL-2 activates the CD4+T cell after, cause virus replication to strengthen.If IL15 can cause circulation CD4+T cytosis as IL2, but only make minimized number CD4+T cell obtain activation simultaneously, it will promise to be a kind of effective immunologic function restorative.

But because natural IL-15 molecular weight is little, it is short to use the later half phase of declining in the body, thereby has limited the performance of biologic activity in its body.Therefore, this area presses for a kind of the improvement transformation period in its body, promotes the approach of its biologic activity performance.

Summary of the invention

Therefore, aspect first, provide a kind of fusion rotein of the present invention, this fusion rotein comprises human normal immunoglobulin Fc fragment, interleukin 15, and wherein said human normal immunoglobulin Fc fragment is connected by joining peptide with interleukin 15.

In a preferred implementation aspect this, the immunoglobulin Fc fragment comprises CH2, CH3 and the CH4 structural domain of heavy chain immunoglobulin.Preferred, this immunoglobulin Fc fragment is the CH of human normal immunoglobulin IgG4.Also preferred immunoglobulin Fc fragment is the Fc fragment of IgG4, comprises hinge region, CH2, the CH3 structural domain of IgG4.

In another preferred implementation aspect this, this fusion rotein has the aminoacid sequence of SEQ ID NO:1.

In another embodiment aspect this, interleukin 15 is a human interleukin 15.

In another preferred implementation aspect this, the connection peptides sequence is ESKYGPPCPSCP.

Also having in the preferred implementation aspect this, this fusion rotein forms dimer by intermolecular disulfide bond.

Aspect second of the present invention, provide the nucleic acid of the above-mentioned fusion rotein of encoding.Preferred this nucleic acid has the nucleotide sequence of SEQ ID NO:2.

Aspect the 3rd of the present invention, provide and contained above-mentioned expression of nucleic acids carrier.

Aspect the 4th of the present invention, provide the host cell that contains above-mentioned expression vector.Preferred described host cell is an eukaryotic cell, and is preferred, and described eukaryotic cell is a yeast cell.

Aspect the 5th of the present invention, a kind of pharmaceutical composition is provided, this pharmaceutical composition contains acceptable carrier on above-mentioned fusion rotein and the pharmacology thereof.

Aspect the 6th of the present invention, provide aforementioned pharmaceutical compositions to be used to prepare the purposes of the medicine of anti-microbial infection.

Aspect the 7th of the present invention, a kind of method of producing above-mentioned fusion rotein is provided, comprise step:

In host cell, express above-mentioned expression vector.

In a preferred implementation of this method, the method comprising the steps of: (a) in fermentor tank to above-mentioned eukaryotic host cell, the preferred yeast cell carries out high-density culture; (b) collect culture supernatant after ultrafiltration and concentration, affinity chromatography and anion exchange methods purifying obtain above-mentioned fusion rotein.

Description of drawings

Fig. 1 is the amino acid (SEQ ID NO:1) and the cDNA sequence (SEQ ID NO:2) of fusion rotein.

Wherein in the aminoacid sequence of SEQ ID NO:1,1-116 amino acids residue is the aminoacid sequence of IL-15, and 117-128 amino acids residue is a connection peptides, and 129-345 amino acids residue is the aminoacid sequence of Fc.

In the cDNA sequence of SEQ ID NO:2: the 1-348 base is the IL-15 encoding sequence; The 349-384 base is the connection peptides encoding sequence; 385-1035 is the Fc encoding sequence.

Fig. 2 is the nucleotide sequence (SEQ ID NO:3) and the aminoacid sequence of connection peptides.

Fig. 3 is the electrophoresis detection figure of pcr amplification signal peptide segment, IL-15 and Fc.

Fig. 4 has shown that the enzyme of final fusion plasmid cuts screening figure.

Fig. 5 has shown the screening of expressing the Yeast engineering bacterium strain of IL15-Fc fusion rotein.

Fig. 6 is the genome dna electrophoresis collection of illustrative plates of the expression strain that screened with the amplification of the method for PCR among the embodiment 3.

Fig. 7 is that the SDS-PAGE electrophoresis of genetically engineered people IL15/Fc fusion rotein behind the purifying is identified photo.

Fig. 8 is that the CTLL-2 cell proliferation method detects fusion rotein biologic activity result.

Embodiment

The present invention at first isolates total mRNA by molecular biology method from human peripheral blood single nucleus cell and in the peripheral blood leucocyte, adopt the RT-PCR method to amplify IL-15 and IgG4 Fc coded cDNA sequence, by dual-PCR method is external the encoding sequence of IL-15cDNA sequence with human normal immunoglobulin Fc district linked to each other then.

Term used herein " immunoglobulin fc region " refers to the immunoglobulin chain constant region, the particularly carboxyl terminal of immunoglobulin heavy chain constant region or a part wherein, for example immunoglobulin fc region can comprise two or more structural domains of heavy chain CH1, CH2, CH3, CH4 and the combination of immunoglobulin hinge region, in a preferred embodiment, the Fc district of used immunoglobulin (Ig) comprises at least one immunoglobulin (Ig) hinge region, a CH2 structural domain and a CH3 structural domain preferably lack the CH1 structural domain.

The known person immunoglobulin (Ig) has plurality of classes, as IgA, IgD, IgE, IgM and IgG (comprise IgG1, IgG2, IgG3, four subclass of IgG4), selecting specific immunoglobulin fc region from specific immunoglobulin class and subclass is within the scope of grasping those skilled in the art, in a preferred examples, immunoglobulin fc region can select to include the encoding sequence in human normal immunoglobulin IgG4 subclass Fc district, wherein lack heavy chain immunoglobulin 1 structural domain (CH1), but comprised hinge area and CH2, CH3, the encoding sequence of three structural domains of CH4.

The connection peptides that connects between interleukin 15 and human normal immunoglobulin is meant the peptide sequence that two albumen are linked together, the optional majority seed amino acid of connection peptides, for example L-Ala (Ala), glycine (Gly) and Serine (Ser) or other amino acid whose combination, for example can select the combination of a series of glycine and Serine, length is about 10-15 amino-acid residue, referring to US00/13827.Also can select the hinge area peptide sequence of human normal immunoglobulin directly interleukin 15 to be linked to each other with human normal immunoglobulin Fc district.Best connection peptides length and amino acid are formed the daily experiment situation that depends on.In a preferred embodiment of the invention, connection peptides adopts the hinge area sequence of human normal immunoglobulin IgG, adopts this connection peptides can reduce the immunogenicity of fusion rotein, and the biologic activity after fusion rotein is used in vivo is provided.

Expression vector described in the present invention can be prokaryotic expression carrier and carrier for expression of eukaryon.To be that those skilled in the art are common grasp for the selection of carrier and structure.Because the expressed product of prokaryotic expression system often exists with insoluble inclusion body form, the target protein of expression need could obtain to have natural biological and learn active target protein through after the complicated sex change and renaturation process.Because the Fc fusion protein molecule is bigger, contain more disulfide linkage in the molecule, structure and function are also complicated, generally all adopt eukaryotic expression system to express, so that, produce glycosylation recombination fusion protein with native protein or polypeptide biologic activity function by glycosylation modified and folding naturally.Because in eukaryotic expression system, yeast expression system have make up fast, target protein expression amount height, produce advantages such as the target protein cost is lower, thus the present invention preferred the yeast carrier for expression of eukaryon.In a preferred scheme, the inventor has made up yeast secretion type expression carrier pPIC9-IL15-Fc, the simple description of this carrier.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell, and prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.Preferably, this host cell is a yeast cell, and more preferably, this host cell is the pichia spp cell, is the pichia pastoris phaff cell best.In a preferred embodiment, the present inventor obtains secreting IL-15/Fc Expression of Fusion Protein engineering bacteria by with behind the described yeast secretion type carrier transfection yeast.

In the present invention, term " IL-15/Fc fusion rotein " is meant by Interleukin-15 and two kinds of albumen of human IgG 4 Fc sections and merges the formed polypeptide in back.Described Interleukin-15 and IgG antibody 4 Fc all come from the people, also can be derived from other inhuman Mammals, but be preferably the Interleukin-15 that is derived from the people and people's IgG antibody 4.

Preferably a kind of dimer molecule of Ro 24-7472/000 provided by the invention-15/Fc fusion rotein.Terminology used here " dimer " is meant that two fusion rotein polypeptide chains are by covalent linkage or non-covalent interaction and stably link together.Particularly the covalent linkage that forms by the immunoglobulin fc region disulfide linkage forms stable dimeric structure.

The present inventor finds, integrates by Nucleotide and the human IgG 4 Fc district encoding sequences of the hIL-15 that will encode, inserts Yeast expression carrier pPIC9, very high-efficiency earth's surface intelligent IL-15/Fc fusion rotein.By optimizing the cultivation and the preparation technology of Yeast engineering bacteria, obtain highly purified human IL-15/Fc fusion rotein, finished the present invention.

In a preferred example, by preferred scheme, from the human peripheral blood mononuclear cell by the PCR method IL-15 cDNA sequence of directly cloning people, then the PCR product directly is cloned into pMD18T (Takara company) carrier, obtain pMD18T-IL15, connect product transformed into escherichia coli DH5 α (Stratagene company).Extract mRNA then from normal people's peripheral blood leucocyte, reverse transcription obtains cDNA first chain, is that template is carried out PCR with it, the Fc fragment gene of amplification IgG4, and the PCR product directly is cloned on the pMD18T carrier, obtains pMD18T-Fc.

With pMD18T-IL15 and pMD18T-Fc is template, the design primer amplification goes out IL15 and Fc segment, link to each other through the signal peptide of transforming on IL15 and the pPICK carrier then, the Fc segment then is connected to the catchment of IL15, constitute the warm proteic carrier of coding IL15-Fc, called after pPIC9K-IL15-Fc.

Express engineering bacteria by expression vector is finished behind the in-vitro transfection host cell.The conversion of expression vector can be adopted conventional method, as Calcium Chloride Method, electroporation etc.In the present invention, the contriver adopts a kind of saccharomycetic efficient method for transformation that is applicable to usually.Can be used for host cell of the present invention and be preferably prokaryotic cell prokaryocyte or eukaryotic cell, more preferably is yeast, is yeast pichia pastoris phaff bacterial strain best.Particularly, engineering yeast of the present invention obtains by the following method.Saccharomyces pastorianus (Pichia pastoria) GS115 bacterium is inoculated in the YPD substratum, and 30 ℃ of shaking table overnight incubation prepare the competence yeast.The expression vector that 80 μ l competence yeast and restriction endonuclease SacI enzyme are cut mixes, and places electroporation apparatus to shock by electricity with 7000 volts/cm 5-10 millisecond then.Yeast after the electric shock is applied to the MD selectivity and cultivates, and puts 28 ℃ and cultivates.Selected clone after 3-5 days, in MD cultivated, in 28 ℃ of cultivations 36 hours, selected clone carried out dna sequencing again, reaffirms that antigen-4 fusion protein gene is correct with single clonal growth.

The inventor also by optimizing the expression condition of Yeast engineering bacteria, has improved IL15-Fc Expression of Fusion Protein level.And by preferable methods, separation and purification goes out the highly purified IL15-Fc fusion rotein of IL15-Fc from culture supernatant.

In the present invention, available multiple ordinary method makes the yeast strain of carrying expression vector express IL-15.Embodiment has below provided a preferred version.Adopt preferred fermention medium, incubation time was generally 72-144 hour, the OD during results ₆₀₀100-300 is answered in photoabsorption, is generally 200-250.

Purifying process can adopt the conventional purifying process that uses in this area, also can adopt the custom-designed purifying process of the inventor.Purification procedures after the preferred fusion protein that the present invention provides may further comprise the steps: (a) collect culture supernatant, (b) ultrafiltration and concentration, (c) Protein A affinity chromatography, (d) Source15Q ion-exchange chromatography.Carry out purifying with the technology that the inventor selects, finally can obtain purity greater than 95% gene human interleukin 15/Fc fusion rotein goods.

Immunoglobulin Fc section fusion rotein be using gene engineering technique produce have the albumen of biologic activity or the CH Fc fragment of polypeptide fragment and immunoglobulin (Ig) (mostly being IgG) is formed the fusion rotein that forms by certain, because fusion rotein has the binary sample molecular structure that is similar to immunoglobulin (Ig), the biologic activity that had both kept the target protein that is merged, have again and be not easy, have advantage such as stability preferably in vivo and in vitro in the application process by proteasome degradation.Particularly owing to compare with the polypeptide active factor that does not merge, the fusion protein molecule amount is big, long half time in serum, overcome the medicine that in recombinant cytokine immunotherapy process, exists and lacked the shortcoming of (tens of minutes to a few hours) in vivo biological half-life, improved the result of treatment of cytokine.And fusion rotein passes through in conjunction with behind the Fc acceptor, combine with the immunocyte that contains the Fc acceptor, thereby have specific target for pre-prepared medicine, be positioned immunologically competent cells such as NK cell, scavenger cell, neutrophil leucocyte, make IL-15 bring into play its immunomodulatory effect, act on and suppress itself and other target cell.

Below in conjunction with specific embodiment, further set forth the present invention, should be understood that this causes that embodiment only is used to the present invention is described and is not used in and limits the scope of the invention.

Embodiment 1: the clone of the Fc fragment gene of human IL-15 functional gene and human IgG 4

1, the clone of IL-15 functional gene:

From normal people's peripheral blood, separate adherent monocyte, after adding LPS stimulation 4h, guanidinium isothiocyanate single stage method extracted total RNA, the AMV reversed transcriptive enzyme synthesizes cDNA first chain, with it is that template is carried out the ripe IL-15cDNA sequence of pcr amplification wild-type people respectively, and used primer is:

Upstream primer: P1 5 ' AACTGGGTGAATGTAATAAG3 '

Downstream primer: P2 5 ' AGAAGTGTTGATGAACA TTTG3 '

The expectation size of the PCR product of human IL-15 is 790bp, and the PCR reaction volume is 50 μ l, and primer concentration is 0.4 μ M, the amplification parameter be 94 ℃ 30 seconds, 51 ℃ 45 seconds, 72 ℃ 50 seconds, 30 capable 2% agarose gel electrophoresis analyses of circulation after product.The expectation size of the PCR product of wild-type human IL-15 is 790bp, and electrophoresis obtains estimating the segment of size.The PCR product directly is cloned into pMD18T (Takara) carrier, obtain pMD18T-IL15, connect product transformed into escherichia coli DH5 α (Stratagene company), positive colony is through full-automatic order-checking (ABI373, PE company) analyzes, the result shows that the cDNA of people's wild-type human IL-15 of being cloned into is consistent with report, comprises complete encoding sequence.

2, the clone of the Fc fragment gene of IgG4: extract mRNA from normal people's peripheral blood leucocyte, reverse transcription obtains cDNA first chain, is that template is carried out PCR with it, the Fc fragment gene of amplification IgG4, and used primer is:

Upstream primer: P3 5 ' ACATGCCCACCGTGCCCAG3 '

Downstream primer: P4 5 ' TTATTTACCCGGAGACAGGGAG3 '

The loop parameter of PCR reaction be 94 ℃ 30 seconds, 56 ℃ 40 seconds, 72 ℃ 45 seconds, carry out 30 circulations.Obtain the Fc gene fragment of about 670bp.The PCR product directly is cloned on the pMD18T carrier, obtains pMD18T-Fc, and sequencing result is consistent with report.

Embodiment 2: the structure of the yeast secretion type carrier of coding IL15-Fc fusion rotein

Be template with pMD18T-IL15 and pMD18T-Fc respectively, the design primer amplification goes out IL15 and Fc segment, link to each other through the signal peptide of transforming on IL15 and the pPICK carrier then, the Fc segment then is connected to the catchment of IL15, constitute the warm proteic carrier of coding IL15-Fc, called after pPIC9K-IL15-Fc.

(a) the pulsating amplification of IL-15

For the IL15 segment, the primer sequence that is used to increase is:

Upstream primer IL15-F:-CGAGAAAAGAAACTGGGTTAACGTTATCTC-

Downstream primer IL15-RE:-CGGAATTCGGAAGTGTTGATGAACAT-

With pMD18T-IL15 is template, and PCR method amplifies the IL15 segment routinely.Amplification condition is 97 ℃, 2min; 94 ℃, 30s, 58 ℃, 30s, 72 ℃, 45s, totally 25 circulations; 72 ℃ again, 10min; Last 4 ℃ of preservations.The result obtains the purpose segment of a 360bp, with conforming to of expection.Reaction product is reclaimed with test kit.

(b) the signal peptide of pPIC9K is transformed

If according to routine operation, selectional restriction restriction endonuclease EcoRI inserts expression vector pPIC9K with the target protein of external source, then can add at least 4 unnecessary amino acid at the N of final protein product end.For eliminating the unnecessary amino acid of this N end, we transform the signal peptide sequence, and the reading frame of purpose fusion rotein directly is right after after signal peptide.

The upstream and downstream primer that is used for the amplification of signal peptide is:

Upstream primer α-factor-FB:-CGGGATCCAAACGATGAGATTTCCTT-

Downstream primer α-factor-R:-TAACCCAGTTTCTTTTCTCGAGAGATACCC-

With pPIC9K is template, and PCR method amplifies signal peptide segment routinely.Identical among reaction conditions and (a), the result obtains the segment of a 280bp.Reaction product is reclaimed with test kit.

(c) the IL15 segment is connected with transformed signal peptide

Finish by two PCR.The PCR product that above two steps of first PCR reaction obtain is template and primer.Reaction conditions is: 97 ℃, and 2min; 94 ℃, 45s, 56 ℃, 45s, 72 ℃, 60s, totally 13 circulations; 72 ℃ again, 10min; Last 4 ℃ of preservations.After this reaction finishes,, add into primer α-factor-FB and IL15-RE and other required compositions of postreaction with the centrifugal ice bath of reaction mixture.Reaction conditions is:

97 ℃, 2min; 94 ℃, 45s, 55 ℃, 45s, 72 ℃, 60s, totally 25 circulations; 72 ℃ again, 10min; Last 4 ℃ of preservations.Electrophoresis detection is found to obtain a segment that is slightly larger than 500bp, is consistent with expected results.Reaction product is reclaimed with test kit.

(d) amplification Fc segment changes its restriction enzyme site

Upstream primer is Fc-FE:-CGGAATTCGAGTCCAAGTACGGTCC-

Downstream primer is Fc-RN:-TTGCGGCCGCTTACTTACCCAAGGAC-

Reaction conditions is: 97 ℃, and 2min; 94 ℃, 45s, 53 ℃, 45s, 72 ℃, 60s, totally 30 circulations; 72 ℃ again, 10min; Last 4 ℃ of preservations.Electrophoresis finds to have the single segment of a 750bp.Meet expection.

Fig. 3 has shown (a) and (b) and (d) result electrophoresis detection collection of illustrative plates.Wherein M represents DL2000DNA electrophoresis mark among two figure, and A is the IL-15 segment, and B is a signal peptide segment, and C is a Fc amplification segment.As seen three's size conforms to 360bp, 280bp, the 700bp of expection.

(e) structure of two intermediate carriers and evaluation

Cut product and the carrier pPIC9K that obtains in (c) with BamHI and EcoRI enzyme respectively, glue reclaims purpose external source segment and carrier segment.Connect two segments with the T4 ligase enzyme.Be transformed into bacillus coli DH 5 alpha.

Cut product and the carrier pPIC9K that obtains in (d) with EcoRI and NotI enzyme respectively, glue reclaims purpose external source segment and carrier segment.Connect two segments with the T4 ligase enzyme.Be transformed into bacillus coli DH 5 alpha.

The clone's that two conversions obtain in the extracting plasmid respectively, called after pPIC9K-Il15 and pPIC9K-Fc, respectively with enzyme cut identify and order-checking errorless to determine.

(f) structure of fusion vector

After determining that two intermediate carrier sequences are errorless, use EcoRI and NotI double digestion respectively, carrier segment after recovery pPIC9K-IL15 enzyme is cut and the Fc segment of pPIC9K-Fc.Connect pPIC9K-IL15 and Fc then, obtain end product fusion vector pPIC9K-IL15-Fc, cut evaluation with enzyme respectively and check order errorless to determine.

Fig. 4 has shown that the enzyme of final fusion plasmid cuts screening figure, 1-6 for the clone that obtains after transforming through the extracting plasmid after with 1.2% agarose electrophoresis collection of illustrative plates behind BamHI and the EcoRI double digestion.Can see cut out behind 1,2,4,6 four plasmid enzyme restriction a segment between 500bp between the 750bp, with conforming to of expection.

Embodiment 3: express the foundation and the evaluation thereof of the Yeast engineering bacterium strain of IL15-Fc fusion rotein

Recombinant plasmid pPIC9K-IL15-Fc and control plasmid pPIC9K take out plasmid greatly, respectively get 5-10 μ g behind the SacI linearization for enzyme restriction, with electric shocking method transformed yeast bacterial strain GS115, transform the His of back with MD (glucose minimal medium) plate screening generation homologous recombination ⁺The clone.Water gets 10 with the whole mixings of clone that conversion obtains ⁵Individual yeast separate application (G418 concentration be respectively 0,0.25,0.5,0.75,1.0,1.5,1.75,2.0,3.0 and 4.0mg/ml) to the YPD flat board of G418 gradient resistance.Cultivated 2-5 days for 30 ℃.Among the BMGY of the sub-20ml of reorganization colony inoculation on several each gradient resistance plates of picking in the substratum, 30 ℃ of shake-flask culture, grow to cell concentration A600nm=2～6, centrifugal receipts bacterium, change (100ml) BMMY (containing 0.5% methyl alcohol) re-suspended cell with 5-10 times of volume, 30 ℃ are continued to cultivate 48h, and it is 0.5% that every 24hr adds methyl alcohol to final concentration.After inducing 72hr, get supernatant and do Dot blot, determine the bacterial strain that expression amount is high by the depth sxemiquantitative of colour developing with mouse-anti people Fc antibody.

Fig. 5 has shown it is the pulsating colour developing figure of mouse-anti people Fc that uses the Yeast engineering bacterium strain HRP mark of dot blotting expression screening IL15-Fc fusion rotein.As can be seen from the figure, two negative controls in the upper left corner do not develop the color.To reach the liquid colour developing the brightest and ranked third tabulation.We determine with this bacterial strain is expression strain.Be numbered KIF6.

The clone of this bacterial strain of picking is in the 5 μ l water that contain 25 unit yeast enzymes (lyticase), and 30 ℃ are incubated 10min ,-80 ℃ of 10min, and room temperature is centrifugal, and getting supernatant 2 μ l is template.According to homologous recombination principle design primer: 5 ' end primer adopts and yeast 5 ' AOX1 promotor homologous sequence, 3 ' end primer is the downstream primer of IL-15 gene, carry out the further screening positive clone of pcr amplification, with the negative contrast of empty carrier transformed clone of no gene insertion.Determine whether this clone contains the purpose segment.

The genome dna electrophoresis collection of illustrative plates of the expression strain that Fig. 6 is screened for the method with PCR increases.Used amplimer is IL15-FE and the Fc-RN among the embodiment 2.Sample 1 is bacterial strain KIF6 among Fig. 5, and 2 and 3 is two other highlighted bacterial strain among Fig. 5.4 are GS115 empty plasmid pPIC9K electricity commentaries on classics bacterial strain.PCR result shows, 1-3 has＞and the fragment of 1000bp, its size and IL15-Fc pulsating conforming to of fusion.Prompting purpose segment has been integrated in the zymic genomic dna.

The fermentation of embodiment 4. recombination microzymes

(a) seed culture

With the yeast bacterial classification KIF6 that embodiment 3 obtains, 0.1ml inoculates the seed culture medium into 100m1, and 30 ℃, 250rpm were cultivated 16-18 hour in shaking table, at OD ₆₀₀Photoabsorption is to stop to shake bacterium at 10 o'clock.

Seed culture based formulas: YNB13.4g/L, glycerine 20g/L, Biotin 0.4mg/L, potassium phosphate salt damping fluid 0.1mol/L, pH6.0.No mother bacterial liquid preparation with each component.

(b) preparation of fermentation tank culture medium

The main moiety of fermention medium is some inorganic salt, and its prescription is as follows: phosphoric acid (80%) 26.7ml/L, CaSO ₄2H ₂O0.93g/L, K ₂SO ₄18.2g/L, MgSO ₄7H ₂O14.9g/L, KOH4.13g/L, glycerine 40g/L adds deionized water to 1L.

Behind the autoclaving, during cultivating, every L adds the 0.1g defoamer, 4.35ml trace element (PTM1).

Trace element (PTM1) prescription:

Cupric sulfate pentahydrate-6.0g/L

NaI-0.08g/L

MnSO ₄·H ₂O-3.0g/L

Na ₂MoO ₄2H ₂O?0.2g/L

Boric acid-0.02g/L

CoCl ₂_0.5g/L

ZnCl ₂-20g/L

FeSO ₄·7H ₂O-65.0g/L

The vitriol oil-5.0ml/L

Vitamin H-0.2g/L

Add water to 1L, standby after the 0.22um filtration sterilization.

(c) connecing bacterium cultivates

Working volume is the fermentor tank of 5L, sterilization 2L substratum.100ml cultured seed nutrient solution is gone in inoculation, begins fermentation.Fermentation parameter is provided with as follows:

Stir speed (S.S.): 200-600rpm

Air flow (pressurized air): 2.0L/ minute

Tank pressure: 5.0PSI

Dissolved oxygen: 30%

PH value: 6.0

Temperature: 28.0 ℃

Use NH in the fermentation ₄OH and phosphoric acid are controlled the pH value automatically; When producing excess foam, with Antifoam204 (Sigma) 0.2ml froth breaking; Dissolved oxygen is controlled to be and the stir speed (S.S.) cascade, and dissolved oxygen is lower than at 30% o'clock and accelerates stirring velocity automatically, to satisfy the supply of oxygen.

(d) feed supplement is cultivated

Measure OD in the fermenting process ₆₀₀Optical density value is monitored saccharomycetic growing state.Cultivate after 26-28 hour, when the OD600 value reaches 180, can see that dissolved oxygen begins to have experienced lasting decline and keeps the rising suddenly of low-level back from rigidly connecting bacterium, illustrate that the glycerine in the substratum is exhausted, begin to replenish glycerine.Glycerine is 50% sterilization, adds 12ml/L PTM1 mixing.The speed of adding is the 15ml/hr/L fermented liquid.The feed supplement process is 4hr.

(e) inducing culture

Glycerine stops to add after replenishing 4hr, can see that dissolved oxygen of fermentation liquid rises, and illustrates that yeast growth slows down.Passed through again about two hours, allow glycerine in the fermented liquid be exhausted after, begin to add methyl alcohol, inducible protein is expressed.Add 12.5m1/L PTM1 liquid in the methyl alcohol of adding.The speed of adding is the 4g/hr/L fermented liquid.Abduction delivering 96 hours, OD at this moment ₆₀₀Value is more than 200.Culture supernatant is collected in 4 ℃ of centrifugal collections, detects through ELISA, and the Expression of Fusion Protein amount can reach 5～10mg/L.

The purifying of embodiment 5. genetically engineered people IL15/Fc fusion roteins

Fermenting culture is collected culture supernatant behind high speed centrifugation, culture supernatant is 20 times of 10KDPellicon (Millipore company) ultrafiltration and concentration through the ion molecular weight cut-off, and uses 50mM Tris, 150mM NaCl, pH7.5 transfering buffering liquid.Through centrifugal removal post precipitation, last sample is to using 50mM Tris, 150mM NaCl, the Protein A affinity column that pH7.5 damping fluid balance is good is washed the limit with level pad liquid with uv-absorbing after last sample is intact again, adopts the 50mM citrate buffer solution then, the direct wash-out of PH=3.4, after collecting elution fraction, with the 50mM Tris of 5 times of volumes, the pH8.0 dilution.Sample on this component is arrived through 50mM Tris/HCl, on the pH=8.0 damping fluid equilibrated Source15Q chromatography column, employing contains the 50mM Tris/HCl of 100mM NaCl, pH=8.0 buffer solution elution impurity, adopt the 50mM Tris/HCl that contains 200mM NaCl then, the pH=8.0 buffer solution elution contains the component of fusion rotein.Through above-mentioned purge process, the purity of target protein can reach more than 95%.

Embodiment 6 genetically engineered people IL15/Fc fusion roteins are identified and determination of activity

Carry out the SDS-PAGE cataphoretic determination with ordinary method: the IL15/Fc fusion rotein behind the purifying carries out conventional SDS-PAGE electrophoresis, and it is single band that the scanning of dyeing back records the IL15/Fc fusion rotein.Fig. 7 is that the SDS-PAGE electrophoresis of genetically engineered people IL15/Fc fusion rotein behind the purifying is identified photo.

Determination of biological activity test with CTLL-2 propagation: promptly adopt CTLL-2 to rely on strain, mtt assay mensuration purifying (unit is SI units/milligram).The result shows that adopting the IL-15-Fc finished product specific activity of embodiment 5 method purifying is 2 * 10 ⁷SI units/milligram.Fig. 8 has shown the result.Adopt the CTLL-2 cell proliferation method to detect fusion rotein biologic activity result, from interpretation as seen, fusion rotein promotes the ED of CTLL-2 propagation ₅₀＜0.5ng/ml, its specific activity answers＞2 * 10 ⁷U/mg.Through the vivo medicine-feeding tentative experiment, the IL-15-Fc fusion rotein is compared with original IL-15, promotes the NK cell-proliferation activity obviously to strengthen.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

1.Tagaya, Y., Bamford, R.N., De Filippis, A.P. and Waldmann .A., IL-15:A pleiotropic cytokine with diverse receptor/signaling pathways whose expressionis controlled at multiple levels.Immunity1996.4:329-336.

2.Grabstein, K.H., Eisenman, J., Shanebeck, K., Rauch, C., Srinivasan, S., Fung, V., Beers., Richardson, J., Schoenborn, M.A., Ahdieh, M., Johnson, L., Alderson, M.R., Watson, J.D., Anderson, D.M. and Giri, J.G., Cloning of a T cellgrowth factor that interacts with the γ chain of the interleukin-2receptor.Science 1994.264:965-968.

3.Burton, J.D., Bamford, R.N., Peters, C., Grant, P.A., Kurys, G., Goldman, C.K., Brennan, J., Roessler, E. and Waldmann, T.A., A lymphokine, provisionallydesignated interleukin T and produced by a human adult T cell leukemia line, stimulated T cell proliferation and the induction of lymphokine-activated killercells.Proc.Natl.Acad.Sci.USA1994.94:4935-4939.

4.Giri, J.G., Anderson, D.M., Kumaki, S., Park, L.S., Grabstein, K.H. and Cosman, D., IL-15, a novel T cell growth factor that shares activities andreceptor components with IL-2.J.Leukoc.Biol.1995.57:763-766.

5.De Jong, J.L. O., Farner, N.L., Widmer, M.B., Giri, J.G. and Sondel, P.M., Interaction of IL-15with the shared IL-2receptorg and+c subunit.J.Immunol1996.156:1339-1348.

6.Giri, J.G., Ahdieh, M., Eisenman, J., Shanebeck, K., Grabstein, K., KumakiS., Namen, A., Park, L.S., Cosman, D. and Anderson, D., EMBO are J.1994.13:2822-2830.

7.Bulfone-Paus, S., D ü rkop, H., Paus, R., Krause, H., Pohl, T. and Onu, A., Differential regulation of human T lymphoblast functions by IL-2 and IL-15.Cytokine1997.9:507-513.

8.Briard, D., Brouty-Boye, D., Azzarone, B., and Jasmin, C. (2002) .Fibroblastsfrom human spleen regulate NK cell differentiation from blood CD34 (+) progenitorsvia cell surface IL-15.J.Immunol.168,4326-4332.

9.Handi surya, A., Steiner, G.E., Stix, U., Ecker, R.C., Pfaffeneder-Mantai, S.Langer, D., Kramer, G., Memaran-Dadgar, N., and Marberger, M. (2001) .Differentialexpression of interleukin-15, a pro-inflammatory cytokine and T-cell growthfactor, and its receptor in human prostate.Prostate 49,251-262.

10.Yajima, T., Nishimura, H., Ishimitsu, R., Watase, T., Busch, D.H., Pamer, E.G.Kuwano, H., and Yoshikai, Y. (2002a) .Over expression of IL-15 in vivo increasesantigen-driyen memory CD8+T cells following a microbe exposure.J.Immunol.168,1198-1203.

11.Ahmad，A.，Ahmad，R.，Toma，E.，Morisset，R.，and?Menezes，J.(2000).Impairedinduction?of?IL-15in?response?to?herpes?simplex?virus?type?1?infection?inperipheral?blood?mononuclear?cells?of?HIV-infected?patients.AIDS?14，744-746.

12.Ahmad，R.，Sindhu，S.T.，Toma，E.，Morisset，R.，and?Ahmad，A.(2003).Studies?on?the?production?of?IL-15?in?HIV-infected/AIDS?patients.J.Clin.Immunol.23，81-90

13.Lin，S.J.，Roberts，R.L.，Ank，B.J.，Nguyen，Q.H.，Thomas，E.K.，andStiehm，E.R.(1998).Effect?of?interleukin(IL)-12?and?IL-15on?activated?naturalkiller(ANK)and?antibody-dependent?cellular?cytotoxicity(ADCC)in?HIV?infection.J.Clin.Immunol.18，335-345

Lin，S.J.，Roberts，R.L.，Ank，B.J.，Nguyen，Q.H.，Thomas，E.K.，andStiehm，E.R.(1997).Human?immunodeficiency?virus?(HIV)?type-1GP120-specific?cell-mediated?cytotoxicity(CMC)and?natural?killer(NK)activity?in?HIV-infected?(HIV+)?subjects：enhancement?withinterleukin-2(IL-2)，IL-12，and?IL-15.Clin.Immunol.Immunopathol.82，163-173

Sequence table

＜110〉Kangtai Biotechnology Co., Ltd., Zhejiang Univ.

＜120〉human interleukin 15 and Fc fusion rotein

<130>047333

<160>4

<170>PatentIn?version3.1

<210>1

<211>345

<212>PRT

＜213〉artificial sequence

<400>1

Asn?Trp?Val?Asn?Val?Ile?Ser?Asp?Leu?Lys?Lys?Ile?Glu?Asp?Leu?Ile

1 5 10 15

Gln?Ser?Met?His?Ile?Asp?Ala?Thr?Leu?Tyr?Thr?Glu?Ser?Asp?Val?His

20 25 30

Pro?Ser?Cys?Lys?Val?Thr?Ala?Met?Lys?Cys?Phe?Leu?Leu?Glu?Leu?Gln

35 40 45

Val?Ile?Ser?Leu?Glu?Ser?Gly?Asp?Ala?Ser?Ile?His?Asp?Thr?Val?Glu

50 55 60

Asn?Leu?Ile?Ile?Leu?Ala?Asn?Asn?Ser?Leu?Ser?Ser?Asn?Gly?Asn?Val

65 70 75 80

Thr?Glu?Ser?Gly?Cys?Lys?Glu?Cys?Glu?Glu?Leu?Glu?Glu?Lys?Asn?Ile

85 90 95

Lys?Glu?Phe?Leu?Gln?Ser?Phe?Val?His?Ile?Val?Gln?Met?Phe?Ile?Asn

100 105 110

Thr?Ser?Glu?Phe?Glu?Ser?Lys?Tyr?Gly?Pro?Pro?Cys?Pro?Ser?Cys?Pro

115 120 125

Ala?Pro?Glu?Phe?Leu?Gly?Gly?Pro?Ser?Val?Phe?Leu?Phe?Pro?Pro?Lys

130 135 140

Pro?Lys?Asp?Thr?Leu?Met?Ile?Ser?Arg?Thr?Pro?Glu?Val?Thr?Cys?Val

145 150 155 160

Val?Val?Asp?Val?Ser?Gln?Glu?Asp?Pro?Glu?Val?Gln?Phe?Ash?Trp?Tyr

165 170 175

Val?Asp?Gly?Val?Glu?Val?His?Asn?Ala?Lys?Thr?Lys?Pro?Arg?Glu?Glu

180 185 190

Gln?Phe?Asn?Ser?Thr?Tyr?Arg?Val?Val?Ser?Val?Leu?Thr?Val?Leu?His

195 200 205

Gln?Asp?Trp?Leu?Asn?Gly?Lys?Glu?Tyr?Lys?Cys?Lys?Val?Ser?Asn?Lys

210 215 220

Gly?Leu?Pro?Ser?Ser?Ile?Glu?Lys?Thr?Ile?Ser?Lys?Ala?Lys?Gly?Gln

225 230 235 240

Pro?Arg?Glu?Pro?Gln?Val?Tyr?Thr?Leu?Pro?Pro?Ser?Gln?Glu?Glu?Met

245 250 255

Thr?Lys?Asn?Gln?Val?Ser?Leu?Thr?Cys?Leu?Val?Lys?Gly?Phe?Tyr?Pro

260 265 270

Ser?Asp?Ile?Ala?Val?Glu?Trp?Glu?Ser?Asn?Gly?Gln?Pro?Glu?Asn?Asn

275 280 285

Tyr?Lys?Thr?Thr?Pro?Pro?Val?Leu?Asp?Ser?Asp?Gly?Ser?Phe?Phe?Leu

290 295 300

Tyr?Ser?Arg?Leu?Thr?Val?Asp?Lys?Ser?Arg?Trp?Gln?Glu?Gly?Asn?Val

305 310 315 320

Phe?Ser?Cys?Ser?Val?Met?His?Glu?Ala?Leu?His?Asn?His?Tyr?Thr?Gln

325 330 335

Lys?Ser?Leu?Ser?Leu?Ser?Leu?Gly?Lys

340 345

<210>2

<211>1046

<212>DNA

＜213〉artificial sequence

<400>2

aactgggtga?atgtaataag?tgatttgaaa?aaaattgaag?atcttattca?atctatgcat 60

attgatgcta?ctttatatac?ggaaagtgat?gttcacccca?gttgcaaagt?aacagcaatg 120

aagtgctttc?tcttggagtt?acaagttatt?tcacttgagt?ccggagatgc?aagtattcat 180

gatacagtag?aaaatctgat?catcctagca?aacaacagtt?tgtcttctaa?tgggaatgta 240

acagaatctg?gatgcaaaga?atgtgaggaa?ctggaggaaa?aaaatattaa?agaatttttg 300

cagagttttg?tacatattgt?ccaaatgttc?atcaacactt?ctggatccga?gtccaaatat 360

ggtcccccat?gcccatcatg?cccagcacct?gagttcctgg?ggggaccatc?agtcttcctg 420

ttccccccaa?aacccaagga?cactctcatg?atctcccgga?cccctgaggt?cacgtgcgtg 480

gtggtggacg?tgagccagga?agaccccgag?gtccagttca?actggtacgt?ggatggcgtg 540

gaggtgcata?atgccaagac?aaagccgcgg?gaggagcagt?tcaacagcac?gtaccgtgtg 600

gtcagcgtcc?tcaccgtcct?gcaccaggac?tggctgaacg?gcaaggagta?caagtgcaag 660

gtctccaaca?aaggcctccc?gtcctccatc?gagaaaacca?tctccaaagc?caaagggcag 720

ccccgagagc?cacaggtgta?caccctgccc?ccatcccagg?aggagatgac?caagaaccag 780

gtcagcctga?cctgcctggt?caaaggcttc?taccccagcg?acatcgccgt?ggagtgggag 840

agcaatgggc?agccggagaa?caactacaag?accacgcctc?ccgtgctgga?ctccgacggc 900

tccttcttcc?tctacagcag?gctaaccgtg?gacaagagca?ggtggcagga?ggggaatgtc 960

ttctcatgct?ccgtgatgca?tgaggctctg?cacaaccact?acacacagaa?gagcctctcc 1020

ctgtctctgg?gtaaataagc?ggccgc 1046

<210>3

<211>36

<212>DNA

＜213〉artificial sequence

<400>3

gagtccaagt?acggtccacc?atgtccatcc?tgtcca 36

<210>4

<211>12

<212>PRT

＜213〉artificial sequence

<400>4

Glu?Ser?Lys?Tyr?Gly?Pro?Pro?Cys?Pro?Ser?Cys?Pro

1 5 10

Claims (9)

1. fusion rotein, it is characterized in that, this fusion rotein comprises human normal immunoglobulin Fc fragment, interleukin 15, and wherein said human normal immunoglobulin Fc fragment is connected by joining peptide with interleukin 15, and the aminoacid sequence of described fusion rotein is SEQ ID NO:1.

2. fusion rotein as claimed in claim 1 is characterized in that, described immunoglobulin Fc fragment comprises CH2, CH3 and the CH4 structural domain of heavy chain immunoglobulin.

3. fusion rotein as claimed in claim 1 is characterized in that, described immunoglobulin Fc fragment is the CH of human normal immunoglobulin IgG4.

4. the nucleic acid of coding claim 1 described fusion rotein.

5. nucleic acid as claimed in claim 4 is characterized in that, the nucleotide sequence of this nucleic acid is SEQ ID NO:2.

6. contain the described expression of nucleic acids carrier of claim 4.

7. a pharmaceutical composition is characterized in that, this pharmaceutical composition contains acceptable carrier on described fusion rotein of claim 1 and the pharmacology thereof.

8. the purposes of the described pharmaceutical composition of claim 7 is characterized in that, described purposes is the medicine of preparation anti-microbial infection.

9. method of producing the described fusion rotein of claim 1 comprises step:

In host cell, express the described expression vector of claim 6.

Images