CA2623425A1 - Methods for diagnosing pancreatic cancer - Google Patents

Abstract

The present invention provides a method of identifying origin of a metastasis of unknown origin by obtaining a sample containing metastatic cells; measuring Biomarkers associated with at least two different carcinomas; combining the data from the Biomarkers into an algorithm where the algorithm normalizes the Biomarkers against a reference; and imposes a cut-off which optimizes sensitivity and specificity of each Biomarker, weights the prevalence of the carcinomas and selects a tissue of origin determining origin based on highest probability determined by the algorithm or determining that the carcinoma is not derived from a particular set of carcinomas; and optionally measuring Biomarkers specific for one or more additional different carcinoma, and repeating the steps for additional Biomarkers.

Description

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

Methods for Diagnosing Pancreatic Cancer FIELD OF THE INVENTION
The present invention provides methods of diagnosing pancreatic cancer.
BACKGROUND OF THE INVENTION
Pancreatic cancer is a deadly disease which has a mortality rate in the United States of more than 27,000 people a year. Lillemoe et al (2000). About 85% of those diagnosed with the disease have metastasis or spread of the disease beyond the pancreas and are almost iinpossible to cure with surgical resection. If the growth is found sooner it may be resected with a much better hope of cure. Only 20% of the tumors are resectable and the survival benefit of approved chemotherapy regiments is rather poor and the chances of a cure are usually 25% or less. Kroep et al.
(1999);
Wiesenauer et al. (2003); Ros et al. (2001); Ryu et al. (2002); and Ito et al.
(2001).
Earlier diagnosis is necessary for earlier successful treatment.
Despite the advances in diagnostic imaging methods like ultrasonography (US), endoscopic ultrasonography (EUS), dualphase spiral computer tomography (CT), magnetic resonance imaging (MRT), endoscopic retrograde cholangiopancreatography (ERCP) and transcutaneous or EUS-guided fme-needle aspiration (FNA), distinguishing pancreatic carcinoma from benign pancreatic diseases, especially chronic pancreatitis, is difficult because of the similarities in radiological and imaging features and the lack of specific clinical symptoms for pancreatic carcinoma.
Substantial efforts have been directed to developing tools upful for early diagnosis of carcinomas. Nonetheless, a definitive diagnosis ' pancreatic is often dep ~ endet on exploratory surgery which is inevitably performed after the disease has advanced past', r~aa ~.:.
the point when early treatment may be effected. 20060029987.
Neoplasms of the exocrine pancreas may arise from ductal, acinar and stromal cells.
Eighty percent of pancreatic carcinomas are derived from ductal epithelium.
60% of these tumors are located in the head of the pancreas, 10% in the tail and 30%
are located in the body of the pancreas or are diffuse. Warshau et al. (1992).
Histologically, these tumors are graded as well as differentiated, moderately differentiated and poorly differentiated. Some tumors are classified as adenosquamous, mucinous, undifferentiated or undifferentiated with osteoblast-like giant cells. Gibson et al. (1978).
Various gene expression profiles and genetic markers related to pancreatic cancer have been put forth. 20050009067; 20040219572; and 20030212264.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts microarray data showing intensities of two genes in a panel of tissues. (A) Prostate stem cell antigen (PSCA). (B) Coagulation factor V(F5).
The bar graphs show the intensity on the y-axis and the tissue on the x-axis. Panc Ca, pancreatic cancer; Panc N, normal pancreas.
Figure 2 depicts electropherograms obtained from an Agilent Bioanalyzer. RNA
was isolated from FFPE tissue using a three hour (A) or sixteen hour (B) proteinase K
digestion. Sample C22 (red) was a one-year old block while sample C23 (blue) was a five-year old block. A size ladder is shown in green.
Figure 3 depicts a coinparison of Ct values obtained from three different qRTPCR
methods: random hexamer priming in the reverse transcription followed by qPCR
with the resulting cDNA (RH 2 step), gene-specific (reverse primer) priming in the reverse transcription followed by qPCR with the resulting cDNA (GSP 2 step), or gene-specific priming and qRTPCR in a one-step reaction (GSP 1 step). RNA from eleven samples was divided into the three methods and RNA levels for three genes were measured:
(3-actin (A), HUMSPB (B), and TTF (C). The median Ct value obtained with each method is indicated by the solid line.
Figure 4 depicts assay optimization. (A and B) Electropherograms obtained from an Agilent Bioanalyzer. RNA was isolated from FFPE tissue using a three hour (A) or sixteen hour (B) proteinase K digestion. Sample C22 (red) was a one-year old block while sample C23 (blue) was a five-year old block. A size ladder is shown in green.
(C and D) Comparison of Ct values obtained from three different qRTPCR
inethods:
random hexamer piriining in the reverse transcription followed by qPCR with the resulting cDNA (RH 2 step), gene-specific (reverse primer) priming in the reverse transcription followed by qPCR with the resulting cDNA (GSP 2 step), or gene-specific priming and qRTPCR in a one-step reaction (GSP 1 step). RNA from eleven sainples was divided into the three methods and RNA levels for two genes were measured:
(3-actin (C), HUMSPB (D). The median Ct value obtained with each method is indicated by the solid line.
Figure 5 is a heatinap showing the relative expression levels of the 10 Marlcer panel across 239 samples. Red indicates higher expression.
DETAILED DESCRIPTION
A Biomarker is any indicia of the level of expression of an indicated Marker gene.
The indicia can be direct or indirect and measure over- or under-expression of the gene given the physiologic parameters and in comparison to an internal control, noi7nal tissue or another carcinoma. Biomarkers include, without limitation, nucleic acids (both over and under-expression and direct and indirect). Using nucleic acids as Biomarkers can include any method known in the art including, without limitation, measuring DNA amplification, RNA, micro RNA, loss of heterozygosity (LOH), single nucleotide polymorphisms (SNPs, Brookes (1999)), microsatellite DNA, DNA hypo-or hyper-methylation. Using proteins as Biomarkers can include any method known in the art including, without limitation, measuring amount, activity, modifications such as glycosylation, phosphorylation, ADP-ribosylation, ubiquitination, etc., imunohistochemistry (IHC). Other Biomarkers include imaging, cell count and apoptosis Markers.
The indicated genes provided herein are those associated with a particular tumor or tissue type. A Marker gene may be associated with numerous cancer types but provided that the expression of the gene is sufficiently associated with one tumor or tissue type to be identified using the algorithm described herein to be specific for a particular origin, the gene can be used in the claimed invention to determine tissue of origin for a carcinoma of unknown primary origin (CUP). Numerous genes associated with one or more cancers are known in the art. The present invention provides preferred Marker genes and even more preferred Marker gene coinbinations.
These are described herein in detail.
"Origin" as referred to in'tissue of origin' means either the tissue type (lung, colon, etc.) or the histological type (adenocarcinonla, squamous cell carcinoma, etc.) depending on tlie particular medical circumstances and will be understood by anyone of slcill in the art.

A Marker gene corresponds to the sequence designated by a SEQ ID NO when it contains that sequence. A gene segment or fragment corresponds to the sequence of such gene when it contains a portion of the referenced sequence or its complement sufficient to distinguish it as being the sequence of the gene. A gene expression product corresponds to such sequence when its RNA, mRNA, or cDNA hybridizes to the coinposition having such sequence (e.g. a probe) or, in the case of a peptide or protein, it is encoded by such niRNA. A segment or fragment of a gene expression product corresponds to the sequence of such gene or gene expression product when it contains a portion of the referenced gene expression product or its complement sufficient to distinguish it as being the sequence of the gene or gene expression product.
The inventive methods, compositions, articles, and kits of described and claimed in this specification include one or inore Marker genes. "Marker" or "Marker gene" is used througliout this specification to refer to genes and gene expression products that correspond with any gene the over- or under-expression of which is associated with a tuinor or tissue type. The preferred Marker genes are described in more detail in Tables 1 and 15.
Table 1 CUP panel SEQ Name 1 Chip sequence ID designation NO:
1 SP-B 209810_at gaaaaaccagccactgctttacaggacagggggttgaagctgagccccgcct cacacccacccccatgcactcaaagattggattttacagctacttgcaattcaaa attcagaagaataaaaaatgggaacatacagaactctaaaagatagacatcag aaattgttaagttaagctttttcaaaaaatcagcaattccccagcgtagtcaaggg tggacactgcacgctctggcatgatgggatggcgaccgggcaagctttcttcct cgagatgctctgctgcttgagagctattgctttgttaagatataaaaaggggtttct ttttgtctttctgtaaggtggacttccagattttgattgaaagtcctagggtgattcta tttctgctgtgatttatctgctgaaagctcagctggggttgtgcaagctagggacc cattcct aatacaat ct caccaat ct 2 TTF l 211024_s_at gtgattcaaatgggttttccacgctagggcggggcacagattggagagggctct gtgctgacatggctctggactctaaagaccaaacttcactctgggcacactctgc cagcaaagaggactcgcttgtaaataccaggatttttttttttttttgaagggagga cgggagctggggagaggaaagagtcttcaacataacccacttgtcactgacac aaaggaagtgccccctccccggcaccctctggccgcctaggctcagcggcga ccgccctccgcgaaaatagtttgtttaatgtgaacttgtagctgtaaaacgctgtc aaaagttggactaaatgcctagtttttagtaatctgtacattttgttgtaaaaagaaa aaccactcccagtccccagcccttcacattttttatgggcattgacaaatctgtgta tattatttca atttc cgtca ctttttct t aact 3 DSG3 205595_at ccatcccatagaagtccagcagacaggatttgttaagtgccagactttgtcagg aagtcaaggagcttctgctttgtccgcctctgggtctgtccagccagctgtttcca tccctgaccctctgcagcatggtaactatttagtaacggagacttactcggcttct ggttccctcgtgcaaccttccactgcaggctttgatccacttctcacacaaaatgt gatagtgacagaaagggtgatctgtcccatttccagtgttcctggcaacctagct ggcccaacgcagctacgagggtcacatactatgctctgtacagaggatccttgc tcccgtctaatatgaccagaatgagctggaataccacactgaccaaatctggat ctttggactaaagtattcaaaatagcatagcaaagctcactgtattgggctaataa tttggcacttattagcttctctcataaactgatcacgattataaattaaatgtttgggt tcataccccaaaa caatat cactcctaattctcaa ac 4 HPT 1 209847_at ctgcacccacctacttagatatttcatgtgctatagacattagagagatttttcatttt tccatgacatttttcctctctgcaaatggcttagctacttgtgtttttcccttttggggc aagacagactcattaaatattctgtacattttttctttatcaaggagatatatcagtgt tgtctcatagaactgcctggattccatttatgttttttctgattccatcctgtgtcccct tcatccttgactccttt atttcact aatttcaaacatttgtc 5 PSCA 205319_at ttcctgaggcacatcctaacgcaagtttgaccatgtatgtttgcaccccttttcccc naaccctgaccttcccatgggccttttccaggattccnaccnggcagatcagttt tagtganacanatccgcntgcagatggcccctccaaccntttntgttgntgtttc catggcccagcattttccacccttaaccctgtgttcaggcacttnttcccccagga agccttccctgcccaccccatttatgaattgagccaggtttggtccgtggtgtccc ccgcacccagcaggggacaggcaatcaggagggcccagtaaaggctgaga tgaagtggactgagtagaactggaggacaagagttgacgtgagttcctgggag tttcca a at 6 F5 204713_s_at atcctctacagccagatgtcacagggatacgtctactttcacttggtgctggaga attcanaagtcaagaacatgctaagcntaagggacccaaggtagaaagagat caagcagcaaagcacaggttctcctggatgaaattactagcacataaagttggg agacacctaagccaagacactggttctccttccggaatgaggccctgggagga ccttcctagccaagacactggttctccttccagaatgaggccctggaaggaccc tcctagtgatctgttactcttaaaacaaagtaactcatctaagattttggttgggag atggcatttggcttctgagaaaggtagctatgaaataatccaagatactgatgaa gacacagctgttaacaattggctgatcagcccccagaatgcctcacgtgcttgg gagaaagcacccctcttgccaacaagcctg aaag 7 MGB 1 206378at gcagcagcctcaccatgaagttgctgatggtcctcatgctggcggccctctccc agcactgctacgcaggctctggctgccccttattggagaatgtgatttccaagac aatcaatccacaagtgtctaagactgaatacaaagaacttcttcaagagttcata gacgacaatgccactacaaatgccatagatgaattgaaggaatgttttcttaacc aaacggatgaaactctgagcaatgttgaggtgtttatgcaattaatatatgacagc agtctttgtgatttattttaactttctgcaagacctttggctcacagaactgcagggt atggtgagaaaccaactacggattgctgcaaaccacaccttctctttcttatgtctt tttact 8 PDEF 220192_x _at gagtggggcccttaaactggattcaaaaaatgctctaaacataggaatggttga agaggtcttgcagtcttcagatgaaactaaatctctagaagaggcacaagaatg gctaaagcaattcatccaagggccaccggaagtaattagagctttgaaaaaatc tgtttgttcaggcagagagctatatttggaggaagcattacagaacgaaagaga tcttttaggaacagtttggggtgggcctgcaaatttagaggctattgctaagaaa ggaaaatttaataaataattggtttttcgtgtggatgtactccaagtaaagctccag tgactaatatgtataaatgttaaatgatattaaatatgaacatcagttaaaaaaaaa attctttaaggctactattaatatgcagacttacttttaatcatttgaaatctgaactc atttacctcatttctt ccaattactccctt g atttact c a 9 PSA 204582_s_at tggtgtaattttgtcctctctgtgtcctggggaatactggccatgcctggagacat atcactcaatttctctgaggacacagataggatggggtgtctgtgttatttgtggg gtacagagatgaaagaggggtgggatccacactgagagagtggagagtgac atgtgctggacactgtccatgaagcactgagcagaagctggaggcacaacgc acca acactcaca caag atg a ct aaaacataacccactctgtcc WT 1 206067_s_at atagatgtacatacctccttgcacaaatggaggggaattcattttcatcactggga gtgtccttagtgtataaaaaccatgctggtatatggcttcaagttgtaaaaatgaa agtgactttaaaagaaaataggggatggtccaggatctccactgataagactgtt tttaagtaacttaaggacctttgggtctacaagtatatgtgaaaaaaatgagactta ctgggtgaggaaatccattgtttaaagatggtcgtgtgtgtgtgtgtgtgtgtgtgt gtgttgtgttgtgttttgttttttaagggagggaatttattatttaccgttgcttgaaatt actgtgtaaatatatgtctgataatgatttgctctttgacaactaaaattaggactgt ataagtactagatgcatcactgggtgttgatcttacaagat The present invention provides a method of diagnosing pancreatic cancers. The present invention thus provides methods for determining the direction of therapy by identifying pancreatic cancers potentially early enough to avoid resection thus allowing for cheinotherapeutic regimens.
5 The present invention further provides composition containing at least one isolated sequence selected from SEQ ID NOs: 39-41 and 43-45. The present invention fitrther provides kits for conducting an assay according to the methods provided herein and further containing Bioinarleer detection reagents.
The present invention fiirther provides methods for measuring gene expression by 10 generating the ainplicons of SEQ ID NOs: 42 and 46 to determine gene expression and comparing levels of at least one of these amplicons to normal tissue gene expression to diagnose pancreatic cancer.
The present invention further provides microarrays or gene chips for performing the methods described herein.
The present invention further provides diagnostic/prognostic portfolios containing isolated nucleic acid sequences, their complements, or portions thereof of a coinbination of genes as described herein wliere the combination is sufficient to measure or characterize gene expression in a biological sample having metastatic cells relative to cells from different carcinomas or normal tissue.
Any method described in the present invention can further include measuring expression of at least one gene constitutively expressed in the sample.
Preferably the Markers for pancreatic cancer are coagulation factor V (F5), prostate stem cell antigen (PSCA), integrin, (36 (ITGB6), kallikrein 10 (KLK10), claudin 18 (CLDN18), trio isoforin (TR10), and hypothetical protein FLJ22041 similar to binding proteins (FKBP10). Preferably, Biomarkers for F5 and PSCA are measured together. Bioinarkers for ITGB6, KLK10, CLDN18, TR10, and FKBP10 can be measured in addition to or in place of F5 and/or PSCA. F5 is described for instance by 20040076955; 20040005563; and W02004031412. PSCA is described for instance by W01998040403; 20030232350; and W02004063355. ITGB6 is described for instance by W02004018999; and 6339148. KLK10 is described for instance by W02004077060; and 20030235820. CLDN18 is described for instance by W02004063355; and W02005005601. TR10 is described for instance by 20020055627. FKBP10 is described for instance by W02000055320.
The invention further provides a inethod for providing a prognosis by deterinining the presence of pancreatic cancer according to the methods described herein and identifying the corresponding prognosis therefor.
The invention fiirther provides a method for finding Bioinarkers coinprising detennining the expression level of a Marlcer gene in a particular metastasis, measuring a Biomarlcer for the Marker gene to deterinine expression thereof, analyzing the expression of the Marlcer gene according to the methods described herein and deterininuig if the Marlcer gene is effectively specific for pancreatic cancer.

The invention further provides compositions comprising at least one isolated sequence selected from SEQ ID NOs: 39-46.
The invention further provides kits, articles, microarrays or gene chip, diagnostic/prognostic portfolios for conducting the assays described herein and patient reports for reporting the results obtained by the present methods.
The mere presence or absence of particular nucleic acid sequences in a tissue sample has only rarely been found to have diagnostic or prognostic value.
Information about the expression of various proteins, peptides or mRNA, on the other hand, is increasingly viewed as iinportant. The mere presence of nucleic acid sequences having the potential to express proteins, peptides, or mRNA (such sequences referred to as "genes") within the genome by itself is not determinative of whether a protein, peptide, or mRNA is expressed in a given cell. Whether or not a given gene capable of expressing proteins, peptides, or mRNA does so and to what extent such expression occurs, if at all, is determined by a variety of complex factors. Irrespective of difficulties in understanding and assessing these factors, assaying gene expression can provide useful infonnation about the occurrence of important events such as tumorogenesis, metastasis, apoptosis, and other clinically relevant phenomena.
Relative indications of the degree to which genes are active or inactive can be found in gene expression profiles. The gene expression profiles of this invention are used to provide a diagnosis and treat patients for CUP.
In the above methods, the sample can be prepared by any method known in the art including, but not limited to, bulk tissue preparation and laser capture inicrodissection.
The bulk tissue preparation can be obtained for instance from a biopsy or a surgical specimen.
In the above methods, the gene expression ineasuring can also include measuring the expression level of at least one gene constitutively expressed in the sample.
In the above metliods, the specificity is preferably at least about 40% and the sensitivity at least at least about 80%.
In the above methods, the pre-determined cut-off levels are at least about 1.5-fold over- or under- expression in the sample relative to benign cells or norinal tissue.

In the above methods, the pre-determined cut-off levels have at least a statistically significant p-value over-expression in the sample having metastatic cells relative to benign cells or normal tissue, preferably the p-value is less than 0.05.
In the above methods, gene expression can be measured by any method known in the art, including, without limitation on a microarray or gene chip, nucleic acid amplification conducted by polymerase chain reaction (PCR) such as reverse transcription polymerase chain reaction (RT-PCR), measuring or detecting a protein encoded by the gene such as by an antibody specific to the proteiii or by measuring a characteristic of the gene such as DNA amplification, methylation, mutation and allelic variation. The microarray can be for instance, a cDNA array or an oligonucleotide array. All these methods and can further contain one or more internal control reagents.
The present invention provides a method of generating a pancreatic cancer prognostic patient report by determining the results of any one of the methods described herein and preparing a report displaying the results and patient reports generated thereby. The report can further contain an assessment of patient outcome and/or probability of risk relative to the patient population.
Sample preparation requires the collection of patient sainples. Patient samples used in the inventive method are those that are suspected of containing diseased cells such as cells taken from a nodule in a fine needle aspirate (FNA) of tissue. Bulk tissue preparation obtained from a biopsy or a surgical specimen and laser capture microdissection are also suitable for use. Laser Capture Microdissection (LCM) technology is one way to select the cells to be studied, minimizing variability caused by cell type heterogeneity. Consequently, moderate or small changes in Marker gene expression between normal or benign and cancerous cells can be readily detected.
Samples can also coinprise circulating epithelial cells extracted from peripheral blood.
These can be obtained according to a number of methods but the most preferred method is the magnetic separation technique described in 61361 82. Once the sample containing the cells of interest has been obtained, a gene expression profile is obtained using a Bioinarker, for genes in the appropriate portfolios.
Preferred metllods for establishing gene expression profiles include determining the amount of RNA that is produced by a gene that can code for a protein or peptide. This is accomplished by reverse transcriptase PCR (RT-PCR), competitive RT-PCR, real time RT-PCR, differential display RT-PCR, Northern Blot analysis and other related tests. While it is possible to conduct these techniques using individual PCR
reactions, it is best to amplify complementary DNA (cDNA) or complementary RNA (cRNA) 5 produced from mRNA and analyze it via microarray. A number of different array configurations and methods for their production are laiown to those of skill in the art and are described in for instance, 5445934; 5532128; 5556752; 5242974;
5384261;
5405783; 5412087; 5424186; 5429807; 5436327; 5472672; 5527681; 5529756;
5545531; 5554501; 5561071; 5571639; 5593839; 5599695; 5624711; 5658734; and 10 5700637.
Microarray technology allows for the measurement of the steady-state mRNA
level of thousands of genes simultaneously thereby presenting a powerful tool for identifying effects such as the onset, arrest, or modulation of uncontrolled cell proliferation. Two microarray technologies are currently in wide use. The first are cDNA arrays and the second are oligonucleotide arrays. Although differences exist in the construction of these chips, essentially all downstream data analysis and output are the same.
The product of these analyses are typically measurements of the intensity of the signal received from a labeled probe used to detect a cDNA sequence from the sample that hybridizes to a nucleic acid sequence at a known location on the inicroarray.
Typically, the intensity of the signal is proportional to the quantity of cDNA, and thus mRNA, expressed in the sample cells. A large number of such techniques are available and usefiil. Preferred methods for determining gene expression can be found in 6271002;
6218122; 6218114; and 6004755.
Aiialysis of the expression levels is conducted by comparing such signal intensities.
This is best done by generating a ratio matrix of the expression intensities of genes in a test sample versus those in a control sample. For instance, the gene expression intensities from a diseased tissue can be compared with the expression intensities generated from benign or norinal tissue of the same type. A ratio of these expression intensities indicates the fold-change in gene expression between the test and control sainples.

The selection can be based on statistical tests that produce ranked lists related to the evidence of significance for each gene's differential expression between factors related to the tumor's original site of origin. Examples of such tests include ANOVA
and Kruskal-Wallis. The ranlcings can be used as weightings in a model designed to interpret the summation of such weights, up to a cutoff, as the preponderance of evidence in favor of one class over another. Previous evidence as described in the literature may also be used to adjust the weightings.
A preferred embodiment is to normalize each measurement by identifying a stable control set and scaling this set to zero variance across all samples. This control set is defined as any single endogenous transcript or set of endogenous transcripts affected by systematic error in the assay, and not known to change independently of this error. All Markers are adjusted by the sample specific factor that generates zero variance for any descriptive statistic of the control set, such as mean or median, or for a direct measurement. Alternatively, if the premise of variation of controls related only to systematic error is not true, yet the resulting classification error is less when normalization is performed, the control set will still be used as stated. Non-endogenous spike controls could also be helpful, but are not preferred.
Gene expression profiles can be displayed in a number of ways. The most common is to arrange raw fluorescence intensities or ratio matrix into a graphical dendogram where columns indicate test samples and rows indicate genes. The data are arranged so genes that have similar expression profiles are proximal to each other. The expression ratio for each gene is visualized as a color. For example, a ratio less than one (down-regulation) appears in the blue portion of the spectrum while a ratio greater than one (up-regulation) appears in the red portion of the spectrum. Cominercially available coinputer software programs are available to display such data including "Genespring"
(Silicon Genetics, Inc.) and "Discovery" and "Infer" (Partek, Inc.) In the case of measuring protein levels to deterinine gene expression, any method lcnown in the art is suitable provided it results in adequate specificity and sensitivity.
For example, protein levels can be measured by binding to an antibody or antibody fragment specific for the protein and measuring the amount of antibody-bound protein.
Antibodies can be labeled by radioactive, fluorescent or other detectable reagents to facilitate detection. Methods of detection include, without limitation, enzyme-linked immunosorbent assay (ELISA) and immunoblot techniques.
Modulated genes used in the methods of the invention are described in the Examples. The genes that are differentially expressed are either up regulated or down regulated in patients with carcinoma of a particular origin relative to those with carcinomas from different origins. Up regulation and down regulation are relative tenns meaning that a detectable difference (beyond the contribution of noise in the system used to measure it) is found in the ainount of expression of the genes relative to some baseline. In this case, the baseline is detennined based on the algorithm. The genes of interest in the diseased cells are then either up regulated or down regulated relative to the baseline level using the same measurement method. Diseased, in this context, refers to an alteration of the state of a body that interrupts or disturbs, or has the potential to disturb, proper perfonnance of bodily functions as occurs with the uncontrolled proliferation of cells. Someone is diagnosed with a disease when some aspect of that person's genotype or phenotype is consistent with the presence of the disease. However, the act of conducting a diagnosis or prognosis may include the determination of disease/status issues such as determining the likelihood of relapse, type of therapy and therapy monitoring. In therapy monitoring, clinical judgments are made regarding the effect of a given course of therapy by coinparing the expression of genes over time to detennine whether the gene expression profiles have changed or are changing to patterns more consistent with normal tissue.
Genes can be grouped so that information obtained about the set of genes in the group provides a sound basis for malcing a clinically relevant judginent such as a diagnosis, prognosis, or treatment choice. These sets of genes make up the portfolios of the invention. As with most diagnostic Markers, it is often desirable to use the fewest nuinber of Markers sufficient to make a correct medical judgment. This prevents a delay in treatment pending fiirther analysis as well unproductive use of time and resources.
One method of establishing gene expression portfolios is througll the use of optinlization algoritluns such as the mean variance algoritlun widely used in establishing stock portfolios. This inethod is described in detail in 20030194734.

Essentially, the method calls for the establishment of a set of inputs (stocks in financial applications, expression as measured by intensity here) that will optimize the return (e.g., signal that is generated) one receives for using it while minimizing the variability of the return. Many commercial software programs are available to conduct such operations. "Wagner Associates Mean-Variance Optimization Application,"
referred to as "Wagner Software" throughout this specification, is preferred. This software uses functions from the "Wagner Associates Mean-Variance Optimization Library" to determine an efficient frontier and optimal portfolios in the Marlcowitz sense is preferred. Markowitz (1952). Use of this type of software requires that inicroarray data be transformed so that it can be treated as an input in the way stock return and risk measurements are used when the software is used for its intended financial analysis purposes.

The process of selecting a portfolio can also include the application of heuristic rules. Preferably, such rules are fonnulated based on biology and an understanding of the technology used to produce clinical results. More preferably, they are applied to output from the optimization method. For example, the mean variance method of portfolio selection can be applied to microarray data for a number of genes differentially expressed in subjects with cancer. Output from the metliod would be an optimized set of genes that could include some genes that are expressed in peripheral blood as well as in diseased tissue. If samples used in the testing method are obtained from peripheral blood and certain genes differentially expressed in instances of cancer could also be differentially expressed in peripheral blood, then a heuristic rule can be applied in which a portfolio is selected from the efficient frontier excluding those that are differentially expressed in peripheral blood. Of course, the rule can be applied prior to the formation of the efficient frontier by, for example, applying the rule during data pre-selection.

Other heuristic rules can be applied that are not necessarily related to the biology in question. For example, one can apply a nile that only a prescribed percentage of the portfolio can be represented by a particular gene or group of genes.
Connnercially available software such as the Wagner Software readily accoiTunodates these types of heuristics. This can be usefiil, for example, when factors other than accuracy and precision (e.g., anticipated licensing fees) have an impact on the desirability of including one or more genes.
The gene expression profiles of this invention can also be used in conjunction with other non-genetic diagnostic methods useful in cancer diagnosis, prognosis, or treatment monitoring. For example, in some circumstances it is beneficial to coinbine the diagnostic power of the gene expression based inethods described above with data from conventional Marlcers such as serum protein Markers (e.g., Cancer Antigen 27.29 ("CA 27.29")). A range of such Markers exists includ'ulg such analytes as CA
27.29.
In one such method, blood is periodically taken from a treated patient and then subjected to an enzyme immunoassay for one of the serum Markers described above.
When the concentration of the Marker suggests the return of tumors or failure of therapy, a sample source amenable to gene expression analysis is taken. Where a suspicious mass exists, a fine needle aspirate (FNA) is talcen and gene expression profiles of cells taken from the mass are then analyzed as described above.
Alternatively, tissue sainples may be taken from areas adjacent to the tissue from which a tumor was previously removed. This approach can be particularly useful when other testing produces ambiguous results.
Kits made according to the invention include formatted assays for determining the gene expression profiles. These can include all or some of the materials needed to conduct the assays such as reagents and instructions and a medium through which Biomarkers are assayed.
Articles of this iiivention include representations of the gene expression profiles useful for treating, diagnosing, prognosticating, and otherwise assessing diseases.
These profile representations are reduced to a medium that can be automatically read by a machine such as computer readable media (magnetic, optical, and the like). The articles can also include instructions for assessing the gene expression profiles in such media. For exainple, the articles may comprise a CD ROM having coinputer instructions for comparing gene expression profiles of the portfolios of genes described above. The articles may also have gene expression profiles digitally recorded therein so that they may be compared witli gene expression data from patient samples.
Alternatively, the profiles can be recorded in different representational format. A

graphical recordation is one such format. Clustering algorithms such as those incorporated in "DISCOVERY" and "INFER" software from Partek, Inc. mentioned above can best assist in the visualization of such data.
Different types of articles of manufacture according to the invention are media or 5 formatted assays used to reveal gene expression profiles. These can comprise, for exainple, microarrays in which sequence coinplements or probes are affixed to a matrix to which the sequences indicative of the genes of interest combine creating a readable determinant of their presence. Alternatively, articles according to the invention can be fashioned into reagent kits for conducting hybridization, ainplification, and signal 10 generation indicative of the level of expression of the genes of interest for detecting cancer.
The following exainples are provided to illustrate but not limit the claimed invention. All references cited herein are hereby incorporated herein by reference.
Example 1 15 Materials and Methods Paracreatic cancer Markers gene discovery.
RNA was isolated from pancreatic tumor, nonnal pancreatic, lung, colon, breast and ovarian tissues using Trizol. The RNA was then used to generate amplified, labeled RNA (Lipshutz et al. (1999)) which was then hybridized onto Affymetrix U133A arrays. The data were then analyzed in two ways.
In the first method, this dataset was filtered to retain only those genes with at least two present calls across the entire dataset. This filtering left 14,547 genes.
2,736 genes were determined to be overexpressed in pancreatic cancer versus normal pancreas with a p value of less than 0.05. Forty five genes of the 2,736 were also overexpressed by at least two-fold coinpared to the inaximuin intensity found from lung and colon tissues.
Finally, six probe sets were found which were overexpressed by at least two-fold coinpared to the maxiinum intensity found from lung, colon, breast, and ovarian tissues.
In the second method, this dataset was filtered to retain only those genes with no more than two present calls in breast, colon, lung, and ovarian tissues. This filtering left 4,654 genes. 160 genes of the 4,654 genes were found to have at least two present calls in the pancreatic tissues (normal and cancer). Finally, eight probe sets were selected which showed the greatest differential expression between pancreatic cancer and normal tissues.
Tissue saniples.
A total of 260 FFPE metastasis and primary tissues were acquired from a variety of commercial vendors. The sainples tested included: 30 breast metastasis, 30 colorectal metastasis, 561ung metastasis, 49 ovarian metastasis 43 pancreas metastasis, prostate primary and 2 prostate metastases and 32 other origins (6 stomach, 6 kidney, 3 larynx, 2 liver, 1 esophagus, 1 pharynx, 1 bile duct, 1 pleura, 3 bladder, 5 melanoma, 3 lyinphoma).
RNA Extf actiofa.
RNA isolation from paraffin tissue sections was based on the methods and reagents described in the High Pure RNA Paraffin Kit manual (Roche) with the following modifications. Paraffin embedded tissue samples were sectioned according to size of the embedded metastasis (2-5mm = 9 X 10gm, 6-8mm = 6 X 10 m, 8-_l0inm = 3 X
10 m), and placed in RNase/DNase 1.5m1 Eppendorf tubes. Sections were deparaffinized by incubation in lml of xylene for 2-5inin at room temperature following a 10-20 second vortex. Tubes were then centrifuged and supematant was removed and the deparaffinization step was repeated. After supernatant was removed, lml of ethanol was added and sample was vortexed for 1 minute, centrifuged and supernatant removed. This process was repeated one additional time. Residual ethanol was removed and the pellet was dried in a 55 C oven for 5-10 minutes and resuspended in 100 1 of tissue lysis buffer, 16 1 10% SDS and 80 1 Proteinase K. Samples were vortexed and incubated in a therinomixer set at 400 rpm for 2 hours at 55 C.

binding buffer and 325 1 ethanol was added to each sample that was then mixed, ceiitrifuged and the supernatant was added onto the filter coluinn. Filter colui-nn along with collection tube were centrifiiged for 1 minute at 8000rpin and flow through was discarded. A series of sequential washes were performed (500 1 Wash Buffer 14 500 l Wash Buffer 114 300 1 Wash Buffer II) in which each solution was added to the colunin, centrifliged and flow through discarded. Column was then centrifiiged at maximum speed for 2 minutes, placed in a fresh 1.5m1 tube and 90 1 of elution buffer was added. RNA was obtained after a 1 minute incubation at room temperature followed by a 1 minute centrifugation at 8000 rpm. Sainple was DNase treated with the addition of 10 1 DNase incubation buffer, 2 1 of DNase I and incubated for minutes at 37 C. DNase was inactivated following the addition of 20g1 of tissue lysis buffer, l8 l 10% SDS and 40 l Proteinase K. Again, 325 1 binding buffer and ethanol was added to each sainple that was then mixed, centrifu.ged and supernatant was added onto the filter column. Sequential washes and elution of RNA
proceeded as stated above with the exception of 50 l of elution buffer being used to elute the RNA.
To eliminate glass fiber contamination carried over from the column RNA was centrifuged for 2 minutes at full speed and supernatant was removed into a fresh 1.5m1 Eppendorf tube. Samples were quantified by OD 260/280 readings obtained by a spectrophotometer and samples were diluted to 50ng/ l. The isolated RNA was stored in Rnase-free water at -80 C until use.
TaqMan Priiner= and Probe Design.

Appropriate mRNA reference sequence accession nuinbers in conjunction witli Oligo 6.0 were used to develop TaqMan'~" CUP assays (lung Markers: human surfactant, pulmonary-associated protein B (HUMPSPBA), thyroid transcription factor 1(TTFl), desmoglein 3 (DSG3), colorectal Marlcer: cadherin 17 (CDH17), breast Markers: mammaglobin (MG), prostate-derived ets transcription factor (PDEF), ovarian Marker: wilms tumor 1(WT1), pancreas Markers: prostate stem cell antigen (PSCA), coagulation factor V (F5), prostate Marker kallikrein 3 (KLK3)) and housekeeping assays beta actin ((3-Actin), hydroxymethylbilane synthase (PBGD).
Primers and hydrolysis probes for each assay are listed in Table 2. Genomic DNA
amplification was excluded by designing assays around exon-intron splicing sites.
Hydrolysis probes were labeled at the 5' nucleotide with FAM as the reporter dye and at 3' nucleotide with BHQ1-TT as the internal quenching dye.
Quantitative Real-Tinae Polynn.ef ase Chain Reaction.
Quantitation of gene-specific RNA was carried out in a 384 well plate on the ABI
Prism 7900HT sequence detection system (Applied Biosystems). For each therino-cycler run calibrators and standard curves were amplified. Calibrators for each Marlcer consisted of target gene in vitro transcripts that were diluted in carrier RNA
from rat kidney at 1X105 copies. Standard curves for housekeeping Markers consisted of target gene in vitro transcripts that were serially diluted in carrier RNA from rat kidney at 1X10l, 1X105 and 1X103 copies. No target controls were also included in each assay run to ensure a lack of environmental contamination. All samples and controls were run in duplicate. qRTPCR was performed with general laboratory use reagents in a 1 reaction contaiiung: RT-PCR Buffer (50nM Bicine/KOH pH 8.2, 115nM KAc, 8% glycerol, 2.5mM MgC12, 3.5mM MnSO4, 0.5mM each of dCTP, dATP, dGTP and dTTP), Additives (2mM Tris-Cl pH 8, 0.21nM Albumin Bovine, 150mM Trehalose, 0.002% Tween 20), Enzyme Mix (2U Tth (Roche), 0.4mg/ l Ab TP6-25), Primer and 10 Probe Mix (0.2gM Probe, 0.5 M Primers). The following cycling paraineters were followed: 1 cycle at 95 C for 1 minute; 1 cycle at 55 C for 2 minutes; Rainp 5%; 1 cycle at 70 C for 2 minutes; and 40 cycles of 95 C for 15 seconds, 58 C for 30 seconds. After the PCR reaction was completed, baseline and threshold values were set in the ABI 7900HT Prism software and calculated Ct values were exported to Microsoft Excel.

One-Step vs. Two-Step Reaetion.
First strand synthesis was carried out using either 100ng of random hexamers or gene specific primers per reaction. In the first step, 11.5 1 of Mix-1 (primers and lug of total RNA) was heated to 65 C for 5 minutes and then chilled on ice. 8.5 1 of Mix-2 (lx Buffer, 0.01mM DTT, 0.5mM each dNTP's, 0.25U/ l RNasin , l0U/ l Superscript III) was added to Mix-1 and incubated at 50 C for 60 minutes followed by 95 C
for 5 minutes. The cDNA was stored at -20 C until ready for use. qRTPCR for the second step of the two-step reaction was performed as stated above with the following cycling paraineters: 1 cycle at 95 C for 1 minute; 40 cycles of 95 C for 15 seconds, 58 C for 30 seconds. qRTPCR for the one-step reaction was performed exactly as stated in the preceding paragraph. Both the one-step and two-step reactions were perfonned on 100ng of teinplate (RNA/cDNA). After the PCR reaction was completed, baseline and threshold values were set in the ABI 7900HT Prism software and calculated Ct values were exported to Microsoft Excel.
Generation of a heatinap.

For each sample, a ACt was calculated by taking the mean Ct of each CUP Marker and subtracting the mean Ct of an average of the housekeeping Markers (ACt =
Ct(CUP
Marker) - Ct(Ave. HK Marker)). The minimalOCt for each tissue of origin Marker set (lung, breast, prostate, colon, ovarian and pancreas) was determined for each sample.
The tissue of origin with the overall minimal ACt was scored one and all other tissue of origins scored zero. Data were sorted according to pathological diagnosis.
Partek Pro was populated with the modified feasibility data and an intensity plot was generated.
Results.
Discovety of novel pancreatic tumoi of os igin and cancer status Marlcers.
First, five pancreas Marker candidates were analyzed: prostate stem cell antigen (PSCA), serine proteinase inhibitor, clade A member 1(SERPINAI), cytokeratin 7 (KRT7), matrix metalloprotease 11 (MMP11), and mucin4 (MUC4) (Varadhachary et al (2004); Fukushima et al. (2004); Argani et al. (2001); Jones et al. (2004);
Prasad et al. (2005); and Moniaux et al. (2004)) using DNA microarrays and a panel of 13 pancreatic ductal adenocarcinoinas, five nonnal pancreas tissues, and 98 sainples from breast, colorectal, lung, and ovarian tumors. Only PSCA demonstrated moderate sensitivity (six out of thirteen or 46% of pancreatic tumors were detected) at a high specificity (91 out of 98 or 93% were correctly identified as not being of pancreatic origin) (Figure 1A). In contrast, KRT7, SERPINAI, MMP11, and MUC4 demonstrated sensitivities of 38%, 31%, 85%, and 31%, respectively, at specificities of 66%, 91%, 82%, and 81%, respectively. These data were in good agreement with qRTPCR performed on 27 metastases of pancreatic origin and 39 metastases of non-pancreatic origin for all Markers except for MMP 11 which showed poorer sensitivity and specificity with qRTPCR and the metastases. In conclusion, the inicroarray data on snap frozen, primary tissue serves as a good indicator of the ability of the Marlcer to identify a FFPE metastasis as being pancreatic in origin using qRTPCR but that additional Markers may be usefiil for optimal perforinance.
Because pancreatic ductal adenocarcinoma develops froin ductal epithelial cells that comprise only a small percentage of all pancreatic cells (with acinar cells and islet cells comprising the majority) and because pancreatic adenocarcinoma tissues contain a significant amount of adjacent norinal tissue (Prasad et al. (2005); and Ishikawa et al.

(2005)), it has been difficult to identify pancreatic cancer Markers (i.e., upregulated in cancer) which would also differentiate this organ from the organs. For use in a CUP
panel such differentiation is necessary. The first query method (see Materials and Methods) returned six probe sets: coagulation factor V (F5), a hypothetical protein 5 FLJ22041 similar to FK506 binding proteins (FKBP10), R 6 integrin (ITGB6), transglutaininase 2 (TGM2), heterogeneous nuclear ribonucleoprotein A0 (HNRPO), and BAX delta (BAX). The second query method (see Materials and Methods) returned eight probe sets: F5, TGM2, paired-like homeodomain transcription factor 1 (PITX1), trio isoform inRNA (TRIO), mRNA for p73H (p73), an unknown protein for 10 MGC:10264 (SCD), and two probe sets for claudinl8. F5 and TGM2 were present in both query results and, of the two, F5 looked the most promising (Figure 1B).
Optinzization of sample pf=ep atad qRTPCR using FFPE tissues.
Next the RNA isolation and qRTPCR methods were optimized using fixed tissues before examining Marlcer panel performance. First the effect of reducing the 15 proteinase K incubation time from sixteen hours to 3 hours was analyzed.
There was no effect on yield. However, some sainples showed longer fragments of RNA when the shorter proteinase K step was used (Figure 2). For exainple, when RNA was isolated from a one year old block (C22), there was no observed difference in the electropherograms. However, when RNA was isolated from a five year old block 20 (C23), a larger fraction of higher molecular weight RNAs was observed, as assessed by the huinp in the shoulder, when the shorter proteinase K digest was used. This trend generally held when other samples were processed, regardless of the organ of origin for the FFPE metastasis. In conclusion, shorteiiing the proteinase K digestion time does not sacrifice RNA yields and may aid in isolating longer, less degraded RNA.
Next, three different methods of reverse transcription were compared: reverse transcription with random hexamers followed by qPCR (two step), reverse transcription with a gene-specific primer followed by qPCR (two step), and a one-step qRTPCR
using gene-specific primers. RNA was isolated from eleven metastases and coinpared Ct values across the three methods for (3-actin, human surfactant protein B
(HUMSPB), and thyroid transcription factor (TTF) (Figure 3). There were statistically significant differences (p < 0.001) for all coinparisons. For all three genes, the reverse transcription with random hexamers followed by qPCR (two step reaction) gave the highest Ct values while the reverse transcription with a gene-specific primer followed by qPCR (two step reaction) gave slightly (but statistically significant) lower Ct values than the corresponding 1 step reaction. However, the 2 step RTPCR with gene-specific primers had a longer reverse transcription step. When HUMSPB and TTF Ct values were norinalized to the corresponding (3-actin value for each sample, there were no differences in the normalized Ct values across the three methods. In conclusion, optimization of the RTPCR reaction conditions can generate lower Ct values, which may help in analyzing older paraffin blocks (Cronin et al (2004)), and a one step RTPCR reaction with gene-specific primers can generate Ct values coinparable to those generated in the corresponding two step reaction.

Diagnostic perfoi=mance of a CUP qRTPCR assay.
Next 12 qRTPCR reactions (10 Markers and two housekeeping genes) were performed on 239 FFPE metastases. The Markers used for the assay are shown in Table 2. The lung Markers were huinan surfactant pulmonary-associated protein B
(HUMPSPB), thyroid transcription factor 1(TTF1), and desmoglein 3 (DSG3). The colorectal Marker was cadherin 17 (CDH17). The breast Markers were mammaglobin (MG) and prostate-derived Ets transcription factor (PDEF). The ovarian Marker was Wilms tumor 1(WT1). The pancreas Markers were prostate stem cell antigen (PSCA) and coagulation factor V (F5), and the prostate Marker was kallikrein 3 (KLK3). For gene descriptions, see Table 15.
Table 2. Primer and probe sequences, accession numbers, and ainplicon len hs.
SEQ SEQ
Target ID Sequence (5'-3') Description ID
NO NO
SP-B 59 caca cccc accttt at a Forward primer 11 ggtcccagagcccgtetca Reverse primer 12 a ct cca ct caaa aaaa cc Probe* 13 cacagccccgacctttgatgagaactcagctgtccagctgcaaaggaaaagc Ainplicon 14 caa t a ac ctct acc TTF1 60 ccaaccca accc c c Forward primer 15 c cccat cc ctcat tca Reverse primer 16 ccc ccatctccc cttcat Probe* 17 ccaacccagacccgcgcttccccgccatctcccgcttcatgggcccggcgagc Anplicon 18 cat aacat a c cat c DSG3 61 ca a aa a aa ataactcaa Forward primer 19 actcca a attc a a 1 Reverse primer 20 att ccaa attacttca attacca Probe* 21 gcagagaaggagaagataactcaaaaagaaacccaattgccaagattacttc Amplicon 22 a attaccaa caaccca aaaatcacctacc aatctct a t CDH17 62 tccctc cagt aa ctta Forward primer 23 tcctcaaactct cct a Reverse primer 24 ccaaaatcaatggtactcatgcccgactg Probe* 25 tccctcggcagtggaagcttacaaaacgactgggaagtttccaaaatcaatggt Amplicon 26 actcat ccc act tctacca cacaca a ttt a a MG 63 a ct at cctcat c Forward primer 27 cacttgt att att ctta Reverse primer 28 ccctctcccagcact ctacgca Probe* 28 agttgctgatggtcctcatgctggcggccctctcccagcactgctacgcaggctct Amplicon 30 ct ccccttatt a aat t atttccaa acaatcaatccacaa t PDEF 64 cgcccacct acatctgga Forward primer 31 cactg cga caca agtga Reverse primer 32 ca cggcct gat aaagagc Probe* 33 cgcccacctggacatctggaagtcagcggcctggatgaaagagcggacttca Amplicon 34 cct c attcactact t cctc acca t WT1 65 c a cccaataca aatacac Forward riiner 35 cg gctactccag caca Reverse primer 36 tca aggcattca atgtgc acg Probe* 37 gcggagcccaatacagaatacacacgcacggtgtcttcagaggcattcagga Ainplicon 38 ttcacttcct atacccc PSCA 66 ct at ca ctt c Forward primer 39 tt ctcacct cttt ca Reverse primer 40 ca cca cact ccct ct Probe* 41 ctgttgatggcaggcttggccctgcagccaggcactgccctgctgtgctactcct Amplicon 42 caaa ccca t a caa F5 67 tgaa aaatatcctgg attattca Forward primer 43 tat g atcttct aatatcatca Reverse primer 44 acaaa aaaca atattaa actc Probe* 45 tgaagaaatatcctgggattattcagaatttgtacaaagggaaacagatattgaa Amplicon 46 actct at atattcca aa ataccacata KLK3 68 ccccca cctcaca Forward primer 47 a at aaacaa ct cc a Reverse primer 48 ca aacaaaa c atcttct Probe* 49 cccccagtgggtcctcacagctgcccactgcatcaggaacaaaagcgtgatct Ainplicon 50 t ct tc caca ctt tttcatcct B actin 69 ccct a gcactcttcca Forward primer 51 c at ccac cacacttca Reverse rimer 52 cttccttcct cat a cct Probe* 53 gccctgaggcactcttccagccttccttcctgggcatggagtcctgtggcatccac Amplicon 54 aaactaccttcaactccatcat aa t t ac t acatcc PBGD 70 ccacacacagcctactttccaa Forward primer 55 tacccac c aatcactctca Reverse primer 56 aac caat c ct caac c aa Probe* 57 ccacacacagcctactttccaagcggagccatgtctggtaacggcaatgcggc Amplicon 58 t caac c aa aaaaca cccaaa at a a t attc c t ta *Probes are 5'FAM-3'BHQI-TT
Analysis of the normalized Ct values in a heat map revealed the high specificity of the breast and prostate Markers, moderate specificity of the colon, lung, and ovarian, and somewhat lower specificity of the pancreas Markers. Combining the normalized qRTPCR data with coinputational refinement improves the performance of the Marker panel. Results were obtained from the combined normalized qRTPCR data with the algorithin and the accuracy of the qRTPCR assay was determined.
Discussion.
In this example, microarray-based expression profiling was used on primary tumors to identify candidate Markers for use with metastases. The fact that primary tumors can be used to discover tuinor of origin Markers for metastases is consistent with several recent findings. For example, Weigelt and colleagues have shown that gene expression profiles of primary breast tumors are maintained in distant metastases.
Weigelt et al. (2003). Italiano and coworkers found that EGFR status, as assessed by IHC, was similar in 80 primary colorectal tumors and the 80 related metastases.
Italiano et al. (2005). Only five of the 80 showed discordance in EGFR status.
Italiano et al. (2005). Backus and colleagues identified putative Markers for detecting breast cancer metastasis using a genome-wide gene expression analysis of breast and other tissues and demonstrated that mammaglobin and CK19 detected clinically actionable metastasis in breast sentinel lyinph nodes with 90% sensitivity and 94%
specificity.
Backus et al. (2005).
The microarray-based studies with priunary tissue confirmed the specificity and sensitivity of known Markers. As a result, with the exception of F5, all of the Markers used have high specificity for the tissues studied here. Argani et al (2001;
Backus et al.
(2005); Cunha et al. (2005); Borgono et al. (2004); McCarthy et al. (2003);
Hwang et al. (2004); Fleming et al. (2000); Nakanzura et al. (2002); and Klzoor et al.
(1997). A
recent study deterinined tliat, using IHC, PSCA is overexpressed in prostate cancer metastases. Lam et al. (2005). Dennis et al. (2002) also demonstrated that PSCA could be used as a tumor of origin Marlcer for pancreas and prostate. As shown herein, strong expression of PSCA is found in some prostate tissues at the RNA level but, because by including PSA in the assay, one can now segregate prostate and pancreatic cancers. A
novel finding of this study was the use of F5 as a complementary (to PSCA) Marker for pancreatic tissue of origin. In both the inicroarray data set with primary tissue and the qRTPCR data set with FFPE metastases, F5 was found to complement PSCA (Figure and Table 3) Table 3 feasibility data Breast Colon Lung Other Ovary Pancreas Prostate Total Total tested 30 30 56 32 49 43 20 260 #Correct 22 27 45 16 43 31 20 204 #Other / No 1 1 3 n/a 1 4 0 10 test #Incorrect 7 2 8 16 5 8 0 46 % Tested 96.67 96.67 94.64 100 97.96 90.70 100 96.15 % Correct of 75.86 93.10 84.91 0 89.58 79.49 100 81.60 tested Correct of 73.33 90.00 80.36 50.00 87.76 72.09 100 78.46 total (%) Previous investigators have generated CUP assays using IHC or microarrays. Su et al. (2001); Rainaswainy et al. (2001); and Bloom et al. (2004). More recently, SAGE
has been coupled to a small qRTPCR Marker panel. Dennis (2002); and Buckhaults et al. (2003). This study is the first to coinbine microarray-based expression profiling with a small panel of qRTPCR assays. Microarray studies with primary tissue identified some, but not all, of the same tissue of origin Markers as those identified previously by SAGE studies. Some studies have demonstrated that a modest agreement between SAGE- and DNA microarray-based profiling data exists and that the correlation improves for genes with higher expression levels. van Ruissen et al.
(2005); and Kim (2003). For example, Dennis and colleagues identified PSA, MG, PSCA, and HUMSPB while Buckhaults and coworlcers (Dennis et al. (2002)) identified PDEF. Executing the CUP assay using qRTPCR is preferred because it is a robust technology and may have perforinance advantages over IHC. Al-Mulla et al.
(2005);
and Haas et al. (2005). As shown herein, the qRTPCR protocol was improved tlirough the use of gene-specific primers in a one-step reaction. This is the first demonstration of the use of gene-specific primers in a one-step qRTPCR reaction with FFPE
tissue.
Otlier investigators have either done a two step qRTPCR (cDNA synthesis in one reaction followed by qPCR) or have used random hexamers or truncated gene-specific primers. Abrahamsen et al. (2003); Specht et al. (2001); Godfrey et al.
(2000); Cronin et al. (2004); and Mikhitarian et al. (2004).
Example 2 5 Pancreatic ductal adenocarcinoma develops from ductal epithelial cells that comprise only a small percentage of all pancreatic cells (with acinar and islet cells comprising the majority) in the normal pancreas. Furtherinore, pancreatic adenocarcinoina tissues contain a significant amount of adjacent normal tissue. Prasad et al. (2005); and Ishikawa et al. (2005). Because of this the candidate pancreas 10 Marlcers were enriched for genes elevated in pancreas adenocarcinoma relative to norinal pancreas cells. The first query method returned six probe sets:
coagulation factor V(F5); a hypothetical protein FLJ22041 similar to FK506 binding proteins (FKBP 10), beta 6 integrin (ITGB6), transglutaminase 2 (TGM2), heterogeneous nuclear ribonucleoprotein A0 (HNRPO), and BAX delta (BAX). The second query 15 method (see Materials and Methods section for details) returned eight probe sets: F5, TGM2, paired-like homeodomain transcription factor 1(PITX1), trio isoforin mRNA
(TRIO), mRNA for p73H (p73), an unknown protein for MGC: 10264 (SCD), and two probe sets for claudin 18.
A total of 23 tissue specific Marker candidates were selected for fiirther RT-PCR
20 validation on metastatic carcinoma FFPE tissues by qRT-PCR. Marker candidates were tested on 205 FFPE metastatic carcinomas, from lung, pancreas, colon, breast, ovary, prostate and prostate primary carcinomas. Table 4 provides the gene symbols of the tissue specific Markers selected for RT-PCR validation and also suinmarizes the results of testing performed with these Markers.

25 Table 4 ID method Marker selection filters Tissue D Q ~ Marker type NOs cro Lit Low exp in Marker Tissue cross adequate?
array corres met tissue redtmdanc reactivity Lung 1/59 X X X

Pancreas 66 X X

Colon 4/85 X X X

Prostate 9/86 X X X

Breast 63 X X X

Ovarian 82 X X X

Out of 23 tested Markers, thirteen were rejected based on their cross reactivity, low expression level in the corresponding metastatic tissues, or redundancy. Ten Markers were selected for the final version of assay. The lung Markers were human surfactant pulmonary-associated protein B (HUMPSPB), thyroid transcription factor 1(TTF
1), and desmoglein 3 (DSG3). The pancreas Markers were prostate stem cell antigen (PSCA) and coagulation factor V (F5), and the prostate Marlcer was kallikrein (KLK3). The colorectal Marker was cadherin 17 (CDH 17). Breast Markers were mammaglobin (MG) and prostate-derived Ets transcription factor (PDEF). The ovarian Marker was Wilms tumor 1 (WT 1).

Optinzization of sanzple preparation and qRT-PCR using FFPE tissues. Next the RNA isolation and qRTPCR inethods were optimized using fixed tissues before examining the performance of the Marker panel. First the effect of reducing the proteinase K incubation time from sixteen hours to 3 hours was analyzed. There was no effect on yield. However, some sainples showed longer fragments of RNA when the shorter proteinase K step was used (Figure 4A, B). For example, when RNA
was isolated from a one-year-old block (C22), no difference was observed in the electropherograms. However, when RNA was isolated fiom a five-year-old block (C23), a larger fraction of higl7er molecular weight RNAs were observed, as assessed by the hump in the shoulder, when the shorter proteinase K digest was used.
This trend generally held when other samples were processed, regardless of the organ of origin for the FFPE metastasis. In conclusion, shortening the proteinase K digestion time does not sacrifice RNA yields and may aid in isolating longer, less degraded RNA.
Next three different methods of reverse transcription were compared: reverse transcription with random hexamers followed by qPCR (two step), reverse transcription with a gene-specific primer followed by qPCR (two step), and a one-step qRTPCR
using gene-specific primers. RNA was isolated from eleven metastases and coinpared Ct values across the three methods for (3-actin, HUMSPB (Figure 4C, D) and TTF. The results showed statistically significant differences (p < 0.001) for all comparisons. For botli genes, the reverse transcription with random hexamers followed by qPCR
(two step reaction) gave the highest Ct values while the reverse transcription with a gene-specific primer followed by qPCR (two-step reaction) gave slightly (but statistically significant) lower Ct values than the corresponding 1 step reaction. However, the two-step RTPCR with gene-specific primers had a longer reverse transcription step.
When HUMSPB Ct values were normalized to the corresponding (3-actin value for each sainple, there were no differences in the nonnalized Ct vah.tes across the three methods.
In conclusion, optimization of the RTPCR reaction conditions can generate lower Ct values, which aids in analyzing older paraffin blocks (Cronin et al. (2004)), and a one step RTPCR reaction with gene-specific primers can generate Ct values comparable to those generated in the corresponding two step reaction.
Diagi~.ostic peiformafzce of optimized qRTPCR assay. 12 qRTPCR reactions (10 Markers and 2 housekeeping genes) were performed on new set of 260 FFPE
metastases. Twenty-one samples gave high Ct values for the houselceeping genes so only 239 were used in a heat map analysis. Analysis of the normalized Ct values in a heat map revealed the high specificity of the breast and prostate Marlcers, moderate specificity of the colon, lung, and ovarian, and somewhat lower specificity of the pancreas Marlcers (Figure 5). Combining the normalized qRTPCR data with coinputational refinement improves performance of the Marlcer panel.
Using expression values, normalized to average of expression of two houselceeping genes, an algoritlun to predict metastasis tissue of origin was developed by combining the normalized qRTPCR data with the algorithm and determined the accuracy of the qRTPCR assay by performing a leave-one-out-cross-validation test (LOOCV). For the six tissue types included in the assay, it was separately estimated that both the number of false-positive calls, when a sample was wrongly predicted as another tumor type included in the assay (pancreas as colon, for exainple), and the number of times a sainple was not predicted as those included in the assay tissue types (otlier). Results of the LOOCV are presented on Table 5.
Table 5 Tissue of Origin Prediction Breast Colon Lung Ovary Pancreas Prostate Other Total Breast 22 0 2 1 1 0 0 Colon 1 27 3 2 4 0 4 Lung 1 2 45 2 3 0 5 Other 1 1 3 1 4 0 16 Ovary 5 0 0 43 0 0 1 Pancreas 0 0 3 0 31 0 6 Prostate 0 0 0 0 0 20 0 Total 30 30 56 49 43 20 32 260 # Correct 22 27 45 43 31 20 16 204 Accuracy 72.3 90.0 87.8 87.8 72.1 100.0 50.0 78.5 The tissue of origin was predicted correctly for 204 out of 260 tested samples with an overall accuracy of 78%. A significant proportion of the false positive calls were due to the Markers' cross-reactivity in histologically similar tissues. For example, three squamous cell metastatic carcinomas originated from pharynx, larynx and esophagus were wrongly predicted as lung due to DSG3 expression in these tissues.
Positive expression of CDH 17 in other than colon GI carcinomas, including stomach and pancreas, caused false classification of 4 out of 6 tested stomach and 3 out of 43 tested pancreatic cancer metastasis as colon.
In addition to a LOOCV test, the data was randomly split into 3 separate pairs of training and test sets. Each split contained approximately 50% of the sainples from each class. At 50/50 splits in three separate pairs of training and test sets, assay overall classification accuracies were 77%, 71% and 75%, confirming assay performance stability.

Last, anotlier independent set of 48 FFPE metastatic carcinomas that included metastatic carcinoma of known primary, CUP specimens with a tissue of origin diagnosis rendered by pathological evaluation including IHC, and CUP specimens that remained CUP after IHC testing were tested. The tissue of origin prediction accuracy was estimated separately for each category of sainples. Table 6 suinmarizes the assay results.
Table 6 Tested Correct Accuracy Known mets 15 11 73.3 Resolved CUP 22 17 77.3 Unresolved CUP 11 The tissue of origin prediction was, with only a few exceptions, consistent witli the lcnown primary or tissue of origin diagnosis assessed by clinical/pathological evaluation including IHC. Similar to the training set, the assay was not able to differentiate squamous cell carcinomas originating from different sources and falsely predicted them as lung.
The assay also made putative tissue of origin diagnoses for eight out of eleven samples which remained CUP after standard diagnostic tests. One of the CUP
cases was especially interesting. A male patient with a history of prostate cancer was diagnosed with metastatic carcinoma in lung and pleura. Serum PSA tests and IHC
with PSA antibodies on metastatic tissue were negative, so the pathologist's diagnosis was CUP with an inclination toward gastrointestinal tumors. The assay strongly (posterior probability 0.99) predicted the tissue of origin as colon.
Discussion. In this study, microarray-based expression profiling on primary tumors was used to identify candidate Marlcers for use with metastases. The fact that primary turnors can be used to discover tumor of origin Markers for metastases is consistent with several recent findings. For example, Weigelt and colleagues have shown that gene expression profiles of primary breast tumors are maintained in distant metastases.
Weigelt et al. (2003). Baclcus and colleagties identified putative Marlcers for detecting breast cancer metastasis using a genome-wide gene expression analysis of breast and other tissues and demonstrated that nlannnaglobin and CK19 detected clinically actionable metastasis in breast sentinel lymph nodes with 90% sensitivity and 94%
specificity. Backus et al. (2005).
During the development of the assay, selection was focused on six cancer types, including lung, pancreas and colon which are among the most prevalent in CUP
(Ghosh 5 et al. (2005); and Pavlidis et al. (2005)) and breast, ovarian and prostate for which treatment could be potentially most beneficial for patients. Ghosh et al.
(2005).
However, additional tissue types and Markers can be added to the panel as long as the overall accuracy of the assay is not compromised and, if applicable, the logistics of the RTPCR reactions are not encuinbered.
10 The microarray-based studies with primary tissue confinned the specificity and sensitivity of known Markers. As a result, the majority of tissue specific Markers have high specificity for the tissues studied here. A recent study found that, using IHC, PSCA is overexpressed in prostate cancer metastases. Lam et al. (2005). Dennis et al.
(2002) also demonstrated that PSCA could be used as a tumor of origin Marker for 15 pancreas and prostate. Strong expression of PSCA in some prostate tissues at the RNA
level was present but, because due to inclusioii of PSA in the assay, prostate and pancreatic cancers can now be segregated. A novel fmding of this study was the use of F5 as a compleinentary (to PSCA) Marker for pancreatic tissue of origin. In both the microarray data set with primary tissue and the qRTPCR data set with FFPE
20 metastases, F5 was found to complement PSCA.
Previous investigators have generated CUP assays using IHC (Brown et al.
(1997);
DeYoung et al. (2000); and Dennis et al. (2005a)) or microarrays. Su et al.
(2001);
Ramaswamy et al. (2001); and Bloom et al. (2004). More recently, SAGE has been coupled to a small qRTPCR Marker panel. Dennis et al. (2002); and Buckhaults et al.
25 (2003). This study is the first to combine microarray-based expression profiling with a small panel of qRTPCR assays. The microarray studies with primary tissue identified some, but not all, of the same tissue of origin Markers as those identified previously by SAGE studies. This finding is not surprising given studies that have demonstrated that a modest agreement between SAGE- and DNA microarray-based profiling data exists 30 and that the correlation improves for genes with higher expression levels.
van Ruissen et al. (2005); and ICm et al. (2003). For exainple, Dennis and colleagues identified PSA, MG, PSCA, and HUMSPB while Buckhaults and coworkers (Buckhaults et al.
(2003)) identified PDEF. Execution of the CUP assay is preferably by qRTPCR
because it is a robust technology and may have performance advantages over IHC.
Al-Mulla et al. (2005); and Haas et al. (2005). Further, as shown herein, the qRTPCR
protocol has been improved through the use of gene-specific primers in a one-step reaction. This is the first demonstration of the use of gene-specific primers in a one-step qRTPCR reaction with FFPE tissue. Otlier investigators have either done a two-step qRTPCR (cDNA synthesis in one reaction followed by qPCR) or have used random hexamers or tiltncated gene-specific primers. Abrahamsen et al. (2003);
Specht et al. (2001); Godfrey et al. (2000); Cronin et al. (2004); and Mikhitarian et al.
(2004).
In suminary, the 78% overall accuracy of the assay for six tissue types compares favorably to other studies. Brown et al. (1997); DeYoung et al. (2000); Dennis et al.
(2005a); Su et al. (2001); Ramaswamy et al. (2001); and Bloom et al. (2004).
Example 3 In this study classifier using gene marker portfolios were built by choosing from MVO and using this classifier to predict tissue origin and cancer status for five major cancer types including breast, colon, lung, ovarian and prostate. Three hundred and seventy eight primary cancer, 23 benign proliferative epithelial lesions and 103 normal snap-frozen human tissue specimens were analyzed by using Affymetrix human U133A GeneChip. Leukocyte samples were also analyzed in order to subtract gene expression potentially masked by co-expression in leukocyte background cells.
A
novel MVO-based bioinformatics method was developed to select gene marker portfolios for tissue of origin and cancer status. The data demonstrated that a panel of 26 genes could be used as a classifier to accurately predict the tissue of origin and cancer status among the 5 cancer types. Thus a inulti-cancer classification method is obtainable by determining gene expression profiles of a reasonably sinall nuinber of gene marlcers.
Table 7 shows the Markers identified for the tissue origins indicated. For gene descriptions see Table 15.

Table 7 Tissue SEQ ID NO: Name Lung 59 SP-B

Pancreas 66 PSCA

Colon 85 HPTl Prostate 86 PSA
80 hKLK2 Breast 63 MGB 1 Ovarian 82 HE4 The sample set included a total of 299 metastatic colon, breast, pancreas, ovary, prostate, lung and other carcinomas and primary prostate cancer samples. QC
based on histological evaluation, RNA yield and expression of control gene beta-actin was implemented. Other sainples category included metastasis originated from stomach (5), kidney (6), cholangio/gallbladder (4), liver (2), head and neck (4), ileum (1) carcinomas and one inesothelioma. Table 8 summarizes the results.
Table 8 Tissue type Collected Histology QC RNA isolation QC ACTB Cut-off QC
Lung 41 37 36 25 Pancreas 63 57 49 41 Colon 45 42 42 31 Breast 40 35 35 34 Ovarian 37 36 35 33 Prostate 27 27 25 19 Other 46 34 29 23 Total 299 268 251 205 Testing the above samples resulted in the narrowing of the Marker set to those in Table 9 with the results seen in Table 10.

Table 9 Final Marker Table Lung surfactant-associated protein SP-B
thyroid transcription factor 1 TTF1 desmoglein 3 DSG3 Pancreas prostate stem cell antigen PSCA
coagulation factor 5 F5 Colon intestinal peptide-associated HPT1 transporter Prostate prostate-specific antigen PSA
Breast Mammaglobin MGB
Ets transcription factor PDEF
Ovary Wilms tumor 1 WT 1 Table 10 Cancer Samples Marker Correct Sensitivity % Wrong Specificity Lung 25/180 SP-B 13/25 52 0/180 100 Pancreas 41/164 PSCA 24/41 59 6/164 96 Colon 31/174 HPT1 22/31 71 2/174 99 Breast 33/172 MGB 23/33 70 3/172 98 Prostate 19/186 PSA 19/19 100 0/186 100 Ovarian 33/172 WTl 24/33 71 1/172 99 Total 205 The results showed that out of 205 paraffin einbedded metastatic tumors; 166 samples (81 %) had conclusive assay results, Table 11.
Table 11 Candidate Correct Incorrect No Accuracy (%) Lung SP-B + TFF+DSG3 19 0 6 76 Pancreas PSCA+F5 27 1 13 66 Colon HPT1 24 2 5 78 Prostate PSA 19 0 0 100 Breast MGB + PDEF 23 3 7 70 Ovarian WT1 23 2 8 70 Other 20 3 87 Overall 155 11 39 76 Of the false positive results, many false derived from histologically and embryologically similar tissues, Table 12.
Table 12 Sain le ID Diagnosis Predicted OV 26 Ovarian Breast Br 24 Breast Colon Br 37 Breast Colon CRC 25 Colon Ovarian Pn 59 Pancreas Colon Cont 27 Stomach pancreas Cont 34 Stomach Colon Cont 35 Stomach Colon Cont 43 Bile duct Pancreas Cont 44 Bile duct Pancreas Cong 25 Liver pancreas The following parameters were considered for the model development:
Separate markers on female and male sets and calculate CUP probability separately for male and female patients. The male set included: SP_B, TTF1, DSG3, PSCA, F5, PSA, HPT1; the female set included: SP B, TTF1, DSG3, PSCA, F5, HPT1, MGB, PDEF, WT1. Background expression was excluded from the assay results: Lung:
SP_B, TTF1, DSG3; Ovary: WT1; and Colon: HPT1.
The CUP model was adjusted to the CUP prevalence (%): lung 23, pancreas 16, colorectal 9, breast 3, ovarian 4, prostate 2, other 43. The prevalence for breast and ovarian adjusted to 0% for male patients, and prostate adjusted to 0% for female patients.
The following steps were taken:
Place markers on similar scale.
Reduce number of variables from 12 to 8 by selecting minimum value from each tissue specific set.
Leave out 1 sample. Build model from remaining sainples. Test left out sainple.
Repeat until 100% of sainples are tested.
Randomly leave out -50% of sainples (-50% per tissue). Build model from remaining samples. Test -50% of sainples. Repeat for 3 different random splits.
Classification accuracy was adjusted to cancer types prevalence To produce the results suminarized in Table 13 with the raw data shown in Table 14.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, the descriptions and 5 examples should not be construed as limiting the scope of the invention.
Table 13 Breast Colon Lung Other Ovary Pancreas Prostate Overall Adjusted Correct 23 29 22 19 24 35 19 171 NoTest 3 2 2 2 3 0 12 Incorrect 7 0 1 4 7 3 0 22 Prevalence 0.03 0.09 0.23 0.43 0.04 0.16 0.02 Tested/total% 91 94 92 100 94 93 100 94 95 Correct/total% 70 94 88 83 73 85 100 89 89 NoTest% 9 6 8 n/a 6 7 0 6 5 Correct 23 25 19 20 20 24 19 150 NoTest% 7 6 5 10 15 0 43 Incorrect 3 0 1 3 3 2 0 12 Prevalence 0.03 0/09 0.23 0.43 0.04 0.16 0.02 Tested/total% 79 81 80 100 70 63 100 79 83 Correct/total% 70 81 76 87 61 59 100 73 76 Correct/tested% 88 100 95 87 87 92 100 93 91 NoTest% 21 19 20 n/a 30 37 0 21 17 LO M N O O f- d' O 00 LO CO 1' M LO O LO r I- M N'Ih O 6) r r d r O O N O
~ CO M O O r(p O LO M 11- N rt CO ln r Op N d" CO O N (p t N O r O
~ d' '1' LC) O O f0 - O O O LO 1- (O f' r C+? LC) r- N O) CO 1- f- N LO 00 O
L(> O
M M CM lzt d* M M d- M M M CM M M M M M M M CM M M M M M M M M d' M d' 0) O O O O O O O LO O O N O O cJ' O O N O CO N O d' O LO O O O O
LI M O O O O O O O ti O O'ch f-- O C0 O O N O 00 f~ r r O I~ O O O O
O O O O O O O CO O O CO O O N 00 O O O r 6 4 CM C O 00 O4 O O O O
ch 't d d z J - d d N d " z t N CO CO CO CO CO CO
~t d- d d' U CO O O N O d' O O O 1~ N M d' L() 'cf O N r O CO CO O LO O O O I~ O CO O
6) C0 CO O O'It O O O d O d O O M O r CM O 1- N O 00 O O O d' O O O
m d O O O O M O OLo Lo N CO f- 00 O o0 I~ O O a0 O O O O N O M O
N N MIt M d M It ~t M N N M M N M',t N N d M MIt M d- It ~f' M d M 'It LL. CO 1~ O r O N f- O LO O 1- N d) I- O O O M O CO Cp Cp 00 O O Lf) N OLO
W M CD r CD - ti CD O) ct ~j' N f- I-- r(p O CO N N r LO CM 1~ O) CD OLf) 00 C) O Lf-) LO Cp M f~ d- LO N O 06 U-) N t~ N t0 O M -t 6 Cfl CO f~ Ln N O O O--I~
Q. M N N N M cM M M M C M N N M M M CO CO CO CO CO CO CO CO CO CO CO CO CO CO
CO CO CO CO CO CO CO
M M C+') M N N M M ct M M M M
O r Cp (p M O O O O O O O O O d- O O O cf' O O CO O O O O O O O O O
(D O Lf) f~ N I~ O O O O O O O O O O O O O O O O N O O O O O O O O O
2 d N N N d' d' ~t' ~t d' d d' ~h d' N d' ~i Ifi N d' Nt C M'ch d' d' d' d' d d' d' ct M O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O
Y O CD N O O CD CD O O CD CD O O O O O CD CD CD O CD O CD O O O CD O O CD CD
-J O O M O O O O O O O O O O O O O O O O O O O O O O O O O O O O
d d N'c1' d' d' d' d' d' 't 'F -t d' ~h 'ct' ch d' d' d' d' d' d' -t 'd' d' 't ch '' ~f' d' d' d) O O O CD O CD CD 6) d- I~ OO r Cp O CD CD O - O CD CO 0> - Ln CD CD CD CD
CD CD
r O O O O O O O M d' Ln C0 N O O O O O CO O O M CO L[> Cfl O O O O O O
N O O O O O O O O"I' c M r(p O O O O 00 O O 0) c O O O O O O O
= N d cY d' ~h d d d N M N N N M d' ch It d' M d' N r N Nt d- d- d' "I' d-'Ih M CO O O N CO O d- 00 d- d' O 00 M O O r 0p O CO O Cp O O O (O Lf) r Lo M CO O O LO f- O Cfl O M N O M N CO O 00 00 O N h l() r 00 O) O O i~ O
W LO O CO O O CO M O N 0) M N O I- CM O M d' M f~ M d- 00 0p M M O~h I~ I-CM M N d' d' N N 'Kt C+') N M M It M M M It M M M M M M N N N N',h M N M
M 00 I~ O O r O CO O O d O O O ln CO M O N d N N O O O O O O O O O O
Il- N O O O O N O O CO O O O OLO L(> O 00 00 CO t~ O O O O O O O O O O
Cn f~ r O O d- O M O O r O O O LO ~j' O r CO O(p O O O O O O O O O O
~ M M~t M;;Y M lzt It M It d- d- M N N It M N N N d- ~t It d d d- It 114' ty t CD CD O CD CD 6) N CO CO CD O O CD OU-) O O CM CD O O OLO CD f~ O O I~ d- O"t = O O O O O M N f~ M N O O O O Cfl 0 ~1' d' O O O O O O d' O O r(p O L() r) CD CD CD O O 0) (O M CO CO O O O O LO O 00 N CD CD CD CD f~ CD O O O "t M O
O
U d' d'd' d' d' N N M N N~h 'ct' d' d M ct M M d-t d"It M d M~t tt M N d' M
O Cp N~ N CO '[h d' 00 CO 'c~' 'cF LO M M r~ ti L(> Op f~ r 00 1- (0 ~i' M I- N N LO M M O Lf) f- I- f~ r r LO O O M N M O C0 00 N 00 ln 1~ N CO
Q CO M I.f) C0 r I~ 1.() L() I' CO 4 CD LO C1' ~I I' f~ LO 1-~ CO Ln d' fl~ d' 1~ M 00 CO 00 L[) N N N N CO N N M N N N N M N N N N N N N N N N N N N N N N N N
~ t CD LO O O "ZY M O f-- N O O N O I- ch LO ~t f~ M 00 M'~t (O LO U) I- f- d-N N
(D O O 6, It 00 M C O N f - - 10 1 - LO M I~ O O O N O f- O N dU") N d- d- d f~ CO CO
CO O f~ C'M O 00 'ch 00 O 00 fl- N I- ti (O O O I~ 0) 6) 00 CO O 00 O N r O O

M N N M M M N M N M N N CO N N N C+') M N N N N N M N M M C'M N M N
z f- O f~ N O M f~ LO 1.O CO 00 L() O 00 - CO Cfl N M 6) O O LO CD O I~ 00 f~
O CD lf) U M CO d: - Ln CO d' M r d' CO O 'ch N r I' 00 O Olzl- LO CO 00 'cY O N CO W O
d' M 0 CM Lf) 00 d' N CO CM ch d' N C) N r N CM N d' M N - d- r CO LO LO M Ln N
m N r N N N N N N N N N N N N N N N N N N N N N N N N N N N N N
.O

1H!HHH1H N N N N = =-+ = -C - - O O O O O O

Y Y Y Y Y Y Y Y Y Y Y 1 Y 1 Y Y Y Y ~1 Y Y 1 O ~1 Y
7 7 7 7 7 7 7 7 7 ~ 7 p [p > 7 ~7 0 (n (n (n (n (n C C C C C ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ L L L L L L L L
O ~ o ~ ~ ~ C C C C C C C C C C C C C _C _C õC ,C C ~ ~ ~
N~ N OD UO O OV OU ~ 7~ 7 7~~ 7 7 - - - ? O O O O O O O O ~
O ~ n ~ L .n~

~ O

a 4- 4- 4- E 4- E E E E E E 4- E E E E E E E4-- "- E4-- E 4- E E 4-a~
d" U' M
O
~ Q- Q 00 d- CO r CO M d' O CO CO r CO O N O O M MLo tf> I- "}' LO d' O M "t N
U? I' M E _ N CO CO M LO CO CO CO c1' CO CD CD r r O O r N N M d' I~ 00 r N 1' M CD O r' (+') 03 m r r r M M r r M M M r r r r r N M M M M M M M r r r r M M M(+'' E"~ U) O 00 r d' r O 6) (fl (p Lo o 0p O 00 O
O r O N f~ LO CO t-~ Cp O f~ N O N O
O N d- d O 00 O 00 00 CO O tt O O Ln O
d' M M M N M M M M m M'cf' C'7 M d' (V d' O O O O O O O M M O O O O LO O OV) O O O O O O O 00 r. . . . . O O O O'd' O O ~
. . . . . . . . . .
O O O O O O O O O O O O O LO O O O
d' d' d' d' d' It Nt CM M'd' d' d d' N d' d' N
O O O O O CO M 00 O r O O O O O O O
O O O O O 1*- N N O M O O O O O O O
O O O O O r OIt O m O O O O O O O
d' d' It 'h d' M M N N d' d' Itt "j- 'ch d' d' O) O O N N N lf) O LO M O CO ~ r LO M O
Cp CO M O CO r r I' CO d' O CO C4 00 I~ O) O
. . . . . . . . . . . . . . . . .
d- N 00 O CO N OI~t 1- M O CO O O I- N O
M M M M M M M N N M ~T M M M N MIt O O O O O O O O O N O O O O O O O
. . . . . . . . . . . . . .
O O O O O O O O O O O O O O O O O
d' It d' d' ch d' 'd' d' It M d' d d' d d' d' d' O O O O O O O M 0) O O O O O O O O
. . . . . . . . . . . . . . . . .
O O O O O O O - Ln O O O (D O O O O
d' It d' d' ch 't d' N N d' d' d' d' If' d' d ct O O O O Olt - O) O O O O O r O O LO
O O O O O N O Cfl f~ O O O O t~ O O LO
. . . . . . . . . . . . . .
O O O O O 00 I- m f~ O O O O 6) O O O
'ch d't d' ~t M cM N N d" "t d' d' rIt d' C+) t~ It C'') LO O OLO tl- O CO O N LO d- Nr- N
N N r I- O Cfl C D O O O 00 r 0') 1~ O M
. . . . . . . . . . . . . . . . .
CO O CO d' d- O 0) 6) O r O CO r- d NIt CO
C'7 N M M M M N N ch M'ct N N M M M N
O O O Cp O O Cfl O O CO r O O O00 O r O O O M O O 6) O O OJ O O O O O) O O
. . . . . . . . . . . .
O O O 6) O O W O O I~ CO O O O CO O LO
d- It It M~t d' M'ct If' N M d- d- ~Y M d- M
m <O O O (D O 00 O O tf) N O O O I- O M
f~ M O O O O N O O d) 0> O O M M O 00 . . . . . . . . . . . . . . .
N O O O O CO O O CO fl- O O f~ M O CO
M M d- It d' d- N d d' N N d' ~t M M ~t N
fl- ln M N M N d' CO It O't 00 00 fl- O d' N
CO M CO ti O I- d' CO O cf. ' 00 M cf I- N~-. . . . . . . . . . . . . . . .
Lf') 6) Il- Cfl 00 (O CO ch O d' OJ O 00 LO d' CO h (N N N N N N N N M N N N N N N N N
O f- N CO ch 00 CO LO f~ - O) d' N 00 M N O
N M N r L(') CO "'- O~ Op M LO d~ LO M Cf r 00 . . . . . . . . . . . . . . . . .
O O O r O O Cp ti O r Op f~ O O
N M M M M N N N M N c+') M CY) N N N N
d' N ch f' N Ln N f- O CO O r"t LO ~t C4 "t M O N CO LO 'c1' M N CO O 00 '- r r r'~
. . . . . . . . . . . . . .
N 11. LO M d M M N 00 r f ~ (O LO M r M'If' N N (N N N N N N N N N N N N N N N
cn U) 'n (D N
a') a) (D nU) L
L L m CO O ~~ O C U) O m O
+ > c0 L ~ O O c0 L> O
O 0 O O Q. Q. Q- 2 U~ Q. O 0 Y Y Y Y Y Y Y ~~ Y ~ Y Y Y s' Y
7 7 O 7 7 O 7 ~ O 7,~ O 7 ~ 7 7 N N
N N N N ~ ~ ~(~6 ~ d 0 a d d d 0 d L L L c (U M U n n > > D D > > > _ O O O>o >O "" U U U U U U U U F' a. Q- Q. a O

~
O
It N NIt d' 00 t- CO I- (O M I. I- (O O N f- kr) M d' CO OLO ~ M O r N LO 1- O C4 I~ CO ~
M M M'c~' M~- d' ~- ~1' r r r r M M M r Table 15 Name N~s ID Accession Description CDH17 62 NM 004063 Cadherin 17 CDX1 78 NM 001804 Homeo box transcription factor 1 DSG3 61/3 NM 001944 Desmoglein 3 F5 67/6 NM 000130 Coagulation factor V
FABP1 71 NM 001443 Fatty acid binding protein 1, liver GUCY2C 79 NM 004963 Guanylate cyclase 2C
HE4 82 NM 006103 Putative ovarian carcinoma marker KLK2 80 BC005196 Kallikrein 2, prostatic HNRPAO 84 NM 006805 Heterogeneous nuclear ribonucleoprotein A0 HPT1 85/4 U07969 Intestinal peptide-associated transporter ITGB6 71 NM 000888 Inte rin, beta 6 KLK3 68 NM 001648 Kallikrein 3 MGB1 63/7 NM 002411 Mammaglobin 1 PAX8 83 BC001060 Paired box gene 8 PBGD 70 NM 000190 H drox meth Ibilane synthase PDEF 64/8 NM 012391 Domain containing Ets transcription factor PIP 81 NM 002652 Prolactin-induced protein PSA 86/9 U17040 Prostate specific antigen precursor PSCA 66/5 NM 005672 Prostate stem cell antigen SP-B 59/1 NM 198843 Pulmonary surfactant-associated protein B
TGM2 72 NM 004613 Transglutaminase 2 TTF1 60/2 NM 003317 Similar to thyroid transcription factor 1 WT1 65/10 NM 024426 Wilms tumor I
-actin 69 NM 001101 13-actin p73H 87 AB010153 p53-related protein KLK10 88 NM 002776 Kallikrein 10 CLDN18 89 NM 016369 Claudin 18 TR10 90 BD280579 Tumor necrosis factor receptor SERPINA1 91 NM 000295 serpin peptidase inhibitor, clade A member 1 KRT7 92 NM 005556 Keratin 7 MMP11 93 NM 005940 matrix metallo e tidase 11 (stromelysin 3) MUC4 94 NM 018406 Mucin 4 cell-surface associated BAX 96 NM 138763 BCL2-assoc X protein transcript variant A
PITX1 97 NM 002653 paired-like homeodomain trans factor 1 MGC:10264 98 BC005807 stearoyl-CoA desaturase (A-9-desaturase) REFERENCES
US patent application publications and patents Foreign patent publications and patents Journal articles Abrahamsen et al. (2003) Towards quantitative mRNA analysis in paraffin-embedded tissues using real-time reverse transcriptase-polymerase chain reaction J Mol Diag 5:34-41 Al-Mulla et al. (2005) BRCAI gene expression in breast cancer: a correlative study between real-time RT-PCR and immunohistochemistry J Histochem Cytochem 53:621-629 Argani et al. (2001) Discovery of new Markers of cancer through serial analysis of gene expression: prostate stem cell antigen is overexpressed in pancreatic adenocarcinoma Cancer Res 61:4320-4324 Backus et al. (2005) Identification and characterization of optimal gene expression Markers for detection of breast cancer metastasis J Mol Diagn 7:327-336 Bloom et al. (2004) Multi-platform, multi-site, microarray-based human tumor classification Am J Pathol 164:9-16 Borgono et al. (2004) Human tissue kallikreins: physiologic roles and applications in cancer Mol Cancer Res 2:257-280 Brookes (1999) The essence of SNPs Gene 23:177-186 Brown et al. (1997) Immunohistochemical identification of tumor Markers in metastatic adenocarcinoma. A diagnostic adjunct in the determination of primary site Am J
Clin Pathol 107:12-19 Buckhaults et al. (2003) Identifying tumor origin using a gene expression-based classification map Cancer Res 63:4144-4149 Cronin et al. (2004) Measurement of gene expression in archival paraffin-embedded tissue Am J Pathol 164:35-42 Cunha et al. (2006) Tissue-specificity of prostate specific antigens:
Comparative analysis of transcript levels in prostate and non-prostatic tissues Cancer Left 236:229-Dennis et al. (2002) Identification from public data of molecular Markers of adenocarcinoma characteristic of the site of origin Can Res 62:5999-6005 Dennis et al. (2005a) Hunting the primary: novel strategies for defining the origin of tumors J Pathol 205:236-247 DeYoung et al. (2000) Immunohistologic evaluation of metastatic carcinomas of unknown origin: an algorithmic approach Semin Diagn Pathol 17:184-193 Fleming et al. (2000) Mammaglobin, a breast-specific gene, and its utility as a Marker for breast cancer Ann N Y Acad Sci 923:78-89 Ghosh et al (2005) Management of patients with metastatic cancer of unknown primary Curr Probi Surg 42:12-66 Godfrey et al. (2000) Quantitative mRNA expression analysis from formalin-fixed, paraffin-embedded tissues using 5' nuclease quantitative reverse transcription-polymerase chain reaction J Mol Diag 2:84-91 Haas et al. (2005) Combined application of RT-PCR and immunohistochemistry on paraffin embedded sentinel lymph nodes of prostate cancer patients Pathol Res Pract 200:763-770 Hwang et al. (2004) Wilms tumor gene product: sensitive and contextually specific Marker of serous carcinomas of ovarian surface epithelial origin Appl Immunohistochem Mol Morphol 12:122-126 Ishikawa et al. (2005) Experimental trial for diagnosis of pancreatic ductal carcinoma based on gene expression profiles of pancreatic ductal cells Cancer Sci 96:387-393 Italiano et al. (2005) Epidermal growth factor receptor (EGFR) status in primary colorectal tumors correlates with EGFR expression in related metastatic sites: biological and clinical implications Ann Oncol 16:1503-1507 Jones'et al. (2004) Comprehensive analysis of matrix metalloproteinase and tissue inhibitor expression in pancreatic cancer: increased expression of matrix metalloproteinase-7 predicts poor survival Clin Cancer Res 10:2832-2845 Khoor et al. (1997) Expression of surfactant protein B precursor and surfactant protein B
mRNA in adenocarcinoma of the lung Mod Pathol 10:62-67 Kim (2003) Comparison of oligonucleotide-microarray and serial analysis of gene expression (SAGE) in transcript profiling analysis of megakaryocytes derived from CD34+
cells Exp Mol Med 35:460-466 Lam et al. (2005) Prostate stem cell antigen is overexpressed in prostate cancer metastases Clin Can Res 11:2591-2596 Lipshutz et al. (1999) High density synthetic oligonucleotide arrays Nature Genetics 21:S20-Markowitz (1952) Portfolio Selection J Finance 7:77-91 McCarthy et al. (2003) Novel Markers of pancreatic adenocarcinoma in fine-needle aspiration: mesothelin and prostate stem cell antigen labeling increases accuracy in cytologically borderline cases Appl Immunohistochem Mol Morphol 11:238-243 Mikhitarian et al. (2004) Enhanced detection of RNA from paraffin-embedded tissue using a panel of truncated gene-specific primers for reverse transcription BioTechniques 36:1-4 Moniaux et al. (2004) Multiple roles of mucins in pancreatic cancer, a lethal and challenging malignancy Br J Cancer 91:1633-1638 Nakamura et al. (2002) Expression of thyroid transcription factor-1 in normal and neoplastic lung tissues Mod Pathol 15:1058-1067 Prasad et al. (2005) Gene expression profiles in pancreatic intraepithelial neoplasia reflect the effects of Hedgehog signaling on pancreatic ductal epithelial cells Cancer Res 65:1619-1626 Ramaswamy et al. (2001) Multiclass cancer diagnosis using tumor gene expression signatures Proc Nati Acad Sci USA 98:15149-15154 Specht et al. (2001) Quantitative gene expression analysis in microdissected archival formalin-fixed and paraffin-embedded tumor tissue Amer J Pathol 158:419-429 Su et al. (2001) Molecular classification of human carcinomas by use of gene expression signatures Cancer Res 61:7388-7393 van Ruissen et al. (2005) Evaluation of the similarity of gene expression data estimated with SAGE and Affymetrix GeneChips BMC Genomics 6:91 Weigelt et al. (2003) Gene expression profiles of primary breast tumors maintained in distant metastases Proc Natl Acad Sci USA 100:15901-15905 Lillemoe et al (2000) Pancreatic cancer: state-of-the-art care CA Cancer J
Clin 50:241-68 Warshau et al. (1992) N Engl J Med 326:4555-4565 Kroep et al. (1999) Ann Oncol 10(Suppl 4):234-238 Wiesenauer et al. (2003) Preoperative Predictors of Malignancy in Pancreatic Intraductal Papillary Mucinous Neoplasms Arch Surg 138:610-618 Ros et al. (2001) Imaging features of pancreatic neoplasms JBR-BTR 84:239-49 Ryu et al. (2002) Relationships and differentially expressed genes among pancreatic cancers examined by large-scale serial analysis of gene expression Cancer Res 62:819-Ito et al. (2001) Molecular basis of T cell-mediated recognition of pancreatic cancer cells Cancer Res 61:2038-46 Gibson et al. (1978) Histological typing of tumors of the liver, biliary tract and pancreas WHO
Geneva DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

Claims (9)

1. A method of identifying pancreatic carcinoma comprising the steps of a. obtaining a sample containing metastatic cells;
b. measuring Biomarkers associated with expression of F5, PSCA, ITGB6, KLK10, CLDN18, TRIO or FKBP10 Marker genes.
wherein the expression levels of the Marker genes above or below pre-determined cut-off levels are indicative of the presence of pancreatic cancer in the sample.

2. The method of claim 1 wherein the Marker genes are F5 and PSCA.

3. The method of claim 2 wherein the Marker genes further comprise or are replaced by ITGB6, KLK10, CLDN18, TRIO and/or FKBP10.

4. The method of one of claims 1-3 wherein gene expression is measured using at least one of SEQ ID NOs: 39-41 and 43-45.

5. A composition comprising at least one isolated sequence selected from SEQ
ID NOs:
39-41 and 43-45.

6. A kit for conducting an assay according to one of claims 1-3 comprising:
Biomarker detection reagents.

7. A microarray or gene chip for performing the method of one of claims 1-3.

8. A diagnostic/prognostic portfolio comprising isolated nucleic acid sequences, their complements, or portions thereof of a combination of genes according to one of claims 1-3, or 1-3 where the combination is sufficient to measure or characterize gene expression in a biological sample having metastatic cells relative to cells from different carcinomas or normal tissue.

9. A method according to one of claims 1-3, or 1-3 further comprising measuring expression of at least one gene constitutively expressed in the sample.