CA3042401A1 - 5-halouracil-modified micrornas and their use in the treatment of cancer - Google Patents

5-halouracil-modified micrornas and their use in the treatment of cancer Download PDF

Info

Publication number
CA3042401A1
CA3042401A1 CA3042401A CA3042401A CA3042401A1 CA 3042401 A1 CA3042401 A1 CA 3042401A1 CA 3042401 A CA3042401 A CA 3042401A CA 3042401 A CA3042401 A CA 3042401A CA 3042401 A1 CA3042401 A1 CA 3042401A1
Authority
CA
Canada
Prior art keywords
mir
seq
nucleotide sequence
nucleic acid
modified
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CA3042401A
Other languages
French (fr)
Inventor
Jingfang Ju
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Research Foundation of State University of New York
Original Assignee
Research Foundation of State University of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Research Foundation of State University of New York filed Critical Research Foundation of State University of New York
Publication of CA3042401A1 publication Critical patent/CA3042401A1/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/335—Modified T or U
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3533—Halogen

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present disclosure provides nucleic acid compositions that incorporate one or more halouracil molecules. More specifically, the present disclosure reveals that the replacement of uracil nucleotides within a microRNA nucleotide sequence with a 5-halouracil increases the ability of the micro-RNA to inhibit cancer progression and tumorigenesis. As such, the present disclosure provides various nucleic acid (e.g., microRNA) compositions having 5-halouracil molecules incorporated in their nucleic acid sequences and methods for using the same. The present disclosure further provides pharmaceutical compositions (e.g., formulations) comprising the modified nucleic acid compositions, and methods for treating cancers, such as colorectal, pancreatic and lung cancer.

Description

TREATMENT OF CANCER
CROSS REFERENCE TO RELATED APPLICATIONS
100011 This application claims priority from U.S. Provisional Application No.
62/464,491, filed February 28, 2017; U.S. Provisional Application No. 62/422,298, filed November 15, 2016 and U.S. Provisional Application No. 62/415,740, filed November 1, 2016, the entire contents of which are incorporated herein by reference.
GOVERNMENT SUPPORT
[0002) The present disclosure was made with government support under grant numbers HL127522 and CA19709802 awarded by the National Institutes of Health. The government has certain rights in the disclosure.
INCORPORATION BY REFERENCE OF SEQUENCE LISTING
100031 The Sequence Listing in the ASCII text file, named as R8859 _ PCT_ SequenceListing.txt of 7 KB, created on October 30, 2017, and submitted to the United States Patent and Trademark Office via EFS-Web, is incorporated herein by reference.
FIELD OF TH E DISCLOSURE
100041 The present disclosure is generally directed to compositions and methods for treating cancer, and more particularly, to methods in which modified microRNAs alone or in conjunction with 5-fluorouracil are used in treating cancer, particularly colorectal, lung or pancreatic cancer.
BACKGROUND
100051 MicroRNAs (miRNAs, miRs) are a class of highly conserved, non-coding small RNA molecules that mediate translation in a cell or organism by negatively regulating the expression of their target genes and thus causing translational arrest, mRNA
cleavage or a combination thereof. See Bartel DP. Cell. (2009) 136(2):215-33. By targeting multiple transcripts, miRNAs regulate a wide range of biological processes, including apoptosis, differentiation and cell proliferation, thus aberrant microRNA function can lead to cancer (see Ambros V. Nature. (2004) 431(7006):350-5) and as such, miRNAs have recently been identified as as biomarkers, oncogenes or tumor suppressors. See, e.g., Croce, CM, Nat Rev Genet. (2009) 10:704-714).
[0006] Colorectal cancer (CRC) is the third most common malignancy and the second most common cancer-related cause of death in the United States. See, Hegde SR, et al., Expert review qf gastroenterology & hepatology. (2008) 2(1):135-49. There are many chemotherapeutic agents used to treat cancer; however pyrimidine antagonists, such as fluoropyrimidine-based chemotherapeutic agents (e.g., 5-fluorouracil, S-1) are the gold standard for treating colorectal cancer. Pyrimidine antagonists, block the synthesis of pyrimidine containing nucleotides (Cytosine and Thymine in DNA; Cytosine and Uracil in RNA). Because pyrimidine antagonists have similar structures when compared to endogenous nucleotides, they compete with the natural pyrimidines to inhibit crucial enzymatic activity involved in the replication process leading to the prevention of DNA
and/or RNA synthesis and inhibition of cell division.
[0007] Pancreatic cancer is a deadly cancer that is very difficult to treat.
See Siegel, RL et al. CA Cancer J. Clin. (2015) 65: 5-29. Unique aspects of pancreatic cancer include a very low 5 year survivial rate of less than 7% (Id.), late presentation, early metastasis and a poor response to chemotherapy and radiation. See Maitra A and Hruban RH, Annu Rev.
Pathol.
(2008) 3:157-188. To date gemcitabine-based chemotherapy (2', 2'-difluoro 2'deoxycytidine) is the gold standard for the treatment of pancreatic cancer, however the effect of therapeutic intervention is limited due to drug resistance. Oettle, H et al. JAMA
(2013) 310: 1473-1481.
[0008] 5-fluorouracil (i.e., 5-FU, or more specifically, 5-fluoro-1H-pyrimidine-2,4-dione) is a well known pyrimidine antagonist that is used in many adjuvant chemotherapeutic medicants, such as Carac cream, Efudex , Fluoroplex , and Adrucil . It is well established that 5-FU targets a critical enzyme, thymidylate synthase (TYMS or TS), which catalyzes the methylation of deoxyuridine monophosphate (dUMP) to deoxythymidine monophosphate (dT1v1P) an essential step in DNA biosynthesis. Danenberg P. V., Biochim.
Biophys. Acta. (1977) 473(2):73-92. However, despite the steady improvement of based therapy, the patient response rate to 5-FU-based chemotherapy remains modest, due to the development of drug resistance. Longley D. B, et al., Apoptosis, Cell Signaling, and Human Diseases, (2007) p. 263-78.
100091 Nevertheless, the existing cancer therapies are still in their infancy, with many hurdles still waiting to be improved or overcome. For example, it is well known that, although 5-FU is fairly efficacious in treating a variety of cancers, 5-FU
possesses substantial toxicity and can elicit a host of adverse side effects. With respect to miRNAs, these compounds are known to be susceptible to enzymatic degradation when administered, which results in poor stabilities. Moreover, tumor cells have been known to circumvent apoptotic pathways by developing resistance to common therapeutic agents, such as 5-FU
and gemcitabine. See Gottesman M. M. et al., Nature Reviews Cancer, (2002) 2(1):48-58.
Thus, there would be a significant benefit in more efficacious, stable, and less toxic medications for the treatment of cancer.
SUMMARY OF THE DISCLOSURE
100101 The current disclosure demonstrates that nucleic acid compositions (i.e., a microRNA), which incorporate a 5-halouracil base have exceptional efficacy as anti-cancer agents. Moreover, the data herein shows that contacting a cell with a modified microRNA
composition of the present disclosure regulates cell cycle progression and reduced tumorigenesis by, for example, reducing cancer cell proliferation and increasing the efficacy of chemotherapeutic agents. The present disclosure is premised on the discovery that the incorporation of 5-halouracil bases within the nucleotide sequences of microRNAs increases microRNA efficacy as an anticancer therapeutic agent over the cancer therapeutic agents alone and/or the native microRNA.
100111 Therefore, in one aspect of the present disclosure nucleic acid compositions that include a modified microRNA nucleotide sequence having at least one uracil base (U, U
3 bases) that has been replaced by a 5-halouracil, such as 5-fluorouracil (5-FU) are described.
In certain embodiments, the modified microRNA has more than one, or exactly one uracil that has been replaced by a 5-halouracil. In some embodiments, the modified microRNA
nucleotide sequence includes two, three, four, five, six, seven, eight or more uracil bases that have been replaced by a 5-halouracil. In other embodiments, all of the uracil nucleotide bases of the modified mRNA have been replaced by a 5-halouracil.
100121 In some embodiments, the 5-halouracil is, for example, 5-fluorouracil, chlorouracil, 5-bromouracil, or 5-iodouracil. In specific embodiments, the 5-halouracil is 5-fluorouracil.
100131 In certain embodiments, the modified microRNA nucleotide sequence includes more than one 5-halouracil whereby each of the 5-halouracils are the same. In other embodiments, the modified microRNA nucleotide sequence includes more than one halouracil whereby each of the 5-halouracils is different. In other embodiments, the modified microRNA nucleotide sequence includes more than two 5-halouracils, whereby the modified microRNA nucleotide sequence includes a combination of different 5-halouracils.
100141 In an exemplary embodiment of the present disclosure, a nucleic acid composition that contains a miR-129 nucleotide sequence that has been modified by replacing at least one of the uracil nucleotide bases with a 5-halouracil is provided. More specifically, the nucleic acid composition contains at least the following native miR-129 nucleotide sequence: CUUUUUGCGGUCUGGGCUUGC [SEQ ID NO. 1], wherein at least one, two, three, four, five, six, seven, eight or all of the uracil bases in the shown nucleic acid sequence or that may be covalently appended to the shown sequence, are replaced by a 5-halouracil.
100151 In a specific embodiment of the present disclosure, the modified microRNA has nucleic acid sequence consisting of CUFuFuFuFuFGc GGuFcuFGGGcuFuFGC [SEQ ID
NO. 4], wherein UF is a halouracil, specifically 5-fluorouracil.
100161 In other embodiments, a seed portion of the native miR-129 nucleotide sequence, GUUUUUGC remains unmodified (i.e., does not include a 5-halouracil) while one or more
4 (or all) of the remaining uracil nucleotide bases in the remainder of the modified miR-129 nucleotide sequence are replaced by an equivalent number of 5-ha1ouracils. In a specific embodiment, the modified miR-129 microRNA of the present disclosure has nucleic acid sequence consisting of CUUUUUGCGGUFCUFGGGCUFUFGC [SEQ ID NO. 5], whereby UF is a halouracil, specifically 5-fluorouracil.
[0017] In some embodiments, the 5-halouracil is, for example, 5-fluorouracil,
5-chlorouracil, 5-bromouracil, or 5-iodouracil. In specific embodiments, the 5-halouracil is 5-fluorouracil.
[0018] In another embodiment of the present disclosure, nucleic acid compositions that contain a miR-15a nucleotide sequence that has been modified by replacing at least one of the uracil nucleotide bases with a 5-halouracil, such as 5-fluorouracil (5-FU) are provided.
Specifically, the nucleic acid composition contains at least the following native miR-15a nucleotide sequence: UAGCAGCACAUAAUGGUUUGUG [SEQ ID NO. 2], wherein at least one, two, three, four, five, six or all of the uracil nucleotide bases in the shown sequence, or that may be covalently appended to the shown sequence, are 5-halouracils.
[0019] In a specific embodiment of the present disclosure, the modified miR-15a microRNA has nucleic acid sequence consisting of UFAGCAGCACAUFAAUFGGUFUFUFGUFG [SEQ ID NO. 6], wherein UF is a halouracil, specifically 5-fluorouracil.
[0020] In other embodiments, a seed portion of the native miR-15a nucleotide sequence, UAGCAGCA, remains unmodified with a 5-halouracil, while one or more (or all) of the remaining uracil bases in the remainder of the miR-15a nucleotide sequence (non-seed portion) are replaced by a 5-halouracil.
[0021] In a specific embodiment, the modified miR-129 microRNA has nucleic acid sequence consisting of UAGCAGCACAUF
AAuFGGuFuFuFGu FG [SEQ ID NO. 7], wherein UF is a halouracil, specifically 5-fluorouracil.
[0022] In another exemplary embodiment, the present disclosure is directed to nucleic acid compositions that include a miR-140 nucleotide sequence that has been modified. In some embodiments, the native miR-140 nucleotide sequence has been modified by replacing at least one of the U bases with a 5-halouracil.
100231 In one set of embodiments, precisely one of the U bases in the native mi R-140 nucleic acid sequence sequence is a 5-halouracil. In a second set of embodiments, precisely or at least two U bases in the native miR-140 nucleotide sequence are replaced by 5-halouracils. In another set of embodiments, precisely or at least three U
bases in the miR-140 nucleotide sequence are 5-halouracils. In other embodiments, precisely or at least four U
bases in the native miR-140 nucleotide sequence are 5-halouracils. In some embodiments, precisely or at least five U bases in the miR-140 nucleotide sequence sequence are 5-halouracil s. In a yet other embodiments, precisely or at least six U bases in the mi R-140 nucleotide sequence are 5-halouracils. In specific embodiments, all of the U
bases in the mi R-140 nucleotide sequence, whether in the native and/or in an appended portion, are 5-halouracils.
100241 In an exemplary embodiment, the modified microRNA nucleic acid composition of the present disclosure has a nucleotide sequence of CAGUFGGUUUUACCCUFAUGGUFAG [SEQ ID NO. 9], wherein UF is a halouracil, specifically 541 El orouracil.
100251 In another exemplary embodiment, the present disclosure is directed to nucleic acid compositions that include a modified native miR-192 or miR-215 nucleotide sequence that has been modified by replacing at least one of the uracil bases with a 5-halouracil. In some embodiments, the modified miR-192 nucleotide sequence has been modified by replacing at least one of the U bases with a 5-fluorouracil.
100261 In another set of embodiments, precisely one of the U bases in the modified miR-192 nucleotide sequence is a 5-halouracil. In a second set of embodiments, precisely or at least two U bases in the modified miR-192 nucleotide sequence are 5-halouracils. In another set of embodiments, precisely or at least three U bases in the modified miR-192 nucleotide sequence are 5-halouracils. In other embodiments, precisely or at least four U
bases in the modified miR-192 or miR-215 nucleotide sequence are 5-halouracils. In specific
6 embodiments, all of the U bases in the modified miR-192 or miR-215 sequence, whether in the native and/or in an appended portion of the nucleic acid, are 5-halouracils.
[0027] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-192 or modified miR-215 nucleotide sequence of CUFGACCUFAUFGAAUFUFGACAGCC [SEQ ID NO. 11], wherein UF is a halouracil, specifically 5-fluorouracil.
100281 In another exemplary embodiment, the present disclosure is directed to nucleic acid compositions that include a modified native mi R-502 nucleotide sequence that has been modified by replacing uracil with 5-halouracil. In some embodiments, the modified miR-502 nucleotide sequence has been modified by replacing at least one of the U
bases with a 5-fluorouracil.
100291 In another set of embodiments, precisely one of the U bases in the miR-nucleotide sequence is a 5-halouracil. In a second set of embodiments, precisely or at least two U bases in the miR-502 nucleotide sequence are 5-halouracils. In another set of embodiments, precisely or at least three U bases in the miR-502 nucleotide sequence are 5-halouracils. In other embodiments, precisely or at least four U bases in the miR-502 nucleotide sequence are 5-halouracils. In other embodiments, precisely or at least five U
bases in the miR-502 nucleotide sequence are 5-halouracils. In other embodiments, precisely or at least six U bases in the modified miR-502 nucleotide sequence are 5-halouracils. In other embodiments, precisely or at least seven U bases in the miR-502 nucleotide sequence are 5-halouracils. In specific embodiments, all of the U bases in the miR-502 nucleotide sequence, whether in the native and/or in an appended portion, are 5-halouracils.
100301 In an exemplary embodiment, the modified miR-502 nucleic acid composition of the present disclosure has a modified nucleotide sequence of AUFCCUFUFGCUAUFCUFGGGUFGCUFA [SEQ ID NO. 13], wherein UF is a halouracil, specifically 5-fluorouracil.
100311 In another exemplary embodiment, the present disclosure is directed to nucleic acid compositions that include a modified miR-506 nucleotide sequence that includes a 5-
7
8 PCT/US2017/059011 halouracil. In some embodiments, the modified miR-506 nucleotide sequence has been modified by replacing at least one of the U bases with a 5-halouracil, such as 5-fluorouracil.
100321 In another set of embodiments, precisely one of the U bases in the native mi R-506 nucleotide sequence is replaced by a 5-halouracil. In a second set of embodiments, precisely or at least two U bases in the modified miR-506 nucleotide sequence are 5-ha1ouracils. In another set of embodiments, precisely or at least three U bases in the modified miR-506 nucleotide sequence are 5-ha1ouracils. In other embodiments, precisely or at least four U
bases in the modified miR-506 nucleotide sequence are 5-halouracils. In other embodiments, precisely or at least five U bases in the modified miR-506 nucleotide sequence are 5-halouracils. In other embodiments, precisely or at least six U
bases in the modified miR-506 nucleotide sequence are 5-halouracils. In other embodiments, precisely or at least seven U bases in the modified miR-506 nucleotide sequence are 5-halouracils. In specific embodiments, all of the U bases in the modified miR-506 nucleotide sequence, whether in the native and/or in an appended portion, are 5-halouracils.
100331 In an exemplary embodiment, the miR-506 nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence of UFAUFUFCAGGAAGGUFGUFUFACUFUFAA [SEQ ID NO. 15], wherein UF is a halouracil, specifically 5-fluorouracil.
100341 In some embodiments, the 5-halouracil is, for example, 5-fluorouracil, chlorouracil, 5-bromouracil, or 5-iodouracil. In specific embodiments, the 5-halouracil is 5-fluorouracil, or a combination thereof.
100351 The present disclosure is also directed to formulations of a modified microRNA
composition described herein or a formulation that includes combinations thereof. In certain embodiments, the formulations can include pharmaceutical preparations that comprise the above-described nucleic acid compositions and a pharmaceutically acceptable carrier.
100361 In another aspect, the present disclosure is directed to a method for treating cancer that includes administering to a subject an effective amount of one or more of nucleic acid compositions described herein. In certain embodiments of the present methods, the nucleic acid compositions include a modified miR-129, miR-15a, mi R-192, miR-215, miR-140, miR-502 or miR-506 nucleotide sequence wherein at least one, two, three, four, five, six or more of the uracil nucleotide bases in the native (unmodified) nucleotide sequence have been replaced by a 5-halouracil. In specific embodiments, the present methods include administering a nucleic acid composition of the present disclosure to a subject having cancer or a predisposition to cancer, whereby the nucleic acid composition is a modified miR-129 or a modified mi R-15a nucleic acid. In a specific embodiment of the present disclosure, the modified microRNA administered has nucleic acid sequence selected from the group consisting of CUFUFUFUFUFGCGGUFCUFGGGCUFUFGC [SEQ ID NO. 4], CUUUUUGCGGUFCUFGGGCUFUFGC [SEQ ID NO. 5], UFAGCAGCACAUFAAUFGGUFUFUFGUFG [SEQ ID NO.6], UAGCAGCACAUFAAUFGGUFUFUFGUFG [SEQ ID NO. 7], CAGUFGGUUUUACCCUFAUGGUFAG [SEQ ID NO. 9], CUFGACCUFAUFGAAUFUFGACAGCC [SEQ ID NO. 11], AUFCCUFUFGCUAUFCUFGGGUFGCUFA [SEQ ID NO. 13], and UFAUFUFCAGGAAGGUFGUFUFACUFUFAA [SEQ ID NO. 15].
100371 In certain embodiments, the subject is a mammal. In other embodiments, the subject being treated is a human, dog, horse, pig, mouse, or rat. In a specific embodiment, the subject is a human that has been diagnosed with cancer, or has been identified as having a predisposition to developing cancer. In some embodiments, the cancer being treated can be, for example, colorectal, stomach, esophageal, lung, ovarian, pancreatic, or cervical cancer. In certain embodiments, the methods of the present disclosure treat a subject for colorectal cancer, pancreatic cancer or breast cancer.
100381 The data provided herein surprisingly shows an increased potency of the modified microRNAs described herein when compared to known anticancer agents, such as 5-FU
alone in several different cancer models, including colorectal cancer, pancreatic cancer, and lung cancer. For example, the present disclosure provides the unexpected finding that the described modified nucleic acid compositions are substantially more potent in inhibiting cancer progression and tumorigenesis than 5-FU, mi R-15a, mi R-129, miR-140, miR-192,
9 miR-215, miR-502 or miR-506 alone, or than a combination of 5-FU and corresponding native microRNAs.
100391 As such, the present compositions and methods provide the additional benefit of permitting a lower dosing, which results in lower toxicity and fewer side effects. A further significant advantage exhibited by the described nucleic acid compositions is that the instant compositions have significantly improved efficacy compared to miR-140, miR-192, miR-215, miR-502 or miR-506 sequences that have not been modified with a halouracil. Thus, at least in view of the noted advantages, the nucleic acid compositions disclosed herein represent a substantial advance in the treatment of cancer.
BRIEF DESCRIPTION OF THE DRAWINGS
100401 FIGS. 1A-1H. Chemical representation of exemplary modified microRNA
nucleotide sequences of the present disclosure. (A) Chemical representation of mi R-129 nucleotide sequence in which all U bases are replaced by a halouracil (i.e., UF), as set forth in SEQ ID NO: 4. (B) Chemical representation of miR-129 in which only the non-seed portion of miR-129 has U bases replaced with halouracils), as set forth in SEQ
ID NO: 5.
(C) Chemical representation of miR-15a nucleotide sequence in which all U
bases are replaced with a halouracil), as set forth in SEQ ID NO: 6. (D) Chemical representation of miR-15a in which only the non-seed portion of miR-15a has U bases replaced with halouracils), as set forth in SEQ ID NO: 7. (E) Chemical representation of the miR-140 nucleotide sequence in which certain (3) U bases are replaced by a halouracil as set forth in SEQ ID NO: 9. (F) Chemical representation of the miR-192 nucleotide sequence in which certain (5) U bases are replaced by a halouracil as set forth in SEQ ID NO:
11. (G) Chemical representation of the miR-502 nucleotide sequence in which certain (7) U bases are replaced by a halouracil as set forth in SEQ ID NO: 13. (H) Chemical representation of the miR-506 nucleotide sequence in which all (i.e., 8) U bases are replaced by a halouracil as set forth in SEQ ID NO: 15.
100411 FIGS. 2A-C. Exemplary modified miR-129 nucleic acids enter cancer cells and effectively reduce target protein expression. (A) Graph showing target (E2F3) specificity and the ability of a modified miR-129 (with all U bases replaced with 5-FU, 5-FU-miR-129) compared to that of control miRNA, and an unmodified miR-129 nucleic acid. (B) A
quantitative Real-Time PCR analysis showing that miR-129 mimics enter cancer cells. (C) MiR-129 mimics enter a cancer cell and break downs TS-FdUIvIP significantly better than 5-FU alone.
100421 FIG. 3. Graphs showing inhibition of colon cancer cell proliferation in 4 different colon cancer cell lines (HCT116, RKO, SW480 and SW620) by an exemplary modified miR-129 nucleic acid (mimic) having all U bases replaced by 5-FU (- -), as compared to a non-specific (Negative control.) control and ectopically expressed native miR-129 (0).
100431 FIG. 4. Combination therapy with 5-FU and modified microRNA
compositions of the present disclosure effectively inhibit cancer cell proliferation.
Graphical comparison of colon cancer cell proliferation for cancer cells treated with a negative control (NC), native mi R-129, 5-FU, an exemplary modified miR-129 nucleic acid mimic of the present disclosure (5-FU-miR-129), and a combination of 5-FU and the exemplary miR-129 mimic of the present disclosure (5-FU-miR-129 + 5-FU).
100441 FIGS. 5A-B. Exemplary microRNA mimics induce apoptosis in colon cancer cells and cause cell cycle arrest. (A) Cell death was quantified by FITC-Annexin V
apoptosis assay to show that modified miR-129 nucleic acid compositions of the present disclosure induce cancer cell apoptosis at significantly higher levels than negative controls, or ectopically expressed native miR-129 in several different colorectal cancer cell lines. (B) Flow cytometiy was conducted to reveal that modified miR-129 nucleic acid compositions (IvIimic-1) of the present disclosure increase GI cell cycle arrest at significantly higher levels than negative controls, or ectopically expressed native miR-129.
100451 FIG. 6. Modified MicroRNA nucleic acid compositions of the present disclosure eliminate chemotherapy resistant cancer stem cells. HCT116 derived colon cancer stem cells were treated with increasing concentrations of exemplary modified miR-129 nucleic acids of the present disclosure (0) or 5-FU (0). Results show that modified miR-129 nucleic acids killed 5-FU resistance cancer stem cells in a dose dependent manner.

100461 FIG. 7. In vivo systemic treatment with exemplary modified miR-129 nucleic acid compositions inhibits colon cancer metastasis without toxic side effects. A
colon cancer metastasis mouse model was established via tail vein injection of metastatic human colon cancer cells. Two weeks after establishing metastasis, 40 lig of a modified miR-129 nucleic acid composition, as set forth in SEQ ID NO: 4 was delivered by intravenous injection with a treatment frequency of one injection every other day for two weeks. The exemplary modified mi R-129 nucleic acid (mimic) was able to inhibit colon cancer metastasis (right panels) while negative control miRNA (left panels) had no effect. Mice treated with modified miR-129 nucleic acid did not exhibit any toxicity.
100471 FIGS. 8A-B. Anti cancer activity of a second exemplary modified microRNA of the present disclosure. (A) Representative western blots comparing the ability of unmodified mi R-15a (miR-15a) and a modified mi R-15a nucleic acid composition (mimic-1) to modulate protein expression in colon cancer cells. Modified miR-15a, as set forth in SEQ ID
NO: 6 (mimic-1) retains the ability to regulate miR-15a targets (YAP!, BMI-1, DCLK1 and ECL2) and break downs TS-FdUMP in colorectal cancer cells. (B) Modified miR-15a (mimic-1) showed enhanced ability to inhibit colon cancer cell proliferation in three different colorectal cancer cell lines (HCT116, RKO, SW620) compared to unmodified miR-15a (miR-15a).
100481 FIG. 9. Graph showing cell cycle control for control (Negative), unmodified miR-15a (miR-15a) and an exemplary modified miR-15a nucleic acid compositon as set forth in SEQ ID NO: 6 (mimic-1). Administration of modified miR-15a nucleic acid induced cell cycle arrest compared to unmodified mi R-15a as shown by an increased Gl/S
ratio exhibited by colorectal cancer cells expressing modified miR-15a when compared to cells ectopically expressing native miR-15a and negative controls.
100491 FIG. 10. Modified miR-15a expression reduces the ability of cancer stem cells to induce cancer cell colony formation. In colon cancer stem cells, expression of unmodified mi R-15a (miR-15a) inhibited cancer cell colony formation when compared to the ability of cancer stem cells provided with a non-specific control microRNA (Negative).
Treatment with an exemplary modified miR-15a (5-FU-miR-15a) of the present disclosure prevented cancer cell colony formation completely.
100501 FIG. 11. Modified miR-15a is an effective anti cancer agent in vivo. A
colon cancer metastasis mouse model was established via tail vein injection of metastatic human colon cancer cells. Two weeks after establishing the metastasis, 40 lig of a modified miR-15a nucleic acid composition as set forth in SEQ ID NO: 6 was delivered by intravenous injection with treatment frequency of one injection every other day for two weeks. The exemplary modified miR-15a nucleic acid (mimic) was able to inhibit colon cancer metastasis while negative control miRNA (negative) had no effect. Mice treated with modified miR-15a nucleic acid did not exhibit any toxicity.
100511 FIGS. 12 A-D. Exemplary modified miR-15a and miR-129 mimics of the present disclosure exhibit enhanced ability to inhibit human breast cancer (A549;C,D) and pancreatic cancer (Panc-1(A); AsPC-1(B)) cell proliferation compared to unmodified miR-15a (miR-15a) or unmodified miR-129 (miR-129) or cells treated with negative controls.
100521 FIGS. 13 A-B. Exemplary modified microRNAs of the present disclosure exhibit an enhanced ability to inhibit human colorectal cancer cell proliferation.
Additional exemplary modified microRNAs were tested for their ability to inhibit colorectal cancer cell proliferation in HCT116 human colorectal cancer cells. (A) An exemplary modified miR-140 mimic as set forth in SEQ ID NO: 9 was administered to human colorectal cancer cells and revealed an increased ability to inhibit colorectal cancer cell proliferation when compared to negative control microRNAs. (B) An exemplary modified miR-192 mimic as set forth in SEQ NO: 11 was administered to human colorectal cancer cells and revealed an increased ability to inhibit colorectal cancer cell proliferation when compared to negative control microRNAs.
100531 FIGS. 14A-D. Exemplary modified microRNAs of the present disclosure exhibit an enhanced ability to inhibit human pancreatic and breast cancer cell proliferation.
Additional exemplary modified microRNAs were tested for their ability to inhibit different types of human cancers by examining their affects on cancer cell proliferation. An exemplary modified miR-502 mimic as set forth in SEQ ID NO: 13 was administered to 1.3 human pancreatic cancer cells (PANC1, A) and human breast cancer (A549, C) and revealed an increased ability to inhibit both types of cancer cell proliferation when compared to negative control microRNAs. Yet another exemplary modified microRNA, a miR-506 mimic as set forth in SEQ ID NO: 15 was administered to human pancreatic cancer cells (PANC I, B) and human breast cancer (A549, I)) and revealed an increased ability to inhibit both types of cancer cell proliferation when compared to negative control microRNAs.
DETAILED DESCRIPTION OF THE DISCLOSURE
[0054] The present disclosure provides nucleic acid compositions that incorporate one or more halouracil molecules. Without being bound by any one particular theory, surprisingly, the present disclosure reveals that the replacement of uracil nucleotides within a microRNA
oligonucleotide sequence with a 5-halouracil increases the ability of the microRNA to inhibit cancer, development, progression and tumorigenesis. As such, the present disclosure provides various nucleic acid (e.g., microRNA) compositions having 5-halouracil molecules incorporated in their nucleic acid sequences and methods for using the same.
The present disclosure further provides formulations, such as pharmaceutical compositions comprising the modified nucleic acid compositions, and methods for treating cancers that include administration of the same to a subject in need thereof.
Nucleic acid compositions.
[0055] The term "microRNA" or "miRNA" or "miR" is used interchangeably to refer to small non-coding ribose nucleic acid (RNA) molecules that are capable of regulating the expression of genes through interacting with messenger RNA molecules (mRNA), DNA or proteins. Typically, microRNAs are composed of nucleic acid sequences of about nucleotides (bases) and are found in mammalian cells.
[0056] The term "modified microRNA", "modified miRNA", "modified miR" or "mimic"
are used interchangeably herein to refer to a microRNA that differs from the native or endogenous microRNA (unmodified microRNA) polynucleotide. More specifically, in the present disclosure a modified microRNA differs from the unaltered or unmodified microRNA nucleic acid sequence by one or more base. In some embodiments of the present disclosure, a modified microRNA of the present disclosure includes at least one uracil (U) nucleotide base replaced by a 5-halouracil. In other embodiments a modified microRNA
includes an additional nucleotide (i.e., adenine (A), cytosine (C), uracil (U), and guanine (G)) and at least one uracil base that is substituted with a 5-halouracil.
100571 In one aspect of the present disclosure, nucleic acid compositions that include a modified microRNA nucleotide sequence having at least one uracil base (U, U
bases) that has been replaced with a 5-halouracil, such as 5-fluorouracil (5-FU) are described. As further discussed herein, the nucleic acid compositions of the present disclosure are useful, at least, in the treatment of cancer, particularly colorectal cancer, pancreatic cancer and breast cancer.
100581 In some embodiments, the nucleic acid compositions contain a nucleotide sequence that has been modified by derivatizing at least one of the uracil nucleobases at the 5-position with a group that provides a similar effect as a halogen atom. In some embodiments, the group providing the similar effect has a similar size in weight or spatial dimension to a halogen atom, e.g., a molecular weight of up to or less than 20, 30, 40, 50, 60, 70, 80, 90, or 80 g/mol. In certain embodiments, the group providing a similar effect as a halogen atom may be, for example, a methyl group, trihalomethyl (e.g., trifluoromethyl) group, pseudohalide (e.g., trifluoromethanesulfonate, cyano, or cyanate) or deuterium (D) atom.
The group providing a similar effect as a halogen atom may be present in the absence of or in addition to a 5-halouracil base in the microRNA nucleotide sequence.
100591 Moreover, in other embodiments, the group providing a similar effect as a halogen atom may be located in the native (or seed) portion and/or in an appended portion of the microRNA nucleotide sequence, which will be readily identified by one of ordinary skill in the art. In some embodiments, one or more (or all) of the above types of groups providing a similar effect as a halogen atom are excluded from the modified mi RNA
nucleotide sequence. When all such alternative groups are excluded, only one or more halogen atoms are present as substituents in the 5-position of one or more uracil groups in the microRNA
nucleotide sequence.

[0060] In certain embodiments, the modified microRNA has more than one, or exactly one uracil that has been replaced with a 5-halouracil.
[0061] In some embodiments, the modified microRNA nucleotide sequence includes three, four, five, six, seven, eight or more uracil bases that have been replaced with a 5-halouracil.
[0062] In other embodiments, all of the uracil nucleotide bases of the modified mRNA
have been replaced by a 5-halouracil.
[0063] In some embodiments, the 5-halouracil is, for example, 5-fluorouracil, chlorouracil, 5-bromouracil, or 5-iodouracil. In specific embodiments, the 5-halouracil is 5-fluorouracil [0064] The term "miR-129" as used herein, is meant to be synonymous with the terms "microRNA-129" or "miRNA-129" and refers to an oligonucleotide having the following nucleotide sequence: CUUUUUGCGGUCUGGGCUUGC [SEQ ID NO. 1], where it is understood that C = cytosine, U = uracil, and G = guanine bases. The foregoing nucleotide sequence is herein referred to as an unmodified miR-129 (i.e., "native") sequence unless otherwise specified. MiR-129 may also be referred to in the field as hsa-mi R-129 or hsa-miR-129-5p, with accession number(s) MI0000252 and M1MAT0000242. MiR-129 is well known and has been studied in detail. See, e.g., J. Wu et al., Cell Cycle, (2010) 9:9, 1809-1818. As also well known in the art, the miR-129 sequence may be modified to produce a "miR-129 mimic", which has a sequence modified from the native sequence, but that retains the known function or activity of the native miR-129. Unless otherwise stated, all such modified miR-129 compositions are herein considered to be within the scope of the term "miR-129 mimic" as used herein.
[0065] A particular modified miR-129 nucleic acid sequence (mimic) of interest contains two U bases (i.e., two U-containing nucleotides) covalently appended to an end of the miR-129 native sequence, such as in CUUUUUGCGGUCUGGGCUUGC-UU [SEQ ID NO. 3].
In the foregoing sequence, the two terminal U bases continue or extend the miR-129 native sequence from 21 nucleotide bases to 23 nucleotide bases. Generally, the miR-129 mimic contains no more than one, two, three, four, or five additional bases (i.e., as additional nucleotides) covalently appended to the miR-129 native sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, the miR-129 is used in single-strand form, but double-stranded versions are also considered herein.
100661 In one embodiment, the present disclosure is directed to nucleic acid compositions that contain a miR-129 nucleotide sequence that has been modified by replacing at least one of the uracil nucleobases (i.e., U bases) with a 5-halouracil, i.e., wherein at least one of the U bases in the miR-129 sequence, whether in the native and/or in an appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
100671 In a first set of embodiments, precisely one of the U bases in the miR-129 sequence is a 5-halouracil. In a second set of embodiments, precisely or at least two U
bases in the miR-129 sequence are 5-halouracils. In a third set of embodiments, precisely or at least three U bases in the miR-129 sequence are 5-hal ouracils. In a fourth set of embodiments, precisely or at least four U bases in the miR-129 sequence are 5-halouracils.
In a fifth set of embodiments, precisely or at least five U bases in the miR-129 sequence are 5-halouracils.
In a sixth set of embodiments, all of the U bases in the miR-129 sequence, whether in the native and/or in an appended portion, are 5-halouracils.
100681 In a specific embodiment, the nucleic composition of the present disclosure has a modified microRNA nucleotide sequence of CUFU
FuFuFuFGcG,-,¨F
CUFGGGCUFUFGC
as set forth in SEQ ID NO. 4, wherein UF is a ha1ouracil, specifically 5-fluorouracil.
100691 The U bases that are replaced with 5-halouracils in the miR-129 sequence may be located in an unmodified part of the miR-129 sequence, as provided above, or, in the case of a miR-129 mimic, may be located in one or more U bases covalently appended to the native miR-129, as also provided above. In other embodiments, a seed portion of the native miR-129 nucleotide sequence, GUUUUUGC remains unmodified with a 5-halouracil while one or more (or all) of the remaining U bases in the remainder of the miR-129 nucleotide sequence are replaced with the equivalent number of 5-halouracils.

[0070] For example, in a specific embodiment, the nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence of CUUUUUGCGGUFCUFGGGCUFUFGC as set forth in SEQ ID NO. 5, whereby UF is a halouracil, specifically 5-fluorouracil.
[0071] In alternative embodiments, the nucleic acid composition contains a miR-nucleotide sequence that has been modified by derivatizing at least one of the uracil (U) nucleobases at the 5-position with a group that provides a similar effect as a halogen atom.
In some embodiments, the group providing the similar effect has a similar size in weight or spatial dimension to a halogen atom, e.g., a molecular weight of up to or less than 20, 30, 40, 50, 60, 70, 80, 90, or 80 g/mol. The group providing a similar effect as a halogen atom may be, for example, a methyl group, trihalomethyl (e.g., trifluoromethyl) group, pseudohalide (e.g., trifluoromethanesulfonate, cyano, or cyanate) or deuterium (D) atom.
The group providing a similar effect as a halogen atom may be present in the absence of or in addition to a 5-halouracil base in the miR-129 nucleotide sequence. Moreover, the group providing a similar effect as a halogen atom may be located in the native (or seed) portion and/or in an appended portion of the miR-129 nucleotide sequence. In some embodiments, one or more (or all) of the above types of groups providing a similar effect as a halogen atom are excluded from the miR-129 nucleotide sequence. When all such alternative groups are excluded, only one or more halogen atoms are present as substituents in the 5-position of one or more uracil groups in the miR-129 nucleotide sequence.
[0072] In another exemplary embodiment, the present disclosure is directed to nucleic acid compositions that include a mi R-15a nucleotide sequence that has been modified. In some embodiments, the miR-15a nucleotide sequence has been modified by replacing at least one of the U bases with a 5-halouracil.
[0073] The term "mi R-15a", as used herein, is meant to be synonymous with the terms "microRNA-15a" or "miRNA-15a" and refers to an oligonucleotide having the following nucleotide sequence: UAGCAGCACAUAAUGGUUUGUG [SEQ ID NO. 2], where it is understood that A = adenine, C = cytosine, U = uracil, and G = guanine bases.
The foregoing nucleotide sequence is herein referred to as a miR-15a unmodified (i.e., "native") sequence unless otherwise specified. MiR-15a may also be referred to in the field as hsa-miR-15a or hsa-miR-15a-5p, with accession number(s) MI0000069. MiR-15a is well known and has been studied in detail, e.g., Xie T, et al. Clin Transl Oncol.
(2015) 17(7):504-
10; and Acunzo M, and Croce CM, Chn. Chem. (2016) 62(4):655-6. As stated above for miR-129 mimics, methods for creating a miR-15a mimic are known by those of ordinary skill in the art. Unless otherwise stated, all such modified miR-15a forms are herein considered to be within the scope of the term "miR-15a mimic", as used herein.
[0074] Generally, a modified miR-15a (i.e., miR-15a mimic) contains no more than one, two, three, four, or five additional nucleotides covalently appended to the miR-15a native sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, the miR-15a is used in single-strand form, but double-stranded versions are also considered herein.
[0075] In some embodiments, at least one of the U bases in the mi R-15a sequence, whether in the native and/or in an appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
100761 In a one set of embodiments, precisely one of the U bases in the miR-15a sequence is a 5-halouracil. In a second set of embodiments, precisely or at least two U
bases in the mi R-15a sequence are 5-halouracils. In another set of embodiments, precisely or at least three U bases in the miR-15a oligonucleotide sequence are 5-halouracils. In other embodiments, precisely or at least four U bases in the mi R-15a sequence are 5-halouracils.
In some embodiments, precisely or at least five U bases in the miR-15a sequence are 5-halouracils. In a yet other embodiments, precisely or at least six U bases in the miR-15a sequence are 5-halouracils. In specific embodiments, all of the U bases in the miR-15a sequence, whether in the native and/or in an appended portion, are 5-halouracils.
100771 In one embodiment, the nucleic acid composition of the present disclosure has a modified microRNA nucleotide sequence of UFAGCAGCACAUF
AAuFGGuFuFuFGuFG
[SEQ ID NO. 6], wherein UF is a halouracil, specifically 5-fluorouracil.

100781 The U bases that are replaced with 5-halouracils in the miR-15a sequence may be located in an unmodified part of the miR-15a sequence, as provided above, or, in the case of a miR-15a mimic, may be located in one or more uracil bases that are appended to the native miR-15a, as also provided above.
[0079] In other embodiments, a seed portion of the native miR-15a nucleotide sequence, UAGCAGCA, remains unmodified with a 5-halouracil while one or more (or all) of the remaining U bases in the remainder of the miR-15a nucleotide sequence (non-seed portion) are replaced with a 5-halouracil.
[0080] In specific embodiments, the nucleic acid composition of the present disclosure has a modified miR-15a nucleotide sequence of UAGCAGCACAUFAAUFGGUFUFUFGUFG
[SEQ ID NO. 71, wherein UF is a halouracil, specifically 5-fluorouracil.
[0081] In certain embodiments, the nucleic acid composition contains a miR- I
5a nucleotide sequence that has been modified by derivatizing at least one of the uracil (U) nucleobases at the 5-position with a group that provides a similar effect as a halogen atom.
In some embodiments, the group providing the similar effect has a similar size in weight or spatial dimension to a halogen atom, e.g., a molecular weight of up to or less than 20, 30, 40, 50, 60, 70, 80, 90, or 80 g/mol. The group providing a similar effect as a halogen atom may be, for example, a methyl group, trihalomethyl (e.g., trifluoromethyl) group, pseudohalide (e.g., trifluoromethanesulfonate, cyano, or cyanate) or deuterium (D) atom.
The group providing a similar effect as a halogen atom may be present in the absence of or in addition to a 5-halouracil base in the miR-15a nucleotide sequence. Moreover, the group providing a similar effect as a halogen atom may be located in the native (or seed) portion and/or in an appended portion of the miR-15a nucleotide sequence.
100821 In some embodiments, one or more (or all) of the above types of groups providing a similar effect as a halogen atom are excluded from miR-15a nucleotide sequence. When all such alternative groups are excluded, only one or more halogen atoms are present as substituents in the 5-position of one or more uracil groups in the miR-15a nucleotide sequence.

100831 In another exemplary embodiment, the present disclosure is directed to nucleic acid compositions that include a miR-140 nucleotide sequence that has been modified. In some embodiments, the miR-140 nucleotide sequence has been modified by replacing at least one of the U bases with a 5-halouracil.
100841 The term "miR-140", as used herein, is meant to be synonymous with the terms "microRNA-140" or "miRNA-140" and refers to an oligonucleotide having the following nucleotide sequence: CAGUGGUUUUACCCUAUGGUAG [SEQ ID NO. 8], where it is understood that A = adenine, C = cytosine, U = uracil, and G = guanine bases.
The foregoing nucleotide sequence is herein referred to as a miR-140 unmodified (i.e., "native") sequence unless otherwise specified. MiR-140 may also be referred by accession number(s) NT 010498 or by miRBase Accession MI0000456. MiR-140 is well known and has been studied in detail, e.g., Zhai, H. et al., Oncotarget. (2015) 6: 19735-46. As stated above for exemplary mimics miR-129 and miR-15a, methods for creating a miR-140 mimic are known by those of ordinary skill in the art. Unless otherwise stated, all such modified miR-140 forms are herein considered to be within the scope of the term "miR-140 mimic", as used herein.
100851 Generally, a modified miR-140 nucleic acid (i.e., miR-140 mimic) contains no more than one, two, three, four, or five additional nucleotides covalently appended to the miR-140 native sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, the miR-140 mimic is used in single-strand form, but double-stranded versions are also considered herein.
100861 In some embodiments, at least one of the U bases in the miR-140 sequence, whether in the native and/or in an appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
100871 In one set of embodiments, precisely one of the U bases in the miR-140 mimic sequence is a 5-halouracil. In a second set of embodiments, precisely or at least two U bases in the miR-140 sequence are 5-halouracils. In another set of embodiments, precisely or at least three U bases in the miR-140 oligonucleotide sequence are 5-halouracils.
In other embodiments, precisely or at least four U bases in the miR-140 sequence are 5-halouracils In some embodiments, precisely or at least five U bases in the miR-140 mimic sequence are 5-halouracils. In a yet other embodiments, precisely or at least six U bases in the miR-140 mimic sequence are 5-halouracils. In specific embodiments, all of the U bases in the miR-140 sequence, whether in the native and/or in an appended portion, are 5-halouracils.
100881 In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-140 nucleotide sequence of CAGUFGGUUUUACCCUFAUGGUFAG [SEQ ID NO. 9], wherein UF is a halouracil.
specifically 5-fluorouracil.
[0089] The U bases that are replaced with 5-halouracils in the miR-140 mimic sequence may be located in an unmodified part of the miR-140 sequence, as provided above, or may be located in one or more uracil bases that are appended to the native miR-140 sequence, as provided above.
[0090] In other embodiments, a seed portion of the native miR-140 nucleotide sequence, remains unmodified with a 5-halouracil while one or more (or all) of the remaining U bases in the remainder of the miR-140 nucleotide sequence (non-seed portion) are replaced with a 5-halouracil.
[0091] In another exemplary embodiment, the present disclosure is directed to nucleic acid compositions that include a miR-192 nucleotide sequence that has been modified. In some embodiments, the miR-192 nucleotide sequence has been modified by replacing at least one of the U bases with a 5-halouracil.
[0092] The term "miR-192", as used herein, is meant to be synonymous with the terms "microRNA-192", "miRNA-192" "microRNA-215", "miR-215" or "miRNA-215" and refers to an oligonucleotide having the following nucleotide sequence:
CUGACCUAUGAAUUGACAGCC [SEQ ID NO. 10], where it is understood that A =
adenine, C = cytosine, U = uracil, and G = guanine bases. The foregoing nucleotide sequence is herein referred to as a miR-192 unmodified (i.e., "native") sequence unless otherwise specified. MiR-192 may also be referred as hsa-mir-192, has-mir-215 or by miRBase Accession MI0000234, or MIMAT0000222. Mi R-192 is well known and has been studied in detail, e.g., Song, B. et al., Clin. Cancer Res. (2008), 14:
8080-8086, and Song, B. et al., Ala Cancer. (2010), 9:96 pp. 1476-4598. As stated above for exemplary mimics miR-129, miR-140 and miR-15a, methods for creating a miR-192 mimics are known by those of ordinary skill in the art. Unless otherwise stated, all such modified miR-192 nucleic acid forms are herein considered to be within the scope of the term "miR-192 mimic", as used herein.
100931 Generally, a modified miR-192 (i.e., miR-192 mimic) contains no more than one, two, three, four, or five additional nucleotides covalently appended to the miR-192 native sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, the miR-192 mimic is used in single-strand form, but double-stranded versions are also considered herein.
100941 In some embodiments, at least one of the U bases in the miR-192 or miR-sequence, whether in the native and/or in an appended portion, is a 5-halouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
100951 In another set of embodiments, precisely one of the U bases in the miR-192 mimic sequence is a 5-halouracil. In a second set of embodiments, precisely or at least two U bases in the miR-192 sequence are 5-halouracils. In another set of embodiments, precisely or at least three U bases in the miR-I92 oligonucleotide sequence are 5-halouracils.
In other embodiments, precisely or at least four U bases in the mi R-192 sequence are 5-halouracils.
In specific embodiments, all of the U bases in the miR-192 sequence, whether in the native and/or in an appended portion, are 5-ha1ouracils.
100961 In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-192 nucleotide sequence of CUFGACCUFAUFGAAUFUFGACAGCC [SEQ ID NO. 11], wherein UF is a halouracil, specifically 5-fluorouraciI.
100971 The U bases that are replaced with 5-halouracils in the miR-192 mimic sequence may be located in an unmodified part of the miR-192 sequence, as provided above, or may be located in one or more uracil bases that are appended to the native miR-192 sequence, as provided above.
[0098] In other embodiments, a seed portion of the native miR-192 nucleotide sequence remains unmodified with a 5-halouracil while one or more (or all) of the remaining U bases in the remainder of the miR-192 nucleotide sequence (non-seed portion) are replaced with a 5-halouracil or combination thereof.
[0099] In another exemplary embodiment, the present disclosure is directed to nucleic acid compositions that include a mi R-502 nucleotide sequence that has been modified. In some embodiments, the miR-502 nucleotide sequence has been modified by replacing at least one of the U bases with a 5-halouracil.
[00100] The term "mi R-502", as used herein, is meant to be synonymous with the terms "microRNA-502" or "miRNA-502" and refers to an oligonucleotide having the following nucleotide sequence: AUCCUUGCUAUCUGGGUGCUA [SEQ ID NO. 12], where it is understood that A = adenine, C = cytosine, U = uracil, and G = guanine bases.
The foregoing nucleotide sequence is herein referred to as a miR-502 unmodified (i.e., "native") sequence unless otherwise specified. MiR-502 may also be referred as hsa-mir-502 or by miRBase Accession MI0003186, or MIMAT0002873. MiR-502 is well known and has been studied in detail, e.g., Zhai, H, et al., Oncogene . (2013), 32:12 pp.
1570-1579. As stated above for exemplary mimics miR-129, miR-140, miR-192 and miR-15a, methods for creating a miR-502 mimics are known by those of ordinary skill in the art.
Unless otherwise stated, all such modified miR-502 nucleic acid forms are herein considered to be within the scope of the term "miR-502 mimic", as used herein.
[00101] Generally, a modified miR-502 (i.e., miR-502 mimic) contains no more than one, two, three, four, or five additional nucleotides covalently appended to the miR-502 native sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, the miR-502 mimic is used in single-strand form, but double-stranded versions are also considered herein.

1001021 In some embodiments, at least one of the U bases in the miR-502 sequence, whether in the native and/or in an appended portion, is a 5-ha1ouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[00103] In another set of embodiments, precisely one of the U bases in the miR-502 mimic sequence is a 5-halouracil. In a second set of embodiments, precisely or at least two U bases in the miR-502 sequence are 5-halouracils. In another set of embodiments, precisely or at least three U bases in the miR-502 oligonucleotide sequence are 5-halouracils.
In other embodiments, precisely or at least four U bases in the miR-502 sequence are 5-halouracils.
In other embodiments, precisely or at least five U bases in the miR-502 sequence are 5-halouracil s. In other embodiments, precisely or at least six U bases in the miR-502 sequence are 5-halouracils. In other embodiments, precisely or at least seven U bases in the miR-502 sequence are 5-halouracils. In specific embodiments, all of the U bases in the miR-502 sequence, whether in the native and/or in an appended portion, are 5-halouracils.
[00104] In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-502 nucleotide sequence of AUFCCUFUFGCUAUFCUFGGGUFGCUFA [SEQ ID NO. 13], wherein UF is a halouracil, specifically 5-fluorouracil.
[00105] The U bases that are replaced by 5-halouracils in the miR-502 mimic sequence may be located in an unmodified part of the miR-502 sequence, as provided above, or may be located in one or more uracil bases that are appended to the native miR-502 sequence, as provided above.
1001061 In other embodiments, a seed portion of the native miR-502 nucleotide sequence remains unmodified with a 5-halouracil while one or more (or all) of the remaining U bases in the remainder of the miR-502 nucleotide sequence (non-seed portion) are replaced by a 5-halouracil or combination thereof 1001071 In another exemplary embodiment, the present disclosure is directed to nucleic acid compositions that include a miR-506 nucleotide sequence that has been modified. In some embodiments, the miR-506 nucleotide sequence has been modified by replacing at least one of the U bases with a 5-halouracil.
[00108] The term "miR-506", as used herein, is meant to be synonymous with the terins "microRNA-506" or "miRNA-506" and refers to an oligonucleotide having the following nucleotide sequence: UAUUCAGGAAGGUGUUACUUAA [SEQ ID NO. 14], where it is understood that A = adenine, C = cytosine, U = uracil, and G = guanine bases.
The foregoing nucleotide sequence is herein referred to as a miR-506 unmodified (i.e., "native") sequence unless otherwise specified. MiR-506 may also be referred as hsa-mir-506 or by miRBase Accession M10003193, or MIMAT0022701. MiR-506 is well known and has been studied in detail, e.g., Li, J, et al., Oncotarget. (2016), 7:38 pp.
62778-62788, and Li, J.
et al., Oncogene. (2016) 35 pp. 5501-5514. As stated above for exemplary mimics miR-129, miR-140, miR-502, miR-192 and miR-15a, methods for creating a miR-506 mimics are known by those of ordinary skill in the art. Unless otherwise stated, all such modified miR-506 nucleic acid forms are herein considered to be within the scope of the term "miR-506 mimic", as used herein.
[00109] Generally, a modified miR-506 (i.e., miR-506 mimic) contains no more than one, two, three, four, or five additional nucleotides covalently appended to the miR-506 native sequence, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases may be exclusively U. Typically, the miR-506 mimic is used in single-strand form, but double-stranded versions are also considered herein.
[00110] In some embodiments, at least one of the U bases in the miR-506 sequence, whether in the native and/or in an appended portion, is a 5-ha1ouracil. The 5-halouracil can be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil.
[00111] In another set of embodiments, precisely one of the U bases in the miR-506 mimic sequence is a 5-halouracil. In a second set of embodiments, precisely or at least two U bases in the miR-506 sequence are 5-halouracils. In another set of embodiments, precisely or at least three U bases in the miR-506 oligonucleotide sequence are 5-halouracils.
In other embodiments, precisely or at least four U bases in the miR-506 sequence are 5-halouracils.
In other embodiments, precisely or at least five U bases in the miR-506 sequence are 5-halouracils. In other embodiments, precisely or at least six U bases in the miR-506 sequence are 5-halouracils. In other embodiments, precisely or at least seven U bases in the miR-506 sequence are 5-halouracils. In specific embodiments, all of the U bases in the miR-506 sequence, whether in the native and/or in an appended portion, are 5-halouracils.
1001121 In an exemplary embodiment, the nucleic acid composition of the present disclosure has a modified miR-506 nucleotide sequence of UFAUFUFCAGGAAGGUFGUFUFACUFUFAA [SEQ ID NO. 15], wherein UF is a halouracil, specifically 5-fluorouracil.
1001131 The U bases that are replaced with 5-halouracils in the miR-506 mimic sequence may be located in an unmodified part of the miR-506 sequence, as provided above, or may be located in one or more uracil bases that are appended to the native miR-506 sequence, as provided above.
1001141 In other embodiments, a seed portion of the native miR-506 nucleotide sequence remains unmodified with a 5-halouracil while one or more (or all) of the remaining U bases in the remainder of the miR-506 nucleotide sequence (non-seed portion) are replaced with a 5-halouracil or combination thereof.
1001151 The modified microRNA nucleic acid compositions described herein can be synthesized using any of the well known methods for synthesizing nucleic acids. In particular embodiments, the nucleic acid compositions are produced by automated oligonucleotide synthesis, such as any of the well-known processes using phosphoramidite chemistry. To introduce one or more 5-halouracil bases in a modified mi R
sequence (e.g., miR-15a sequence, miR-140 sequence, miR-192 sequence, miR-502 sequence, miR-sequence or miR-129 sequence), a 5-halouracil nucleoside phosphoramidite can be included as a precursor base, along with the phosphoramidite derivatives of nucleosides containing natural bases (e.g., A, U, G, and C) to be included in the nucleic acid sequence.
1001161 In some embodiments, the nucleic acid compositions of the present disclosure may be produced biosynthetically, such as by using in vitro RNA transcription from plasmid, PCR fragment, or synthetic DNA templates, or by using recombinant (in vivo) RNA

expression methods. See, e.g., C. M. Dunham et al., Nature Methods, (2007) 4(7), pp. 547-548. The microRNA sequence (e.g., miR-15a sequence, miR-140 sequence, miR-192 sequence, miR-502 sequence, miR-506 sequence or miR-129 sequence)may be further chemically modified such as by functionalizing with polyethylene glycol (PEG) or a hydrocarbon or a targeting agent, particularly a cancer cell targeting agent, such as folate, by techniques well known in the art. To include such groups, a reactive group (e.g., amino, aldehyde, thiol, or carboxylate group) that can be used to append a desired functional group may first be included in the oligonucleotide sequence. Although such reactive or functional groups may be incorporated onto the as-produced nucleic acid sequence, reactive or functional groups can be more facilely included by using an automated oligonucleotide synthesis in which non-nucleoside phosphoramidites containing reactive groups or reactive precursor groups are included.
Modjfied Nucleic Acid Formulations [00117] In another aspect, the present disclosure is directed to formulations of the modified nucleic acid compositions described herein. For example, the present nucleic acid compositions can be formulated for pharmaceutical uses. In certain embodiments, a formulation is a pharmaceutical composition containing a nucleic acid composition described herein and a pharmaceutically acceptable carrier. In other embodiments, a formulation of the present disclosure comprises a modified miR-129 nucleic acid, a modified miR-15a nucleic acid, a modified miR-140 nucleic acid, a modified miR-nucleic acid, a modified miR-502, a modified miR-506 nucleic acid or a combination thereof and a pharmaceutically acceptable carrier. More specifically, the modified microRNA
nucleic acids set forth in the following nucleotide sequences can be formulated for pharmaceutical application and use; CUFUFUFUFUFGCGGUFCUFGGGCUFUFGC [SEQ ID
NO. 4], CUUUUUGCGGUFCUFGGGCUFUFGC [SEQ ID NO. 5], UFAGCAGCACAUFAAUFGGUFUFUFGUFG [SEQ ID NO.6], UAGCAGCACAUFAAUFGGUFUFUFGUFG [SEQ ID NO. 7], CAGUFGGUUUUACCCUFAUGGUFAG [SEQ ID NO. 9], CUFGACCUFAUFGAAUFUFGACAGCC [SEQ ID NO. 11], AUFCCUFUFGCUAUFCUFGGGUFGCUFA [SEQ ID NO. 13], and UFAUFUFCAGGAAGGUFGUFUFACUFUFAA [SEQ ID NO. 15].
[00118] The term "pharmaceutically acceptable carrier" is used herein as synonymous with a pharmaceutically acceptable diluent, vehicle, or excipient. Depending on the type of pharmaceutical composition and intended mode of administration, the nucleic acid composition may be dissolved or suspended (e.g., as an emulsion) in the pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier can be any of those liquid or solid compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with tissues of a subject. The carrier should be "acceptable" in the sense of being not injurious to the subject it is being provided to and is compatible with the other ingredients of the formulation, i.e., does not alter their biological or chemical function.
1001191 Some, non-limiting examples, of materials which can serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose;
starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gelatin; talc; waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as ethylene glycol and propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar;
buffering agents;
water; isotonic saline; pH buffered solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. The pharmaceutically acceptable carrier may also include a manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or stearic acid), a solvent, or encapsulating material. If desired, certain sweetening and/or flavoring and/or coloring agents may be added. Other suitable excipients can be found in standard pharmaceutical texts, e.g. in "Remington's Pharmaceutical Sciences", The Science and Practice of Pharmacy, 19th Ed. Mack Publishing Company, Easton, Pa., (1995).
[00120] In some embodiments, the pharmaceutically acceptable carrier may include diluents that increase the bulk of a solid pharmaceutical composition and make the pharmaceutical dosage form easier for the patient and caregiver to handle.
Diluents for solid compositions include, for example, microcrystalline cellulose (e.g. Avicel*), microfine cellulose, lactose, starch, pregelatinized starch, calcium carbonate, calcium sulfate, sugar, dextrates, dextrin, dextrose, dibasic calcium phosphate dihydrate, tribasic calcium phosphate, kaolin, magnesium carbonate, magnesi urn oxide, maltodextrin, mannitol, polymethacrylates (e.g. Eudragie), potassium chloride, powdered cellulose, sodium chloride, sorbitol and talc.
[00121] The nucleic acid compositions of the present disclosure may be formulated into compositions and dosage forms according to methods known in the art. In certain embodiments, the formulated compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, tablets, capsules, powders, granules, pastes for application to the tongue, aqueous or non-aqueous solutions or suspensions, drenches, or syrups; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; (3) topical application, for example, as a cream, ointment or spray applied to the skin, lungs, or mucous membranes; or (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually or buccally; (6) ocularly; (7) transdermally; or (8) nasally.
[00122] In some embodiments, the formulations of the present disclosure include a solid pharmaceutical agent that is compacted into a dosage form, such as a tablet, may include excipients whose functions include helping to bind the active ingredient and other excipients together after compression. Binders for solid pharmaceutical compositions include acacia, alginic acid, carbomer (e.g. carbopol), carboxymethylcellulose sodium, dextrin, ethyl cellulose, gelatin, guar gum, hydrogenated vegetable oil, hydroxyethyl cellulose, hydroxypropyl cellulose (e.g. K1uce143)), hydroxypropyl methyl cellulose (e.g.
MethoceM, liquid glucose, magnesium aluminum silicate, maltodextrin, methylcellulose, polymethacrylates, povidone (e.g. Kollidon , Plasdone), pregelatinized starch, sodium alginate and starch.
[00123] The dissolution rate of a compacted solid pharmaceutical composition in a subject's stomach may be increased by the addition of a disintegrant to the composition.

Disintegrants include alginic acid, carboxymethylcellulose calcium, carboxymethylcellulose sodium (e.g. Ac-Di-Sole, Primellosee), colloidal silicon dioxide, croscarmellose sodium, crospovidone (e.g. Kollidoe), Polyplasdoner), guar gum, magnesium aluminum silicate, methyl cellulose, microcrystalline cellulose, polacrilin potassium, powdered cellulose, pregelatinized starch, sodium alginate, sodium starch glycolate (e.g.
Explotabe) and starch.
1001241 Therefore, in certain embodiments, glidants can be added to formulations to improve the flowability of a non-compacted solid agent and to improve the accuracy of dosing. Excipients that may function as glidants include colloidal silicon dioxide, magnesium trisilicate, powdered cellulose, starch, talc and tribasic calcium phosphate.
1001251 When a dosage form such as a tablet is made by the compaction of a powdered composition, the composition is subjected to pressure from a punch and dye.
Some excipients and active ingredients have a tendency to adhere to the surfaces of the punch and dye, which can cause the product to have pitting and other surface irregularities. A lubricant can be added to the composition to reduce adhesion and ease the release of the product from the dye. Lubricants include magnesium stearate, calcium stearate, glyceryl monostearate, glyceryl palmitostearate, hydrogenated castor oil, hydrogenated vegetable oil, mineral oil, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, sodium stearyl fumarate, stearic acid, talc and zinc stearate.
1001261 A formulated pharmaceutical composition for tableting or capsule filling can be prepared by wet granulation. In wet granulation, some or all of the active ingredients and excipients in powder form are blended and then further mixed in the presence of a liquid, typically water that causes the powders to clump into granules. The granulate is screened and/or milled, dried and then screened and/or milled to the desired particle size. The granulate may then be tableted, or other excipients may be added prior to tableting, such as a glidant and/or a lubricant. A tableting composition may be prepared conventionally by dry blending. For example, the blended composition of the actives and excipients may be compacted into a slug or a sheet and then comminuted into compacted granules.
The compacted granules may subsequently be compressed into a tablet.

1001271 In other embodiments, as an alternative to dry granulation, a blended composition may be compressed directly into a compacted dosage form using direct compression techniques. Direct compression produces a more uniform tablet without granules.
Excipients that are particularly well suited for direct compression tableting include microcrystalline cellulose, spray dried lactose, dicalcium phosphate dihydrate and colloidal silica. The proper use of these and other excipients in direct compression tableting is known to those in the art with experience and skill in particular formulation challenges of direct compression tableting. A capsule filling may include any of the aforementioned blends and granulates that were described with reference to tableting; however, they are not subjected to a final tableting step 1001281 In liquid pharmaceutical compositions of the present disclosure, the agent and any other solid excipients are dissolved or suspended in a liquid carrier such as water, water-for-injection, vegetable oil, alcohol, polyethylene glycol, propylene glycol or glycerin. Liquid pharmaceutical compositions may contain emulsifying agents to disperse uniformly throughout the composition an active ingredient or other excipient that is not soluble in the liquid carrier. The liquid formulation may be used as an injectable, enteric, or emollient type of formulation. Emulsifying agents that may be useful in liquid compositions of the present invention include, for example, gelatin, egg yolk, casein, cholesterol, acacia, tragacanth, chondrus, pectin, methyl cellulose, carbomer, cetostearyl alcohol and cetyl alcohol.
1001291 In some embodiments, liquid pharmaceutical compositions of the present disclosure may also contain a viscosity enhancing agent to improve the mouth-feel of the product and/or coat the lining of the gastrointestinal tract. Such agents include acacia, alginic acid bentonite, carbomer, carboxymethylcellulose calcium or sodium, cetostearyl alcohol, methyl cellulose, ethylcellulose, gelatin guar gum, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, maltodextrin, polyvinyl alcohol, povidone, propylene carbonate, propylene glycol alginate, sodium alginate, sodium starch glycolate, starch tragacanth and xanthan gum. In other embodiments, the liquid composition of the present disclosure may also contain a buffer, such as gluconic acid, lactic acid, citric acid or acetic acid, sodium gluconate, sodium lactate, sodium citrate, or sodium acetate.
[00130] Sweetening agents, such as sorbitol, saccharin, sodium saccharin, sucrose, aspartame, fructose, mannitol and invert sugar, may be added to certain formulations of the present disclosure to improve the taste. Flavoring agents and flavor enhancers may make the dosage form more palatable to the patient. Common flavoring agents and flavor enhancers for pharmaceutical products that may be included in the composition of the present disclosure include maltol, vanillin, ethyl vanillin, menthol, citric acid, fumaric acid, ethyl maltol and tartaric acid.
[00131] Preservatives and chelating agents, such as alcohol, sodium benzoate, butylated hydroxy toluene, butylated hydroxyanisole and ethylenediamine tetraacetic acid, may be added at levels safe for ingestion to improve storage stability. Solid and liquid compositions may also be dyed using any pharmaceutically acceptable colorant to improve their appearance and/or facilitate patient identification of the product and unit dosage level.
[00132] A dosage formulation of the present disclosure may be a capsule containing the composition, for example, a powdered or granulated solid composition of the disclosure, within either a hard or soft shell. The shell may be made from gelatin and optionally contain a plasticizer such as glycerin and sorbitol, and an pacifying agent or colorant.
Methods for Treating Cancer [00133] As stated above, the modified microRNA nucleic acid compositions of the present disclosure and formulations thereof show unexpected and exceptional anticancer activity when compared to that exhibited by a native microRNA and/or a known cancer therapy (chemotherapy), such as 5-FU. Therefore, another aspect of the present disclosure provides a method for treating cancer in a mammal by administering to the mammal an effective amount of one or more of the modified microRNA nucleic acid compositions of the present disclosure, or formulations thereof.
[00134] As shown in FIGS. 2A and 8A, exemplary modified microRNA nucleic acids of the present disclosure, i.e., modified miR-15a and modified MiR-129 suppress BCI.2 expression and activity in the cancer cells of a subject, which results in an increased amount of available pro-apoptotic proteins which ultimately leads to increased cancer cell death.
miR-129, for example, regulates apoptosis by directly targeting BCL2 as well as by impacting other critical cell death-related proteins. Further, FIG. 2A shows that miR-129 reduces the expression, and thus activity of E2F3, a transcription factor protein that regulates cell cycle progression and reduces the expression or activity of thymidylate synthase (TS) protein levels, which results in increased cellular proliferation and increased efficacy of chemotherapeutic agents.
[00135] Other exemplary microRNA's such as modified miR-506, miR-140, miR-192 and miR-502 also modulate cancer cell proliferation and cancer cell apoptosis, as shown in FIGS. 13A-B and 14A-D.
100136] In fact, FIGS. 7 and 11 show that intravenous treatment with two exemplary modified microRNA's of the present disclosure (e.g., modified miR-129 and modified miR-15a) effectively treat colorectal cancer by inhibiting tumor growth and development.
[00137] Generally, the methods for treating cancer of the present disclosure include administering a nucleic acid composition of the present disclosure (e.g., a modified microRNA, such as modified miR-129 nucleic acid, a modified miR-15a nucleic acid, a modified mi R-140 nucleic acid, a modified miR-192 nucleic acid, a modified miR-502, a modified miR-506 nucleic acid or a combination thereof) to a subject. In certain embodiments, the nucleic acid composition can be administered as a formulation that includes a nucleic acid composition and a carrier. In other embodiments, the nucleic acid composition of the present disclosure can be administered in the absence of a carrier (i.e., naked).
[00138] The term "subject" as used herein refers to any mammal. The mammal can be any mammal, although the methods herein are more typically directed to humans. The phrase 'subject in need thereof' as used herein is included within the term subject and refers to any mammalian subject in need of a treatment, particularly cancer or has a medically determined elevated risk of a cancerous or pre-cancerous condition. In specific embodiments, the subject includes a human cancer patient. In some embodiments, the subject has colorectal cancer or has a medically determined elevated risk of getting colorectal cancer. In other embodiments, the subject has pancreatic cancer, or has a medically determined elevated risk of getting pancreatic cancer such as, for example, being diagnosed with chronic pancreatitis.
In yet other embodiments, a subject of the present disclosure has lung cancer, or has a medically determined elevated risk of getting lung cancer.
1001391 The terms "treatment" "treat" and "treating" are synonomous with the term "to adminster an effective amount". These terms shall mean the medical management of a subject with the intent to cure, ameliorate, stabilize, reduce one or more symptoms of or prevent a disease, pathological condition, or disorder such as cancer. These terms, are used interchangeably and include the active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also include causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, treating includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. It is understood that treatment, while intended to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder, need not actually result in the cure, ameliorization, stabilization or prevention. The effects of treatment can be measured or assessed as described herein and as known in the art as is suitable for the disease, pathological condition, or disorder involved. Such measurements and assessments can be made in qualitative and/or quarititiative terms. Thus, for example, characteristics or features of a disease, pathological condition, or disorder and/or symptoms of a disease, pathological condition, or disorder can be reduced to any effect or to any amount.
1001401 In certain embodiments, the nucleic acid compositions of the present disclosure are used to treat cancer, such as colorectal cancer.

1001411 The term "cancer", as used herein, includes any disease caused by uncontrolled division and growth of abnormal cells, including, for example, the malignant and metastatic growth of tumors. The term "cancer" also includes pre-cancerous conditions or conditions characterized by an elevated risk of a cancerous or pre-cancerous condition.
Thus, the treatment of cancer is herein also considered to include a method for the prevention of cancer or a method for preventing a pre-cancerous condition from transforming into a cancerous condition or into a completely non-cancerous condition. The cancer or pre-cancer (neoplastic condition) can be located in any part of the body, including the internal organs and skin. Some examples of applicable body parts containing cancer cells include the colon, rectum (including anus), stomach, esophageal, digestive organs, lungs, pancreas, and liver.
The cancer or neoplasm can also include the presence of one or more carcinomas, sarcomas, lymphomas, blastomas, or teratomas (germ cell tumors). In some embodiments, the cancer may also be a form of leukemia.
1001421 In particular embodiments, the nucleic acid compositions described herein are used to treat colorectal (i.e., colon or rectal), pancreatic or lung cancer in any of its stages, as further described below. As is well know, cancer spreads through a subject by invading the normal, non-cancerous tissue surrounding the tumor, via the lymph nodes and vessels, and by blood after the tumor invades the veins, capillaries and arteries of a subject. When cancer cells break away from the primary tumor ("metastasize"), secondary tumors arise throughout an afflicted subject forming metastatic lesions.
1001431 For example, there are four stages of colorectal cancer, which are generally characterized by the degree of metastasis. In Stage 0 or carcinoma in situ, abnormal potentially cancerous cells are found in the mucosa (innermost layer) of the colon wall. In Stage I, cancerous cells have formed in the mucosa of the colon wall and have spread to the submucosa (layer of tissue under the mucosa) and may have spread to the muscle layer of the colon wall. Stage II is composed of three subclasses: Stage IIA, wherein the cancerous tissue has spread through the muscle layer of the colon wall to the serosa (outermost layer) of the colon wall; Stage BB, wherein the tumor has spread through the serosa of the colon wall but has not spread to nearby organs; and Stage IIC, wherein the cancer has spread through the serosa of the colon wall and invaded nearby organs. Stage Ill is also divided into three subclasses: Stage IIIA, wherein the cancer may have spread through the mucosa of the colon wall to the submucosa and muscle layer, and has spread to one to three nearby lymph nodes or tissues near the lymph nodes; or the cancer has spread through the mucosa to the submucosa and four to six nearby lymph nodes; Stage IIIB, wherein the tumor has spread through the muscle layer of the colon wall to the serosa or has spread through the serosa but not to nearby organs and the cancer has spread to one to three nearby lymph nodes or to tissues near the lymph nodes; or has spread to the muscle layer or to the serosa, and to four to six nearby lymph nodes; or has spread through the mucosa to the submucosa and may have spread to the muscle layer and has spread to seven or more nearby lymph nodes. In Stage BIC colorectal cancer, the tumor has spread through the serosa of the colon wall but not to nearby organs and the cancer has spread to four to six nearby lymph nodes;
or the cancer has spread through the muscle layer to the serosa or has spread through the serosa but not to nearby organs and the cancer has spread to seven or more nearby lymph nodes; or the cancer has spread through the serosa to nearby organs and to one or more nearby lymph nodes or to tissues near the lymph nodes. Finally, Stage IV colon cancer is divided into two subclasses: Stage IVA, wherein the cancer has spread through the colon wall and into nearby organs and one organ that is not near the colon or to a distant lymph node; and Stage IVB, wherein the cancer has spread through the colon wall and into nearby organs and more than one organ that is not near the colon or into the lining of the abdominal wall.
1001441 Yet another example of tumor staging includes the Dukes classification system for colorectal cancer. Here, the stages are identified as Stage A, wherein the tumor is confined to the intestinal wall; Stage B, wherein the tumor exhibits invasion through the bowel but has not invaded the lymph nodes; Stage C, wherein cancerous cells or tissue is found within the lymph nodes of a subject; and Stage D, wherein the tumor exhibits widespread metastases into several organs of the subject.
1001451 The Astler Coller classification system may alternatively be used.
Here, Stage A
colorectal cancer is identified as cancer that is only present in the mucosa of the intestine;

Stage B1 whereby the tumor extends into muscularis propria but does not penetrate through it and the tumor has not metastasized into the lymph nodes, Stage B2 colorectal cancer is denoted by a tumor that penetrates through muscularis propria and the tumor has not metastasized into the lymph nodes; Stage Cl is characterized by a tumor that extends into muscularis propria, but does not penetrate through it and the tumor has metastasized into the lymph nodes; Stage C2 colorectal cancer is classified as a tumor that penetrates through the muscularis propria where the tumor has metastasized into the lymph nodes; and Stage D describes a tumor that has metastasized throughout the organism or subject.
[00146] In some embodiments, the treatment methods of the present disclosure are more particularly directed to cancer subjects exhibiting reduced levels of miR-129 expression, miR-15a expression, miR-506 expression, miR-502, miR-140 or a combination thereof. In this respect, it is known that miR-15a is down-regulated in cancers. See, for example, R
I Aqeilan, et al., Cell Death and Differentiation (2010) 17, pp. 215-220.
Further, it is known that cancerous cells having reduced levels of miR-129 expression are resistant to 5-fluorouracil, as described, e.g., in U.S. Application Pub. No. 2016/0090636, the contents of which are incorporated by reference in their entirety. Additionally, it is known that pancreatic cancer cells exhibit reduced levels of mi R-506. See, e.g., Li, J, et al. Oncogene.
35 pp. 5501-5514.
[00147] In yet another example, the microRNA mimics of the present disclosure are used to treat pancreatic cancer. Pancreatic cancer arises from precursor lesions called pancreatic intraepithelial neoplasia, or Pan1Ns. These lesions are typically located in the small ducts of the exocrine pancreas, and depending on the extent of cytologic atypia may be classified as low-grade dysplasia, moderate dysplasia or high-grade dysplasia lesions. Such lesions typically show that activating mutations in the KRAS gene present, along with certain inactivating mutations in CDKN2A, TP53 and SMAD4. Collectively, these genetic mutations lead to the formation of an infiltrating cancer. Pancreatic cancer is staged based on size of the primary tumor and whether it has grown outside of the pancreas into surrounding organs; whether the tumor has spread to the nearby lymph nodes, and whether it has metastasized to other organs of the body (e.g., liver, lungs, abdomen).
This information is then combined and used to provide the specific stage, i.e., 0, 1A, 1B, 2A, 2B, 3 and 4. For stage zero (0), the pancreatic tumor is confined to the top layers of pancreatic duct cells and has not invaded deeper tissues. The primary tumor has not spread outside of the pancreas such as in pancreatic carcinoma in situ or pancreatic intraepithelial neoplasia III. A stage lA pancreatic tumor is typically confined to the pancreas and is 2 cm across or smaller.
Further a stage IA pancreatic tumor has not spread to nearby lymph nodes or distant sites. A
stage 1B pancreatic tumor confined to the pancreas and is larger than 2 cm across. A stage 1B pancreatic tumor has not spread to nearby lymph nodes or distant sites.
Stage 2A
pancreatic tumors exhibit a tumor growing outside the pancreas but not into major blood vessels or nerves, but the cancer has not spread to nearby lymph nodes or distant sites. A
subject exhibiting stage 2B pancreatic cancer presents a tumor is either confined to the pancreas or growing outside the pancreas but not into major blood vessels or nerves, but has spread to nearby lymph nodes. A subject exhibiting stage 3 pancreatic cancer presents a tumor that is growing outside the pancreas into major blood vessels or nerves, but has spread to distant sites. Stage 4 pancreatic cancer has metastasized to distant cites, lymph nodes and organs.
1001481 In another example, the modified microRNA nucleic acid compositions of the present disclosure are used to treat lung cancer. The present methods include the treatment of non-small cell lung cancers, such as squamous cell carcinoma, adenocarcinoma, and large cell carcinoma. Lung cancer often arises from malignancies in the bronchi of the lungs and spreads to other parts of the body, such as lymph nodes. For example, in the case of small cell lung cancer, a cancerous lesion is often found in once lung then spreads to the second lung, the fluid surrounding the lungs (pleura) or neighboring organs. Lung cancer is staged based on size of the primary tumor and whether it has grown outside of the lung into lymph nodes and whether it has metastasized to other organs of the body (e.g., bones, liver, breast, brain). This information is then combined and used to provide the specific stage, i.e., 0, 1, 2, 3 and 4. For stage zero (0), i.e., carcinoma in situ, the cancer is small in size and has not spread into deeper lung tissues or outside the lungs. Stage 1 lung cancer shows cancerous cells present in the underlying lung tissues, but the lymph nodes remain unaffected. Stage 2 lung cancer reveals that the cancer has spread to nearby lymph nodes or into the chest wall.

Stage 3 lung cancer is classified by a continuous spread from the lungs to the lymph nodes or to nearby structures and organs, such as the heart, trachea and esophagus.
Stage 4 lung cancer exhibits metastasized cancer throughout the body, which may affect the liver, bones or brain.
1001491 The nucleic acid compositions according to the present disclosure may be administered by any of the routes commonly known in the art. This includes, for example, (1) oral administration; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection; (3) topical administration; or (4) intravaginal or intrarectal administration; (5) sublingual or buccal administration; (6) ocular administration;
(7) transdermal administration; (8) nasal administration; and (9) administration directly to the organ or cells in need thereof 1001501 The amount (dosage) of nucleic acid compositions of the present disclosure being administered depends on several factors, including the type and stage of the cancer, presence or absence of an auxiliary or adjuvant drug, and the subject's weight, age, health, and tolerance for the agent. Depending on these various factors, the dosage may be, for example, about 2 mg/kg of body weight, about 5 mg/kg of body weight, about 10 mg/kg of body weight, about 15 mg/kg of body weight, about 20 mg/kg of body weight, about 25 mg/kg of body weight, about 30 mg/kg of body weight, about 40 mg/kg of body weight, about 50 mg/kg of body weight, about 60 mg/kg of body weight, about 70 mg/kg of body weight, about 80 mg/kg of body weight, about 90 mg/kg of body weight, about 100 mg/kg of body weight, about 125 mg/kg of body weight, about 150 mg/kg of body weight, about 175 mg/kg of body weight, about 200 mg/kg of body weight, about 250 mg/kg of body weight, about 300 mg/kg of body weight, about 350 mg/kg of body weight, about 400 mg/kg of body weight, about 500 mg/kg of body weight, about 600 mg/kg of body weight, about 700 mg/kg of body weight, about 800 mg/kg of body weight, about 900 mg/kg of body weight, or about 1000 mg/kg of body weight, wherein the term "about" is generally understood to be within 10%, 5%, 2%, or 1% of the indicated value. The dosage may also be within a range bounded by any two of the foregoing values. Routine experimentation may be used to determine the appropriate dosage regimen for each patient by monitoring the compound's effect on the cancerous or pre-cancerous condition, or effect on microRNA
expression level or activity (e.g., miR-15a, miR-129, miR-140, miR-192, miR-502, miR-506), or effect on BCL2 level or activity, or effect on TS level or activity, or effect on E2F3 level or the disease pathology, all of which can be frequently and easily monitored according to methods known in the art. Depending on the various factors discussed above, any of the above exemplary doses of nucleic acid can be administered once, twice, or multiple times per day.
1001511 The ability of the nucleic acid compositions described herein, and optionally, any additional chemotherapeutic agent for use with the current methods can be determined using pharmacological models well know in the art, such as cytotoxic assays, apoptosis staining assays, xenograft assays, and binding assays.
[00152] The nucleic acid compositions described herein may or may not also be co-administered with one or more chemotherapeutic agents, which may be auxiliary or adjuvant drugs different from a nucleic composition described herein.
1001531 As used herein, "chemotherapy" or the phrase a "chemotherapeutic agent" is an agent useful in the treatment of cancer. Chemotherapeutic agents useful in conjunction with the methods described herein include any agent that modulates BCL2, E2F3 or TS, either directly or indirectly. Examples of chemotherapeutic agents include: anti-metabolites such as methotrexate and fluoropyrimidine-based pyrimidine antagonist, 5-fluorouracil (5-FU) (Carac cream, Efudex , Fluoroplex , Adrucile) and S-1; antifolates, including polyglutamatable antifolate compounds; raltitrexed (Tomudexe), GW1843 and pemetrexed (Alimtae) and non-polyglutamatable antifolate compounds; nolatrexed (Thymitaq0), plevitrexed, BGC945; folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; and purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine. In a specific embodiment of the current disclosure, the chemotherapeutic agent is a compound capable of inhibiting the expression or activity of genes, or gene products involved in signaling pathways implicated in aberrant cell proliferation or apoptosis, such as, for example, YAP1, BMI1, DCLK1, BCL2, thymidylate synthase or E2F3; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
[00154] In some embodiments, the chemotherapeutic agent is an anti-cancer drug, or a tissue sensitizer or other promoter for an anti-cancer drug. In some embodiments, the co-drug may be another nucleic acid, or another miRNA, such as a microRNA mimic of the present disclosure, gemctiabine or free 5-FU.
[00155] In a specific embodiment, the other nucleic acid is a short hairpin RNA (shRNA), siRNA, or nucleic acid complementary to a portion of the BCL2 3'UTR.
[00156] In other embodiments, the chemotherapy may be any of the following cancer drugs, such as one or more of methotrexate, doxorubicin, cyclophosphamide, cis-platin, oxaliplatin, bleomycine, vinblastine, gemcitabine, vincristine, epirubicin, folinic acid, paclitaxel, and docetaxel. The chemotherapeutic agent may be administered before, during, or after commencing therapy with the nucleic acid composition.
[00157] In some embodiments, the chemotherapeutic agent is a co-drug.
[00158] E2F transcription factor 3, E2F3 (RefSeq NG_029591.1, N/VI_001243076.2, NP 001230005.1) is a transcription factor that binds DNA and interacts with effector proteins, including but not limited to, retinoblastoma protein to regulate the expression of genes involved in cell cycle regulation. Therefore, any drug that inhibits the expression of E2F3 may be considered herein as a co-drug.
[00159] B-cell lymphoma 2 (BCL2), (RefSeq NG_009361.1, NM_000633, NP_000624) including isoform a (NM_000633.2, NP 000624.2) and fi NM 000657.2, NP
_000648.2 thereof, are encoded by the BcI-2 gene, which is a member of the BCL2 family of regulator proteins that regulate mitochondria regulated cell death via the intrinsic apoptosis pathway.
BCL2 is an integral outer mitochondrial membrane protein that blocks the apoptotic death of cell cells by binding BAD and BAK proteins. Non-limiting examples of BCL2 inhibitors include antisense oligonucleotides, such as Oblimersen (Genasense; Genta mimetic small molecule inhibitors including, ABT-737 (Abbott Laboratories, Inc.), ABT-199 (Abbott Laboratories, Inc.), and Obatoclax (Cephalon Inc.). Any drug that inhibits the expression of BCL2 may be considered herein as a co-drug.
1001601 Thymidylate synthase (RefSeq: NG_028255.1, NM_001071.2, NP_001062.1) is a ubiquitous enzyme, which catalyses the essential methylation of dUMP to generate dTMP, one of the four bases which make up DNA. The reaction requires CH Ha-folate as a cofactor, both as a methyl group donor, and uniquely, as a reductant. The constant requirement for CH H4-folate means that thymidylate synthase activity is strongly linked to the activity of the two enzymes responsible for replenishing the cellular folate pool:
dihydrofolate reductase and serine transhydroxymethylase. Thymidylate synthase is a homodimer of 30-35kDa subunits. The active site binds both the folate cofactor and the dUMP substrate simultaneously, with the dUMP covalently bonded to the enzyme via a nucleophilic cysteine residue (See, Carreras et al, Annu. Rev. Biochem., (1995) 64:721-762). The thymidylate synthase reaction is a crucial part of the pyrimidine biosynthesis pathway which generates dCTP and dTTP for incorporation into DNA. This reaction is required for DNA replication and cell growth. Thymidylate synthase activity is therefore required by all rapidly dividing cells such as cancer cells. Due to its association with DNA
synthesis, and therefore, cellular replication, thymidylate synthase has been the target for anti-cancer drugs for many years. Non-limiting examples of thymidylate synthase inhibitors include folate and dUMP analogs, such as 5-fluorouracil (5-FU). Any drug that inhibits the expression of thymidylate synthase may be considered herein as a co-drug.
1001611 If desired, the administration of the nucleic acid composition described herein may be combined with one or more non-drug therapies, such as, for example, radiotherapy, and/or surgery. As well known in the art, radiation therapy and/or administration of the chemotherapeutic agent (in this case, the nucleic acid composition described herein, and optionally, any additional chemotherapeutic agent) may be given before surgery to, for example, shrink a tumor or stop the spread of the cancer before the surgery.
As also well known in the art, radiation therapy and/or administration of the chemotherapeutic agent may be given after surgery to destroy any remaining cancer.

[00162] Examples have been set forth below for the purpose of illustration and to describe certain specific embodiments of the invention. However, the scope of this invention is not to be in any way limited by the examples set forth herein.
EXAMPLES
Example 1. Materials and Methods.
[00163] modyied miR-129: the 5-FU modified miR-129 molecules were synthesized by an automated oligonucleotide synthesis process and purified by HPLC. The two strands were annealed to make the mature modified 5-FU-miR-129. More specifically, a process referred to as "2'-ACE RNA synthesis" was used. The 2'-ACE RNA synthesis is based on a protecting group scheme in which a silylether is employed to protect the 5'-hydroxyl group in combination with an acid-labile orthoester protecting group on the 2'-hydroxy (2'-ACE).
This combination of protecting groups is then used with standard phosphoramidite solid-phase synthesis technology. See, for example, S.A. Scaringe, F.E. Wincott, and M.H.
Caruthers, J. Am. Chem. Soc., 120 (45), 11820-11821(1998); International PCT
Application WO/1996/041809; M.D. Matteucci, M.H. Caruthers, J. Am. Chem. Soc., 103, 3185-(1981); S.L. Beaucage, M.H. Caruthers, Tetrahedron Lett. 22, 1859-1862 (1981), the entire contents of each of which are expressly incorporated herein.
[00164] The exemplary modified miR-15a nucleic acid, modified miR-140 nucleic acid, modified miR-192 nucleic acid, modified miR-502, modified miR-506 nucleic acid or any other modified microRNAs that replace uracil with a 5-halouracil can be synthesized in the same manner as miR-129a.
[00165] Some exemplary structures of the protected and functionalized ribonucleoside phosphoramidites currently in use are shown below:

A
Ca )4;
y s.e : N
=====%,0-.S.;=-i), =
rifii=
"*.*µ =======, 0:
, rtik4, 0õõ* A
A
Nyl4 = 0:
tet, 6 \
- =-= V"(;)--.:*- :
= p \tõ..:141 :
f A *(4 0 oli6;;
, oi cYN'Ys/
Y ........................... P
1001661 Cell culture. The human colon cancer cell lines HCT116, RKO, SW480, SW620, and the normal colon cell line CCD 841 CoN, pancreatic cancer cell lines ASPC-1, Panc-1, and lung cancer cell line A549,were obtained from the American Type Culture Collection (ATCC) and maintained in McCoy's 5A medium (HCT-116), DMEM (RKO, SW480, SW620) and MEM (CCD 841 CoN) (Thermo Fischer). Media was supplemented with 10%

fetal bovine serum (Thermo Fischer).
[00167] For transfections, 1x105 cells were plated in six-well plates and transfected with 100 nM of either mi R-15a precursor, non-specific miRNA (Thermo Fischer) or modified miR-15a mimics (Dharmacon) after 24 hours using Oligofectamine (Thermo Fischer) following the manufacturer's protocols. For reagent free transfection, cells were plated in 6 well plates at (1x105) cells per well. Twenty-four hours later 100 pmol miRNA
(Control, miR-15a, Mimic-1) were diluted in Optimem (Thermo Fischer) and added to the plate.
Media was changed after 24 hours. Media was supplemented with 10% fetal bovine serum (Thermo Fischer). Briefly, cells were cultured in DMEM/F12 supplemented with B27, ng/mL bFGF, and 20 ng/mL EGF (Life Technologies) in ultra-low attachment flasks. The spheroid cells were maintained by collection through gentle centrifugation, dissociation to single cells and replating.
[00168] Western innnunoblot analysis: Forty-eight hours after transfection, equal amounts of protein (15 ps) extracted from cells lysed in RIPA buffer with protease inhibitor (Sigma) and were separated on 10% -12% sodium dodecyl sulfate-polyacrylamide gels using standard procedures. The primary antibodies used for the analysis were rabbit anti-YAPI
monoclonal antibody (1:10000) (Cell Signaling Technologies), anti-DLCK1 (1:500) (Abcam), anti-BCL2 (1:500) (NeoMarkers), ant-BMI-1 (1:10000) (Cell Signaling Technologies), mouse anti-human TS antibody (1:500), anti-a-tubulin (1:50000) (Santa Cruz Biotech Inc.), anti-GAPDH (1:100000) (Santa Cruz Biotech Inc.), ant-E2F3 (1:500) (Santa Cruz Biotech Inc.),. Horseradish peroxidase¨conjugated antibodies against mouse or rabbit (1:5000, Santa Cruz Biotech Inc.) were used as the secondary antibodies. Protein bands were visualized with autoradiography film using SuperSignal West Pico Chemiluminescent Substrate (Thermo Fischer). Western blot density was quantified using Image J software.
[00169] Cell proliferation assay: Twenty-four hours after transfection, cells were seeded in 96-well plates at a density of 2000 cells per well. The cell proliferation assay was performed on days 1 to 5 by incubating 10 I WST-1 (Roche Applied Science, Mannheim, Germany) in the culture medium for lh and reading the absorbance at 450 and 630nm. The cell proliferation rate was calculated by subtracting the absorbance at 450 nm from the absorbance at 630 nm. Experiments for the cell proliferation assay were performed at least three times. The O.D. was calculated by subtracting the absorbance at 630 nm from that at 450 nm. Proliferation experiments were performed three times.
[00170] Anchorage-independent proliferation was studied to determine cancer cell colony forming ability. Cancer cells were trypsinized and counted and a total of lx105 cells per well were transfected in 6-well plates with 25 nM modified microRNA or native miRs or a negative control miRNA with oligofectamine, and 6 hours after transfection, cells were recounted. A total of 20,000 cells in 0.35% agar (Bacto Agar; Becton Dickinson) were layered on top of 1 mL of a solidified 0.6% agar layer in a 35-mm dish. Growth media with B27, 10 ng/mL bFGF, and 20 ng/mL EGF were included in both layers. After 2 weeks of incubation, colonies more than 50 mm in diameter were counted.
[00171] Cell cycle analysis: Twenty-four hours after transfection, cells were harvested and resuspended at 0.5 to 1 x 106 cells/mL in modified Krishan's buffer supplemented with 0.02 mg/mL RNase H and 0.05 mg/mL propidium iodide. Stained cells were detected by flow cytometry and results were analyzed with Modfit LT'' software. The experiments for cell cycle analysis were performed at least three times.
[00172] Apoptosis Assay. To distinguish between early and late apoptosis, a fluorescein isothiocyanate (FITC)¨Annexin assay was done (Becton Dickinson). HCT116, RKO, 5W480 and 5W620 cells were plated into 6 well plates (1x105) cells per well, after 24h, cells were transfected with 25 nM modified miRNAs using Oligofectamine. Forty-eight hours after transfection, cells were harvested, stained with propidium iodide and anti-annexin-V antibody (Annexin V-FITC Apoptosis Detection kit, Invitrogen, CA, USA) following the manufacturer's protocol, and stained cells were detected by flow cytometry.
[00173] 5-al treatment and cootoxicity assay: Twenty-four hours after transfection, cancer cells were plated in 96-well plates at 2 x 103 cells per well in triplicates in 100 1.1L of medium. After 24 hours, fresh medium containing 2 1.1M 5-FU alone, 50 nM
native microRNA, 50 nM modified microRNA (e.g., modified miR-129), or a combination of 2 mM 5-FU with 50 nM a modified microRNA of the present disclosure e.g., modified miR-129, were added, and cells were cultured for an additional 72 hours. Cell viability was measured using the WST-1 assay.
[00174] Lentivirus production: Briefly, 1.5 x 106 293T cells were plated in a 10-cm dish with 10 mL of DMEM + 10% FBS. Two days later, pEZX-MR03, a lentiviral plasmid, expressing miR-129 or hsa-miR-15a, was transfected with Lenti-Pac HIV
expression packaging kit following the manufacturer's protocol. Forty-eight hours later, the virus was harvested and concentrated with Lenti-Pac lentivirus concentration solution.
Then the titer of the virus (approximately 1011 virus particles/ml) was determined with Lenti-PacTm HIV
qRT-PCR titration kit. In addition, serial dilution of the virus (0.1 L, 0.5 L, 2 10 ttL, 50 pi) was used to transduce 5 x 104 HCT116 CSC to determine the transduction efficiency.

The lowest concentration (2 pt) to achieve 100% positive expression was used to infect the cells for mouse in vivo treatement experiments.
[00175] Real-time qRT-PCR analysis of nucleic acid expression. The expression levels of microRNAs in cancer cells were quantified. Briefly, the primers specific to the microRNA
of interest and an internal control RNU44 gene were purchased from Ambion.
cDNA
synthesis was performed by the High Capacity cDNA Synthesis Kit (Applied Biosystems) with miRNA-specific primers. Real-time qRT-PCR was carried out on an Applied Biosystems 7500 Real-Time PCR machine with miRNA-specific primers by Taq/Vlan Gene Expression Assay (Applied Biosystems). Expression level of the exemplary miRs of the present disclosure was calculated by the AACT method based on the internal control RNU44, normalized to the control group and plotted as relative quantification.
[00176] Human cancer stern cell profiler: RNAs were extracted from cancer cells transfected with either exemplary microRNAs of the present disclosure or negative mi RNA
using TRIzol reagent (Thermo Fischer) in accordance with the manufacturer's protocol.
RNAs were transcribed to first-strand cDNA using the RT2 First Strand Kit (Qiagen). Next, the cDNA is mixed with RT2 SYBR Green Mastermix (Qiagen), and this mixture is aliquoted into the wells of the Human Cancer Stem Cells RT2 Profiler PCR Array (Qiagen).
Applied Biosystems 7500 Real-Time PCR machine was used for qRT-PCR (Applied Biosystems), and relative expression values were determined using the AACT
method.
[00177] Mouse subcutaneous tumor implantation model: Two days before injection, HCT116 cancer stem cells were plated at 5 x 105/well in a 6-well ultra low attachment plate.
20 pL of the virus or 100 pmole exemplary modified miR-129 or modified miR-15a were used to transduce or transfect cells. Forty-eight hours later, cells were collected and re-suspended at 106/m1 in DMEM/F12 knockout media with 30% matrigel. Ten-twelve week-old NOD/SCID mice (Jackson Laboratories, Bar Harbor, MA, USA) were used for tumor implantation. The mice were anesthetized by isoflurane inhalation. 1004 of cell suspension was injected subcutaneously into both sides of the lower back area.
The tumor size was measured using a caliper, and tumor volume was calculated using the formula V =
length x width2/2.

[00178] For the in vivo miRNA delivery experiments, we created colon cancer cells that expressed the lenti-luc reporter gene by infecting parental HCT116 cells with a recombinant lentivirus. Luciferase-expressing HCT116 cells (2.0x106 cells per mouse) were suspended in 0.1 mL of PBS solution and was injected through tail vein of each mouse. Two weeks after injection of colon cancer cells, mice were treated via tail vein injection with 40 i.tg of negative control or modified miR(s) packaged with in vivo-jetPEI (Polyplus Transfection).
Mice were treated every other day for 2 weeks (8 times). Following treatment, mice were screened using NIS Spectrum In vivo Imaging System (P/IS) (PerkinElmer).
[00179] RNA isolation: For mouse xenografts, sectioned tissues were deparaffinized, hydrated, and digested with proteinase K, respectively. Subsequently, total RNA was isolated using the TRizol reagent. Total RNA was also isolated from clinical specimens by the TRIzol -based approach.
[00180] Statistical analysis All experiments were repeated at least three times. All statistical analyses were performed with SigmaPlot software. The statistical significance between two groups was determined using Student's 1-test (paired 1-test for clinical samples, and unpaired 1-test for all other samples). For comparison of more than two groups, one-way ANOVA followed by a Bonferroni-Dunn test was used. Data were expressed as mean standard error of the mean (SEM). The statistical significance is either described in figure legends, or indicated with asterisks(*). *=P <0.05; **=P<0.01; ***=P< 0.001.
Example 2: Modified microRNAs of the present disclosure have anti-cancer activity.
[00181] As shown in FIGS. 3, 8B, 12A-B, 13A-B and 14A-D, the modified miRNAs (modified miR: 129, 15a, 192 (215), 140, 502, and 506) are more effective in inhibiting colon cancer, pancreatic cancer, and lung cancer cell proliferation than non-modified miRNA precursor. In addition, the modified miRNAs can be delivered into cancer cells without the transfection reagent (data not shown). Notably, the results show that cancer cell proliferation across several different colorectal cancer cell lines, pancreatic cancer cell lines, and lung cancer cell lines, is inhibited significantly when compared to cancer cells treated with control microRNAs.

Example 3: Modified miR-129 nucleic acids have anti-cancer activity.
[00182] In the following experiments, 5-FU was incorporated into miR-129. In one experiment, all U bases in miR-129 were replaced with 5-FU, as shown in the structure provided in FIG. 1A, where "UF" represents 5-fluorouracil or other 5-halouracil. In another experiment, all U bases, except the seed region of the miR-129, were replaced with 5-FU, as shown in the structure provided in FIG. 1B.
[00183] Analysis of target specificity: The results of Western immunoblot experiments in colon cancer HCT-116 cells demonstrate that the exemplary modified miR-129 polynucleotides of the present disclosure were able to retain their target specificity to TS, BCL2 and E2F3 via. The results are shown in FIGS. 2A and 2B, which shows the results for the modified miR-129 nucleic acid having all U bases were replaced with 5-FU, as obtained by two separate operators as set forth in SEQ ID. NO: 4. Of further significance, the exemplary miR-129 mimics were found to be more potent than unmodified (control) miR-129 in reducing the expression levels of TS, BCL2 and E2F3.
[00184] Function enhancement of mod?fied microRNAs of the present disclosure.
The impact of an exemplary modified miR-129 on colon cancer cell proliferation was compared to that of native miR-129. The results show that, at 50 nM concentration, 5-FU-miR-129 can suppress HCT-116 tumor cell growth completely. Moreover, as shown by the results in FIG. 3, 5-FU-miR-129 is much more potent than the native miR-129, thereby providing a significantly higher inhibitory effect. Such inhibition is specific, as the scramble control miR has no effect on cell proliferation.
[00185] Next, the potencies of modified miR-129 and 5-FU on cell proliferation were compared using HCT-116 colon cancer cells. As shown by the results provided in FIG. 4, 50 nM (40-fold less than 5-FU) of modified miR-129 is unexpectedly much more potent than 2 1.1M 5-FU in inhibiting tumor cell proliferation.
[00186] Exemplary modified microRNAs of the present disclosure induce apoptosis in colon cancer cells. With Ba2 being an important target of miR-129, the impact of a modified miR of the present disclosure on apoptosis was investigated.
Specifically, cell death was quantified using an apoptosis assay in HCT116, RKO, SW480, and SW620 colon cancer cells transfected with negative control miRNA, native miR-129 or an exemplary miR-129 mimic of SEQ ID NO: 4. Results show that the miR-129 mimic was able to induce apoptosis by 2 to 30-fold in all 4 colon cancer cell lines via a fluorescence-activated cell sorting (FACS)-based FITC¨Annexin assay compared to the native miR-129 and negative control miRNA (FIG. 5A).
[00187] miR-129 mimic trigger GL'S cell cycle check point control. Cell cycle analysis was performed using flow cytometry in HCT-116 cells treated with scramble control, miR-129 precursor, and an exemplary miR-129 mimic. As shown in FIG. 5B, cell cycle analysis revealed that the miR-129 mimic impacts colon cancer cell growth by inducing G1 arrest, and such impact is much more potent (more than two-fold) than native miR-129.
[00188] miR-129 mimics eliminated chemotherapy resistant colon cancer stem cells.. To determine the impact of certain exemplary modified microRNAs of the present disclosure (i.e., miR-129 mimics) on 5-FU resistant colon cancer stem cells, HCT116 derived colon cancer stem cells were treated with various concentrations of Mimic-1 or 5-FU.
The data shown in FIG. 6 reveal that exemplary microRNA mimics of the present disclosure are able to eliminate 5-FU resistant colon cancer stem cells by over 80% at 100 nM
concentration, while a lethal dose of 5-FU at 100 RM has minimal effect on tumor stem cell viability.
[00189] Taken together, these results show that exemplary modified microRNA
polynucleotides of the present disclosure were able to inhibit cell proliferation of HCT116 colon cancer stem cells (FIG. 6). Such inhibitory effect by modified miR-129 was much more potent than native miR-129, as proliferation was nearly completely blocked with 25 nM miR-129 on day 6 (FIG. 6). We also demonstrated the impact of treatment of cells with modified miR-129 on anchorage independent cell growth using a soft agar assay.
The modified miR-129 treated colon cancer stem cells and formed no visible spheres compared to cells treated with the native miR-129 or control miRNA (similar to those seen in FIG. 10).
1001901 miR-129 mimics inhibit colon cancer metastasis in vivo. The therapeutic impact of modifying miR-129 nucleic acids was evaluated using a colon cancer metastasis model.
Two weeks after establishing metastasis, 40 lig of a miR-129 nucleic acid of SEQ ID NO; 4 was delivered by intravenous injection with treatment frequency of one injection every other day for two weeks.
[00191] The results shown in FIG. 7 reveal that modified microRNA-129 inhibits colon cancer metastasis while negative control miRNA has no effect, while exhibiting no toxic side effects. .
Example 3. Modified miR-15a and anti-cancer activity thereof.
1001921 Exemplary modified miR-15a compostions have anti-cancer activity. As shown in FIG. 1C and FIG. 1D, exemplary modified miR-15a mimics in which all of the uracil bases (FIG. 1C) or only uracil bases that in the non-seed region (FIG. 1D) of the miR-15a nucleic acid sequence were replaced with a 5-halouracil (i.e., 5-flurouracil) were synthesized as set forth above.
[00193] Three days following transfection of the exemplary modified miR-15a set forth in FIG. 1C into HCT-116 colon cancer stem cells, protein was collected and Western Bloting was performed to confirm that the modified miR-15a nucleic acid compositions of the present disclosure maintained the ability to regulate key miR-15a targets. As shown in FIG.
8A, miR-15a targets YAP1, BM 11, DCLK1 and BCL2 exhibited protein levels that were reduced upon transfection by either the unmodified miR-15a (native-miR15a) or modified miR-15a compositions, indicating that the 5-halouracil modification did not inhibit the ability of miR-15a to regulate their targets in cells.
[00194] Modified miR-15a has increased therapeutic eafficacy in vitro. In order to determine whether the modified miR-15a compositions of the present disclosure demonstrated increased potency in colon cancer cell lines compared to unmodified miR-15a, HCT-116 colon cancer cells were transfected with a negative control (non-specific oligonucleotide), unmodified miR-15a or the exemplary modified miR-15a compositions set forth in FIG. 1C.
[00195] A WST-1 assay was used to assed cancer cell proliferation. As shown in FIG. 8B, six days after transfection, unmodified miR-15a had decreased cell proliferation by 53%
compared to control. In the case of modified miR-15a, cell proliferation was decreased by 84%. Taken together, the experimental results show that modified miR-15a is more effective at decreasing cancer cell proliferation compared to the unmodified miR-15a.
1001961 Modified miR-15a nucleic acids were also analyzed for their ability to inhibit cell cycle progression in cancer cells. FIG. 9 shows that unmodified miR-15a induced cell cycle arrest and lead to about 3-fold increase in the Gl/S ratio. FIG. 9 also shows that the exemplary modified miR-15a compositions of the present disclosure were more effective in stopping cell cycle progression when compared to their native counterpart. For example, a 7-fold increase in the Gl/S ratio was exhibited by cells expressing the exemplary modified miR-15a nucleic acids of the present disclosure when compared to the control.
Therefore, modified miR-15a is more effective at inducing cell cycle arrest in colon cancer cells than unmodified miR-15a.
[00197] The effects of the exemplary modified miR-15a compositions on colony formation by colon cancer stem cells in Matrigel matrix were also examined. As shown in FIG. 10, while many colonies were generated by cells transfected with control miRNAs (FIG. 10, Negative), very few colonies were generated by cells transfected with unmodified miR-15a (FIG. 10, miR-15a). In contrast, in the case of cells transfected with modified miR-15a, no colonies were observed (FIG. 10, 5-FU-miR-15a). These results indicate that the exemplary modified miR-15a compositions of the present disclosure are indeed more potent inhibitors of tumorigenesis and colorectal cancer progression.
1001981 Modified miR-1 5a inhibits cancer development and progression in vivo.
To further our understanding of miR-15a in colon CSCs, a mouse xenograft model was established that included colorectal cancer cells that have been either pre transfected with modified miR-15a or negative control miRNA. Eight weeks after injection, tumors were measured and harvested. A drastic reduction in tumor size for tumors established from CSCs expressing modified miR-15a mimic (>25x) (n=8), as shown in FIG. 11.
1001991 The data presented here supports the viability of a novel modification in which halouracils (e.g., 5-FU) is incorporated into a miRNA nucleic acid sequence to enhance the chemotherapeutic function of the native microRNA molecule with or without the use of other chemotherapeutic agents.

Claims (22)

WHAT IS CLAIMED lS:
1. A nucleic acid composition cornprising a modified microRNA nucleotide sequence that comprises at least one uracil nucleic acid, wherein one or more of said at least one uracil nucleic acid is a 5-halouracil.
2. The nucleic acid composition of claim 1, wherein said modified microRNA
nucleotide sequence comprises a microRNA nucleotide sequence selected from the group consisting of miR-129, miR-15a, miR-140, miR-192, miR-502 and miR-506.
3. The nucleic acid composition of claim 2, wherein said modified microRNA
nucleotide sequence comprises a microRNA nucleotide sequence selected from the group consisting of CU F U F U F U F U F GCGGU F CU F GGGCU F U F GC [SEQ ID NO. 4], CUUUUUGCGGU F CU F GGGCU F U F GC [SEQ ID NO. 5], U F AGCAGCACAU F AAU F GGU F U F U F GU F G [SEQ ID NO.6], UAGCAGCACAU F AAU F GGU F U F U F GU F G [SEQ ID NO. 7], CAGU F GGUUUUACCCU F AUGGU F AG [SEQ ID NO. 9], CU F GACCU F AU F GAAU F U F GACAGCC [SEQ ID NO. 11], AU F CCU F U F GCUAU F CU F GGGU F GCU F A [SEQ ID NO. 13], and U F AU F U F CAGGAAGGU F GU F U F ACU F U F AA [SEQ ID NO. 15].
4. The nucleic acid composition of claim 2, wherein said modified microRNA
nucleotide sequence comprises a microRNA nucleotide sequence of miR-129 as set forth in SEQ ID NO. 1 or miR-15a as set forth in SEQ ID NO. 2.
5. The nucleic acid composition of claim 4, wherein said microRNA
nucleotide sequence is the miR-129 nucleotide sequence set forth in SEQ ID NO. 1, wherein at least one of the uracil nucleic acids is a 5-halouracil.
6. The nucleic acid composition of claim 4, wherein said microRNA
nucleotide sequence is the miR-15a nucleotide sequence set forth in SEQ ID NO. 2, wherein at least one of the uracil nucleic acids is a 5-halouracil.
7. The composition of claim 1, wherein said 5-halouracil is 5-fluorouracil.
8. The composition of claim 1, wherein at least two of the uracil nucleic acids in the nucleotide sequence are 5-halouracils.
9. The composition of claim 8, wherein at least three of the uracil nucleic acids in the nucleotide sequence are 5-halouracils.
10. The composition of claim 9, wherein at least four of the uracil nucleic acids in the nucleotide sequence are 5-halouracils.
11. The composition of claim 10, wherein at least five of the uracil nucleic acids in the nucleotide sequence are 5-halouracils.
12. The composition of claim 11, wherein at least 6 of uracil nucleic acids in the nucleotide sequence are 5-hal ouracils.
13. The composition of claim 1, wherein all of uracil nucleic acids in the nucleotide sequence are 5-halouracils.
14. The composition of claim 2, wherein said 5-halouracil is 5-fluorouracil.
15. A pharmaceutical composition comprising a nucleic acid composition of claim 1, and a pharmaceutically acceptable carrier.
16. The pharmaceutical composition of claim 14, wherein the nucleic acid composition is selected from the group consisting of CU F U F U F U F GCGGU F CU F GGGCU F
U F GC[SEQ
ID NO. 4], CUUUUUGCGGUFCUFGGGCUFUFGC [SEQ ID NO. 5], U F AGCAGCACAU F AAU F GG F U FGU F G [SEQ ID NO.6], UAGCAGCACAU F AAU F GGU F U F GU F G [SEQ ID NO. 7], CAGU F GGUUUUACCCU F AUGGU F AG [SEQ ID NO. 9], CU F GACCU F AUFGAAU F UFGACAGCC [SEQ ID NO. 11], AU F CCU F U F GCUAU F CU F GGGU F GCU F A [SEQ ID NO. 13], and U F AU F U F CAGGAAGGU F GU F U F ACU F U F AA [SEQ ID NO. 15], wherein UF is a 5-halouruacil.
17. The pharmaceutical composition of claim 15, wherein said 5-halouracil is 5-fluorouracil.
18. A method for treating cancer comprising:
administering to a subject an effective amount of a nucleic acid composition of claim 1, wherein said subject has cancer or has been diagnosed with a predisposition for developing cancer, and wherein progression of said cancer is inhibited.
19. The method of claim 18, wherein the mammal is a human.
20. The method of claim 19, wherein said subject has a cancer selected from the group consisting of colorectal, pancreatic or lung cancer.
21. The method of claim 20, wherein said subject has colorectal cancer.
22. The method of claim 17, wherein the nucleic acid composition is selected from the group consisting of CU F U F U F U F U F GCGGU F CU F GGGCU F U F GC [SEQ ID
NO. 4], CUUUUUGCGGU F CUFGGGCU F U F GC [SEQ ID NO. 5], U F AGCAGCACAU F AAU F GGU F U F U F GU F G [SEQ ID NO.6], UAGCAGCACAU F AAU F GGU F U F U F GU F G [SEQ ID NO. 7], CAGU F GGUUUUACCCU F AUGGU F AG [SEQ ID NO. 9], CU F GACCU F AU F GAAU F U F GACAGCC [SEQ ID NO. 11], AU F CCU F U F GCUAU F CU F GGGU F GCU F A [SEQ ID NO. 13], and U F AU F U F CAGGAAGGU F GU F U F ACU F U F AA [SEQ ID NO. 15], wherein said 5-halouracil is 5-fluoracil.
CA3042401A 2016-11-01 2017-10-30 5-halouracil-modified micrornas and their use in the treatment of cancer Pending CA3042401A1 (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US201662415740P 2016-11-01 2016-11-01
US62/415,740 2016-11-01
US201662422298P 2016-11-15 2016-11-15
US62/422,298 2016-11-15
US201762464491P 2017-02-28 2017-02-28
US62/464,491 2017-02-28
PCT/US2017/059011 WO2018085198A1 (en) 2016-11-01 2017-10-30 5-halouracil-modified micrornas and their use in the treatment of cancer

Publications (1)

Publication Number Publication Date
CA3042401A1 true CA3042401A1 (en) 2018-05-11

Family

ID=62077036

Family Applications (1)

Application Number Title Priority Date Filing Date
CA3042401A Pending CA3042401A1 (en) 2016-11-01 2017-10-30 5-halouracil-modified micrornas and their use in the treatment of cancer

Country Status (12)

Country Link
US (2) US11584932B2 (en)
EP (2) EP3534912A4 (en)
JP (2) JP7130639B2 (en)
KR (2) KR102502248B1 (en)
CN (2) CN110290794A (en)
AU (2) AU2017353907B2 (en)
BR (1) BR112019008810A2 (en)
CA (1) CA3042401A1 (en)
IL (1) IL282836A (en)
MX (1) MX2019005101A (en)
SG (1) SG11202104571RA (en)
WO (2) WO2018085198A1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015021346A1 (en) * 2013-08-08 2015-02-12 The Research Foundation For The State University Of New York Keratins as biomarkers for cervical cancer and survival
MX2019005101A (en) 2016-11-01 2019-08-22 Univ New York State Res Found 5-halouracil-modified micrornas and their use in the treatment of cancer.
US11236337B2 (en) 2016-11-01 2022-02-01 The Research Foundation For The State University Of New York 5-halouracil-modified microRNAs and their use in the treatment of cancer
US10941403B2 (en) 2018-04-02 2021-03-09 Oregon Health & Science University Microrna inhibitors as anti-cancer therapeutics
JP2022525156A (en) * 2019-03-14 2022-05-11 ザ・リサーチ・ファウンデーション・フォー・ザ・ステイト・ユニヴァーシティ・オブ・ニューヨーク Modified microRNAs and their use in the treatment of cancer
WO2021188747A1 (en) * 2020-03-18 2021-09-23 The Research Foundation For The State University Of New York Modified short-interfering rna compositions and their use in the treatment of cancer
WO2021262919A2 (en) * 2020-06-26 2021-12-30 The Research Foundation For The State University Of New York 5-halouracil-modified micrornas and their use in the treatment of cancer

Family Cites Families (149)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5889136A (en) 1995-06-09 1999-03-30 The Regents Of The University Of Colorado Orthoester protecting groups in RNA synthesis
EP1430128B1 (en) * 2001-09-28 2018-04-25 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Micro-rna molecules
EP2530157B1 (en) * 2003-07-31 2016-09-28 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of miRNAs
US20050261217A1 (en) 2004-05-18 2005-11-24 Isis Pharmaceuticals Inc. Modulation of pumilio 1 expression
US7592441B2 (en) 2004-10-04 2009-09-22 Rosetta Genomics Ltd Liver cancer-related nucleic acids
US7825229B2 (en) 2005-03-25 2010-11-02 Rosetta Genomics Ltd. Lung cancer-related nucleic acids
US7642348B2 (en) 2004-10-04 2010-01-05 Rosetta Genomics Ltd Prostate cancer-related nucleic acids
US20070259349A1 (en) 2006-05-04 2007-11-08 Itzhak Bentwich Bladder cancer-related nucleic acids
PL2302055T3 (en) 2004-11-12 2015-02-27 Asuragen Inc Methods and compositions involving miRNA and miRNA inhibitor molecules
AU2006242154B2 (en) 2005-05-02 2011-11-03 Cold Spring Harbor Laboratory Composition and methods for cancer diagnosis utilizing the mir 17-92 cluster
EP1904110A4 (en) 2005-06-03 2009-02-11 Southern Adelaide Health Servi Targeting cells with altered microrna expression
US20090209621A1 (en) 2005-06-03 2009-08-20 The Johns Hopkins University Compositions and methods for decreasing microrna expression for the treatment of neoplasia
ES2545383T3 (en) 2005-08-01 2015-09-10 The Ohio State University Research Foundation Methods and compositions based on microRNA for the diagnosis, prognosis and treatment of breast cancer
JP2009507918A (en) 2005-09-12 2009-02-26 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション Compositions and methods for diagnosis and therapy of BCL2-related cancers
US7943318B2 (en) 2006-01-05 2011-05-17 The Ohio State University Research Foundation Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer
JP5490413B2 (en) 2006-01-05 2014-05-14 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション Abnormal microRNA expression in pancreatic endocrine and acinar tumors
CA2633754C (en) 2006-01-05 2013-06-18 The Ohio State University Research Foundation Microrna-based methods and compositions for the diagnosis and treatment of solid cancers
EP2522747A1 (en) 2006-03-02 2012-11-14 The Ohio State University MicroRNA expression profile associated with pancreatic cancer
US7985584B2 (en) 2006-03-20 2011-07-26 The Ohio State University Research Foundation MicroRNA fingerprints during human megakaryocytopoiesis
EA201100813A1 (en) 2006-04-03 2012-06-29 Сантарис Фарма А/С PHARMACEUTICAL COMPOSITION
WO2007112753A2 (en) 2006-04-03 2007-10-11 Santaris Pharma A/S Pharmaceutical composition comprising anti-mirna antisense oligonucleotides
US20080076674A1 (en) 2006-07-06 2008-03-27 Thomas Litman Novel oligonucleotide compositions and probe sequences useful for detection and analysis of non coding RNAs associated with cancer
EP2455494B1 (en) 2006-07-13 2013-12-18 The Ohio State University Research Foundation Micro-RNA-based methods and compositions for the diagnosis and treatment of colon related diseases
WO2008014008A2 (en) 2006-07-28 2008-01-31 The Johns Hopkins University Compositions and methods for modulating angiogenesis
EP2094848A2 (en) 2006-09-19 2009-09-02 Asuragen, INC. Mir-143 regulated genes and pathways as targets for therapeutic intervention
EP2076599A2 (en) 2006-09-19 2009-07-08 Asuragen, Inc. Mir-200 regulated genes and pathways as targets for therapeutic intervention
US8188255B2 (en) 2006-10-20 2012-05-29 Exiqon A/S Human microRNAs associated with cancer
EP2090665A2 (en) 2006-10-20 2009-08-19 Exiqon A/S Novel human microRNAs associated with cancer
US20090137504A1 (en) 2006-12-21 2009-05-28 Soren Morgenthaler Echwald Microrna target site blocking oligos and uses thereof
EP3536788A1 (en) 2006-12-21 2019-09-11 QIAGEN GmbH Microrna target site blocking oligos and uses thereof
WO2008092099A2 (en) 2007-01-26 2008-07-31 Rosetta Genomics, Ltd. Compositions and methods for treating hematopoietic malignancies
US20100310583A1 (en) 2007-01-31 2010-12-09 Immune Disease Institute Let-7 microrna and mimetics thereof as therapeutics for cancer
US9006206B2 (en) 2007-02-27 2015-04-14 Rosetta Genomics Ltd. Composition and methods for modulating cell proliferation and cell death
US8399248B2 (en) 2007-05-03 2013-03-19 Merck Sharp & Dohme Corp. Methods of using MIR34 as a biomarker for TP53 functional status
KR20100049079A (en) * 2007-07-18 2010-05-11 더 리젠트스 오브 더 유니버시티 오브 콜로라도 Differential expression of micrornas in nonfailing versus failing human hearts
US20100249213A1 (en) 2007-09-06 2010-09-30 The Ohio State University Research Foundation MicroRNA Signatures in Human Ovarian Cancer
CN101842484B (en) 2007-09-14 2015-07-29 俄亥俄州立大学研究基金会 MIRNA in human peripheral blood microvesicles expresses and its purposes
US8361714B2 (en) * 2007-09-14 2013-01-29 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
US20090136957A1 (en) 2007-09-15 2009-05-28 Irena Ivanovska Methods and compositions for regulating cell cycle progression via the miR-106B family
CN101861401B (en) 2007-10-11 2014-03-12 俄亥俄州立大学研究基金会 Methods and compositions for diagnosis and treatment of esphageal adenocarcinomas
CA2704043C (en) 2007-10-29 2018-09-18 Rosetta Genomics Ltd. Targeting micrornas for the treatment of liver cancer
US20110009469A1 (en) 2007-12-05 2011-01-13 The Johns Hopkins University Compositions and methods of treating neoplasia
EP2260109A4 (en) 2008-02-28 2011-06-08 Univ Ohio State Res Found Microrna-based methods and compositions for the diagnosis, pronosis and treatment of prostate related disorders
EP2271370A4 (en) 2008-03-24 2011-11-02 Univ New York Compositions and methods for diagnosing and treating melanoma
WO2009154835A2 (en) 2008-03-26 2009-12-23 Asuragen, Inc. Compositions and methods related to mir-16 and therapy of prostate cancer
US20100113284A1 (en) 2008-04-04 2010-05-06 Alexander Aristarkhov Small interfering rna (sirna) target site blocking oligos and uses thereof
WO2009126726A1 (en) 2008-04-08 2009-10-15 Asuragen, Inc Methods and compositions for diagnosing and modulating human papillomavirus (hpv)
US20110166200A1 (en) 2008-04-24 2011-07-07 Zhan Zhang Methods of using mir210 as a biomarker for hypoxia and as a therapeutic agent for treating cancer
EP2296669B1 (en) 2008-05-30 2012-03-21 Yale University Targeted oligonucleotide compositions for modifying gene expression
EP2294218A2 (en) 2008-06-02 2011-03-16 New York University Compositions and methods for diagnosis, prognosis and treatment of mesothelioma
US8927207B2 (en) * 2008-06-05 2015-01-06 Research Foundation Of State University Of New York miRNAs as therapeutic targets in cancer
WO2009153774A2 (en) 2008-06-17 2009-12-23 Rosetta Genomics Ltd. Compositions and methods for prognosis of ovarian cancer
WO2010005850A1 (en) 2008-07-08 2010-01-14 The J. David Gladstone Institutes Methods and compositions for modulating angiogenesis
EP2310021A4 (en) 2008-07-10 2012-06-27 Merck Sharp & Dohme Methods of using compositions comprising mir-192 and/or mir-215 for the treatment of cancer
WO2010023658A2 (en) 2008-08-28 2010-03-04 Rosetta Genomics Ltd. Compositions and methods for the treatment of glioblastoma
CN102239260B (en) 2008-10-03 2017-04-12 库尔纳公司 Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoprotein-a1
WO2010065630A2 (en) 2008-12-03 2010-06-10 The Johns Hopkins University Compositions and methods for treating hepatic neoplasia
CN108042560A (en) 2008-12-04 2018-05-18 库尔纳公司 By inhibiting to treat 1 relevant disease of Sirtuin for the natural antisense transcript of Sirtuin 1
WO2010065787A2 (en) 2008-12-04 2010-06-10 Curna, Inc. Treatment of tumor suppressor gene related diseases by inhibition of natural antisense transcript to the gene
MX2011005912A (en) 2008-12-04 2011-06-17 Opko Curna Llc Treatment of vascular endothelial growth factor (vegf) related diseases by inhibition of natural antisense transcript to vegf.
CN102292456A (en) 2008-12-05 2011-12-21 俄亥俄州立大学研究基金会 MicroRNA-based methods and compositions for the diagnosis and treatment of ovarian cancer
US20100311815A1 (en) 2009-02-23 2010-12-09 The Regents Of The University Of Michigan Mir-101 cancer markers
WO2010099342A2 (en) * 2009-02-25 2010-09-02 Cepheid Methods of detecting lung cancer
JP6250263B2 (en) 2009-03-04 2017-12-20 クルナ・インコーポレーテッド Treatment of SIRT1-related diseases by suppression of natural antisense transcripts against sirtuin 1 (SIRT1)
US8735568B2 (en) 2009-03-09 2014-05-27 The J. David Gladstone Institutes Methods of modulating smooth muscle cell proliferation and differentiation
WO2010108192A1 (en) 2009-03-20 2010-09-23 The Research Foundation Of State University Of New York Mirnas as therapeutic targets in cancer
US8852940B2 (en) * 2009-04-01 2014-10-07 The Regents Of The University Of California Embryonic stem cell specific microRNAs promote induced pluripotency
SG175821A1 (en) * 2009-04-29 2011-12-29 Academisch Medisch Ct Bij De Univeriteit Van Amsterdam Means and methods for counteracting, preventing and/or determining heart failure, or a risk of heart failure
WO2010127195A2 (en) 2009-05-01 2010-11-04 Curna, Inc. Antisense oligonucleotides of hemoglobins
WO2010129746A2 (en) 2009-05-06 2010-11-11 Curna, Inc. Treatment of tristetraproline (ttp) related diseases by inhibition of natural antisense transcript to ttp
KR100998365B1 (en) * 2009-06-29 2010-12-06 압타바이오 주식회사 Novel guanosine rich modified oligonucleotides and antiproliferative activity thereof
WO2011014980A1 (en) 2009-08-07 2011-02-10 Capitalbio Corporation Methods and compositions diagnosing cervical cancer and cervical dysplasia, guidding subsequent treatment, determining prognosis, and improving patient survival
US8822144B2 (en) 2009-08-19 2014-09-02 Rosetta Genomics Ltd. Compositions and methods for prognosis and treatment of prostate cancer
WO2011024157A1 (en) 2009-08-23 2011-03-03 Rosetta Genomics Ltd. Nucleic acid sequences related to cancer
US9157080B2 (en) 2009-09-09 2015-10-13 New York University Compositions and methods for treatment, diagnosis and prognosis of mesothelioma
ES2597554T3 (en) * 2009-11-04 2017-01-19 Diamir, Llc Methods of using micro-RNA of body fluids for the diagnosis and control of mild cognitive impairment
US9173895B2 (en) 2009-12-16 2015-11-03 Curna, Inc. Treatment of membrane bound transcription factor peptidase, site 1 (MBTPS1) related diseases by inhibition of natural antisense transcript to MBTPS1
WO2011090741A2 (en) 2009-12-29 2011-07-28 Opko Curna, Llc TREATMENT OF TUMOR PROTEIN 63 (p63) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO p63
ES2664605T3 (en) 2010-01-04 2018-04-20 Curna, Inc. Treatment of diseases related to interferon regulatory factor 8 (irf8) by inhibition of the natural antisense transcript to the irf8 gene
US8846631B2 (en) 2010-01-14 2014-09-30 Regulus Therapeutics Inc. MicroRNA compositions and methods
JP5981850B2 (en) 2010-01-25 2016-08-31 カッパーアールエヌエー，インコーポレイテッド Treatment of RNase H1-related diseases by inhibition of natural antisense transcripts against RNase H1
CN102844435B (en) 2010-02-22 2017-05-10 库尔纳公司 Treatment of pyrroline-5-carboxylate reductase 1 (pycr1) related diseases by inhibition of natural antisense transcript to pycr1
EP3214174B1 (en) * 2010-03-04 2019-10-16 InteRNA Technologies B.V. A mirna molecule defined by its source and its diagnostic and therapeutic uses in diseases or conditions associated with emt
US20130059015A1 (en) 2010-03-11 2013-03-07 H. Lee Moffitt Cancer Center & Research Institute Human Cancer micro-RNA Expression Profiles Predictive of Chemo-Response
US9526693B2 (en) 2010-03-16 2016-12-27 Sanford-Burnham Medical Research Inslilute Delivery of agents using interfering nanoparticles
CN102858979B (en) 2010-04-09 2018-01-26 库尔纳公司 FGF21 relevant diseases are treated by suppressing the natural antisense transcript of FGF2 1 (FGF21)
WO2011128886A1 (en) 2010-04-12 2011-10-20 Ramot At Tel Aviv University Ltd. A micro-rna for cancer diagnosis, prognosis and therapy
TWI586356B (en) 2010-05-14 2017-06-11 可娜公司 Treatment of par4 related diseases by inhibition of natural antisense transcript to par4
TW201201819A (en) 2010-05-19 2012-01-16 Opko Curna Llc Treatment of BCL2-like 11 (BCL2L11) related diseases by inhibition of natural antisense transcript to BCL2L11
CN107412251A (en) 2010-05-26 2017-12-01 库尔纳公司 ATOH1 relevant diseases are treated by suppressing the natural antisense transcript of atonal homolog 1 (ATOH1)
WO2011157294A1 (en) 2010-06-16 2011-12-22 Universita' Degli Studi Di Padova Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto
WO2012009347A2 (en) 2010-07-12 2012-01-19 Opko Curna Llc Treatment of bcl2 binding component 3 (bbc3) related diseases by inhibition of natural antisense transcript to bbc3
WO2012009508A2 (en) 2010-07-15 2012-01-19 Emory University Microrna compositions and methods related thereto
US20130123138A1 (en) 2010-07-25 2013-05-16 New York University Compositions and methods for prognosis of mesothelioma
WO2012017430A2 (en) 2010-08-01 2012-02-09 Tel Hashomer Medical Research Infrastructure And Services Ltd. Microrna patterns for the diagnosis, prognosis and treatment of melanoma
US8993533B2 (en) 2010-10-06 2015-03-31 Curna, Inc. Treatment of sialidase 4 (NEU4) related diseases by inhibition of natural antisense transcript to NEU4
KR101343616B1 (en) 2010-10-08 2013-12-20 연세대학교 산학협력단 Pharmaceutical Compositions for Treating Pancreatic Cancer and Screening Method for Pancreatic Cancer Therapeutic Agent
EP2638163B1 (en) 2010-11-12 2017-05-17 The General Hospital Corporation Polycomb-associated non-coding rnas
JP2014502606A (en) 2010-12-15 2014-02-03 メディミューン，エルエルシー Melanoma treatment
WO2012092485A1 (en) * 2010-12-31 2012-07-05 Anthrogenesis Corporation Enhancement of placental stem cell potency using modulatory rna molecules
WO2012093384A1 (en) 2011-01-03 2012-07-12 Rosetta Genomics Ltd. Compositions and methods for treatment of ovarian cancer
EP2474617A1 (en) * 2011-01-11 2012-07-11 InteRNA Technologies BV Mir for treating neo-angiogenesis
MX2013008944A (en) * 2011-02-03 2014-01-08 Mirna Therapeutics Inc Synthetic mimics of mir-124.
US9132152B2 (en) 2011-02-10 2015-09-15 The Regents Of The University Of California Compositions and methods for generating induced pluripotent stem cells
US20120264131A1 (en) 2011-03-18 2012-10-18 Baylor Research Institute CHANGES IN THE EXPRESSION OF miR-200c/141 CLUSTER OF microRNAs AS BIOMARKERS FOR EPITHELIAL-TO-MESENCHYMAL TRANSITION IN HUMAN COLORECTAL CANCER METASTASIS
US8987224B2 (en) * 2011-08-05 2015-03-24 Baylor College Of Medicine MicroRNA-198 as a tumor suppressor in pancreatic cancer
US20150267193A1 (en) * 2011-10-14 2015-09-24 Ramanuj Dasgupta MicroRNAs and Methods of Using Same
EP2785355A4 (en) 2011-11-30 2015-12-02 Cedars Sinai Medical Center Targeting micrornas mir-409-5p, mir-379 and mir-154* to treat prostate cancer bone metastasis and drug resistant lung cancer
US9745578B2 (en) 2011-11-30 2017-08-29 Cedars-Sinai Medical Center Targeting microRNA miR-409-3P to treat prostate cancer
WO2013109604A1 (en) * 2012-01-19 2013-07-25 Alnylam Pharmaceuticals, Inc. Viral attenuation and vaccine production
EP2825648B1 (en) 2012-03-15 2018-09-05 CuRNA, Inc. Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
SG11201406787TA (en) * 2012-04-20 2014-12-30 Agency Science Tech & Res Rnai-based therapies for cardiomyopathies, muscular dystrophies and laminopathies
CA2873797A1 (en) 2012-05-16 2013-11-21 Rana Therapeutics Inc. Compositions and methods for modulating utrn expression
BR112014028647A2 (en) 2012-05-16 2017-07-25 Rana Therapeutics Inc compositions and methods for modulating bdnf expression
AU2013262649A1 (en) 2012-05-16 2015-01-22 Rana Therapeutics, Inc. Compositions and methods for modulating smn gene family expression
BR112014028645A2 (en) 2012-05-16 2017-06-27 Rana Therapeutics Inc compositions and methods for modulating expression of apoa1 and abca1.
EP2850187A4 (en) 2012-05-16 2016-01-20 Rana Therapeutics Inc Compositions and methods for modulating pten expression
US10174315B2 (en) 2012-05-16 2019-01-08 The General Hospital Corporation Compositions and methods for modulating hemoglobin gene family expression
WO2013173608A1 (en) 2012-05-16 2013-11-21 Rana Therapeutics, Inc. Compositions and methods for modulating mecp2 expression
CN104583398A (en) 2012-05-16 2015-04-29 Rana医疗有限公司 Compositions and methods for modulating gene expression
US10174323B2 (en) 2012-05-16 2019-01-08 The General Hospital Corporation Compositions and methods for modulating ATP2A2 expression
CA2882428A1 (en) 2012-07-12 2014-01-16 Baylor College Of Medicine Micrornas sensitize cancers to therapy
US9096853B2 (en) * 2012-09-24 2015-08-04 U.S. Department Of Veterans Affairs Modified siRNA molecules incorporating 5-fluoro-2′-deoxyuridine residues to enhance cytotoxicity
WO2014071067A2 (en) 2012-10-31 2014-05-08 The Rockefeller University Treatment and diagnosis of colon cancer
EP2917348A1 (en) 2012-11-06 2015-09-16 InteRNA Technologies B.V. Combination for use in treating diseases or conditions associated with melanoma, or treating diseases or conditions associated with activated b-raf pathway
WO2014100252A1 (en) * 2012-12-18 2014-06-26 University Of Washington Through Its Center For Commercialization Methods and compositions to modulate rna processing
US10697020B2 (en) * 2013-05-15 2020-06-30 The Research Foundation For The State University Of New York MicroRNA-129 as a biomarker for colorectal cancer
AU2014274730A1 (en) 2013-06-07 2016-01-21 Rana Therapeutics, Inc. Compositions and methods for modulating FOXP3 expression
WO2014201417A1 (en) * 2013-06-14 2014-12-18 The University Of Kansas Methods and compositions of modulating tumor initiating cells and the use thereof
PL3074050T3 (en) * 2013-10-28 2021-04-06 Icahn School Of Medicine At Mount Sinai Compositions and methods for modulating neuronal excitability and motor behavior
WO2015095862A2 (en) 2013-12-20 2015-06-25 The Feinstein Institute For Medical Research Microrna biomarkers for ovarian cancer
JP2017511694A (en) 2014-02-12 2017-04-27 トーマス・ジェファーソン・ユニバーシティ Compositions and methods for using microRNA inhibitors
KR101596166B1 (en) 2014-10-07 2016-02-19 가톨릭대학교 산학협력단 A Use of microRNA for Ddiagnosing and Treating Brest Cancer
US10900036B2 (en) 2015-03-17 2021-01-26 The General Hospital Corporation RNA interactome of polycomb repressive complex 1 (PRC1)
EP3331546B1 (en) 2015-08-03 2023-10-04 Biokine Therapeutics Ltd. Cxcr4 inhibitor for the treatment of cancer
US10053696B2 (en) 2016-01-21 2018-08-21 University Of South Carolina MiRNA-489 in treatment of breast cancer
MX2019005101A (en) 2016-11-01 2019-08-22 Univ New York State Res Found 5-halouracil-modified micrornas and their use in the treatment of cancer.
US11236337B2 (en) 2016-11-01 2022-02-01 The Research Foundation For The State University Of New York 5-halouracil-modified microRNAs and their use in the treatment of cancer
US10443055B2 (en) 2016-12-22 2019-10-15 Beth Israel Deaconess Medical Center Compounds that target MYC microRNA responsive elements for the treatment of MYC-associated cancer
US10988766B2 (en) 2017-01-06 2021-04-27 Oregon Health & Science University Compositions and methods used in diagnosing and treating colorectal cancer
WO2018136919A2 (en) 2017-01-23 2018-07-26 Trustees Of Boston University Methods relating to lung cancer
KR101953300B1 (en) 2018-06-22 2019-02-28 의료법인 성광의료재단 A composition, kit and method for diagnosing and treating taxane-based anticancer drugs resistance cancer
MA53669A (en) 2018-09-20 2021-07-28 Modernatx Inc COMPOSITIONS AND METHODS OF NUCLEIC ACID DELIVERY
MA54226A (en) 2018-11-13 2021-09-22 Regulus Therapeutics Inc MICRORNA COMPOUNDS AND METHODS OF MODULATING MIR-10B ACTIVITY
WO2020154207A1 (en) 2019-01-22 2020-07-30 Research Institute At Nationwide Children's Hospital A novel method for monitoring and treating oral cancer
JP2022525156A (en) 2019-03-14 2022-05-11 ザ・リサーチ・ファウンデーション・フォー・ザ・ステイト・ユニヴァーシティ・オブ・ニューヨーク Modified microRNAs and their use in the treatment of cancer
US20220275374A1 (en) 2019-11-14 2022-09-01 The Board Of Regents Of The University Of Oklahoma Oligonucleotide interference treatments of prostate cancer
US11965162B2 (en) 2020-04-16 2024-04-23 The Johns Hopkins University MicroRNA and inhibitors thereof and methods of treatment
WO2021262919A2 (en) 2020-06-26 2021-12-30 The Research Foundation For The State University Of New York 5-halouracil-modified micrornas and their use in the treatment of cancer

Also Published As

Publication number Publication date
EP3873613A4 (en) 2023-11-15
EP3534912A1 (en) 2019-09-11
CN110290794A (en) 2019-09-27
US20230365972A1 (en) 2023-11-16
EP3873613A1 (en) 2021-09-08
AU2019371830A1 (en) 2021-06-03
JP2022173194A (en) 2022-11-18
SG11202104571RA (en) 2021-06-29
MX2019005101A (en) 2019-08-22
US20190062754A1 (en) 2019-02-28
AU2017353907A1 (en) 2019-05-23
JP7130639B2 (en) 2022-09-05
KR20190086688A (en) 2019-07-23
KR20210088614A (en) 2021-07-14
JP2019533697A (en) 2019-11-21
CN113573781A (en) 2021-10-29
WO2018085198A1 (en) 2018-05-11
IL282836A (en) 2021-06-30
KR102502248B1 (en) 2023-02-21
EP3534912A4 (en) 2020-10-07
AU2017353907B2 (en) 2023-11-30
WO2020092466A1 (en) 2020-05-07
US11584932B2 (en) 2023-02-21
BR112019008810A2 (en) 2019-07-16

Similar Documents

Publication Publication Date Title
AU2017353907B2 (en) 5-halouracil-modified microRNAs and their use in the treatment of cancer
JP2018507866A (en) Pharmaceutical composition for cancer treatment comprising microRNA as an active ingredient
US20220145304A1 (en) Modified micrornas and their use in the treatment of cancer
JP2021513508A (en) Anti-cancer microRNA and its lipid preparation
US11236337B2 (en) 5-halouracil-modified microRNAs and their use in the treatment of cancer
TWI526211B (en) RNAi molecules for thymidine nucleotide synthesis enzymes and their use
US20220090076A1 (en) 5-halouracil-modified micrornas and their use in the treatment of cancer
US10697020B2 (en) MicroRNA-129 as a biomarker for colorectal cancer
WO2015072247A1 (en) Cancer stem cell-targeting drug composition
US20230151363A1 (en) Modified short-interfering rna compositions and their use in the treatment of cancer

Legal Events

Date Code Title Description
EEER Examination request

Effective date: 20220815

EEER Examination request

Effective date: 20220815

EEER Examination request

Effective date: 20220815

EEER Examination request

Effective date: 20220815

EEER Examination request

Effective date: 20220815