CA2489194A1 - Polypeptides involved in candida biofilm formation and uses thereof - Google Patents

Description

i'O~.YPEPTIDES INVOLVED IN CANDIDA BIOFILM FORMATION
ANA USES THEREOF
FIELD OF THE INVENTION , The present invention relates to the field of fungal biofilm formation. More specifically, the present invention relates to the identification of polypeptides and polynuclevtide sequences encoding the same which are involved in Candida biofilm formation. The present invention also relates tn a method for identifying compounds that affect biofilm formation and uss of such eornpounds in compositions and mekhvds far the prevention and the impairment of biofilm, such as those caused by Candida albicans or Candida glabafra.
BRIEF DESCRIPTION OF THE PRIOR ART
A biofilm is a community of micro-organisms attached to a surface' it h contains an exopolymeric matrix and exhibits distinctive phenotypic properties (Donlan arid Costerton, 2002). This type of cell development is predominant under 1.
many environmental conditions. For micro-organisms of clinical importance, implanted devices {and indwelling intravascular catheters in particular) provide pathogens with surfaces on which they can adhere and Subsequently form biofilms (Donlan and Costerton, 2002). Transcriptome and proteorne analysis has revealed ':
a that under these growth conditions, bacterial cells adopt a metabolic profile which differs to that seen in cells growing under planktonic conditions (BeclCer ef al., ;
I
2D01; Whiteiey ef al., 2001; Schernbri ef al., 2003; Beloin et al., 2004).
Consequently, biofilms have been shown to be more tolerant yr resistant to both host defence machinery and antimicrobiai agents than free swimming cells; as a result, implant infections are difficult to treat (Bailiie and Douglas, 1999;
Donlan ;, and Costerton, 2002). Since surface attachment is a prerequisite for biofilm '.
formation, the early stages of biofilm formation are primarily conditioned by microbial surface molecules able to bind to abiotic surfaces (referred to as adhesins). For example, in Streptococci, surface associated proteins such as SpaP and Fap1 have been found to function as high~affinity adhesins and play an important role in biofilm initiation and development (Bowen et at., 1991;
Froeliger and Pives-Taylor, 2001). Qther adhesins are needed for cell-cell stabilization of the biofilm structure. For exarnpte, three glucan-binding proteins (GbpA, GbpB
and GbpC) are involved in structural and functional regulation of plaque biofilms in Strepfococecrs mutans (Hazlett et al., 1999).
Candida species are now ranked as the fourth most common cause of bloodstream infection in the United States and Gandida grlabrata represents the second leading cause of candidiasis after Candida albicans in the United States and in France (Pfaller et al., 1999; Vazquez et al., 1999) (F. Dromer on behalf of the French Mycoses Study Group. initiation of an active surveillance program on i yeast-related bloodstream infections in France (ASPYRIF). Abstract P9861, 4th .
European Congress of Clinical Microbiology and Infectious Diseases, Prague 2004). Although the majority of implant infections are caused by bacteria, the prevalence of implant infections due to fungal pathogens has dramatically increased over the last ten years.
In C. albicans, biofilm formation occurs in three steps. The first is the adherence of the cells to the surface, and is followed by an intermediate phase k ;
during which the micracolanies produce extracellular matrix. Finally, a maturation phase occurs, during which biofilm growth is accomplished by cells completely _.
embedded in extraceliular material (Chandra et al., 2001). G. glabrata has also been shown to be capable of forming a biofilm on a range of plastic surfaces, although the presence of extracellular matrix has not been demonstrated (Nikawa et al., 1997; Kumamoto, 20Q2; Shin ef al., 2042). Various adhesin classes have m been identified in C, albicans, and some have been shown to be involved in biofilm formation (Sundstrom, 1999). Far instance, ALS? expression is induced in biofilms (Chandra et al., 2001; Garcia-Sanchez et a1_, 2004; Green et 8l-, 20U4)., and is necessary for wild~type biofilm formation in C. albicans (Zhao, X., Daniels, J.K , a Oh, S , Green, C.13., Soll, D.R. and Hoyer L.L. Abstract 33C, 7th ASM
conference on Candida and candidiasis, 2004). In C. gJabrafa, five adhesin encoding genes (EPA7, EPA2, EPA3, EPA4 and SPAS) have been previously identified (Cormack et al., 1999; De las Penal et aJ., 2003), although none has been studied for its j involvement in biofilm formation. EPA9 is mainly expressed during the exponential growth phasev it encodes a Ca2+-dependent lectin which recognizes N-acetyl lactosarnine and which is necessary far the mediation of yeast ceN adherence to cultured human epithelial cells (Cormack et al., 1999). The five EPA genes are organized into two clusters located within sub-telomeric regions and consequently, EPA2 to EPA5 are not expressed in wild type C. glabrata under all tested conditions (De las Penal et al., 2003).
In view of the above, there is a need to provide new pnlypeptides as well as polynucleotides encoding such polypeptides involved in regulation of Candida biofilm formation. There is also a need to provide for new compositions comprising inhibition of such polypeptide in the treatment and impairment of biofilm formation in mammals.
SUMMARY
The present invention satisfies at least one of the above-mentioned needs.
More specifically, an object of the invention is to provide a method of screening for a compound that affects biofilm formation of a Caredida strain such i or functional derivative as Candida glabrafa or Candrda albrcans, said palypept de thereof being selected from the Candida genes consisting of epa6, epa7, sir4, rill A
and yak1, the method comprising the steps of:
- providing a cell with an initial expression level for said polypeptide or functional derivative thereof;
- contacting said cell with at least one compound to be tested; ii .' - evaluating expression of the polypeptide or functional derivative thereof;
and identifying the compound that inhibits the initial expression level of $aid pdlypeptide dr functional derivative thereof in the cell.
Another objects of the invention concern a compound that affects biofilm formation of a Candlda strain such as Candida glabrata or Car~dida albieans obtained by the method as defined above, and a composition comprising the j compound.
A further object is to provice a method for determining the likelihood of a Candida strain of forming a biofilm, comprising the steps of:
a) obtaining a cell of said Candida strain, such as Candida glabrata or Candida albicans; and ~_' l b) measuring the mRNA level of epa6 andlor epa7 genes in said cell during planktanic growth compared to biofilm growth, wherein overexpression of epa6 and epa7 mRNA respectively during planktonic growth and biofilm growth, is indicative of the capacity of said Candida strain of forming a biofilm. ..
Yet, another object is to provide a method method for detecting the presence or absence of a Candlda biQfilm in a sample, comprising the steps of:
,1 "
a) contacting the sample with a molecule that specifically recognizes a r' Candida yakl polypeptide comprising an amino acid sequence substantially similar to SEQ Ip NOS: 2 or 4, for a time and under ~
...
conditions sufficient to form a complex; and b) detecting the presence or absence of the complex formed in a). ,'I, '' ..,.
.::
::

I
t.
Another object of the invention is to provide a method far preventing andlor impairing biofilm formation of a Candida strain in a mammal, the method comprising the step of administering to the mammal a therapeutically effective ;
amount of a composition as defined above.
5 Furthermore, the present invention is concerned with the use of at least one Candida genes selected from the group consisting of epa6, epa7, sir4, rift and i yakl as a target far identifying a compound capable of impairing biofilm formation of a Candida strain, such as Candida glabrata or Candida albicans.
BRIEF dESCRIPTIO~N OF THE FIGURES
Figure 1. ~iofilm formed by C_ glabrata strain BG2 on a plastic slide. Biofilm was formed in YF'D medium at 37°C on the surface of a Thermanox slide. At the highest magnification, residual extracellular polymeric material is visible.
Figure 2. C. gtabrata cells are more adherent in the stationary phase. (A) Influence of the growth phase on biofilm formation by C. gla6rata strain BG2.
The i:
cells were grown on YPD medium and the OD600 of the culture was followed. At different stage of growth (OD60p = 0.5, 2, 4, 5.4 and 12.5) an aliquot was =!--recovered. The cells were washed, resuspended in YPD medium (ODE00 = 1 ).
j.
The relationship between the OD600 and the number of cel! in the suspension was not affected by the stage of growth (2.7 t 0.3 celllm! for OD600 = 1). The cells were then distributed into microtiter plate wells. After 24h of growth at 37°C, less adherent cells were eliminated by serial washes and XTT reduction was measured. {B) Kinetics of XTT reduction according to the time of incubation of adherent cells with the XTT.
I
:.
Figure 3. C, glabrata Biofilm mutants. (A) Biofilm firmed by C, glabrafa mutant I' strains on a plastic slide. l3iofilms were farmed in SC medium at 37°C
on the surface of a Thermanox slide. The Biafiim- strains produced smaller structures at .~.,~.::
I
I' .:
the plastic surface whereas Biofilm++ strains produced very large and complex I .
i structures (B) Strains were grown under biofilm conditions in 96 well plates in SC
medium at 37°C, with less-adherent cells being eliminated by serial washes. ' Adherent cells were examined and photographed using an inverted microscope (Zeiss Axiovert 200M) at two different magnifications. Wells containing wildtype strain (BG2), Biafilm- (CG129) and Biofilm++ (CG137) mutant strains are shown.
Figure 4. EPA6 and EPA7. (A) Schematic representations of the EPA6-7 gene and the disruption strategy. (B) Southern-blot analysis of the DNA digested by Clal orHirtdlll and hybridized with the EPA6-SPAT specific probe.
Figure 5. Epa6p influences biofilrn formation in C. glabrafa (A) Biofilm formation by the CG122 (epa8-1), CG164 {epa6 .), CG129 {yak9) and BG570 (epa9-5 .
strains as monitored by an XTT reduction assay. 10D% Ac corresponds to the , amount of the XTT reduced by the wild type strain (BG2). The reported values are the means ~- SD of three independent experiments. (B) Transcription of ~PA6 and ' EPA7 as assessed by RT-PCR. Cells were grown were grown under planktonic (late stationary phase of growth) or biofilm growth conditions (see Experimental E'rocedure). ACT1 was used as a control. (C) Transcription of EPA6 at different 2D stages of the planktonic growth on SC medium at 37°C as compare to biofilm , growth. Cells were grown under planktonic growth and an aliquot was recovered after (1 ) 2h of growth (D0600 = 0.1 ); (2) 4h of growth (DfJ600 = 0.24); (3) 6h of ' growth (D0600 = 0.72): (4} dh of growth {DO60b = 2.1); (5) 10h of growth (DO6D0 = 4.9); (6) 24h of growth (DOB00 ~ 7.7); (7) 48h of growth (DQ$00 ~ 7.42); (8) ~.
Cells were Brawn under biofilm growth conditions for 24h using the 96 well plate ; .
model (see Experimental Procedures). ACTS was used as a control.
Figure 6. Variegation of URA3 gene expression when inserted at the EPA locus.
Each strain was grown on YPD medium at 37°C under agitation. The cells were '. ' then washed with sterile water: serial dilutions of cells (107, 106 and 105) were j;:
spotted on YP1~, SD and FOA media and incubated at 37°C for 24h. ~:, i:

Figure 7. Bipfilm formation is regulated by sub-telomeric silencing. (A}
Biofilm r.::
formation by BG2, CG145 (sir4 .), CG149 (rif? .), BG675 (sir3 .), BG592 (rap?-

2?) and CG170 {sir4 .epa6 .) strains was monitored by an XTT reduction assay. 100%
I.
Ac correspond to the amount of the XTT reduced by the original strain (BG2).
The reported values are the means ~ SD of three independent experiments. (B) Transcription of EPA6 and EPA7 as assessed by RT-PCR. BG2, CG145 (sir~t .), CG149 (rif? .) and CG170 (sir4 , epa6 .} strains were grown under planktonic growth conditions (late stationary phase of growth) (see Experimental procedures).
AGT? was used as control.
Figure $. The biofifm signal and Yak1 p act through a sub-telomeric silencing-n .
dependent Mpklp-independent pathway (A) Biofilm tom~atian by BCC, CG145 (sir4 .). CG172 (sir4. yak l) and CG174 (n~pk7 .) strains was monitored by XTT
~ .
reduction assay. 10o% Ac correspond to the amount of the XTT reduced by the original strain (BG2). (B) Transcription of EPA6 and ~'PA7 as assessed by RT-PCR_ SG2, CG145 (sir4 .}, CG14A (rif? .). ~G67B (sir9 .), CG172 (sir4 . yak?) and CG174 (mpk9 .) strains were grown under planktonic (late stationary phase of growth) or biofilm growth conditions in the 9fi-well plate model (see Experimental Procedures). ACT? was used as control. I.
Figure 9_ Mddel far EPAB-EPA7 regulation.
1~' Figure 10. YAKS is necessary to the formation of biofilm in Gandida albicans.
' Strains yak?D of C. afbicans do not possess growth defects on complete media (YPD) but their filament process is altered (Lee medium). These strains do not produce biofilm microfermentor or tubular models.
'a:..
:i ..:..
i~
;, . .

I
l'..' l DETAILED iOESCRIpTION OF THE INVENTION
The inventors have surprinsingly found Candida genes that are implicated in the formation of Candida biofilm. In this connection, the present invention specifically relates to the identification of polypeptides and polynucteotide sequences encoding the same which ors involved in Candida biofifm formation.
The present invention also relates to the use of said polypeptides in compositions and methods for the impairment and the prevention of Candida biofilmin mammals, such as thane caused by Candida albieans or Candida glabatra.
1. Methods of screening and c~rtlpounds In a first embodiment, the present invention relates to a method of screening for a compound that affects biofilm formation of a Candida strain such as Candida glabrata or Candida albicans, said polypeptide or functional derivative ';;
thereof being selected from the Candida genes consisting of epa8, epa7, sir4, rift and yak1, the method comprising the steps of: l. .
- providing a cell with an initial expression level for said palypeptide or 'l functional derivative thereof;
- contacting said cell with at least one compound to be tested; .;
- evaluatin ex ressian of the of a tide or functional derivative 9 p p YP P ,. .
thereof; and identifying the compound that inhibits the initial expression level of 24 said polypeptide or functional derivative thereof in the cell. '" .
According to a preferred embodiment, the compound inhibits the expression of the polypeptide or functional derivative thereof by down-regulating the transcription of a polynucleatide encoding this polypeptide or by down-regulating the translation of this polypeptide.
In another embodiment, the present invention relates to a compound obtained by tha above-mentioned method. Such a compound has the capacity of affecting biofilm formation of a Candida strain, such as Candida albrcans or Candlda glabatra. !t will be understood that the compound of the invention affects i biofilm formation (for instance, by inhibiting or preventing biofifm formation or development) preferably by decreasing the expression of the polypeptide andlor the polynucleatide comtemptated by the present invention, in said fungus. ; .
As it may be appreciated, the compound of the invention finds a particular use as an anti-fungal agent.
According to a second embodiment of the invention, it is provided a method for determining the likelihood of a Candida strain of forming a b~ofilm, comprising the steps vf:
a) obtaining a ceN of said Candida strain, such as Caridlda glabrata or Candlda albicans; and b) measuring the mRNA level of epa6 andlor epa7 genes in said cell during planktonic growth compared to biofiim growth, wherein overexpression of epa6 and epa7 mRNA respectively during planktonic growth and biofrlm growth, is indicative of the capacity of said Candida strain of forming a biQfilm, According to another object of the invention, there is provided a method for detecting the presence or absence of a Candida biofiim in a sample, comprising the steps of:
a) contacting the sample with a molecule that specifically recognizes a Candida yak1 polypeptide comprising an amino acid sequence substantially similar to SEQ ID NOS: 2 or 4, for a time and under conditions sufficient to form a complex; and b) detecting the presence or absence of the complex formed in a)-By "substantially idantica)", ii will be understood that the Candida yakl polypeptide contemplated by the present invention preferably has an amino acid sequence having at least 80% identity, or even preferably 85°/a identity, or even more preferably 95°!° identity to part or all of SEQ ID NQ:2 or of SEQ 10 NG:4, or 5 functional derivatives thereof.
Yet, mare preferably, the Gandida yakl polypeptide comprises an amino acid sequence having 100% identity with S>=Q ID NOv2 or SEQ ID NO:4, j A "functional derivative", as is generally understood and used herein, refers ,.
to a proteinlpeptide sequence that possesses a functional biological activity that is 1Q substantially similar to the biological activity of the whole prateinlpeptide sequence. In other wards, it refers to a polypeptide or fragments) thereof that substantially retains) the capacity of being involved in fungal biafilm formation. A
functional derivative of a proteinlpeptide may or may not contain post~translational ..
modifications such as covalently linked carbohydrates, if such modification is not v necessary for the performance of a specific function. The term "functional derivative" is meant to encompass the "fragments", "segments", "variants", ' "analogs" or "chemical derivatives" of a proteinlpeptide. As used herein, a proteinlpeptide is said to be a "chemical derivative" of another prateinlpeptide when it contains additional chemical moieties not normally part of the proteinlpeptide, said moieties being added by using techniques well known in the I;
art. Such moieties may improve the proteinlpeptide solubility, absorption, bioavailability, biological half life, and the like. Any undesirable toxicity and side-effects of the proteinlpeptide may be attenuated and even eliminated by using such moieties.
One can use a program such as the CLUSTAL program to compare amino v -...
acid sequences. This program compares amino acid sequences and finds the i ' optimal alignment by inserting spaces in either sequence as appropriate. It is possible to calculate amino acid identity or homology for an optimal alignment. A '' program like BI~ISTp will align the longest stretch of similar sequences and assign .
:.
'.

11 ' a value to the fit. It is thus possible to obtain a comparison where several regions of similarity are found, each having a different score. Both types of identity analysis are contemplated in the present invention.
According to a preferred embodiment the molecule is an antibody that ' specifically binds to said yakl polypeptide. More over, the amino acid sequence is preferably encoded by a nucleotide sequence substantially similar to SEQ ID v .
NOS: 1 or 3, or functional fragments thereof.
As used herein, the term "specifically binds to" refers to antibodies that bind with a relatively high affinity to one or more epitopes of a protein of interest, but ;
r:
which da not substantially recognize and bind to molecules other than the ones) of interest. As used herein, the term "relatively high affinity" means a binding affinity between the antibody and the protein of interest of at least 10 6 M, and preferably of at least about 10-' M and even more preferably 10-a M to ~IO-'° M
Determination of such affinity is preferably conducted under stand2~rd competitive binding immunoassay conditions which is common knowledge to one skilled in the ;
art.
f3y "substantially identical", it will be understood that the nucleotide sequence contemplated by the present invention preferably has a nucleic acid sequence which is at least 6a% identical, more particularly 80% identical and even more particularly 95% identical to part or all of any one of SEQ !D NO 1 or 3 or functional fragments thereat.
A ''functional fragment", as is generally understood and used herein, refers to a nucleic acid sequence that encodes for a functional biological activity that is substantially similar to the biological activity of the whole nucleic acid sequence. In other wards, it refers to a nucleic acid or fragments) thereof that substantially retains the capacity of encoding a polypeptide involved in Candida biofilm formation.

h, ' Tne term "fragment", as used herein, refers to a polynucleotide sequence ' {e.g., cDNA) which is an isolated portion of the subject nucl~ic acid constructed artificially (e.g., by chemical synthesis) or by cleaving a natural product into multiple pieces, using restriction endonuclea~ses or mechanical shearing, or a 1 ;
portion of a nucleic acid synthesized by i'CR, DNA polymerase or any other polymerizing technique well known in the art, or expressed in a host cell by recombinant nucleic acid technology well known to one of skill in the art.
Amino acid or nucleotide sequence "identity" and "similarity" are determined from an optimal global alignment between the two sequences being compared. An ;, optimal global alignment is achieved using, for example, the Needleman-Wunsch p.
algorithm (Needleman and Wunsch, 19'0, J. Mol. Biol. 48.443-453). "Identity"
means that an amino acid or nucleotide at a particular position in a first ' palypeptide or polynucleotide is identical to a corresponding amino acid or ' nucleotide in a second polypeptide or polynucleotide that is in an optima!
global alignment with the first polypeptide or polynucleotide. In contrast to identity, "similarity" encompasses amino acids that are conservative substitutions. A
"conservative" substitution is any substitution that has a positive score in the blosumti2 substitution matrix (Hentikaff and Hentikoff, 1992, Proc. Natl.
Acad. Sci.
t-.
USA 89: 10915-10919). By the statement "sequence A is n°/o similar to sequence B", it is meant that n% of the positions of an optimal global alignment between '-I
se uences A and B consists of identical residues or nucleotides and conservative substitutions. By the statement "sequence A is n% identical to sequence B", it is °.
~i:
meant that n% of the positions of an optimal global alignment between sequences A and B consists of identical residues or nueleatides.
2 5 i~ ...
2. Methods of treatment and compositions The compounds obtained by the method of the invention may be used in many ways in the prevention andlor impairment of biofilm fom~atian of Candida stra ins.
i ~:
..,..
_,: , i :!

In this connection, another embodiment of the present invention relates to a , composition for preventing or impaling such biofilms. The composition of the ;
.
present invention advantageously comprises a compound of the invention and an acceptable carrier.
As used herein, the term "impairing" refers to a process by which the formation or development of a Candida biofilm, such as one of G. albicans or glabatra, is affected or completely destroyed. AS used herein, the term "preventing" refers to a process by which with the formation or development of a Candida biofilm such as C. albicans or fabatra, is obstructed or dela ed. ' 9 y f' As used herein, the expression "an acceptable carrier" means a vehicle for containing the compounds obtained by the method of the invention that can be administered to a mammalian halt without adverse effects. Suitable carriers Ip known in the art include, but are not limited to, gold particles, sterile water, saline, glucose, dextrose, or buffered solutions. Carriers may include auxiliary agents including, but not limited to, diluents, stabilizers (i_ e., sugars and amino acids), preservatives, wetting agents, emulsifying agents, pH buffering agents, viscosity ~i ~
enhancing additives, colors and the like. ~ .
~:i Further agents can be added to the composition of the invention. For instance, the composition of the invention may also comprise other anti-fungal (' i:: .
agents well known in the art.
The amount of compounds obtained by the meihod of the invention is preferably an effective amount. An effective amount of compound obtained by the ..
method of the invention is the amount necessary to allow the same to perform their biofilm formation inhibitor role without causing overly negative effects in the host to which the composition is administered. The exact amount of compounds obtained by the method of the invention to be used and the composition to be administered will vary according to factors such as the mode of administration, as well as the other ingredients in the composition.
:.
i':;~ .

The composition of the invention may be given to a mammal through various routes of administration. For instance, the composition may be administered in the form of sterile injectable preparations, such as sterile injectable aqueous or oleaginous suspensions. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic parenterally-acceptable diluents or solvents. They may be given parenterally, fpr example intravenously, intramuscularly or sub-cutaneously by injection, by infusion or per as.
Suitable W
dosages will vary, depending upon factors such as the amount of each of the r components in the composition, the desired effect (short or long term), the route of , administration, the age and the weight of the mammal to be treated. Any other methods weH known in the art may be used far administering the composition of 1. .
the invention.
Yet, another embodiment of the invention is to provide a method for '~ , preventing andJor impairing biofilm formation of a Candida strain in a mammal, the method comprising the step of administering to the mammal an effective amount of a composition as defined above. Preferably, the patient is a human, and even more preferably an immunocompromised human.
n According to another embodiment, the present invention is concerned with the use of at least one Candida genes selected from the group consisting of epa6, !
epa7, sir4, rift and yak1 as a target for identifying a compound capable of ., impairing biofilm formation of a Candida strain.
The present invention will be mare readily understood by referring to the following examples, These examples are illustrative of the wide range of applicability of the present invention and is not intended to limit its scope.
Modifications and variations can be made therein without departing from the spirit and scope of the invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, preferred methods and materials are described hereinafter_ EXAMPLES

The yak1p kinase controls expression of adhesins and bi4film formation in candida glabrata in a sir4p dependent pathway .' ..
a::.
10 Biofilm is the predominant type of microbial development in natural environments, and potentially represents a major form of resistance or source of recurrence during halt infection. Although a large number of studies have focussed on the ~ .
genetics of bacterial biofilm formation, very little is known about the genes involved i .
in this type of growth in fungi. A genetic scresn for Carrdida glabrafa Biofilm 15 mutants was performed using a 96-well plate model of biofilm formation.
Study of h ::.':
the isolated mutant strains allowed the identification of four genes involved in biofilm formation (RIF1, SlR4, EPA6 and YAK1 ). ~pa6p is a newly identified adhesin required for biofilm formation in this pathogenic yeast. ERA& and its close paralogue EPA7 are located in sub-telomeric regions and their transcription is regulated by Sir4p and Rif1p, two proteins involved in sub-telomeric silencing.
Biofilm growth conditions induce the transcription of EPA6 and EPA i7: this is dependent on the presence of an intact sub-telomeric silencing machinery and is independent of the Mpk1 p signalling pathway. Finally, the kinase Yak1 p is required for expression of both adhesin genes and acts through a sub-telorneric 2b silencing machinery-dependent pathway_ ", The aim of this study was to identify C. glabrata genes involved in biofilm II
formation. To date, two different approaches have been used to study biQfilm ..::. .
genetics. On one hand, the use of insertional mutant collections has been I.
3l7 particularly effective in identifying genes required for the early steps in bacterial j:
:I' ~::j ::
,..

biofilm formation (O'Toole et al., 1999). On the other hand, global expression I .
analysis comparing cells growing under biafilm conditions to those in a planktonic '~-~
state of growth has revealed new elements which are specifically regulated during biofilm maturation (Whiteley et at., 2001; Schembri et at., 2003; Beloin et al. , 2004). Similarly, transcriptome analysis has confirmed the unique physiology of C.
albicans cells during biofiim formation (Garcia-Sanchez et at., 2004).
In this study, we used a genetic screening strategy to identify genes involved in biofilm formation in C. glabrata. We identified a new protein (Epafip) which Is the principal adhesin involved in biofilm formation in this yeast.
Finally, we demonstrated that the expression of EPA6 is regulated both by the Yak1 p kinase and a biofitm signal which involve a pathway dependent on the sub-telomeric silencing machinery.
.:
Results I~ ..
C. glabrata strain BG2 forms biofrlm a When incubated in a 2~ well plate and in the presence of a plastic slide, C.
glabrata grew as a thin biofilm on this plastic surface where C. glabrafa formed tridimentional structures (Figure 1). Although the technique used to prepare the cells does not usuaNy allow the observation of the exopolymeric matrix, residual t:. , polymeric structures are visible at the highest magnification. In contrast with C.
albicans biofilms, usually composed of a mix of yeast and hyphae, C. glabrata biofilms are composed of budding yeasts only with no evidence of filamentation or pseudo filamentation on any media tested in this study.
When C. glabrata strain BG2 was incubated in a microtiter plate, similar biofilm ..
growth was observed on the surface of the wells. Less than 0.1 % of the cells in the wells were in the planktanic state. Moreover, no cell accumulation at the bottom of the wells due to sedimentation was visible. After washing out the less adherent cells, the number of cells strongly adherent to the plastic surface was estimated using a colorimetric assay based on XTT reduction (Ramage ef al,, 2001}. By .. ..
analyzing the relationship between the cells growth phase and their ability to adhere to the plastic surface and form biofilm, we showed that C.glabrata cells in the stationary phase had greater adherence than those in the logarithmic growth phase (Figure 2A).
ldentificafion of C. glabrata mutant sfrains with altered ability to form biofJms We used an insertional mutant library (Cormack and Falkow, 1999) to isolate C.
glabrata strains with increased ability to form biofilm (phenotype Biofilm++) or those which were partially or completely defective in terms of biofilm formation -' {phenotype t3iofilm-). We plated 5000 mutant cells on YPD, replicated them individually into 96-well rnicrotiter plates and incubated the resulting cultures at ~ :.:
37°C (see Experimental procedures). After elimination of the feast adherent cells, we used the XTT assay to estimate the quantity of cells which adhered strongly to :l the plastic surface. So as to be able to identify Biofilm++ and Biofilm-strains, measurements were made after 1 hour of incubation with XTT - this is a time point at which XTT is not completely reduced by the wild type strain (Figure 2B). We , identified 72 Biofilm- mutants {chosen arbitrarily as having less than 30°/a of the number of adherent cells seen with the wild type strain) and .44 Biofilm++
mutants ~i.
(chosen arbitrarily as having more than 2t)0% of the number of adherent cells seen with the wild type strain).
The eight mutants that yielded the lowest XTT reductase activity and the '' .
twelve that yielded the highest activity were selected for further analysis.
We :~.::::
confirmed that these Biofilm mutant strains had the same growth rate under , planktonic conditions as the wild type strain (with the same media and temperature used to grow biofilms). Moreover, as the enzyme reducing XTT in yeast is a , mitochondrial dehydrogenase (Baillie and Douglas, 1999), we checked that these Biafilm mutant strains were not affected in their mitochondria) metabolism by plating them on YPG (2% glycerol} medium (data not shown). Figure 3A shows a typical example of the structures produced by Biofilm- and Biofilm++ Strains in the ii ,L., therrnanox slide model of biofiim formation. In synthetic medium, the original strain and the Biofilm~ strain {CG129) produce small structures that differ by their size ~~.! .
and density. In the other hand, the Biafrlm++ strain {CG137} farmed large tridimeniianal structures that nearly completely covered the surface of the plastic slide. In the 96-well plate model ofi biofilrn formation, and after washing away the less adherent cells from the well surface, the original BG2 strain showed small colonies of between two cells and one hundred cells adhering to the plastic, whereas Biofilm- mutants were seen to be single cells or as colonies of less than .
ten cells (Figure 3t3), However, the total number of cell clusters on the plastic surface did not seem to be affected in these two mutants, as compared to the wild type strain. In contrast, a confluent or near-confluent layer of cells was observed for Biofilm++ mutant strains.
Of the 20 mutants studied, we were able to identify 15 insertion sites for the piasmid .used for insertional mutagenesis (see Experimental procedures). FQr the five remaining strains, we were unable to recover any plasmid: it is likely that these plasmids had undergone too many alterations and that the insertion site could not ., .
be sequenced. The sequences obtained were compared by blast analysis with the 75 genome sequence of C. glabrata strain ATCC2001 (Dujon ef a!., 2004). A high proportion of insertion sites were intergenic (7 out of 15). This result is in good ~:
agreement with a previous analysis of the mutant library used in this study, which I' showed that insertion sites far many of these strains were located in intergenic ~~ .:
regions (Cormack and I=alkow. 1999). The present report will focus on a detailed ~_ analysis of four mutant strains {two Biofilm++ and two Biofilm~), and feSUltS
concerning other mutant strains will be presented in a later publication. '' 1r~ .
Epa6p is a newly identified adhesin involved in biofilm formation In the CG122 strain (Biofilm-), the tIRA3-cassette was inserted 1019 by upstream of a 2145-nucleotide open reading frame (CDS1045.1) encoding a protein 35% ;.:
....
identical to the previously identified Epalp adhesin (Cormack et al., 1999).
This i newly identified r=PA gene was designated ~'PAB. Epa6p shares all the features of an Epa protein, i.e. a peptide signal, a C-terminal putative transmembrane domain, numerous putative N- glycosylation sites and a serine-Ithreanine-rich domain of 295 amino acids respectively (Frieman et al., 2002), in the ATCC20Q1 strain, the EPA6 gene is located within one of the two subtelomeric regions of chromosome

3. A 10 kb sequence 98°i° identical to the EPA6 DNA sequence was identified at the other sub-telomeric end of this chromosome (Dujon et al_, 2004). We reasoned that this EPA6 paralogue could be present in the BG2 genome as well. We therefore amplified the complete EPAB ORF from BG2: restriction analysis of the amplified PCR product indeed revealed the presence of another EPAB-related gene, which was named EPA7 (Figure 4A). These two EPA genes encode ~ .
proteins of 715 and 71~ amino acids respectively and share 95°/o percent identity ,: .
at the nucleotide Level. We deleted EPA6 by replacing a large part of the open reading frame by the URA3 marker (see Figures 4A and 4B). One should note that the disruption cassette used to delete EPA6 could also theoretically disrupt EPA7.
However, none of the 60 screened transforrnants carried mutations in the SPAT
~.
gene, whereas we obtained fi independent epa6 .'vURA3 strains.
We next tested the respective contributions of the Epa adhesins to C. glabrata biofilm formation. Whereas the quintuple epa9 .-epa5 . mutant strain was very slightly affected in terms of biofilm formation (75 t 14°/°) as compared to the ~i , original strain (Figure 5A), the epa6 . strains displayed a clear Biofilm-phenotype, _i with 30 ~ 5°lo adherent cells as compared to the parent strain (Figure 5A). The characteristics of this biofrlm defect match those observed in the originally isolated epa6-9 mutant, indicating that FpaEp is the main adhesin involved in biofilm i formation in C. gla6rata.
.i i.
EPA6 and EPA7 expression is inde~ced in biofilm An EPA6-EPA7 sequence comparison allowed us to identify specific primers far each gene that could be used to study their respective transcription under planktonic and biofilm culture conditions through RT-PCR analysis. The specificity '' of the EPAB primers was confirmed using genornic DNA from the epa6 . strain, with genomic DNA from BG2 as a positive control (data not shown). The results of the RT-PCR experiments are presented in Figure 5B and demonstrated an increase (2.d ~ t~.3 fold) in EPAB transcript levels in biofilm, compared to planktonic cultures. We did not observe PCR amplification products from RNAs of ;...
epa6 . mutant strains, thereby confirming the specificity of the E~'A6 primers. The study of the expression of EPA at different stages of growth in planktonic ' .
condition (Figure 5C) demonstrated that EPA6 gene is transcribed at the highest level during the late stationary growth phase, consistent with the increased ability of stationary phase cells to form a biofrlm and the role of Epa6p in this process.
This contrasts with other EPA genes previously identified, which are either expressed during exponential growth (EPA) or not at all {EPA2-SPAS) (Cormack et al., 1999; De las Penas et at., 2003). Very law levels of the EPA7 transcript ~-:v were detected in planktonic cultures, while (as with EPA6) incrf~a~sed levels were observed in biofilm (Figure 5B). Similarly, EPA9 to EPAS were not expressed in planktanic cultures. These results demonstrate that the expression of EPAB and EPA7 is induced in biofilm, and suggest the existence of a response to the biofilrn f ifestyle, i~
EPA6 and EPA7 transcription is controlled by YAK1 Further analysis of the Biofilm- mutant strains revealed that in two cases the plasmid had inserted within an Oi~F encoding a protein with 58% similarity at the amino acid level to the S. ceievisiae Yaklp protein. C?riginally isolated as a ._ suppresser of a ras9 temperaturesensitive mutant, YAKS deletion conferred growth on a tpkl tpk2 tpk3 triple mutant strain in S. cerevisiae (Garret and Broach, 1989). Yak1p participates in a pathway parallel to that of the CAMP-dependent protein kinase (PKA): it has overlapping targets but antagonistic effects, and Seems t0 be InvolVBd in m~~~a~tfhC ~hv 5tairiaticin ~igi~ai (VVCIIICf VVIIG'IIfJUffll3 ~'f r!
fv al., 1991). We transformed the f3G14 strain (Ura-) using an EcoRl digested plasmid containing the tlRA3 gene and the sequences surrounding the insertion site from the original yak9 mutant strain: 90% of the transformants displayed the same Biofilm- phenotype as the original mutant. As assayed by XTT analysis, the transformants had 30 ~ 18% adherent cells, compared to the wild type strain (Figure 5A). As the numbers of adherent cells for the yak9 (CG129) and the epa8 .
(CG164) mutant strains were nearly identical (see Figure 2}, we studied transcription levels for EPA6 and FPAT in the yak? mutant strains. As shown In c.
ji L

Figure 5B, YAK1 is required for the transcription of ERA6 and EPA7 under bath planktonic and biofilm conditions.
."
FPA6 transcription is regulated by sub-teiarrreric silencing S When we studied the growth of the epa6 . strain (CG1$4) an SD and FOA media, . i we noticed that it was able to grow on bath media {Figure 6). This result indicated that some of the epa6 . cells expressed the URA3 gene (allowing strains to grow on SD) whereas the remainder had a silent URA3 gene (allowing them to grow on FdA). In S. cerevisiae, epigenetic gene silencing has been shown to oCCUr at the -- 10 silent mating-type loci HMZ and HMR or within sub-telomeric regions and the tandem rONA array (Sherman and Pitlus, 1997; t_ustig, 1998). At subtelomeric Loci, silencing is mediated by a multiprotein complex within which the Sir2l3/4 silent information regulator proteins play critical roles (Huang, 2002).
The telorneres contain multiple Raplp-binding sites that recruit the Sir complex:
the uir-Rapt E

15 interaction is then competed by two Raplp interacting factors (Rif1p and Rif2p) v (Huang, 2002). tn the ATCC2001 strain, EPA6 is located in a sub-telomeric region of chromosome 3. Moreover, in two Biofilm++ mutants, insertion sites were located i i just upstream of genes encoding proteins involved in sub-telomeric silencing. [

i Thus, the CG137 and CG140 strains had the plasmid insertion site 925 by and !

20 430 by upstream of the SlR4 homologue (CDS~129.1) and RlF1 homologue [

(C>OS0069.1) of C, glabrata, respectively. CgSir4p and CgRiflp show 17.8f and 24.8fo amino acid identity with their respective S. evrevisiae orthologues. When i SfR4 was deleted in an epaS .::URA3 mutant strain, the variegation of URA3 gene expression was abolished and the epa6 , sir4 . double mutant strain (CG170} was 25 net able to grow on FOA medium {Figure 6). As expected, sir4 .
(CG160) and rift .

(CG149) strains displayed a Biofilm++ phenotype, thus confirming that sub-telomeric silencing regulates biafdm formation in C. glabrata (Figure 7A).

Accordingly, raps-27 and sir3 . strains (De las Penas et al., 2003) were also Biofilm++ (Figure 7A).

30 Measurements of EPA6 expression in these strains showed that the :.

8iofilm++ phenotype was associated with significant overexpression of the EPA6 .. . 22 .. .
gene (Figure 7B), However, the epa6 . sir4 . double mutant strain (CG170) displayed the same level of biafilm formation as the single sir4 . mutant strains:
this shows that in a sir4 . background, the EPA6 gene is not necessary for the expression of a Biofilm++ phenotype (Figure 7B). One should note that in the sir4 , and to a lower extent in the rii9 . strains, EPA7 and EPA1-EPA5 were also averexpressed suggesting that other Epa proteins could be subject to sub-telomeric silencing in this context (Figure 7B, and data not shown}.
The bioi'iIm signal and Yak7p act through a sub-telorneric silencing -deperrdertt Mpk~pindeperrdent pathway In order to determine whether or not Yak1p regulation of EPA6 transcription was dependent on the sub-telomeric silencing machinery, we constructed a yak9 sir4 . fn double mutant strain. As shown in Figure 8A, a yak~i mutation in a sir4 .
context did not affect cell adherence, and yak9 sir4 . strains were Biofilm++.
Moreover, EPA6 and EP,47 transcription levels were stilt higher than in the original strain. These results strongly suggest that Yaklp regulates the transcription of C.
i glabrata adhesins via a sub-telomeric silencing-dependent mechanism.
In order to determine whether the biofilm signal responsible far the increase I
of EPA6 expression in biofilm as compared to planktonic growth conditions was acting via regulation of sub-telomeric silencing, we compared EF'A5 and EPAT
expression in a sir4 , strain under both circumstances. As shown in Figure 8B, no apparent further increase of the EPAG and EPA7 transcription levels were detectable in biofilms (compared to planktonic growth conditions) in any of the i sub-telomeric silencing mutant strains. Thus, a mutation in any of the proteins involved in sub-telomeric silencing seems to suppress the inducibiiity of C. ~
i glabrata adhesin encoding genes in response to biofilm growth conditions. This suggests that the biofilm signal regulates sub-teiomeric silencing. _1.,,:
In S. cerevisiae, regulation of sub-telomeric silencing by stress (but not by nitrogen starvation) acts via Sir3p phosphoryfation by the Mpk~p kinase (Ai et al., 2002), i.e. part of the cell wall integrity pathway. We reasoned that Mpklp could be also a key kinase far the regulation of sub-telorneric silencing in response to biofilm w ::.
,.~:
'!
v growth conditions. We identified the ItrlPK9 gene in the C, glabrata genome.
ft ' encodes a protein showing 76 a/o identity with the S. cerevisiae homologous protein. Even though the deletion of Mpklp increased SPAS and ~PA7 transcript . levels during pianktonic growth, it did not abolish its biofilm dependent inducibility (Figure i3). The biofilm signalling pathway therefore appears to be ' Mpk1pindependent.
Discussion 1 p EPA6 encodes the main adhesin for biofilm formation in C. glabrata fn this study, we demonstrated that EpaBp represents the main adhesin involved in t biofilm formation in C. glabrata. Indeed, epa6 . strains are 8iofilm-, and EPA6 transcription is induced by biafilm growth conditions. Epa7p does not seem to play a major role in biofifm formation, since yekf strains which do not express EPAB t t v ~ 5 and EPA7 had a Biofilm phenotype comparable to that of epa6 .
strains.
However, t' epa6 . strains do not seem to be impaired in terms of adherence to a plastic f 1 surface per se. As shown in Figure 38, it is the size of the colonies adhering to the plastic surface that is affected in epa6 . strains, not their number.!
This result ;

suggests that Epa6p is not involved in adherence to the plastic surface as such 20 but rather in cell-cell adherence within the biofilm, The fact that the closest t homologue of Epa proteins in S. cerevisiae is FIollp (a protein known to be I

involved in calf flocculation and in biofilm formation) supports this hypothesis (Reynolds and Fink, 2001; Haime et al., 2004).

Theoretically, the adhesin candidate responsible for adherence to a plastic surface 25 should be expressed under planktonic and biofilm growth conditions but should not be subject to Yak1p regulation since YAKI deletion does not preventw adherence to the plastic (see below). In a recent report, De la Penal and colleagues estimated ;

that they may be at feast 16 different EPA genes in the C. glabrata enome De las Penas et al., 2003). It is not yet known whether one or more of the 30 other Epa proteins or other types of adhesin (i.e. glucan- or protein-based) are ,' responsible for adherence to plastic ire C. glabrata. w 1.
. . ;24 j.
.t t Yak9p acts through a sub-telomeric silerrcir7g machinery dependent pathway in C.
.;
gfabrata a We demonstrate here that Yaklp is necessary for FPAB and EPA7 expression.
. Moreover, these phenotypes are bypassed by a mutation in one of the genes encoding proteins necessary for sub-telomeric silencing. These results suggest that Yaklp acts through a sub-telomeric silencing-dependent mechanisrn_ It remains to be found whether Yak1p is itself regulated by biofilm growth conditions.
in S, cerevisiae, Yaklp has been spawn to be regulated at three levels_ firstly, its specific activity is regulated by nitrogen starvation and stationary phase status 90 (Garret et al., ?991), Secondly, the same signals also regulate the level of expression of its encoding gene. Thirdly and finally, nuclear localization is induced by glucose starvation or rapamycin treatment (Schmelzle et al., 2004; Moriya et ' al-, 2001). In response to glucose removal, Yaklp associates vrith Smhlp-Bmh2p, enters the nucleus and phosphorylates Pop2p, a component of a rnultiprotein complex that regulates gene expression both positively and negatively (Moriya et al.. 2001). Yak1p regulates also the nucleocytoplasmic localization of the PKA
regulatory subunit Bcy1p (Griffioen et al" 2001), The action of Yak1p thus appears :.
to be very complex and muftifactarial. Furthermore, in Dictyostelium diseoideum, YakA is necessary far starvation-induced growth arrest and the starvation-induced induction of gsnes necess2ry far development (Mendes Souza et al., 1998). In C. t , t.
glabrata, YAKS transcription level was not affected by biofilm growth conditions (data nat shown), although this kinase seems to be necessary fvr shifting from planktonic growth to growth under hiofilm conditions.
Our working model for the regulation of sub-telomeric silencing by biofilm growth is presented in Figure 9. in this made!, expression of the Epa adhesins is j .
controlled by subtelomsric silencing which in turn is regulated by a biofiim signal acting through or independently of Yak1 p. A large part of this regulatory pathway is still to be understood but the strategy used in this study appears to be very promising for the identification of proteins involved in the physical interactions of C. j glabrata with the enviranrnent, as well as for proteins involved in the regulation of sub-telomeric silencing.
i .J
Modulation of sub-telomeric silencing by Rifip and Mpk9p in C. glabrata .9 The results presented here suggest that C. glabrata adhesins are regulated by a biofilm signal and Yakip via a sub,telomeric silencing machinery-dependent mechanism. Sir3p is the limiting factor for propagation of silencing in sub-telomeric 5 regions (Stone and Pillus, 1998) and the only Jcinase identified to date as being involved in Sir3p phasphorylation {and subsequently in the regulation of sub-telomeric silencing) is Mpklp (Ai et al., 2002). In response to stress (but not to nitrogen starvation), Mpk1 p is activated and phosphorylates Sir3p, thus repressing sub-telomeric silencing. This leads to expression of the PAtI genes located in the v10 sub-telomeric region encoding cell wall proteins (Ai et al.. 2002).
Additional factors y (such as starvation, heat shock or the presence of mating pheromone) can affect i Sir3p phosphorylation and sub-telomeric silencing (Stone and Pillus, 1996; Ai et al., 2002). Jn this study, we demonstrated that biofilm-induced regulation of sub-I telomeric silencing was not dependent on Mpk1p. However, the function of Mpk1p i 15 in C. glabrafa seems to differ slightly from that of its S.
cerevisiae counterpart. ' I.
Indeed, deletion of MPK~ in C. glabra#a increases EPAE transcription, most ',.

probably due to modulation of sub-telorneric silencing, whereas in S. cerevisiae ;..

deletion of the same gene does not modify the constitutive level .
of sub-telomeric silencing (Ai et al., 2002). The function of Rif1p seems also td be different in C.

20 giabrata when compared to S. cerevisiae. Indeed, in the latter organism, RJf1p acts as a negative regulator of telomeric silencing and length (Moretti et at., 1994), I.

whereas deletion of RlF1 in C. glabrata derepresses the expression of the EPA ~.

genes located within sub-telomeric regions- These results suggest that the overall mechanisms of sub-tetomeric silencing are not ronsenred between , these two r 25 hemiascomycetous yeasts, even though the same constitutive elements are present.
L

Variegation of EPA6 expression suggests phenotypic heterogeneity of the cell ~y surface in C. glabrata We demonstrated that in a epaB .::URA3 cell population, some cells were Ura+

and others were Ura-. This result strongly suggests that in a BG2 cell population, ',:
,.

some cells express the EPA6 gene at the cell surface whilst others do not, Similar i results were obtained with the other SPA genes identified to date (De Jas Penas et a!., 2003). Moreover, previous studies in S. cereuisiae have shown that the degree of silencing within sub-telomeric regions differed from one chromosome end to '. 5 another (Pryde and Louis, 1989)_ One can thus imagine that the Epa organization at the cell surface of a clonai C. glabrata cell population is highly heterogeneous. It remains to be seen whether such putative antigenic heterogeneity in C.
glabrata is a means by which this pathogenic yeast escapes the immune system in vivo.
Castano ef al. (2004), found That C_ gtabrata mutants with insertions in SlR3 ad i RIFJ were hyperadherent to epithelial cells and show, in findings strikingly i reminiscent of our own, that increased adherence depends on EPA6 and its close homologue EPA7. These normally silent adhesins therefore have roles in adherence as well as in biofilm formation, perhaps pointing to a similar complex role in the infection process.
i I
Experimental procedures i Strains and media , .
Candida gta6rata strains used in this study are listed in Table 1: all strains were ~, isogenic to the BG2 strain (Fidel et al., 1998), The SC and -Ura DO synthetic media and the YPD rich medium were prepared as previously described (Sherman. 1992). When needed, ~-fluoroorotic acid (FGA) was added to SC
medium at lgll. The bacterial strain Esct~erichia colt XL1-blue (Stratagene, La Jolta, CA) was used for propagation of ail plasmids, All procedures for manipulating DNA were performed as previously described (Sambrook et al. ,1989). ~ ..
6iofilm formation C. glabrata strains were grown to stationary phase with agitation in SC medium at ~, .
37°C. Cells were then harvested by centrifugation, washed in sterile water and ::L:.
resuspended in SC or YPD medium at a cell density adjusted to OD600 = 1. For -.
:.
y' .

the plastic slide model of biofilm formation, these cell suspensions were distributed into prestelirized polystyrene 24-well plates (TPP) in which a round plastic slide was added (Thermanox, Nunc). After 24h of growth at 37°C, the culture medium was eliminated firstly by inverting the plates and secondly by careful pipetting_ L3iofilm were then examined by scanning electronic microscopy (SAM) as previously described (Prigent-Combaret et al., 200p). Briefly, biofilm samples were fixed for 1 h in 0.07 M sodium cacodylate buffer (pH T.3) containing 1.2%
glutaraldehyde and 0.05% ruthenium red. The samples were then washed in the same buffer containing 0_05°lo ruthenium red and pastfixed in 1% osmium tetroxide in cacodylate buffer, treated by the critical point drying method, and observed on a Gemini DSM 982 scanning electron microscope. Transmission and scanning I electron microscopy were performed by Srigitte Arbeille and Claude l_ebas at the Laboratoire de Bioiogie Gellufaire et Microscopie Electronique> UFR Medecine, I.
Tours, France. For the microtiter plate model of biafilm formation. the cell suspension in SC medium were distributed (100 trl per well) into presterilized, i ;
polystyrene 9ti-well microtiter plates (TPP, round bottom) and incubated overnight , at 37°C. Following biofilm formation, less adherent cells were removed by washing the plates three times in water and once in PSS buffer. Strongly adherent cells were quantified by using the previously described metabolic 2,3-bis(2-methoxy-

4-vitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT, Sigma) reduction assay Ii ' (Ramage ef al., 2001 ). Briefly, XTT solution was prepared at 0.5 mglml in PBS, i .
r filter-sterilized and stored at -20°C. Prior to each assay, an aliquot of stock XT'f was thawed and methadione (1 UM final) was added. A 100 Nl aliquot of the XTf-J
methadiane solution was added iv each well. The microtiter plates were then c , incubated for 1 hour at 37°C A colorimetric change was measured at 492 nm using a microtiter plate reader (L_absystems Multiskan RS).
Characterization of fhe URA3-cassette insertion sife in the Biofilm rrrutant strains The mutant library used for screening for Biofilm mutant strains has been ~'I
, previously described (Cormack et a~., 1999). In order to determine the sequence of ~,',;
the URA3-cassette inserkion site, the genamic DNA was extracted (Philippsen ef '!
I_' :1,.i ...
..
!i! .
r~ .

'' _ ., 28 al., 1891 ) and digested by EcoRl. After ligation and amplification in E.
colt, a plasmid containing the URA3-cassette and the genomic flanking regions was recovered. The sequence of the insertion site was then determined using M13-40 and M13-REV48 as sequencing primers.
Gene disruption -.. The disruption cassette was constructed by PCR fusion using a similar strategy to that used by Kuwayama and colleagues (Kuwayama et at., 2002). For EPA6, t upstream and downstream gene fragments and the URA3 marker were PCR- t amplified using the HFpCR kit from Ciontech (Palo Alto, CA). The primers used for these amplifications are listed in Table A (supplementary material), and their positions are shown in Figure 4. EPA6-3'S and EPA6-5'3 contain the reverse t complements of MKRfEPA6 and MKRrEPA6, respectively. In addition, 5 ng of i each of the three gel-purified, amplified fragments were used as substrates for f.
PCR fusion with the primers EPA6-5'5 and EFA6-3'3 and the following programme_ 94°C for 30s, followed by 35 cycles of 94°C for 15s and 68°C far 4 min. The final PCR fragment represented the epa6 _::URA3 cassette. The BG14 a l (ura3) strain was transformed with the deletion cassette as previously described F
(Cormack and Falkow, 1999), and Ura+~ transformants were then selected an -URA DO plates. Proper integration of the cassette was determined by PCR using a primer that annealed to a region outside the disruption cassette (EPA6ex) and a ' .
primer that annealed to a sequence within the marker (URA3F) (Figure 4A, Table j A). We screened 55 colonies and identified 6 putative, homologous integrants.
A
second pair of primers was used to check for correct integration of the cassette (EPA6ex2-URA3R) (Figure 4A, Tabie A). PCR amplifications of the EPA6ex EPA6ex2 region were used to verify the knock-out of the wild-type gene in each putative deletion strain (Figure 4A, Table A). Furthermore, Southern blot analysis ~' was used to confirm gene deletion. A similar strategy was used to disrupt SlR4, RlF9 and MPI~~, Concerning YAKS, the piasmid recovered from the original yak7::URA3 strains was used to transform the strain BGId after EcoRl restriction. y Primers for both outer regions of the cassette in the C. glabrata genome were 1.
.; :t :.t .
.::.
t:, used to screen for transformants having integrated the cassette in the YAK9 locus.
Southern blot analysis was performed to confirm gene deletion.
So as to construct a double mutant sir4 . epa6 . and sir4 . yak9 strain, a spontaneous Ura- derivative of a slr4 .::URA3 strain was isolated on FOA
medium.
The stability of the Ura, phenotype was tested by growing the cells on YPD
medium and plating them on FOA and SD media, We also checked that the Biofilm++ phenotype was not affected by this mutation. This sir4 .::ura3 strain was then used as a recipient strain for constructing the sir4 . epa6 . and slr4 .
yak?
double mutants, using the same strategy as with the corresponding single mutant I
1Q strains.
I
_.
RNA preparation and RT PCR
v Cells were grown to stationary phase on SC medium, under agitation for j planktonic growth conditions or in microtiter plates for biofilm growth conditions.
Total RNA from 106 cells was prepared as previously described (Schmitt et al., '1990}. The purified RNA was treated with DNase to eliminate any trace of DNA, ~, l and was then used to isolate the mRNA using the oligotex mRNA kit (~2iagen).
RT-PCR was performed by using the Access RT-PCR system kit (Promega) and an l Icycter (Biorad) thermocycler. After RNA denaturation (68°C for 5min), the reverse l transcription step was performed at 48°C for 45 min followed by 2min at 94°C. l PGR amplifications were carried out as follows: 2 min at 94°C (one cycle) 94°C for ~--sec, 58°C for 1 min, 68°C for 1 min (30 cycles) and 68°C
for 7 min (one cycle).
The primers used for the RT-PCR are listed in Table A (supplementary matariaf). ~ .
ACTS was used as the control. For each preparation and each couple of primers.
25 PCRs without the reverse transcription step were performed to check that C' preparations were free of DNA. Three independent RNA preparations were '=
prepared from each strain and growth condition. in order to compare the expression of EPA6 in each strain and each growth condition, serial dilutions of a ..
the fCR products (ACTt and EPA6) obtained with the BG2 strain under , , 30 planktonic growth conditions were deposited in an agarose gel, and curves of the ratio of the fluorescence of the bands and the dilutions were drawn. The ~ w 1.i l: ~ .

...I
't fluorescence of each electrophoretic band was measured using a VersaDoc Imaging System (Biorad) apparatus and Quantity One 4.3.1 software (Biorad).
For v each sample, appropriate dilutions of the PGR products were deposited on agarose gels and their fluorescence was compared to the standard curves.
.. b The mechanism of action of YAKS on biobtm formarion in C. albicans is different from the one previously identifred in C. glat~rata I

1a YAKS is necessary far biofilm formation in Gandida glabrata. A
strain in which I

YAKS has been deleted produced only 30l0 of t~iofilm as compared to the original .' t strain. We identified the target of YAKS regulation in C, gtabrata, Thus, the gene EPA6 which encodes an adhesin necessary for biofiim formation is not expressed ~' in a yak9: t strain. EPA6 as all the other members of this adhesinsj family identified 15 to date is located within a sub-telomeric region of the C, gtabrata genome and its j transcription is regulated by the sub-tetomeric silencing machinery.
Our results ~..

suggest that YAK1 regulates the expression of FPAfi and consequently biofilm t formation through the regulation of sub-telomeric silencing level.

..
20 In Candida albicans, none adhesin has been shown to be individually necessary for biofilm formation. This development state in C. albicans seems to be under the control of multiple factors. Moreover, na sub-telomeric localization of the C.

albicans adhesin genes has been demonstrated. YAK7 in C. alblcans, seems to act on biofilm formation through a mechanism completely different from the one 25 we have identified in C. glabrata, ~.
~.
;.

The sequence of the Carrdida atbicans YAK1 gene was obtained from the ", CandidaDB database ( tt :II eno(ist.oasteur.frlCandidaDB; Df01-g1 iiee a 00-6$) 't that has been built using Assembly 6 of the C, albfcans gename .
sequence made 30 public by the Stanford Genome Technology Genter in September 2000.
The ,..
,i sequence of the CaYAK9 gene is divided into two parts, narnety YAKl.Sf and YAK~.3f, because of a potentlaf frame-shift in the open-reading frame-shift.
While the C-terminal domain shows 67°~° similarity to the S.
cervvisiae Yak1 protein, the N~terminel domain is not significantly homologous to its S. cerevlslae counterpart.
This seems a common feature of all Yak1-related proteins which have a aminoterminal of taw complexity. The accession numbers are as follows:
YAK1.5f SGTC Assembly 6 : orffi.ll$0 18 SGTC Asserr~bly 19 : orf19.1~8Iorf19.7788 CandidaDB : CAt?354 ... Nucleotide sequence (SEQ ID N0:1) t.ccgtt ttcc:ctttctti:ctttctttct:tgctccccccraaaaggaactt tgaaagattr.tgaatgattcttgcataatttcaacatcacacaaataatt_ taaeaataat:ttaagaaagaaaaagtgggtggtgttgtctttaacctata ggtt:atctcaccttcaataeaaccact_gtcacaacagtactatttaactt gattattcc:Ltaatctatttacttattattagtgcataaetttgtagtaa ~.

at agattaaggagagaa~aaagtgt taat~3tgtgtaac~tgtgt.araagtg 2 Q tgcgtgtaaaaaCgtaaaet~cttgcccttatLgt~~gtttt.tgtttatra j , acacacacacacacacacaccagacagactacacaaatttttttCtgttc aatttgt_tcacatacaaacacaaattac:aac~acaaotacaactacaaca 1 cattC:ctCaaG~a~~gtt;.ctCatattCaatttC,aatrtcaatCtta=Cattt.

tar_aaatcattattatt.attattattattat.tggtataotactcaatac:a attgaaagggtttcaattatctagcLtatLttaatagtatttaLt.cant y tact:Cattttttaaaaattctgat.CCtcCCCCtttttCCCtCaagttcaa acaaaacgcaagagatCacataccattaataatatataagaccaaccatt gtaacr_acacaaagtatcacagtatcaccgacaaatttatacatATGGCA

TA'f AATAG CAATAACAA CAGT'rCTAAT1'ATAATTATAATTTT AA'I' CGACA

3Q CAATTC'rATAGGAGGAAATTGGCAT~'TACCACCACCACCTCCTCCACCAA

CTCAACTTAC'TTCTAGTGGTGCA'I'ACCACCACCACCAACAACAACAGCAC i C CGCAGC AACATT2'ATC'_ ACC=TAATCATC: CTAATGG'rCAAGATATTTTATC ~

ATCATC~.GATT C TCAAT'TTCTGTCACAATTAAAA C..~.AAATCAAATTCCTG

GATTC'C'GTAACCCTTGGTTT'rCTCAACAACAAAATTCTACCCCTAATATG l TTATCATCTTt'A'~'CA'rCTGCATCATC'rTCAT7:'ATCTCAATC'ACCGACTAA

ATCACATCAAATACCATTATTACAACAACATCAACC.'TCCA~:'TACTAAATA

AACGATTATCATTTACAAATAAT T'rA CCAATA.~1C'T~l'ATGAACATGAAAG~' ' AGTAGTAA'fAG'1'AG'rACTAACAACAACAGCAGCAGCAnTGG C.AATGGCAA a CAATAATAACAATGATAA'rAATAC.rAATGTAC'CACCATATATACATCCAC

cAACTCGTGCmGATAATCCATTTAA'rCA'rTA'1'T'TTG~CACTCAAGAAGTT

ACTT'rGGGTAGTAATc~ACCGAAGAATGTC(sGC'rGCTG'1'AGAT GAACTC.A

TTATAATCCA2'ATt3GA'1'TC'AATLAAC71ACTTA.A'I'GCT'T'ATCCTTC'I GGTC

CTGC~'C,GAATTGCTGGTACTCAATATCTTAATAATCCTAAT'rTGGGTCCA i;
' ' CTGUTAAAZ'GC CAATAGAAGATCAT CTG'rdI,GGGGTATTACCCAAT'fAT'1'A 1 4$ TCGTCAACAACAAC'AACAACAAGT'rCAAGATCAGTCTAC'TGCTGt=TGCTG i .

CTGCTGCTGCTC~CGGCAGCGGCATA'rTA'1'CT'r CCACCAGC'rAGAT'fGGGA j, ::;i . ..
r ss AC1~.'I'CAACTCTGA'rTGTTC'.AA'fA'1'CAACAATATCAACA:4GCATTACACAt~
= ' TCAAAGAATAACTAAACATAAGA11CCC1GCACCCAA.GGGCAAGGA~1,AATA
' TA T AA
Aminoacid se4uence~,SEQ IA NO:2) ". :u!AYNSN2~NSSNYNYNFNRHNS IGGNWHLPPPP P CaPTQI,TSSGAY~iHHQQQQIiPQQHLSPN
~iPNGQDII~aSSVSQr'SSQLKQNQI PGFT~NYWFSQQQNSTPNMLSSSSSASS SLSQS PTKS
-.-.. H~; 'T PLI~QQfiQpPLLNKRLSFTNNLP LTYSI~IP:SSSNSSSNNNSSSNG1NGNNNNNnNNTNVP
I'Y 1 H PP'I'RAD?dPFNHY F'ATQE'V'i'LGSNbRR'~ISAr~VDG'rHYNPYGFNQQL~NAYPSGPAG1A
1Q GTQYLNNPNL,GPSVNANHRSSVGVLPNYYRC7QQQQCVQpf~STAAAAAAAAAAAYYLPPA1~
LGRS'rSZVQYQQYQQALHNQRI'1KHKNPAPtGKENI~
YAK 1.3i - SGTC Assembly fi : orf6.1179 SGTC Assembly 19 : orf19.1d7I0rf19.77a7 CandidaDB : CA0353 Nucleotide seguence (SEQ tp N0:3) CTG CAT'rTAA CGC CrAAnT~'CCATC"AA CACCCTAAATATAGACGATGTTC
TATAAAT'rCAATTCATAT'ATCACCAG2'CAATGCCTTA'I"CGATATAT'TTAA
cAGAATCA'rATAGTTTATGTCaACCAAGAAAATTCCAATATTCGAAATCA
ACTAAT C C'T'AAP CGAGTATT11ACTAAACCA CTGG~~ACCTAAATATAATAA I , TGGGTATC~A'f AA'1'GAAGATAGTGA'f TATATTT'rATATGTTAATGATGTAT
Tae GAAG TGAAGAAGGGAAAAA.A.TA'TA7.'GGTAT'rAGATT'TA'fTAC3GTTCA ~.
GGTACA'I'T2'GGACAAGTAGTTAAATGTCAAAATCTTAATAATCAAAC't'GT
TTGTGC'I'GT': AAAG'fGA'TCAAA'1'CGAAACCAGCATATATGAATCAATCAT
TAACTGAAGTT CaA'f TATTAGP.ATTTTTAAA'l'G CTAATAGTGATGGGAAA
AATTTCATTCGATTATTGGA'!'ACATTTATGCATAP.AGAACATCTTTr,T'I°r f AG'rATTTGAAATC'rTGG CAT CGAA'rTTATA'TGAAT'I'AA'rTAAACAAAAT C I
3D AAT'fTCAAGGTCTTAA'I'ATGAAATTAGTTAA~1TTATTAACTAAACAA'fTG
T'rAGATTCAA'rGGCTCAATTCsAAAAA'rT'1'CCAAA'rGATTCAT'~'GTGATTT
AAAACCAG11AAATATCTTATTATG'fCAACCCGATAAACCCAATATAAAAG
TC ATTG ATT'rTGGTAGTG CTTGTTTCACAAGAAATACTAT'A'='ATACT'TAT
ATTCAATCAAC~ATTTTATCGATCACCAGA~1G1'A.zITATTAGGTTTACCT'1 A ~.;
TACTGAATCAATTGAT'ATGTGGTCATTAGGTTGTATCGTGGGGGAATTA'r '!'TTTAGGTT;ACCAATGTTTCC2'GGAACTTCAGAATATAATCAAATT'rTT
AAA.ATTGTTGATATGTTGGGTC'CTCCACCAAGACATA2'GA'1'TGAAGTTGG
GAAAAAT TC AT'T CAAT'!'T C'I'TTAAAAAGAAAG TCAACA CCAC CACCACCA
CCATCAACAACAATAATAATAATACTTCAGAAACAAAACCAATTTATGAA
4Q CT'rAAATCAT!'TGATGAATATTGTCAATTT7.'TAGAATATAAACGACAAAA .
ACAAGAf.GGTG~TACATCTACAACCAACAACAATACTAATAG'I'AG TAG'rA
G'T'AGTAATCATCATAATAATAATCATf~AAAAGGAACAACCAAATAAA.AAT
TATTTTAAACATAAATTATTAAAAGATATTATT'ATTAAT'fATAAATTACC
TTCAAAAAA.AA'rGACAAATTCAATGAT'fGAAAA.P.Gp.ATATCATGATCGAT' ~.I -4~J TATTAT'IAA~~TGATTT'."rTAEICTAA.AGTACTCAATT'1'AAATCCAT:'AGAA
AGATT AACAC.~.'TCAAGAAG CTTTAAAACATC-'C:AT'1'T ATTATTGATC~ TTAFr 'rACCACTGATT'rATAAgaaLaagaataagaata~caatgtggagggaggg ggaggttgac:cagtattaagt:ttLatacrctr.taatgatacttLttaatL j' aattttgtt.tats-jtaaacaaectc..c~ttttLtgttaagaaet.gaataCggLt .' ,,: .
', . ...
~.n. . .

taLatagcatcat.ataatttt,ctt,aataggaz~r.ac33aat,aagaataygaa tatgaataataggaatagga.at.agtcataataataatgaaCtgaattggt atatcaacttgacaattaaa.agaatcggtcgtgtagaactgtaaattttcc caaaaaaaaaaagaaaaaaaatcttcaactct.tr.cagaagaagaacactg gaaatcaac:aaagtgtr_aar._cattcaac:eatttaaccatttaactaaccc tcaataatar.ctacatcttgctatt_gaattggaatagattat,cactacat tgtt~tataar.agagaataa~cartatcattatcattatcattatcatta gttttcagaaaagactacacct=tcaattaaatctgtaaatataatcaac.a acatcat~taaaaaaaaaataaaetattgatcacaataaaaacccaataa ,_,-, 10 ttatcaatcr_aattacaatctacatttggacgaaaacaataaat_catc.ta ttaatactatcatttttaaaaccattatagaaacatatatatatatar.at aCar_dc:acacaCaCattatCatacttaCtagcaacCtaCCattatgaatg tatcaactagtgctttaggagtaagaagaagaaaagtaacaacaraaaac attgat.gatyaagaaaattctgcc.gtattaaaat taggaccagaattr_~:a actaaatcaaatcacaaatgatggagaagaacaacaattaattgcattau :.atttatccgaagcaagattatCaattcgagoagcattaaaagaaagaaaa cataataaaaataaaaataaaaccagaaaaaagggaggtaataataataa tagtagtagc:att Aminoacid seauence (S~Q IQ N0:4) L~HLThKFHQHPKYRRCS INS IrIIS PVNALS I Yi~TESYSLCQP~t~CF~YS KS2'NPKRVLTFCP
~EF>KYNNCYr~NF,DSDYILYVNI~Vt~GS~;~GKKYMVLI7LLGSGTFGQrIVKC~NLNNQTVC".P.V
KV I KSKPAYM?VQSL'rEVRLLFFLNANSI3GKNF I R.LLI7TFMHKEHI~CLVF~: T LhSNL~Y~:I.I
KQvQt~~QGLNMKLVKLLTKQLT,DSMAQLKNFQMIHCD1,KPFNILLCQPbKhNI T~V IDFGSA
CF'TRNTIYT'YI~~SRFYRSPEVYLGLPYTESIDMWSLGCI'VGELFLGLPMFPGTSFYNf7Ir KIVDMLGPPPRHMZEVGKNSFrrFFKKKVNTTIWTTNNTVNNNTSFTICPIYFLK.,~,rl~EYCQr LF'fKRc,~K~EC=ATSTT~1NNTNSSSSSNFIHNNNHFCKEQPNKNYx'KFiKL,LKpI I I VYKLF.,STCK
M.TNSMI GL'KF.YHDRLLLTL7F1~'I'KVLNL2JPLERL'rPQEALKHPFI I7VNTTDL
Inactivation of the CaYAK'1 gene was conducted in C, a(bicans strain RM1000 (Lra3b::~imm4341 ura3o::Rimm434 his9~::hisGl hiS~o::hisG; Alonso-Monge et al., 2003) according to the procedures of ~nioe et al. {2000) and Goia et al (2003) Briefly the URA3 and HlS9 markers of pFA-Ura and pFA-His, respectively (Gala ef al., 2003), were amplified using the foJlawing oligonucieotides and standard conditions for amplification Yak1-5p

5'-CAAACAAAACGCAAGAGATCACATACCATTAATAATATATAAGACCAACCAT
TGTAACCACACAAAGTATCACAGTATCACCGACAAATTTATACATAGAAGCTT
GGTACGCTGCAGGTC-3' .:
YaJc 1-3p 3'-TAAACAAAATTAATTAAAAAGTATCATTAAAGAGTATAAAACTTAATACTGGT ~v CAACCTCCCCCTCCCTCCACATTGTTATTC-J-fATTCTTATTCTTCTGATATCAT
CGATGAATTCGAG ~r .
:v .Ii i',.

with the underlined regions corresponding to the pFA plasmids and the non-underlined regions corresponding to regions of the YAKf gene located 5' or 3' of the open reading frame.
The resulting PCR products were used to transform C. albicans RIM1000 cells prepared according to Walther and Wendland (2003). Ura3+ or HIS1+
transformants were selected on appropriate media and the replacement of one copy of the CaYAIC~ gene in these transformants was confirmed by PCR using v= standard procedures. Ura3+ or His+ tran$formants were subsequently transformed by the PCR-amplified NIS9 or Ut?A3 markers, respectively, using the same i technique. Transformants were selected for prototrophy and replacement of the ,.; second YAK7 allele was confirmed by PCR.
The resulting C. albicans ura3/ura~ his~Ihis9 yakt~ ::URA3J~ak7a ::NlS9 strains were tested for their ability to form biofilms in two mr~del of biofim formation on a plastic surtace. The first model is based on the use of a micro-fermentor containing a Thermanoxr~" slide which has been previously described (Garcia-Sanchez et al., 2004). In the second model, ThermanoxT"" slides are incubated at p 37°G in minimal medium in a glass tube under continuous rotation for 2-48h, In both models the C. albicans yak~~,lyakio strains were unable to develop a biofilm of significant biomass_ Yet, observation of the ThermanoxT"" slide obtained using the second hiofilm made! revealed that the mutant strain was able to form ,-:
microcolonies on the pla$tie surface. These micro-color?ies consisted mostly of !
yeast cells with some hyphal or pseudo-hyphal forms {Figure).
The resulting C. albicans ura3lura3 lus9/hisf yak90 ::URA3lyak?o ::HIS?
strains 1 .
were tested for their ability to produce hyphae in Lee's medium (Lee et al,, 1975) which triggers the yeast-to-hypha transition in C. atbieans. As shown in the Figure, ..
in contrast to wild-type C. albicans which readily forms hyphae after a few hours of incubation in Lee's medium, no true hypha was visible with the mutant strain and I, only pseudo-hyphae were observed.
I.
:,-j :, ;.

:f ....
Taken together, these data suggest that the Yak1 kinase is necessary for the w'j switch from yeast-to-hypha growth and for the switch from planktonic to biofilm growth in G. aJblcans.

Ai, W., Bertram, P.G.. Tsang, C.K., Chan, T.F., and Zheng, X.F.S. (202) Regulation of subtelomeric silencing during stress reponse. Molecular Cell 10:
' 1295-13x5, i i 15 Alansa-Mange R, Navarro-Garcia I~, Roman E, Negredo AI, Eisman B, Nombela , C, Pia J. (20x3) Tha Hog1 mitogen-activated protein kinase is essential in the ~' oxidative stress response and chlamydospore formation in Candida albicans.
~i Eukaryot Cell.2(2):351-61.
I i 20 l3ailtie, G.S., and Douglas, L.J, (1999) Candida biofilm and their suceptibility to f antifungal agent. Methods Enzymol310: 644-fi56.
Becksr, P., Hufnagie, W., Peters, G., and Herrmann, M, (2001) Detection of i different gene expression in biofitm-forming versus planktonic population of 25 Staphylococcus aureus using micro-representational-difference analysis.
Appl L..
Enviran Microbiol67: 2958-2985.
c;
Betoin, C.. Valle, J., Latour-Lambent, P., Faure, P., Kzreminski, M., Balestrino, D., Haagensen, J.A.J., Malin, S., Prensier, G., Arbeiile, r~., and Ghigo, J.M.
(20Q4) 30 Global impact of mature biofilm lifstyle on Escherichia coli K-'f 2 gene expression, j. , , Mol N9icrobiol5~f: 659-674.
v' 1.:~
.:.
;:...

i ' ~s 8owen. W.H., Schilling, K., Giertsen, E., Pearson, 5., Lee, S.F., 8leiweis, A., and Seaman, D. {7991) Rafe of a colt surface-associeted protein in adherence and .I
- dentaf caries. Infect lmmun 59: 4604-4609.
Castana, L, Pan, S.J_, Zupancic, M., Hennequin, C., Dujon, B.. and Cc~rmack, B.P.
(2004) Telomere lenghi control and transcriptional regulation of sub-telomeric adhesins in Candida glabrata. Mol Miereabiol: this issue.
Chandra, J., Kuhn, D.M., Mukherjee, P.K., Hoyer, L.L., McCormick, T., and 18 Ghannoum, M.A. (2001 ) Biofilm formation by the fungal pathogen Candida ;,j albieans: Development, architecture, and drug resistance. J 8acteriai 183: 5384-1 5394.
. ' Carmack, B.P., and Falkow, S_ (1999) Efficient homologous and illegitimate ;

recombination in the opportunistic yeast pathogen Candida glabrata_ Genetics '' 151: 979-987. ' r i i i Cormack, B.P., Ghari, N., and Falkow, 5. (1999) An adhesin of the yeast pathogen Candida glabrata mediating adherence to human epithelial cells_ Science 285: I

578-582.
i De las Penas, A., Pan, S.J., Gastano, I., Alder, J., Cregg, R., and Cc~rmack, B.P.

(2403) Virulence-related surface glycaprateins in the yeast pathogen Gandida I:

glabrata are encoded in subtelorneric clusters and subject to RAPS-and SJR-' i dependent transcriptional silencing. Genes pev 17: 2245-2258. E
i:

;.
Danlan, R.M., and Gosterton, J.W. (202) 8iafilms: survival mechanisms of clinical ' relevant microorganisms. Clin Micrabiol Rev 15: 167-193.

Dujon, B., Sherman, D., Fisher, G., Durrens, P.. Casaregola, S., Lafontaine, l., De ;y .

Montigny, J., Marck, C., Neuveglise, C., Talla, E., Goffard, N., Frangeul, ~.., Aigle, :I.
:..
!.
.::.

M_, Anthouard, V., Babour, A., Barbe, V.B., S., Blanchin, S_, Beckerich, J~M., Beyne E, Bieykasten, C., Boisrame, A., Boyer, J., Cattolico, L., Confaniaieri, F., De Daruvar, A., Despons, I-., Fabre, E_, Fairhead, C., Ferry-Dumazet, H., Groppi, A., Hantraye, F., Nennequin, C., Jauniaux, N., Joyet, P., Kachouri, R , Kerrest, A., Kaszui, R., Lemaire, M., Lesur, I., Ma, L., Muller, H., Nicaud, J.M., Nikolski, M., Oztas, S., Ozier-Kalogeropoulos, O., Pellenz. S., Potier, S., Richard, G.F., Straub, M.L_, Suleau, A., Swennen, D., Tekaia, F., Wesolowski-Louvel, M., Westhof, E., Wirth, B., ~eniou-Meyer, M., Zivanovic, L, Bolatin-Fukuhara, M., Thierry, A., Bouchier, C., Caudron, B.. Scarpelli, C., Gaiilardin, C., Weissenbach, J., Wincker, 90 P., and Souciet, J.t_. (2004) Gename evolution in yeasts. Nature 430: 35-44. ;
a ',.i Enloe, 8., A. Diamond, and A. P_ Mitchell. 2000. A single-transformation gene a I function test in diploid Candida albicans. J t3acteriol 182:5730-6.
~:
Fidet, P.L., Cutright, J.L_, Tait, L., and Sobel, J.D. (1996) A murine model of Gandida glabrafa vaginitis. J Infect Leis X73: 425-431.
i Frieman, M.B., McCaffery, J.M., and Cormack, S.P. (2002) Modular domain structure of the Candida glabrata adhesin Epalp, a a1,6 glucan-cross-Unked cell 2Q wall protein. Ma! Microbiol 2: 479-4.92.
i Fraeliger, E.H., and Pives-Taylor, f'. (2001) Streptococcus parasanguis fimbria-assaciated adhesin Fap1 is required for biofilm formation. Infect lrrrmun 69:

2519.
Garcia-Sanchez, S., Aubert, S., Iraqui, I., Janbon, G., Ghigo, J.M., and d'Enfert, C. r, (2004) Transcriptome invariance in biofitm populations of Candida albicans.
.:;
Eukaryot Cell 3: 536-545.
Garret, S., and Broach, J_ (1989) Loss of Ras activity in 5accharomyces cerevisiae is suppressed by disruptions of a new kinase gene, YAKS, whose 1IL41 ..

. .., product rnay act downstream of the CAMP-dependent protein kinase. Genes Dev 3: 1336-1348.
I
Garret, S., Menold, M_M., and Broach, J. (1991) The Saccharomyces cerevisiae YAK1 gene encodes a protein kinase that is induced by arrest early in the cell cycle. Moi Cell Biol 11: 4045-4052.
Green, C.B., Gheng, G., Chandra, J., Mukherjee, P., Ghannoum, M.A., and Hoyer, L.L. (2004) RT-PCR detection al Candida albieans AL5 gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms. Microbiology 150: 267-275.
l ' Cola S, Martin R, Walther A, aunkler A, Wendland J. (2003) New modules for l .
PCR-based gene targeting in Candida atbicans: rapid and efficient gene targeting using 100 by of flanking homology region. Yeast. 20{16):1339-47. t l Griffioen, G., Branduardi, P., l3allarini, A., Anghileri, P., Norbeck, J., Baroni, M.D_, ' l and Ruis, H. (2001) Nueleocytoplasmic distribution of budding yeast protein kinase A regulatory subunit Bcy1 requires Zds1 and its regulated by Yak1-depedent ;
phosphorylatian of its targeting domain. MoI Cell Biol 21; 511-523.
Halme. A., Bumgarner, S., Styles, C., and Fink, G.R~ (2DD4) Genetic and ' epigenetic regulation of the J=LQ gene family generates cell-surface variation in yeast. Cell ~11fi: 405-415.
Hazlett, K.R_, Mazurkiewicz, J.E., and 8anas, J.A. (1999) Inactivation of the gbpA
gene of Sfepfomyces mufans alters strcutural and functional aspects of plaque biofilm which are compensated try recombination of the gffB and gtfC genes.
Infect Immun 6T: 3909-3974. ~.;
Huang, Y. (2002) Transcriptional silencing in Saccharamyees cerevisiae and l.., f..
;,, ,1..

.. .»

SchiZasaccharamyces pambe. Nucleic Acids Res 30: 1465-1482, ..
_ ., Kumamoto, G.A. {2002) Candida biofilms. Curr Opinion Microbial 5: 608-611.
Kuwayama, H., Obara, S., Morio, T., Katoh, M., Urushibara, N., and Tanaka, Y.
(2002) PCRmediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors. Nucleic Acids Res 30: e2.
Lee KL, ~uckley HR, Campbell CC. {1975} An amino acid liquid synthetic medium for the development of mycelial and yeast forms of Candida Albicans, Sabouraudia.l3(2}:148-53.
'; Lustig, A.J. {199$} Mechanisms of silencing in Saceharamyces cerevisiae_ Curr Opinion Gen Dav 8: 233-239.
Mender 5ouza, G., Lu, S., and Kuspa, A, (1998) YakA, a protein kinase required for the transition from growth to development in Dictyostellium. Development 125:
2291-2302.
Moretti, P., Freeman, K., Coodfy, L., and Shore, b. (1994) Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev 8: 2257-2289.
Moriya, H., Shimizu-Yoshida, Y., Ornori, A., Iwashita, S., Katoh, M., and Sakai, A. ~;
{2001 } Yak1 p, a DYRK family kinase, translocates to the nucleus and phosphorylates yeast Pop2p in response to a glucose signal. Ge»es Dev 15: ' 1227~ 1228. '"
Nikawa, H., Nishimura, H., Hamada, T., Kumagai, H,, and Samaranayake, L.P. I;
, (1997) Effects of dietary sugars and, saliva and serum on Candida biafilm .:-: ..
formation on acrylic surfaces. Mycdpathoiagia 't39: 87-91.
i O'Toale, G.A" Pratt, L.A., Watnick, P.I-, Newman, D.K., Weaver, V.B., and Koiter, R. (1999] Genetics approaches to study biofilms. Mefiavds Enzymol 310: 91-109.

Pfaller, M.A., Messer, S.A., Hohis, R.J., Jones, R.N., Doern, G-V., Brandt, M.E., and Hajjeh, R.A_ (1999) Trends in species distribution and susceptibity to fluconasoie among blood stream isolates of Candida species in the United states.
Diagn Micriobiol Infect Dis 33' 217-222.
Philippsen, P., Stotz, A., and Scherf, C. (1991) ONA of Sacetranomyces ' cerevisiae.
' i . Methods Enzymol 194; 169-182.

Prigent-Combaret, C., Prensier, G., Ls Thi, T.T-, Vida(, O., Lejeune, P., and Darel, C. (2000) Development pathway fro biafilm formation in curli-producing Escherichia coli Strains: role of flagella, curli, and colanic acid.
Environ. Mierobiol.

2: 450-464.
n Pryde, F.E., and Louis, E.J. (1999) Limitation of silencing at native yeast telomeres. EMBO J 78: 2538-2550.

I-Ramage, G.. Wicker, B.L., and l.opez-Ribot, .l.!-. (x001) Biofilms of Candida aJbicarrs and their associated resistance to antifungal agent. Am Clirt Lab 20: 42-r :

44.
s Reynolds, T.B., and Fink, G.R. (2001) Baker's yeast, a model for fungal biofilm formation. Science 2g1: 878-88'l.

Sambrook, J., Fritsch, J=.F., and Maniatis, T. ('1989) Molecular clanirrg. A

Laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.

Schembri. M.A., Kjaergaard, K., and Klemm, f~. (2003) Global gene expression in , ::.r ..
,r..

yr 41 1.
Escherichia coti biafifms. Mol Microbiot 48: X53-287, Schmelzle, T., Beck, T., Martin, t~.E., and Hall, M.N. (2004) Activation of the f~ASICyclic AMP Pathway supresses a TC?R deficiency in yeast. Eukaryot Cell 24:
338-351.
Schmitt, M.E., Brown, T.A., and Trumpower, B.f_. {1890) A rapid and simple method for preparation of RNA from Saccharomyces cer~evisiae_ Nucleic Acids Res 18: 3091-3092.
Sherman, F. (1992) Getting started with yeast. In Guide to Yeast Genetics and Molecular Biology. Vol. 194. Guthrie, C, and Fink, G.R. (eds), San Diego,:
Academic Press, pp. 3-2'1.
i.
..
Sherman, F., and Pillus, l.. (1997) An uncertain silence. Trends Genet 13: 308 313. Shin, J_H., Kes, S.J., Shin, M.G., Kim, S.H., Shin, D.H., I-ee, S.K., Suh, S.P., and Ryang, D.W, {2002) l3iofiim productipn by isolates of Candida species ::
recovered from nonneutrpenic patients: Comparison of bloodstream isolates with isolates from other sources. .I Clin Microbiot 40: 1244-1248.
i Stone, E.M., and Pillus, !__ (1996) Activation of an MAP kinase cascade leads to Sir3p hyperphasphorylation and strengthens transcriptional silencing. J Celt Bio1 ~
13~: 5'l1-583.
Stone, E.fu1_, and Piflus, L. (1998) Silent chromatin in yeast; an orchestrated medley featuring Sir3p. BioEssays 20: 30-40.
Sundsirom, P. (1999) Adhesins in Candida aJbicans. Curr Opinion Mierobiol 2.
353-357.
f:
y.
.,;, .
a .i:.~
~._.i.. .
_~..~-.~-._ , _ . .

_: .
d 42 Vazquez, J.A., Sobel, J.D., Peng, G., Steele~Moore, L., Schuman, P., Holloway.
W., and Neaton, J.D. {9999) Evolution of vaginal Candida species recovered from human immunodeficient virus-infected women receiving fluconazole prophylaxis:
the emergence of Candida glabrata? Clin Infecf Dis 28. 1 t)25-1031.
b Walther A, Wendland J. (2803) An improved transformation protocol for the human fungal pathogen Candida albicans. Curr Genet. .4(6):339-43.
Werner-Whashburne, M., Brown, D., and Braun, E. (1991) Beyl, the regulatory subunit of the CAMP-dependent protein kinase in yeast, is differentially modified in reponse to the physiological status of the cell- J Bioi Chem 286: 19704-19709.
16 Whiteley, M., Bangers, M.G., Bumgarner, 1~.E., Parsek, M.R_, Teitzel, G.M., Lory, I
S., and Greenberg, E.P. {2001y Gene expression in Pseudomanas aeruglnosa biofilms. Nafure 413: 864-864.
Although preferred embodiments of the present invention have been ~ _;
described in detail herein and illustrated in the accompanying drawings, it is to be understood that the invention is not limited to these precise embodiments and that j various changes and modifications may be effected therein without departing from the scope or spirit of the present invention.
i:
j:~,.
i::
::I
i ~v

Claims (15)

CLAIMS:

1. A method of screening for a compound that affects biofilm formation of a Candida strain such as Candida glabrata or Candida albicans, said polypeptide or functional derivative thereof being selected from the Candida genes consisting of epa6, epa7, sir4, rif1 and yak1, the method comprising the steps of:
- providing a cell with an initial expression level for said polypeptide or functional derivative thereof;
- contacting said cell with at least one compound to be tested;
- evaluating expression of the polypeptide or functional derivative thereof;
and - identifying the compound that inhibits the initial expression level of said polypeptide or functional derivative thereof in the cell.

2. The method of claim 1, wherein the compound inhibits expression of said polypeptide or functional derivative thereof by down-regulating the transcription of a polynucleotide encoding said polypeptide or by dawn-regulating the translation of said polypeptide.

3. A compound that affects biofilm formation of a Candida strain such as Candida glabrata or Candida albicans obtained by the method as defined in claim 1 or 2.

4. The compound as defined in claim 3, for use as an anti-fungal agent.

5. A composition comprising a compound as defined in claims 3 or 4, and an acceptable carrier.

8. A method for determining the likelihood of a Candida strain of forming a biofilm, comprising the steps of:

a) obtaining a cell of said Candida strain, such as Candida glabrata or Candida albicans; and b) measuring the mRNA level of epa8 and/or epa7 genes in said cell during planktonic growth compared to biofilm growth, wherein overexpression of epa6 and epa7 mRNA respectively during planktonic growth and biofilm growth, is indicative of the capacity of said Candida strain of forming a biofilm.

7. A method for detecting the presence or absence of a Candida biofilm in a sample, comprising the steps of:
a) contacting the sample with a molecule that specifically recognizes a Candida yak1 polypeptide comprising an amino acid sequence substantially similar to SEQ ID NOS: 2 or 4, for a time and under conditions sufficient to form a complex; and b) detecting the presence or absence of the complex formed in a).

8. The method of claim 7, wherein the molecule is an antibody that specifically binds to said yak1 polypeptide.

9. The method of claim 7 or 8, wherein said amino acid sequence is encoded by a nucleotide sequence substantially similar to SEQ ID NOS: 1 or 3.

10. The method of any one of claims 6 to 8, wherein said Candida biofilm consists of Candida glabrata biofilm or Candida albicans.

11. A method for preventing and/or impairing biofilm formation of a Candida strain in a mammal, the method comprising the step of administering to the mammal an effective amount of a composition as defined in claim 5.

12. The method of claim 11, wherein said mammal is a human.

13. The method of claim 11 or 12, wherein said Candida strain consists of Candida glabrata or Candida albicans.

14. Use of at least one Candida genes selected from the group consisting of epa6, epa7, sir4, rif1 and yak1 as a target for identifying a compound capable of impairing biofilm formation of a Candida strain.

15. Use according to claim 14, wherein said Candida strain consists of Candida glabrata or Candida albicans.