CA2412882A1 - Peptide extended glycosylated polypeptides - Google Patents

Abstract

Glycosylated polypeptides comprising the primary structure NH~2-X-P~p-COOH
wherein X is a peptide addition comprising or contributing to a glycosylation site, and P~p is a polypeptide of interest or comprising the primary structure NH~2-P~x-X-P~y-COOH, wherein P~x is an N-terminal part of a polypeptide P~p of interest, P~y is a C-terminal part of said polypeptide P~p, and X is a peptide addition comprising or contributing to a glycosylation site. The glycosylated polypeptides having improved properties as compared to the polypeptide of interest.

Description

PEPTIDE EXTENDED GLYCOSYLATED POLYPEPTIDES
FIELD OF THE INVENTION
The present invention relates to novel glycosylated polypeptides as well as means and methods for their preparation.
BACKGROUND OF THE INVENTION
to Polypeptides, including proteins, are used for a wide range of applications, including industrial uses and human or veterinary therapy.
One generally recognized drawback associated with polypeptides is that they do not have a sufficiently high stability, are immunogenic or allergenic, have a reduced serum half-life, are susceptible to clearance, are susceptible to proteolytic degradation, and the like.
One method for improving properties of polypeptides has been to attach non-peptide moieties to the polypeptide to improve properties thereof. For instance, polymer molecules such as PEG
has been used for reducing immunogenicity and/or increasing serum half-life of therapeutic polypeptides and for reducing allergenicity of industrial enzymes.
Glycosylation has been 2o suggested as another convenient route for improving properties of polypeptides such as stability, half-life, etc.
Machamer and Rose, J. Biol. Chem., 1988, 263, 5948-5954 and 5955-5960, disclose modified glycoprotein G of vesicular stomatitis virus that is glycosylated at additional N-glycosylation sites introduced in the polypeptide backbone.
US 5,218,092 discloses physiologically active polypeptides with at least one new or additional carbohydrate attached thereto. The additional carbohydrate molecules) is/are provided by adding one or more additional N-glycosylation sites to the polypeptide backbone, and expressing the polypeptide in a glycosylating host cell.
US 5,041,376 discloses a method of identifying or shielding epitopes of a transportable protein, in which method an N-glycosylation site is introduced on the exposed surface of the protein baclcbone (using oligonucleotide-directed mutagenesis of the nucleotide sequence encoding the protein), the resulting protein is expressed, glycosylated and assayed for protein activity and for shielded epitopes.
SUBSTITUTE SHEET (RULE 26) WO 00/26354 discloses a method of reducing the allergenicity of proteins by including an additional glycosylation site in the protein backbone and glycosylating the resulting protein variant.
Guan et al., Cell, 1985, Vol. 42, 489-496 disclose glycosylated fusion protein variants comprising a rat growth hormone backbone C-terminally extended with transmembrane and cytoplasmic domains of the vesicular stomatitis virus glycoprotein, which growth hormone backbone has been modified to incorporate two additional N-glycosylation sites.
WO 97/04079 discloses lipolytic enzymes modified to by an N- or C-terminal peptide extension capable of conferring improved performance, in particular wash performance to the enzyme.
Matsuura et al., Nature Biotechnology, 1999, Vol. 17, 58-61 disclose the use of random elongation mutagenesis for improving thermostability of a non-glycosylated microbial catalase.
The random elongation mutagenesis is conducted in the C-terminal end of the catalase.
US 5,338,835, entitled CTP extended forms of FSH, describe the use of the C-terminal portion of the CG beta subunit or a variant thereof for extension of the C-terminal of CG, FSH
and LH. Said C-terminal portion may comprise O-glycosylation sites. It is speculated that a similar approach may be used for other proteins.
US 5,508,261 discloses alpha, beta-heterodimeric polypeptide having binding affinity to vertebrate luteinizing hormone (LH) receptors and vertebrate follicle stimulating hormone (FSH) receptors comprising a glycoprotein hormone alpha-subunit polypeptide and a specified non-naturally occurring beta-subunit polypeptide.
WO 95/05465 discloses EPO analogs which have one or more amino acids extending from the C-terminal end of EPO, the C-terminal extention having at least one additional carbohydrate site. The 28 amino acid C-terminal part of CG (having four O-glycosylation sites) is mentioned as an example.
WO 97/30161 discloses hybrid proteins comprising two coexpressed amino acid sequences forming a dimes, each comprising a) at least one amino acid sequence selected from a homomeric receptor, a chain of a heteromeric receptor, a ligand, and fragments theref; and b) a subunit of a heterodimeric proteinaceous hormone or fragments thereof; in which a) and b) 3o are bonded directly or though a peptide linker, and, in each couple, the two subunits (b) are different and capable of aggregating to form a dimes complex.
In none of the above reference it has been disclosed or indicated that a polypeptide of interest can be modified to include additional glycosylation sites by N-terminally extending SUBSTITUTE SHEET (RULE 26) said polypeptide with a~ peptide sequence comprising one or more additional glycosylation sites. The present invention is based on this finding.
BRIEF DESCRIPTION OF THE INVENTION
Accordingly, in a first aspect the invention relates to a glycosylated polypeptide comprising the primary structure, NH2-X-Pp-COOH
wherein X is a peptide addition comprising or contributing to a glycosylation site, and Pp is a polypeptide of interest.
The introduction of additional glycosylation sites by means of a peptide addition is an elegant way of providing additional glycosylation sites in a polypeptide of interest. More specifically, the invention has the advantage that polypeptides with altered glycosylation pattern are more easily obtained, e.g. the variants can be designed without detailed knowledge or use of structural and/or functional properties of the polypeptide. Also, the utilization of glycosylation sites introduced by a peptide addition has been found to be improved relative to glycosylation sites introduced within a structural part of the polypeptide Pp.
Also other properties of the peptide extended polypeptide, such as uptake in specific cells, may be improved relative to a polypeptide modified with glycosylation sites in a structural part (and not being subjected to peptide extension).
In a second aspect the invention relates to a glycosylated polypeptide comprising the primary structure NH2-PX X-Py-COOH, wherein PX is an N-terminal part of a polypeptide Pp of interest, Py is a C-terminal part of said polypeptide Pp, and X is a peptide addition comprising or contributing to a glycosylation site.
In other aspects the invention relates to a nucleotide sequence encoding a polypeptide of the invention, an expression vector comprising said nucleotide sequence and methods of preparing a polypeptide of the invention.
SUBSTITUTE SHEET (RULE 26) In a further aspect the invention relates to a method of improving (a) selected property/ies of a polypeptide Pp of interest, which method comprises a) preparing a nucleotide sequence encoding a polypeptide comprising the primary structure NHZ-X-Pp-COOH, wherein X is a peptide addition comprising or contributing to a glycosylation site, the peptide addition being capable of conferring the selected improved property/ies to the polypeptide Pp, b) expressing the nucleotide sequence of a) in a suitable host cell under conditions ensuring attachment of an oligosaccharide moiety thereto, optionally c) conjugating the expressed polypeptide of b) to a second non-peptide moiety, and d) recovering the polypeptide resulting from step c).
DRAWINGS
Figure 1 is a dosis response curve for uptake of glucocerebrosidase wildtype and modified according to the invention into J774E macrophages. The activity is measured by the GCB
activity assay.
Figure 2 illustrates the pharmakokinetics of a FSH polypeptide produced according to the invention.
DETAILED DISCLOSURE OF THE INVENTION
DEFINTTIONS
In the context of the present application and invention the following definitions apply:
The term "conjugate" is used about the covalent attachment of of one or more polypeptide(s) to one or more non-peptide moieties. The term covalent attachment means that the polypeptide and the non-peptide moiety are either directly covalently joined to one another, or else are indirectly covalently joined to one another through an intervening moiety or moieties, such as a bridge, spacer, or linkage moiety or moieties.
The term "non-peptide moiety" is intended to indicate a molecule, different from a peptide polymer composed of amino acid monomers and linked together by peptide bonds, SUBSTITUTE SHEET (RULE 26) S
which molecule is capable of conjugating to an attachment group of the polypeptide of the invention. Preferred examples of such molecule include polymers, e.g.
polyalkylene oxide moieties lipophilic groups, e.g. fatty acids and ceramides. The term "polymer molecule" is defined as a molecule formed by covalent linkage of two or more monomers and may be used interchangeably with "polymeric group". Except where the number of non-peptide moieties, such as polymeric groups, attached to the polypeptide is expressly indicated, every reference to "non-peptide moiety " referred to herein is intended as a reference to one or more non-peptide moieties attached to the polypeptide.
The term "oligosaccharide moiety" is intended to indicate a carbohydrate-containing molecule to comprising one or more monosaccharide residues, capable of being attached to the polypeptide (to produce a glycosylated polypeptide) by way of ih vivo or ifZ vitro glycosylation. Except where the number of oligosaccharide moieties attached to the polypeptide is expressly indicated, every reference to "oligosaccharide moiety" referred to herein is intended as a reference to one or more such moieties attached to the polypeptide.
The term "ifz vivo glycosylation" is intended to mean any attachment of an oligosaccharide moiety occurring ire vivo, i.e. during posttranslational processing in a glycosylating cell used for expression of the polypeptide, e.g. by way of N-linked and O-linlced glycosylation. Usually, the N-glycosylated oligosaccharide moiety has a common basic core structure composed of five monosaccharide residues, namely two N-acetylglucosamine residues and three mannose residues. The exact oligosaccharide structure depends, to a large extent, on the glycosylating organism in question and on the specific polypeptide. Depending on the host cell in question the glycosylation is classified as a high mannose type, a complex type or a hybrid type. The term "if2 vitro glycosylation" is intended to refer to a synthetic glycosylation performed ifa vitro, normally involving covalently linking an oligosaccharide moiety to an attachment group of a polypeptide, optionally using a cross-linlung agent. In vivo and ih vitro glycosylation are discussed in detail further below.
An "N-glycosylation site" has the sequence N-X'-S/T/C-X", wherein X' is any amino acid residue except proline, X" any amino acid residue that may or may not be identical to X' and preferably is different from proline, N asparagine and S/T/C either serine, threonine or 3o cysteine, preferably serine or threonine, and most preferably threonine.
The oligosaccharide moiety is attached to the N-residue of such site. An "O-glycosylation site" is the OH-group of a serine or threonine residue. An "i~z vitro glycosylation site" is, e.g., selected from the group consisting of the N-terminal amino acid residue of the polypeptide, the C-terminal residue of the polypeptide, lysine, cysteine, arginine, glutamine, aspartic acid, glutamic acid, serine, SUBSTITUTE SHEET (RULE 26) tyrosine, histidine, phenylalanine and tryptophan. Of particular interest is an in vitro glycosylation site that is an epsilon-amino group, in particular as part of a lysine residue.
The term "peptide addition" is intended to indicate one or more consecutive amino acid residues that are added to the amino acid sequence of the polypeptide Pp of interest. Normally, the peptide addition is linked to the amino acid sequence of the polypeptide Pp by a peptide linkage.
The term "attachment group" is intended to indicate a functional group of the polypeptide, in particular of an amino acid residue thereof or an oligosaccharide moiety attached to the polypeptide, capable of attaching a non-peptide moiety of interest. Useful to attachment groups and their matching non-peptide moieties are apparent from the table below.
AttachmentAmino acidExamples of non-Conjugation Reference group peptide moiety method/Activate d PEG

-NH2 N-terminal,Polymer, e.g. mPEG-SPA Shearwater PEG, Inc.

Lys with amide or Tresylated Delgado et imine al, group mPEG critical reviews in Therapeutic Drug Carner Lipophilic Systems substituent 9(3,4):249-304 (1992) -COOH C-term, Polymer, e.g. mPEG-Hz Shearwater Asp, PEG, Inc Glu with ester or amide group -SH Cys Polymer, e.g. PEG- Shearwater PEG, Inc with disulfide, vinylsulphoneDelgado et al, maleimide or PEG-maleimidecritical vinyl reviews sulfone group in Therapeutic, Drug Carrier Systems 9(3,4):249-304 (1992) -OH Ser, Thr, PEG with ester, OH-, Lys ether, carbamate, carbonate -CONH~

Polymer, e.g.
PEG

Aldehyde Oxidized Polymer, e.g. PEG-hydrazideAndresz et PEG, al., Ketone oligosacchari 1978, SUBSTITUTE SHEET (RULE 26) de Makromol.

Chem.

179:301, WO

92/16555, WO

The term "comprising an attachment group" is intended to mean that the attachment group is present on an amino acid residue of the relevant peptide or polypeptide or on an oligosaccharide moiety attached to said peptide or polypeptide.
The term "contributing to a glycosylation site" as used in connection with the peptide addition X is intended to cover the situation, where a glycosylation site is formed from more than one amino acid residue (as is the case with an N-glycosylation site), and where at least one such amino acid residue originates from the peptide X and at least one amino acid residue to originates from the polypeptide Pp, whereby the glycosylation site can be considered to bridge X and Pp (or, where relevant, PX or Py).
The term "non-structural part" as used about a part of the polypeptide Pp of interest is intended to indicate a part of either the C- or N-terminal end of the folded polypeptide (e.g.
protein) that is outside the first structural element, such as an a-helix or a (3-sheet structure.
The non-structural part can easily be identified in a three-dimensional structure or model of the polypeptide. If no structure or model is available, a non-structural part typically comprises or consists of the first or last 1-20 (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,.17, 18, 19 or 20) amino acid residues, such as 1-10 amino acid residues of the amino acid sequence constituting the mature form of the polypeptide of interest.
Amino acid names and atom names (e.g. CA, CB, NZ, N, O, C, etc) are used as defined by the Protein DataBank (PDB) (www.pdb.org) which are based on the ILTPAC
nomenclature (IUPAC Nomenclature and Symbolism for Amino Acids and Peptides (residue names, atom names e.t.c.), Eur. J. Bioche»z.,138, 9-37 (1984) together with their corrections in Eur. J.
Biochezzz., 152, 1 (1985). The term "amino acid residue" is intended to indicate an amino acid residue contained in the group consisting of alanine (Ala or A), cysteine (Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), lysine (Lys or K), leucine (Leu or L), methionine (Met or M), asparagine (Asn or N), proline (Pro or P), glutamine (Gln or Q), arginine (Arg or R), serine (Ser or S), threonine (Thr or T), valine (Val or V), tryptophan (Trp or W), and 3o tyrosine (Tyr or Y) residues. The terminology used for identifying amino acid SUBSTITUTE SHEET (RULE 26) positions/mutations is illustrated as follows: A15 (indicates an alanine residue in position 15 of the polypeptide), A15T (indicates replacement of the alanine residue in position 15 with a threonine residue), A15[T/S] (indicates replacement of the alanine residue in position 15 with a threonine residue or a serine residue). Multiple substitutions are indicated with a "+", e.g.
A15T+F57S means an amino acid sequence which comprises a substitution of the alanine residue in position 15 for a threonine residue and a substitution of the phenylalanine residue in position 57 for a serine residue.
The term "nucleotide sequence" is intended to indicate a consecutive stretch of two or more nucleotides. The nucleotide sequence can be of genomic, cDNA, RNA, semisynthetic, 1o synthetic origin, or any combinations thereof.
"Cell", "host cell", "cell line" and "cell culture" are used interchangeably herein and all such terms should be understood to include progeny resulting from growth or culturing of a cell. "Transformation" and "transfection" are used interchangeably to refer to the process of introducing DNA into a cell.
"Operably linked" refers to the covalent joining of two or more nucleotide sequences in such a manner that the normal function of the sequences can be performed. For example, the nucleotide sequence encoding a presequence or secretory leader is operably linked to a nucleotide sequence for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if 2o it affects the transcription of the sequence.
"Introduction" or "removal" of a glycosylation site or an attachment group for a non-peptide moiety is normally achieved by introducing or removing an amino acid residue comprising or contributing to such site or group to/from the relevant amino acid sequence, conveniently by suitable modification of the encoding nucleotide sequence. For instance, when an N-glycosylation site is to be introduced/removed this can be done by introducing/removing a codon for the amino acid residues) required for a functional N-glycosylation site. When an attachment group for a PEG molecule is to be introduced/removed, it will be understood that this be done by introducing/removing a codon for an amino acid residue, e.g. a lysine residue, comprising such group tolfrom the encoding nucleotide sequence. The term "introduce" is 3o primarily intended to include substitution of an existing amino acid residue, but can also mean insertion of additional amino acid residue. The term "remove" is primarily intended to include substitution of the amino acid residue to be removed for another amino acid residue, but can also mean deletion (without substitution) of the amino acid residue to be removed.
SUBSTITUTE SHEET (RULE 26) The term "epitope" is used in its conventional meaning to indicate one or more amino acid residues) displaying specific 3D and/or charge characteristics at the surface of the polypeptide, which is/are capable of giving rise to an immune response in a mammal and/or specifically binding to an antibody raised against said epitope or which is/are capable of giving rise to an allergic response.
The term "unshielded epitope" is intended to indicate that the epitope is not shielded and therefore has the above properties. The term "shielded epitope" is intended to indicate that the non-peptide moiety shields, and thus inactivates the epitope, whereby it is no longer capable of giving rise to any substantial immune response in a mammal, e.g.
due to 1o inappropriate processing and/or presentation in the antigen presenting cells, andlor of reacting with an antibody raised against the unshielded epitope. The shielding should thus be effective in both the naive mammal and mammals that already produce antibodies reacting with the unshielded epitope.
The degree of shielding of epitopes can be determined as reduced immunogenicity and/or reduced antibody reactivity and/or reduced reactivity with monoclonal antibodies raised against the epitope(s) in question using methods known in the art. The degree of shielding of allergenic epitopes can be determined, e.g., as described in WO 00/26354.
The term "reduced" as used about an immunogenic or allergic response is intended to indicate that a given molecule gives rise to a measurably lower immune or allergic response 2o than a reference molecule, when determined under comparable conditions.
Preferably, the relevant response is reduced by at least 25%, such as at least 50%, such as preferably by at least 75%, such as by at least 90% or even at least 100%.
The term "serum half. life" is used in its normal meaning, i.e. the time in which half of the relevant molecules circulate in the plasma or bloodstream prior to being cleared.
Alternatively used terms include "plasma half-life", "circulating half-life", "serum clearance", "plasma clearance" and "clearance half life". The term "functional ih vivo half-life" is the time in which 50% of a given function (such as biological activity) of the relevant molecule is retained, when tested in vivo (such as the time at which 50% of the biological activity of the molecule is still present in the body/target organ, or the time at which the activity of the 3o polypeptide is 50% of the initial value). The molecule is normally cleared by the action of one or more of the reticuloendothelial systems (RES), kidney (e.g. by glomerular filtration), spleen or liver, or receptor-mediated elimination, or degraded by specific or unspecific proteolysis.
Normally, clearance depends on size or hydrodynamic volume (relative to the cut-off for glomerular filtration), shape/rigidity, charge, attached carbohydrate chains, and the presence of SUBSTITUTE SHEET (RULE 26) cellular receptors for the molecule. The term "increased" as used about serum half-life or functional ifi vivo half life is used to indicate that the relevant half life of the relevant molecule is statistically significantly increased relative to that of the reference molecule as determined under comparable conditions. For instance, the relevant half life is increased by at least 25%, 5 such as by at least 50%, by at least 100% or by at least 1000%.
The term "function" is intended to indicate one or more specific functions of the polypeptide of interest and is to be understood qualitatively (i.e. having a similar function as the polypeptide of interest) and not necessarily quantitatively (i.e. the magnitude of the function is not necessarily similar). Typically, a given polypeptide has many different to functions, examples of which are given further below in the section entitled "Screening for or measurement of function". For therapeutically useful polypeptides an important "function" is biological activity, e.g. in vitro or in vivo bioactivity. For enzymes, an important function is biological activity such as catalytic activity.
The interchangeably used terms "measurable function" and "functional" are intended to indicate that the relevant function (preferably reflecting the intended use) of a polypeptide of the invention is above detection limit when measured by standard methods known in the art, e.g. as an in vitro bioactivity and/or in vivo bioactivity. For instance, if the polypeptide is a hormone and the function of interest is the hormone's affinity towards a specific receptor a measurable function is defined to be a detectable affinity between the hormone modified in 2o accordance with the invention and the receptor as determined by the normal methods used for measuring such affinity. If the polypeptide is an enzyme and a function of interest is the catalytic activity a measurable function is the enzyme's ability to catalyze a reaction involving the normal substrates for the enzyme as measured by the normal methods for determining the enzyme activity in question. Typically, if not otherwise stated herein, a measurable function is at least 2%, such as at least 5% of that of the unmodified polypeptide Pp, as determined under comparable conditions, e.g. in the range of 2-1000%, such as 2-500% or 2-100%, such as 5-100% of that of the unmodified polypeptide.
The term "functional site" is intended to indicate one ox more amino acid residues which is/are essential for or otherwise involved in the function or performance of the polypeptide, i.e. the amino acid residues) that mediates) a desired biological activity of the polypeptide Pp. Such amino acid residues are "located at" the functional site.
For instance, the functional site can be a binding site (e.g. a receptor-binding site of a hormone or growth factor or a ligand-binding site of a receptor), a catalytic site (e.g. of an enzyme), an antigen-binding site (e.g. of an antibody), a regulatory site (e.g. of a polypeptide subject to regulation), or an SUBSTITUTE SHEET (RULE 26) interaction site (e.g. for a regulatory protein or an inhibitor). The functional site can be determined by methods known in the art and is conveniently identified by analysing a three-dimensional or model structure of the polypeptide complexed to a relevant ligand.
The term "polypeptide" is intended to indicate any structural form (e.g. the primary, secondary or tertiary form (i.e. protein form)) of an amino acid sequence comprising more than 5 amino acid residues, which may or may not be post-translationally modified (e.g. acetylated, carboxylated, phosphorylated, lipidated, or acylated). The interchangeably used terms "native"
and "wild-type" are used about a polypeptide which has an amino acid sequence that is identical to one found in nature. The native polypeptide is typically isolated from a naturally 1o occurring source, in particular a mammalian or microbial source, such as a human source, or is produced recombinantly by use of a nucleotide sequence encoding the naturally occurring amino acid sequence. The term "native" is intended to encompass allelic variants of the polypeptide in question. A "variant" is a polypeptide, which has an amino acid sequence that differs from that of a native polypeptide in one or more amino acid residues.
The variant is typically prepared by modification of a nucleotide sequence encoding the native polypeptide (e.g. to result in substitution, deletion or truncation of one or more amino acid residues of the polypeptide or by introduction (by addition or insertion) of one or more amino acid xesidues into the polypeptide) so as to modify the amino acid sequence constituting said native polypeptide. A "fragment" is a part of a parent native or variant polypeptide, typically differing 2o from such parent in one or more removed C-terminal or N-terminal amino acid residues or removal of both types of such residues. Normally, the variant or fragment has retained at least one of the functions of the corresponding parent polypeptide (e.g. a biological function such as enzyme activity or receptor binding capability). Normally, the polypeptide Pp is a full length protein or a variant or fragment thereof.
The term "antibody" includes single monoclonal antibodies (including agonist and antagonist antibodies) and antibody compositions with polyepitopic specificity (also termed polyclonal antibodies).
The term "monoclonal antibody" is used in its conventional meaning to indicate a population of substantially homogeneous antibodies. The individual antibodies comprised in 3o the population have identical binding affinities and vary structurally only to a limited extent.
Monoclonal antibodies are highly specific, being directed against a single epitope.
Furthermore, in contrast to conventional (polyclonal) antibody preparations that typically include different antibodies directed against different epitopes, each monoclonal antibody is SUBSTITUTE SHEET (RULE 26) directed against a single epitope on the antigen. The antibody to be modified is preferably a human or humanized monoclonal antibody.
"Antibody fragment" is defined as a portion of an intact antibody comprising the antigen binding site or the entire or part of the variable region of the intact antibody, wherein the portion is free of the constant heavy chain domains (i.e. CH2, CH3, and CH4, depending on antibody isotype) of the Fc regions of the intact antibody. Examples of antibody fragments include Fab, Fab', Fab'-SH, F(ab')2, and Fv fragments; diabodies; any antibody fragment that is a polypeptide having a primary structure consisting of one uninterrupted sequence of contiguous amino acid residues (which may also be termed a single chain antibody fragment or 1o a single chain polypeptide). ' Polypeptide of the invention In its first aspect the invention relates to a glycosylated polypeptide comprising the primary structure, NH2-X-Pp-COOH, wherein X is a peptide addition comprising or contributing to a glycosylation site, and Pp is a polypeptide of interest.
In one embodiment the polypeptide consists essentially of or consists of a polypeptide with the primary structure NH2-X-Pp-COOH.
The peptide addition according to this aspect is preferably one, which has less than 90%
identity to a native full length protein. The identity is determined on the basis of an alignment of the peptide addition to the entire amino acid sequence of the full length native protein, the alignment being made to ensure the highest possible degree of identity between amino acid residues. For instance, the program CLUSTALW version 1.74 using default parameters (Thompson et al., 1994, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, Nucleic Acids Research, 22:4673-4680) can be used.
Usually, the peptide addition is fused to the N-terminal end of the polypeptide Pp as reflected in the above shown structure so as to provide an N-terminal elongation of the polypeptide Pp. However, it is also possible to insert the peptide addition within the amino acid sequence of the polypeptide Pp. This is reflected in the polypeptide according to the second SUBSTITUTE SHEET (RULE 26) aspect of the invention, wherein the polypeptide comprises the primary structure NHZ-PX X-Py-COOH, wherein PX is an N-terminal part of a polypeptide Pp of interest, Py is a C-terminal part of said polypeptide Pp, and X is a peptide addition comprising or contributing to a glycosylation site.
In one embodiment the polypeptide consists essentially of or consists of a polypeptide with the primary structure NH2-PX X-Py-COOH.
In order to minimize structural changes effected by the insertion of the peptide addition within the sequence of the polypeptide Pp, it is desirable that it be inserted in a non-structural to part thereof. For instance, PX is a non-structural N-terminal part of a mature polypeptide Pp, and Py is a structural C-terminal part of said mature polypeptide, or PX is a structural N-terminal part of a mature polypeptide Pp, and Py is a non-structural C-terminal part of said mature polypeptide. Preferably, when the glycosylation site to be introduced is an N-glycosylation site, Px is a non-structural N-terminal part since, in general, the best N-glycosylation is obtained in the N-terminal part of a polypeptide.
When the peptide addition comprises only few amino acid residues, e.g. 1-5 such as 1-3 amino acid residues, and in particular 1 amino acid residue, the peptide addition can be inserted into a loop structure of the polypeptide Pp and thereby elongate said loop.
When the peptide addition is constituted by one amino acid residue it will be understood that this is selected so as 2o to ensure that a functional glycosylation site is introduced.
Polypeptides of the invention are glycosylated polypeptides. Normally, the peptide addition part of the polypeptide of the invention has attached at least one oligosaccharide moiety. The polypeptide Pp part of the polypeptide may or may not have attached at least one oligosaccharide moiety. Glycosylation can be achieved as described in the section entitled "Glycosylation"
Preferably, the polypeptide of the invention has properties such as size, charge, molecular weight and/or hydrodynamic volume that are sufficient to reduce or escape clearance by any of the clearance mechanisms disclosed herein, in particular renal clerance. Such properties are, e.g., determinable by the nature and number of oligosaccharide and second non-peptide moieties attached thereto. Tn one embodiment, the polypeptide of the invention has a molecular weight of at least 67 kDa, in particular at least 70 lcDa as measured by SDS-PAGE
according to Laemmli, U.K., Nature Vol 227 (1970), p680-85. This is of particular relevance when the polypeptide of interest is a therapeutically useful protein, the functional in vivo half-life of which is to be prolonged. A molecular weight of at least 67 kDa is obtainable by SUBSTITUTE SHEET (RULE 26) introduction of a sufficient number of glycosylation sites to obtain a glycosylated polypeptide with such Mw, or by conjugating the glycosylated polypeptide to a sufficient number and type of a second non-peptide moiety to obtain such Mw. For instance, for a glycosylated polypeptide of interest having a molecular weight of at least 25 kDa linked to a peptide addition of 2 kDa, the combined extended polypeptide having at least two PEG-attachment groups, conjugation to two or more PEG molecules each having a molecular weight of 20 kDa results in a total molecular weight of at least 67 kDa.
Preferably, the polypeptide of the invention has at least one of the following properties relative to the polypeptide Pp, the properties being measured under comparable conditions:
ire vitro bioactivity which is at least 25%, such as at least 30% or at least 45% of that of the polypeptide Pp as measured under comparable conditions, increased affinity for a mannose receptor, a mannose-6-phosphate receptor or other carbohydrate receptors, increased serum half life, increased functional in vivo half-life, reduced renal clearance, reduced immunogenicity, increased resistance to proteolytic cleavage, improved targeting to lysosomes, macrophages and/or other subpopulations of human cells, improved stability in production, improved shelf life, improved formulation, e.g. liquid formulation, improved purification, improved solubility, and/or improved expression.
Improved properties are determined by conventional methods known in the art for determining such properties. The improvement is of a magnitude that is within detection limits.
Improved affinity for or uptake by the mannose receptor is expected to result in increased uptake in phagocytic cells, preferably monocytes, macrophages (e.g. Kupffer cells, glia/mikroglia, alveolar phagocytes, reticulum cells, or other peripheral macrophages) or macrophage like cells (for instance osteoclasts, dendritic cells, or astrocytes) in increased uptake of the polypeptide in phagocytic cells (e.g. macrophages). This is of particular relevance when the polypeptide of interest is one for which such uptake is required for the polypeptide to exert its biological activity. Such polypeptide is e.g. an antigen intended for use for vaccine purposes or a lysosomal enzyme.
Polypeptide of interest The present invention can be applied broadly. Thus, the polypeptide of interest can have any function and be of any origin. Accordingly, the polypeptide can be a protein, in particular a mature protein or a precursor form thereof or a functional fragment thereof that essentially has retained a biological activity of the mature protein. Furthermore, the polypeptide can be an SUBSTITUTE SHEET (RULE 26) oligopeptide that contains in the range of 30 to 4500 amino acids, preferably in the range of 40 to 3000 amino acids.
The polypeptide can be a native polypeptide or a variant thereof. For instance, the polypeptide is a variant that comprises at least one introduced and/or at least one removed glycosylation site as compared to the corresponding native polypeptide. The variant has retained at least one function of the corresponding native polypeptide, in particular a biological activity thereof.
The polypeptide can be a therapeutic polypeptide useful in human or veterinary therapy, i.e. a polypeptide that is physiologically active when introduced into the circulatory 1o system of or otherwise administered to a human or an animal; a diagnostic polypeptide useful in diagnosis; or an industrial polypeptide useful for industrial purposes, such as in the manufacture of goods wherein the polypeptide constitutes a functional ingredient or wherein the polypeptide is used for processing or other modification of raw ingredients during the manufacturing process.
The polypeptide can be of mammalian origin, e.g. of human, porcine, ovine, urcine, murine, rabbit, donkey, or bat origin, of microbial origin, e.g. of fungal, yeast or bacterial origin, or can be derived from other sources such as venom, leech, frog or mosquito origin.
Preferably, the industrial polypeptide of interest is of microbial origin and the therapeutic polypeptide of human origin.
2o Specific examples of groups of polypeptides to be modified according to the invention include: an antibody or antibody fragment, an irnmunoglobulin or immunoglobulin fragment, a plasma protein, an erythrocyte or thrombocyte protein, a cytol~ine, a growth factor, a profibrinolytic protein, a binding protein, a protease inhibitor, an antigen, an enzyme, a ligand, a receptor, or a hormone. Of particular interest is a polypeptide that mediates its biological effect by binding to a cellular receptor, when administered to a patient. The antibody can be a polyclonal or monoclonal antibody, and can be of any origin including human, rabbit and murine origin. Preferably, the antibody is a human or humanized monoclonal antibody.
Immunoglobulins of interest include IgG, TgE, IgM, IgA, and IgD and fragments thereof, e.g.
Fab fragments. Specific antibodies and fragments thereof are those reactive with any of the 3o proteins mentioned immediately below.
The non-antibody polypeptide of interest can be i) a plasma protein, e.g. a factor from the coagulation system, such as Factor VII, Factor VIII, Factor IX, Factor X, Factor XIII, thrombin, protein C, antithrombin III or heparin co-factor II, Tissue factor inhibitor (e.g. 1 or 2), endothelial cell surface protein C receptor, a factor from the fibrinolytic system such as pro-SUBSTITUTE SHEET (RULE 26) urokinase, urokinase, tissue plasminogen activator, plasminogen activator inhibitor 1 (PAI-1) or plasminogen activator inhibitor 2 (PAI-2), the Von Willebrand factor, or an a-1-proteinase inhibitor, ii) a erythrocyte or thrombocyte protein, e.g. hemoglobin, thrombospondin or platelet factor 4, iii) a cytokine, e.g. an interleukin such as IL-1 (e.g. IL-la or 1L-1(3), IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-11, lL-12, TL,-13, IL-15, 1L.-16, IL-17, IL-18,1L-19, IL-20, IL-21, IL-22, IL-23, a cytokine-related polypeptide, such as IL-lRa, an interferon such as interferon-a, interferon-(3 or interferon-'y, a colony-stimulating factor such as GM-CSF or G-CSF, stem cell factor (SCF), a binding protein, a member of the tumor necrosis factor family (e.g TNF-oc, lymphotoxin-a, lymphotoxin-Vii, FasL, CD40L, CD30L, CD27L, Ox40L, 4-1BBL, RANKL, 1o TRAIL, TWEAK, LIGHT, TRANCE, APRIL, THANK or TALL-1), iv) a growth factor, e.g platelet-derived growth factor (PDGF), transforming growth factor a (TGF-a), transforming growth factor (3 (TGF-(3), epidermal growth factor (EGF), vascular endothelial growth factor (VEGF), somatotropin (growth hormone), a somatomedin such as insulin-like growth factor I
(IGF-I) or insulin-like growth factor II (IGF-II), erythropoietin (EPO), thrombopoietin (TPO) or angiopoietin, v) a profibrinolytic protein, e.g. staphylokinase or streptokinase, vi) a protease inhibitor, e.g. aprotinin or CI-2A, vii) an enzyme, e.g. superoxide dismutase, catalase, uricase, bilirubin oxidase, trypsin, papain, asparaginase, arginase, arginine deiminase, adenosin deaminase, ribonuclease, alkaline phosphatase, (3-glucuronidase, purine nucleoside phosphorylase or batroxobin, viii) an opioid, e.g. endorphins, enkephalins or non-natural opioids, ix) a hormone or neuropeptide, e.g. insulin, calcitonin, glucagons, adrenocorticotropic hormone (ACTH), somatostatin, gastrins, cholecystokinins, parathyroid hormone (PTH), luteinizing hormone (LH), follicle-stimulating hormone (FSH), gonadotropin-releasing hormone, chorionic gonadotropin, corticotropin-releasing factor, vasopressin, oxytocin, antidiuretic hormones, thyroid-stimulating hormone, thyrotropin-releasing hormone, relaxin, glucagon-like peptide 1 (GLP-1), glucagon-like peptide 2 (GLP-2), prolactin, neuropeptide Y, peptide YY, pancreatic polypeptide, leptin, orexin, CART (cocaine and amphetamine regulated transcript), a CART-related peptide, melanocortins (melanocyte-stimulating hormones), melanin-concentrating hormone, natriuretic peptides, adrenomedullin, endothelin, exendin, secretin, amylin (IAPP;islet amyloid polypeptide precursor), vasoactive intestinal peptide (VlP), pituitary adenylate cyclase activating polypeptide (PACAP), agouti and agouti-related peptides or somatotropin-releasing hormones, or x) another type of protein or peptide such as thymosin, bombesin, bombesin-like peptides, heparin-binding protein, soluble CD4, SUBSTITUTE SHEET (RULE 26) pigmentary hormones, hypothalamic releasing factor, malanotonins, phospholipase activating protein, a detoxifying enzyme such as acyloxyacyl hydrolase, or an antimicrobial peptide.
One group of polypeptides of particular interest in the present invention is selected from the group of lysosomal enzymes (as defined in US 5,929,304) such as those responsible for or otherwise involved in a lysosomal storage disease, i.e. enzymes that have a therapeutical effect on patients with a lysosomal storage disease. Such enzymes, e.g.
include glucocerebrosidase, a-L-iduronidase, acid oc-glucosidase, a-galactosidase, acid sphingomyelinase, galactocerebrosidase, arylsulphatase A, sialidase, and hexosaminidase.
Also, other proteins involved in lysosomal storage diseases such as Saposin A, B, C or D
to (Nakano et al., J. Biochem. (Tokyo) 105, 152-154, 1989; Gavrieli-Rorman and Grabowski, Genomics 5, 486-492, 1989) can be modified as described herein. Preferably, these polypeptides are of human origin.
The present inventors have shown that providing such enzymes with additional N-linked oligosaccharide moieties considerably improve properties thereof, such as stability, targeting, expression, and in vivo activity and targeting. Accordingly, in one embodiment the polypeptide of the invention is a glycosylated lysosomal enzyme comprising a peptide addition comprising or contributing to a glycosylation site.
The industrial polypeptide is typically an enzyme, in particular a microbial enzyme, and can be used in products or in the manufacture of products such as detergents, household 2o articles, personal care products, agrochemicals, textile, food products, in particular bakery products, feed products, or in industrial processes such as hard surface cleaning. The industrial polypeptide is normally not intended for internal administration to humans or animals. Specific examples include hydrolases, such as proteases, lipases or cutinases, oxidoreductases, such as lactase and peroxidase, transferases such as transglutaminases, isomerases, such as protein disulphide isomerase and glucose isomerase, cell wall degrading enzymes such as cellulases, xylanases, pectinases, mannanases, etc., amylolytic enzymes such as endoamylases, e.g. alpha-amylases, or exo-amylases, e.g. beta-amylases or amyloglucosidases, etc.
Further specific examples are those listed in WO 00/26354, the contents of which are incorporated herein by reference. Normally, an enzyme modified according to the present invention has one or more 3o improved properties selected from the group consisting of increased stability (in particular against proteolytic degradation or thermal degradation) leading to, e.g., improved shelf life and improved performance in use; improved production, e.g. in terms of improved expression (e.g.
as a consequence of improved secretion and/or increased stability of the expressed enzyme) SUBSTITUTE SHEET (RULE 26) 1$
and improved purification, decreased allergenicity, increased activity in the relevant industrial process in which it is used, and improved properties with respect to immobilization.
When the polypeptide Pp is an industrial enzyme the N-terminal peptide addition may comprise or contribute to a glycosylation site. However, it is also within the scope of the present invention to provide a polypeptide comprising an industrial enzyme arid a C-terminal or N-terminal peptide addition comprising an attachment group for a second non-peptide moiety being a polymer, e.g. PEG. The peptide addition may or may not comprise a glycosylation site. The peptide addition is preferably as described herein.
For instance, such attachment group can be provided by a lysine or cysteine residue.
In one embodiment the polypeptide of the invention comprises a personal care enzyme (i.e. an enzyme useful for personal care applications), which polypeptide is incapable of passing the mucous membrane of a mammal in particular a human exposed to the polypeptide.
Thereby, allergenicity can be reduced or avoided. Furthermore, stability of such enzyme can be increased. The polypeptide according to this embodiment comprises an N-terminal or C-terminal peptide addition comprising or contributing to a glycosylation site and/or an attachment group for a second non-peptide moeity, e.g. a polymer such as PEG.
In another embodiment the polypeptide comprises a lipase as disclosed in WO
97/04079, in particular a Humicola lanugiuosa lipase, wherein the N- or C--terminal peptide addition comprises a glycosylation site and/or at least one attachment group for a second non-2o peptide moeity, e.g. a polymer such as PEG. Thereby, the N- or C-terminal peptide addition is shielded from degradation and/or increased expression, including secretion, of the enzyme is likely to be obtained. In connection with this embodiment the N-terminal peptide addition can comprise any of the peptide additions disclosed in WO 97/04079.
In yet another embodiment the polypeptide Pp is an amyloglucosidase and the N-or C-terminal peptide addition comprises or contributes to a glycosylation site and/or an attachment group for a second non-peptide moeity, e.g. a polymer such as PEG. When the peptide addition is N-terminal the modification of such enzyme is contemplated to result in reduced or no degradation of the N-terminus of said enzyme (an otherwise well known problem associated with the recombinant production of amyloglucosidase). In other words the N-terminus of the enzyme is protected by the non-peptide moiety attached to the N-terminal peptide addition of the amyloglucosidase.
In yet another embodiment the polypeptide Pp is an antigen, in particular an antigen intended for use in eliciting an immune response (for vaccine purposes). It is contemplated to be advantageous to add N-terminal glycosylation sites) to antigens in accordance with the SUBSTITUTE SHEET (RULE 26) invention in that the risk of changing antigenicity is thereby reduced.
Antigens are recognized by a wide range of target cells, including antigen presenting cells (APC), and taken up by those cells for efficient intracellular processing and presentation to other cells of the immune system, such as, e.g., T cells, to induce or elicit desired immune responses. Antigens (and fragments thereof, e.g., antigen peptides) can be modified by a peptide addition and non-peptide moieties according to the invention. Such modifications facilitate and/or optimize uptake and/or targeting to processing compartment of the antigen by such target cells. For example, N-terminally extended antigen polypeptides of the invention are taken up by the target cells more efficiently and/or at an enhanced or improved rate (when the non-peptide moiety is one to involved in such uptake). Such efficient, improved, or enhanced uptake of modified antigens by the target cells increases the kinetics and potency of the immune response to the immunizing antigen. These modifications to antigens also improve the affinity of the antigens for particular cellular receptors on target cells, including, e.g., mannose receptors and other carbohydrate receptors (in particular when the non-peptide moiety is an oligosaccharide moiety).
Antigen polypeptides of the invention include, but are not limited to those, for which an improved, enhanced or altered uptake of antigens in the following type of target cells is desired: antigen-presenting and antigen-processing cells, such as monocytes, B
cells, antigen-presenting macrophages, marginal zone macrophages, follicular dendritic cells, dendritic cells, 2o Langerhans cells, keratinocytes, M-cells (e.g., M-cells of the gut), myocytes for intramuscular immunization or epithelial cells for mucosal immunization, Kuppfer cells in the liver, and the like. A number of other cells, including capillary endothelium and some endocrine cells, can present antigen in some circumstances; the cells develop MHC class II
molecules that confer antigen-presenting function. Furthermore, MHC class I molecules are expressed on the surface of most nucleated cells, including, for example, muscle cells, and therefore these cells can also present antigens to CD8+ T cells. Activated T cells, which release IFN-gamma actively induce expression of MHC molecules on some tissue cells. Such cells are also of use with the novel polypeptides of the invention. Preferably, such cells are of mammalian origin, in particular human (for use in immunization of a human) or animal (for veterinary purposes).
A wide range of antigens can be modified according to the invention. Examples are as follows:
Caf~cer antigens Examples of cancer antigens that can be modified according to the invention include, but are not limited to: bullous pemphigoid antigen 2, prostate mucin antigen (PMA) (Beckett SUBSTITUTE SHEET (RULE 26) and Wright (1995) 1>2t. J. Cancer 62: 703-710), tumor associated Thomsen-Friedenreich antigen (Dahlenborg et al. (1997) Iht. J. Caf~cer 70: 63-71), prostate-specific antigen (PSA) (Dannull and Belldegrun (1997) Br. J. Urol. 1: 97-103), EpCam/KSA antigen, luminal epithelial antigen (LEA.135) of breast carcinoma and bladder transitional cell carcinoma 5 (TCC) (Jones et al. (1997) Arzticazzcer Res. 17: 685-687), cancer-associated serum antigen (CASA) and cancer antigen 125 (CA 125) (Kierkegaard et al. (1995) Gyrzecol.
Oyzcol. 59: 251-254), the epithelial glycoprotein 40 (EGP40) (Kievit et al. (1997) Iht. J.
Cancer 71: 237-245), squamous cell carcinoma antigen (SCC) (Lozza et al. (1997) Ayztica>zcer Res.
17: 525-529), cathepsin E (Mota et al. (1997) Am. J. Pathol. 150: 1223-1229), tyrosinase in melanoma 10 (Fishman et al. (1997) Cafzcer 79: 1461-1464), cell nuclear antigen (PCNA) of cerebral cavernomas (Notelet et al. (1997) Surg. Neurol. 47: 364-370), DF3/MLTC1 breast cancer antigen (Apostolopoulos et al. (1996) Immu>zol. Cell. Biol. 74: 457-464;
Pandey et al. (1995) Cancer Res. 55: 4000-4003), carcinoembryonic antigen (Paone et al. (1996) J.
Cancer Res.
Cli>z. Oucol. 122: 499-503; Schlom et al. (1996) Breast Caucer Res. Treat. 38:
27-39), tumor-15 associated antigen CA 19-9 (Tolliver and O'Brien (1997) South Med. J. 90:
89-90; Tsuruta et al. (1997) Urol. hzt. 58: 20-24), human melanoma antigens MART-1/Melan-A27-35 and gp100 (Kawakami and Rosenberg (1997) hzt. Rev. lyzzuzurzol. 14: 173-192; Zajac et al. (1997) Ifzt. J.
Cancer 71: 491-496), the T and Tn pancarcinoma (CA) glycopeptide epitopes (Springer (1995) Crit. Rev. Ozzcog. 6: 57-85), a 35 kD tumor-associated autoantigen in papillary thyroid 20 carcinoma (Lucas et al. (1996) Antica~zcer Res. 16: 2493-2496), KH-1 adenocarcinoma antigen (Deshpande and Danishefsky (1997) Nature 387: 164-166), the A60 mycobacterial antigen (Maes et al. (1996) J. Cancer Res. Clin. Oyzcol. 122: 296-300), heat shock proteins (HSPs) (Blachere and Srivastava (1995) Semiyz. Cayzcer Biol. 6: 349-355), and MAGE, tyrosinase, melan-A and gp75 and mutant oncogene products (e.g., p53, ras, and HER-2/neu (Bueler and Mulligan (1996) Mol. Med. 2: 545-555; Lewis and Houghton (1995) Semifz. Cancer Biol. 6:
321-327; Theobald et al. (1995) Proc. Nat'l. Acad. Sci. USA 92: 11993-11997);
TAG-72, a mucin ag expressed in most human adenocarcinomas (McGuinness et al. (1999) Hum Gene Ther 10:165-73.
Bacterial antigeyzs Bacterial antigens that can be modified according to the invention include, but are not limited to, Helicobacter pylori antigens CagA and VacA (Blaser (1996) Alirzzefzt. Plaamzacol.
Ther. 1: 73-7; Blaser and Crabtree (1996) Am. J. Clin. Pathol. 106: 565-7;
Censini et al. (1996) Proc. Nat'l. Acad. Sci. USA 93: 14648-14643). Other suitable H. pylori antigens include, for SUBSTITUTE SHEET (RULE 26) example, four immunoreactive proteins of 45-65 kDa as reported by Chatha et al. (1997) Ihdiarz J. Med. Res. 105: 170-175 and the H. pylori GroES homologue (HspA) (Kansau et al.
(1996) Mol. Microbiol. 22: 1013-1023. Other suitable bacterial antigens include, but are not limited to, the 43-kDa and the fimbrilin (41 kDa) proteins of P. girzgivalis (Boutsl et al. (1996) Oral Microbiol. Immurzol. 11: 236-241); pneumococcal surface protein A (Briles et al. (1996) Arzrz. NYAcad. Sci. 797: 118-126); Chlarrzydia psittaci antigens, 80-90 kDa protein and 110 kDa protein (Buendia et al. (1997) FEMS Microbiol. Lett. 150: 113-9); the chlamydial exoglycolipid antigen (GLXA) (Whittum-Hudson et al. (1996) Nature Med. 2: 1116-1121);
Chlamydia przeumorziae species-specific antigens in the molecular weight ranges 92-98, 51-55, l0 43-46 and 31.5-33 kDa and genus-specific antigens in the ranges 12, 26 and 65-70 kDa (Halme et al. (1997) Scahd. J. Immurzol. 45: 378-84); Neisseria gorzorrhoeae (GC) or Escherichia coli phase-variable opacity (Opa) proteins (Chen and Gotschlich (1996) Proc. Nat'l.
Acad. Sci.
USA 93: 14851-14856), any of the twelve immunodominant proteins of Schistosoma marzsoni (ranging in molecular weight from 14 to 208 kDa) as described by Cutts and Wilson (1997) Parasitology 114: 245-55; the 17-kDa protein antigen of Brucella abortus (De Mot et al.
(1996) Curr. Microbiol. 33: 26-30); a gene homolog of the 17-kDa protein antigen of the Gram-negative pathogen Brucella abortus identified in the nocardioform actinomycete Rhodococcus sp. NI86/21 (De Mot et al. (1996) Curr. Microbiol. 33: 26-30); the staphylococcal enterotoxins (SEs) (Wood et al. (1997) FEMS Immurzol. Med.
Microbiol. 17: 1-10), a 42-kDa M. hyopneurzzorziae NrdF ribonucleotide reductase R2 protein or 15-kDa subunit protein of M. lzyoprzeurnorziae (Fagan et al. (1997) Infect. Immurz. 65: 2502-2507), the meningococcal antigen PorA protein (Feavers et al. (1997) Clin. Diagrz. Lab.
Immurzol. 3: 444-50); pneumococcal surface protein A (PspA) (McDaniel et al. (1997) Gerze Ther.
4: 375-377);
F. tularerzsis outer membrane protein FopA (Fulop et al. (1996) FEMS Immunol.
Med.
Microbiol. 13: 245-247); the major outer membrane protein within strains of the genus Actinobacillus (Hartmann et al. (1996) Zerztralbl. Bakteriol. 284: 255-262);
p60 or listeriolysin (HIy) antigen of Listeria rrzozzocytogerzes (Hess et al. (1996) Proc. Nat'l.
Acad. Sci. USA 93:
1458-1463); flagellar (G) antigens observed on Salrrzorzella erzteritidis and S. pullorum (Holt and Chaubal (1997) J. Clin. Microbiol. 35: 1016-1020); Bacillus anthracis protective antigen 3o (PA) (Ivins et al. (1995) Vaccine 13: 1779-1784); Echirzococcus grarzulosus antigen 5 (Jones et al. (1996) Parasitology 113: 213-222); the rol genes of Slzigella dysenteriae 1 and Escherichia coli K-12 (Klee et al. (1997) J. Bacteriol. 179: 2421-2425); cell surface proteins Rib and alpha of group B streptococcus (Larsson et al. (1996) Infect. Imrnurz. 64: 3518-3523); the 37 kDa secreted polypeptide encoded on the 70 kb virulence plasmid of pathogenic Yersinia spp.
SUBSTITUTE SHEET (RULE 26) (teary et al. (1995) Contrib. Microbiol. Imrnunol. 13: 216-217 and Roggenkamp et al. (1997) Infect. Immure. 65: 446-51); the OspA (outer surface protein A) of the Lyme disease spirochete Borrelia burgdorferi (ti et al. (1997) Proc. Nat'l. Acad. Sci. USA 94: 3584-3589, Padilla et al.
(1996) J. Infect. Dis. 174: 739-746, and Wallich et al. (1996) Infection 24:
396-397); the Brucella melitensis group 3 antigen gene encoding Omp28 (Lindler et al. (1996) Infect.
Immun. 64: 2490-2499); the PAc antigen of Streptococcus mutans (Murakami et al. (1997) Infect. Immurz: 65: 794-797); pneumolysin, Pneumococcal neuraminidases, autolysin, hyaluronidase, and the 37 kDa pneumococcal surface adhesin A (Paton et al.
(1997) Microb.
Drug Resist. 3: 1-10); 29-32, 41-45, 63-71 x 10(3) MW antigens of Salmonella typhi (Perez et l0 al. (1996) Immunology 89: 262-267); K-antigen as a marker of Klebsiella przeumoniae (Priamukhina and Morozova (1996) Klin. Lab. Diagn. 47-9); nocardial antigens of molecular mass approximately 60, 40, 20 and 15-10 kDa (Prokesova et al. (1996) Int. J.
Immunophannacol. 18: 661-668); Staphylococczzs aureus antigen ORF-2 (Rieneck et al.
(1997) Biochim Biophys Acta 1350: 128-132); GIpQ antigen of Borrelia hermsii (Schwan et al.
(1996) J. Clin. Microbiol. 34: 2483-2492); cholera protective antigen (CPA) (Sciortino (1996) J. Diarrlzoeal Dis. Res. 14: 16-26); a 190-kDa protein antigen of Streptococcus mutans (Senpuku et al. (1996) Oral Microbiol. Irnmunol. 11: 121-128); Anthrax toxin protective antigen (PA) (Sharma et al. (1996) Protein Expr. Purif. 7: 33-38); Clostridium perfringerzs antigens and toxoid (Strom et al. (1995) Br. J. Rheumatol. 34: 1095-1096); the SEF14 fimbrial antigen of Salrraonella enteritidis (Thorns et al. (1996) Microb. Pathog. 20:
235-246); the Yersinia pestis capsular antigen (Fl antigen) (Titball et al. (1997) Infect.
Inzrnun. 65: 1926-1930); a 35-kilodalton protein of Mycobacterium leprae (Triccas et al. (1996) Infect. Immun.
64: 5171-5177); the major outer membrane protein, CD, extracted from Moraxella (Branhamella) catarrhalis (Yang et al. (1997) FEMS Immurzol. Med. Microbiol.
17: 187-199);
pH6 antigen (PsaA protein) of Yersirzia pestis (Zav'yalov et al. (1996) FEMS
Immunol. Med.
Microbiol. 14: 53-57); a major surface glycoprotein, gp63, of Leislamarzia major (Xu and Liew (1994) Vaccine 12: 1534-1536; Xu and Liew (1995) Immunology 84: 173-176);
mycobacterial heat shock protein 65, mycobacterial antigen (Mycobacterium leprae hsp65) (Lowrie et al.
(1994) Vaccirze 12: 1537-1540; Ragno et al. (1997) Arthritis Rheurn. 40: 277-283; Silva (1995) Braz. J. Med. Biol. Res. 28: 843-851); Mycobacterium tz~berculosis antigen 85 (Ag85) (Huygen et al. (1996) Nat. Med. 2: 893-898); the 45/47 kDa antigen complex (APA) of Mycobacterium tuberculosis, M. bovis and BCG (Horn et al. (1996) J. Inzmunol. Methods 197:
151-159); the mycobacterial antigen, 65-kDa heat shock protein, hsp65 (Tascon et al. (1996) Nat. Med. 2:
888-892); the mycobacterial antigens MPB64, MPB70, MPB57 and alpha antigen (Yamada et SUBSTITUTE SHEET (RULE 26) al. (1995) Kekkaku 70: 639-644); the M. tuberculosis 38 kDa protein (Vordermeier et al.
(1995) Vaccine 13: 1576-1582); the MPT63, MPT64 and MPT-59 antigens from Mycobacterium tuberculosis (Manca et al. (1997) Infect. Immun. 65: 16-23;
Oettinger et al.
(1997) Scand. J. Immunol. 45: 499-503; Wilcke et al. (1996) Tuber. Lung Dis.
77: 250-256);
the 35-kilodalton protein of Mycobacterium leprae (Triccas et al. (1996) Infect. Imnaun. 64:
5171-5177); the ESAT-6 antigen of virulent mycobacteria (Brandt et al. (1996) J. Immunol.
157: 3527-3533; Pollock and Andersen (1997) T. Infect. Dis. 175: 1251-1254);
Mycobacterium tuberculosis 16-kDa antigen (Hsp16.3) (Chang et al. (1996) .l. Biol. Chem.
271: 7218-7223);
and the 18-kilodalton protein of Mycobacterium leprae (Baumgart et al. (1996) Infect. ImnZUn.
l0 64: 2274-2281); protective antigen (PA) of B. anthracis; V antigen from Yersinia pestis, Y.
enterocolitica, and Y. pseudotuberculosis; antigens against bacterium Vibrio cholerae, cholera toxin B subunit, and heat-labile enterotoxins (LT) from enterotoxigenic E.
coli strains.
Viral pathogens Polypeptides or proteins corresponding to or associated with various viral pathogens, including, but not limited to, e.g., hanta virus (e.g., hanta virus glycoproteins), flaviviruses, such as, e.g., Dengue viruses (e.g., envelope proteins), Japanese, St. Louis and Murray Valley encephalitis viruses, tick-borne encephalitis viruses can be modified according to the invention.
Viral antigens that can be modified according to the invention include, but are not 2o limited to, influenza A virus N2 neuraminidase (Kilbourne et al. (1995) Vaccine 13: 1799-1803); Dengue virus envelope (E) and premembrane (prM) antigens (Feighny et al. (1994) Am.
J. Trop. Med. Hyg. 50: 322-328; Putnak et al. (1996) Am. J. Trop. Med. Hyg.
55: 504-10); HIV
antigens Gag, Pol, Vif and Nef (Vogt et al. (1995) Vaccine 13: 202-208); HIV
antigens gp120 and gp160 (Achour et al. (1995) Cell. Mol. Biol. 41: 395-400; Hone et al.
(1994) Dev. Biol.
Stand. 82: 159-162); gp41 epitope of human immunodeficiency virus (Eckhart et al. (1996) J.
Gen. Virol. 77: 2001-2008); rotavirus antigen VP4 (Mattion et al. (1995) J.
Virol. 69: 5132-5137); the rotavirus protein VP7 or VP7sc (Emslie et al. (1995) J. Virol. 69:
1747-1754; Xu et al. (1995) J. Gen. Virol. 76: 1971-1980); herpes simplex virus (HSV) glycoproteins gB, gC, gD, gE, gG, gH, and gI (Fleck et al. (1994) Med. Microbiol. Imrnunol. (Berl) 183: 87-94 [Mattion, 1995]; Ghiasi et al. (1995) Invest. Ophthalmol. Vis. Sci. 36: 1352-1360; McLean et al. (1994) J. Infect. Dis. 170: 1100-1109); immediate-early protein ICP47 of herpes simplex virus-type 1 (HSV-1) (Banks et al. (1994) Virology 200: 236-245); immediate-early (1E) proteins ICP27, ICPO, and ICP4 of herpes simplex virus (Manickan et al. (1995) J. Virol. 69:
4711-4716); influenza virus nucleoprotein and hemagglutinin (Deck et al.
(1997) Vaccine 15:
SUBSTITUTE SHEET (RULE 26) 71-78; Fu et al. (1997) J. Virol. 71: 2715-2721); B19 parvovirus capsid proteins VPl (Kawase et al. (1995) Virology 211: 359-366) or VP2 (Brown et al. (1994) Virology 198:
477-488);
Hepatitis B virus core and a antigen and capsid protein (Schodel et al. (1996) Izztervirology 39:
104-106); hepatitis B surface antigen (Shiau and Murray (1997) J. Med. Virol.
51: 159-166);
hepatitis B surface antigen fused to the core antigen of the virus (Id.);
Hepatitis B virus core-preS2 particles (Nemeckova et al. (1996) Acta Virol. 40: 273-279); HBV preS2-S
protein (Kutinova et al. (1996) Vaccine 14: 1045-1052); VZV glycoprotein I (Kutinova et al. (1996) Vaccine 14: 1045-1052); rabies virus glycoproteins (Xiang et al. (1994) Virology 199: 132-140; Xuan et al. (1995) Virus Res. 36: 151-161) or ribonucleocapsid (Hooper et al. (1994) Proc. Nat'l. Acad. Sci. USA 91: 10908-10912); human cytomegalovirus (HCMV) glycoprotein B (UL55) (Britt et al. (1995) J. Infect. Dis. 171: 18-25); the hepatitis C
virus (HCV) nucleocapsid protein in a secreted or a nonsecreted form, or as a fusion protein with the middle (pre-S2 and S) or major (S) surface antigens of hepatitis B virus (HBV) (Inchauspe et al.
(1997) DNA Cell Biol. 16: 185-195; Major et al. (1995) J. Virol. 69: 5798-5805); the hepatitis C virus antigens: the core protein (pC); El (pEl) and E2 (pE2) alone or as fusion proteins (Saito et al. (1997) Gastroenterology 112: 1321-1330); the gene encoding respiratory syncytial virus fusion protein (PFP-2) (Falsey and Walsh (1996) Vaccine 14: 1214-1218;
Piedra et al.
(1996) Pediatr. Infect. Dis. J. 15: 23-31); the VP6 and VP7 genes of rotaviruses (Choi et al.
(1997) Virology 232: 129-138; Jin et al. (1996) Arch. Virol. 141: 2057-2076);
the E1, E2, E3, 2o E4, E5, E6 and E7 proteins of human papillomavirus (Brown et al. (1994) Virology 201: 46-54; Dillner et al. (1995) Cancer Detect. Prev. 19: 381-393; Krul et al. (1996) Cancer lmuznno1.
Immunother. 43: 44-48; Nakagawa et al. (1997) J. Infect. Dis. 175: 927-931); a human T-lymphotropic virus type I gag protein (Porter et al. (1995) J. Med. Virol. 45:
469-474); Epstein-Barr virus (EBV) gp340 (Mackett et al. (1996) J. Med. Virol. 50: 263-271); the Epstein-Barr virus (EBV) latent membrane protein LMP2 (Lee et al. (1996) Eur. J. Iznnzunol.
26: 1875-1883); Epstein-Barr virus nuclear antigens 1 and 2 (Chen and Cooper (1996) J.
Virol. 70:
4849-4853; Khanna et al. (1995) Virology 214: 633-637); the measles virus nucleoprotein (N) (Fooks et al. (1995) Virology 210: 456-465); and cytomegalovirus glycoprotein gB (Marshall et al. (1994) J. Med. Virol. 43: 77-83) or glycoprotein gH (Rasmussen et al.
(1994) J. Infect.
3o Dis. 170:673-677).
Parasites Antigens from parasites can also be modified according to the invention. These include, but are not limited to, the schistosome gut-associated antigens CAA
(circulating SUBSTITUTE SHEET (RULE 26) anodic antigen) and CCA (circulating cathodic antigen) in Schistosonza nzazzsozZi, S.
laaenzatobium or S. japonicuzn (Deelder et al. (1996) Parasitology 112: 21-35); a multiple antigen peptide (MAP) composed of two distinct protective antigens derived from the parasite Sclaistosoma mansoni (Ferro et al. (1997) Parasite Immunol. 19: 1-11);
Leishmania parasite 5 surface molecules (Lezama-Davila (1997) Arch. Med. Res. 28: 47-53); third-stage larval (L3) antigens of L. loa (Akue et al. (1997) J. Infect. Dis. 175: 158-63); the genes, Tams1-1 and Tamsl-2, encoding the 30-and 32-kDa major merozoite surface antigens of Theileria annulata (Ta) (d'Oliveira et al. (1996) Gene 172: 33-39); Plasmodium falciparum merozoite surface antigen 1 or 2 (al-Yaman et al. (1995) Trans. R. Soc. Trop. Med. Hyg. 89: 555-559; Beck et al.
l0 (1997) J. Infect. Dis. 175: 921-926; Rzepczyk et al. (1997) Infect. Immun.
65: 1098-1100);
circumsporozoite (CS) protein-based B-epitopes from Plasmodium berghei, (PPPPNPND)2 and Plasmodiuzn yoelii, (QGPGAP)3QG, along with a P. berghei T-helper epitope KQIRDSITEEWS (Reed et al. (1997) Vaccine 15: 482-488); NYVAC-Pf7 encoded Plasmodium falciparunz antigens derived from the sporozoite (circumsporozoite protein and 15 sporozoite surface protein 2), liver (liver stage antigen 1), blood (merozoite surface protein 1, serine repeat antigen, and apical membrane antigen 1), and sexual (25-kDa sexual-stage antigen) stages of the parasite life cycle were inserted into a single NYVAC
genome to generate NYVAC-Pf7 (Tine et al. (1996) Infect. Immun. 64: 3833-3844);
Plasmodium falciparum antigen Pfs230 (Williamson et al. (1996) Mol. Biochenz. Parasitol.
78: 161-169);
20 Plasnzodiuzzz falciparuzzz apical membrane antigen (AMA-1) (Lal et al.
(1996) Infect. Inznzun.
64: 1054-1059); Plasmodium falciparum proteins Pfs28 and Pfs25 (puffy and Kaslow (1997) Izzfect. Immun. 65: 1109-1113); Plasnzodiunz falciparum merozoite surface protein, MSP1 (Hui et al. (1996) Infect. Izzzmun. 64: 1502-1509); the malaria antigen Pf332 (Ahlborg et al. (1996) Immunology 88: 630-635); Plasmodium falciparum erythrocyte membrane protein 1 (Baruch et 25 al. (1995) Proc. Nat'l. Acad. Sci. USA 93: 3497-3502; Baruch et al. (1995) Cell 82: 77-87);
Plasmodium falcaparum merozoite surface antigen, PfMSP-1 (Egan et al. (1996) J. Infect. Dis.
173: 765-769); Plasmodium falciparum antigens SERA, EBA-175, RAP1 and RAP2 (Riley (1997) J. Pharnz. Pharnzacol. 49: 21-27); Schistosozna japonicum paramyosin (Sj97) or fragments thereof (Yang et al. (1995) Biochem. Biophys. Res. Comnzun. 212:
1029-1039); and Hsp70 in parasites (Maresca and Kobayashi (1994) Experientia 50: 1067-1074).
Allergen antigens Allergen antigens that can be modified according to the invention, include, but are not limited to those of animals, including the mite (e.g., Dermatophagoides pterozzyssinus, SUBSTITUTE SHEET (RULE 26) Dennatoplaagoides farinae, Blomia tropicalis), such as the allergens der p1 (Scobie et al.
(1994) Biochem. Soc. Traps. 22: 4485; Yssel et al. (1992) J. Immunol. 148: 738-745), der p2 (Chua et al. (1996) Clin. Exp. Allergy 26: 829-837), der p3 (Smith and Thomas (1996) Clin.
Exp. Allergy 26: 571-579), der p5, der p V (Lip et al. (1994) J. Allergy Clin.
Immunol. 94: 989-996), der p6 (Bennett and Thomas (1996) Clin. Exp. Allergy 26: 1150-1154), der p 7 (Shen et al. (1995) Clin. Exp. Allergy 25: 416-422), der f2 (Yuuki et al. (1997) Int.
Arch. Allergy Immunol. 112: 44-48), der f3 (Nishiyama et al. (1995) FEBS Lett. 377: 62-66), der f7 (Shen et al. (1995) Clin. Exp. Allergy 25: 1000-1006); Mag 3 (Fujikawa et al. (1996) Mol. Immunol. 33:
311-319). Also of interest as antigens are the house dust mite allergens Tyr p2 (Erilcsson et al.
to (1998) Eur. J. Biochem. 251: 443-447), Lep dl (Schmidt et al. (1995) FEBS
Lett. 370: 11-14), and glutathione S-transferase (O'Neill et al. (1995) Imrnunol Lett. 48: 103-107); the 25,589 Da, 219 amino acid polypeptide with homology with glutathione S-transferases (O'Neill et al.
(1994) Biochifn. BioplZys. Acta. 1219: 521-528); Blo t 5 (Arruda et al. (1995) Int. Arch. Allergy Immunol. 107: 456-457); bee venom phospholipase A2 (Carballido et al. (1994) J. Allergy Clin. Immunol. 93: 758-767; Jutel et al. (1995) J. Immunol. 154: 4187-4194);
bovine dermal/dander antigens BDA 11 (Rautiainen et al. (1995) J. Invest. Dennatol.
105: 660-663) and BDA20 (Mantyjarvi et al. (1996) J. Allergy Clin. Immunol. 97: 1297-1303);
the major horse allergen Equ c1 (Gregoire et al. (1996) J. Biol. Chem. 271: 32951-32959); Jumper ant M.
pilosula allergen Myr p I and its homologous allergenic polypeptides Myr p2 (Donovan et al.
(1996) Biochem. Mol. Biol. Int. 39: 877-885); 1-13, 14, 16 kD allergens of the mite Blornia tropicalis (Caraballo et al. (1996) J. Allergy Clin. InZmunol. 98: 573-579);
the cockroach allergens Bla g Bd90K (Helm et al. (1996) J. Allergy Clin. Immunol. 98: 172-80) and Bla g 2 (Arruda et al. (1995) J. Biol. Claeyn. 270: 19563-19568); the cockroach Cr-PI
allergens (Wu et al. (1996) J. Biol. Chem. 271: 17937-17943); fire ant venom allergen, Sol i 2 (Schmidt et al.
(1996) J. Allergy Clin. InZmunol. 98: 82-88); the insect Chironomus thummi major allergen Chi t 1-9 (Kipp et al. (1996) Int. Arch. Allergy Immunol. 110: 348-353); dog allergen Can f 1 or cat allergen Fel d 1 (Ingrain et al. (1995) J. Allergy Clin. Immunol. 96: 449-456); albumin, derived, for example, from horse, dog or cat (Goubran Botros et al. (1996) Immufaology 88:
340-347); deer allergens with the molecular mass of 22 kD, 25 kD or 60 kD
(Spitzauer et al.
(1997) Clin. Exp. Allergy 27: 196-200); and the 20 kd major allergen of cow (Ylonen et al.
(1994) J. Allergy Clin. Irnmunol. 93: 851-858).
Pollen and grass allergens can also be modified according to the invention.
Such allergens include, for example, Hor v9 (Astwood and Hill (1996) Gene 182: 53-62, Lig v1 (Batanero et al. (1996) Clin. Exp. Allergy 26: 1401-1410); Lol p 1 (Muller et al. (1996) Int.
SUBSTITUTE SHEET (RULE 26) Arch. Allergy Immunol. 109: 352-355), Lol p II (Tamborini et al. (1995) Mol.
Immunol. 32:
505-513), Lol pVA, Lol pVB (Ong et al. (1995) Mol. Immunol. 32: 295-302), Lol p 9 (Blaher et al. (1996) J: Allergy Clin. Imnzunol. 98: 124-132); Par J I (Costa et al.
(1994) FEBS
Lett. 341: 182-186; Sallusto et al. (1996) J. Allergy Clin. Imnzunol. 97: 627-637), Par j 2.0101 (Duro et al. (1996) FEBS Lett. 399: 295-298); Bet v1 (Faber et al. (1996) J.
Biol. Chem. 271:
19243-19250), Bet v2 (Rihs et al. (1994) Int. Arclz. Allergy Immunol. 105: 190-194); Dac g3 (Guerin-Marchand et al. (1996) Mol. Irnmunol. 33: 797-806); Phl p 1 (Petersen et al. (1995) J.
Allergy Clin. Immunol. 95: 987-994), Phl p 5 (Muller et al. (1996) Int. Arcla.
Allergy Immunol.
109: 352-355), Phl p 6 (Petersen et al. (1995) Int. Arch. Allergy Immunol.
108: 55-59); Cry j I
l0 (Sone et al. (1994) Bioclaem. Bioplzys. Res. Commuf2. 199: 619-625), Cry j II (Namba et al.
(1994) FEBS Lett. 353: 124-128); Cor a 1 (Schenk et al. (1994) Eur. J.
Biochem. 224: 717-722); cyn d1 (Smith et al. (1996) J. Allergy Clin. Immunol. 98: 331-343), cyn d7 (Suphioglu et al. (1997) FEBS Lett. 402: 167-172); Pha a 1 and isoforms of Pha a 5 (Suphioglu and Singh (1995) Clirz. Exp. Allergy 25: 853-865); Cha o 1 (Suzuki et al. (1996) Mol.
Immunol. 33: 451-460); profilin derived, e.g, from timothy grass or birch pollen (Valenta et al. (1994) Biochem.
Biophys. Res. Commun. 199: 106-118); P0149 (Wu et al. (1996) Plant Mol. Biol.
32: 1037-1042); Ory s1 (Xu et al. (1995) Gene 164: 255-259); and Amb a V and Amb t 5 (Kim et al.
(1996) Mol. Immunol. 33: 873-880; Zhu et al. (1995) J. Immunol. 155: 5064-5073).
Food allergens that can be modified according to the invention include, for example, profilin (Rihs et al. (1994) Int. Arcla. Allergy Inzmunol. 105: 190-194); rice allergenic cDNAs belonging to the alpha-amylase/trypsin inhibitor gene family (Alvarez et al.
(1995) Biochim Biophys Acta 1251: 201-204); the main olive allergen, Ole a I (Lombardero et al. (1994) Clirz Exp Allergy 24: 765-770); Sin a 1, the major allergen from mustard (Gonzalez De La Pena et al. (1996) Eur J Biochem. 237: 827-832); parvalbumin, the major allergen of salmon (Lindstrom et al. (1996) Scand. J. Immunol. 44: 335-344); apple allergens, such as the major allergen Mal d 1 (Vanek-Krebitz et al. (1995) Biochem. Biophys. Res. Commun.
214: 538-551); and peanut allergens, such as Ara h I (Burks et al. (1995) J. Clin.
lyzvest. 96: 1715-1721).
Fungal allergens that can be modified according to the invention include, but are not limited to, the allergen, Cla h III, of Cladosporium herbarum (Zhang et al.
(1995) J. Inzmunol.
154: 710-717); the allergen Psi c 2, a fungal cyclophilin, from the basidiomycete Psilocybe cubensis (Homer et al. (1995) Int. Arch. Allergy Immunol. 107: 298-300); hsp 70 cloned from a cDNA library of Cladosporiunz herbarum (Zhang et al. (1996) Clin Exp Allergy 26: 88-95); the 68 kD allergen of Penicillium notatum (Shen et al. (1995) Clin. Exp. Allergy 26: 350-356);
aldehyde dehydrogenase (ALDH) (Achatz et al. (1995) Mol Immunol. 32: 213-227);
enolase SUBSTITUTE SHEET (RULE 26) (Achatz et al. (1995) Mol. Immunol. 32: 213-227); YCP4 (Id.); acidic ribosomal protein P2 (Id.).
Other allergens that can be modified include latex allergens, such as a major allergen (Hev b 5) from natural rubber latex (Akasawa et al. (1996) J. Biol. Clzem.
271: 25389-25393;
Slater et al. (1996) J. Biol. Chem. 271: 25394-25399).
Antigens associated with autoimmune diseases and iyzflammatory conditions Autoantigens that can be modified according to the invention include, but are not limited to, myelin basic protein (Stinissen et al. (1996) J. Neurosci. Res.
45: 500-511) or a 1o fusion protein of myelin basic protein and proteolipid protein (Elliott et al. (1996) J. Clin.
hzvest. 98: 1602-1612), proteolipid protein (PLP) (Rosener et al. (1997) J.
Neuroimmunol. 75:
28-34), 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) (Rosener et al.
(1997) J.
Neuroinzmunol. 75: 28-34), the Epstein Barr virus nuclear antigen-1 (EBNA-1) (Vaughan et al.
(1996) J. Neuroimmurzol. 69: 95-102), HSP70 (Salvetti et al. (1996) J.
Neuroimmunol. 65: 143-53; Feldmann et al. (1996) Cell 85: 307).
Antigens that can be modified according to the invention and used to treat scleroderma, systemic sclerosis, and systemic lupus erythematosus include, for example, (-2-GPI, 50 kI~a glycoprotein (Blank et al. (1994) J. Autoimnzun. 7: 441-455), Ku (p70/p80) autoantigen, or its 80-lcd subunit protein (Hong et al. (1994) Invest. Ophthalmol. Vis. Sci. 35:
4023-4030; Wang et al. (1994) J. Cell Sci. 107: 3223-3233), the nuclear autoantigens La (SS-B) and Ro (SS-A) (Huang et al. (1997) J. Clin. Immunol. 17: 212-219; Igarashi et al. (1995) Autoimrnunity 22:
33-42; Keech et al. (1996) Clin. Exp. Immuuol. 104: 255-263; Manoussakis et al. (1995) J.
Autoimmun. 8: 959-969; Topfer et al. (1995) Proc. Nat'l. Acad. Sci. USA 92:
875-879), proteasome (-type subunit C9 (Feist et al. (1996) J. Exp. Med. 184: 1313-1318), Scleroderma antigens Rpp 30, Rpp 38 or Scl-70 (Eder et al. (1997) Proc. Nat'l. Acad. Sci.
USA 94: 1101-1106; Hietarinta et al. (1994) Br. J. Rheurrzatol. 33: 323-326), the centrosome autoantigen PCM-1 (Bao et al. (1995) Autoimmunity 22: 219-228), polymyositis-scleroderma autoantigen (PM-Scl) (Kho et al. (1997) J. Biol. Chem. 272: 13426-13431), scleroderma (and other systemic autoimmune disease) autoantigen CENP-A (Muro et al. (1996) Clin.
Immunol.
Imnzunopathol. 78: 86-89), U5, a small nuclear ribonucleoprotein (snRNP) (Okano et al.
(1996) Clin. Immunol. Imyrzunopathol. 81: 41-47), the 100-kd protein of PM-Scl autoantigen (Ge et al. (1996) Arthritis Rlzeum. 39: 1588-1595), the nucleolar U3- and Th(7-2) ribonucleoproteins (Verheijen et al. (1994) J. Immunol. Methods 169: 173-182), the ribosomal protein L7 (Neu et al. (1995) Clin. Exp. Inzmunol. 100: 198-204), hPop1 (Lygerou et al. (1996) SUBSTITUTE SHEET (RULE 26) EMBO J. 15: 5936-5948), and a 36-kd protein from nuclear matrix antigen (Deng et al. (1996) Arthritis Rheum. 39: 1300-1307).
Antigens useful in treatment of hepatic autoimmune disorders can also be modified;
these include the cytochromes P450 and UDP-glucuronosyl-transferases (Obermayer-Straub and Manns (1996) Baillieres Clue. Gastroerzterol. 10: 501-532), the cytochromes P450 2C9 and P450 IA2 (Bourdi et al. (1996) Chem. Res. Toxicol. 9: 1159-1166; Clemente et al. (1997) J.
Clin. Eudocrihol. Metab. 82: 1353-1361), LC-1 antigen (Klein et al. (1996) J.
Pediatr.
Gastroehterol. Nutr. 23: 461-465), and a 230-kDa Golgi-associated protein (Funaki et al.
(1996) Cell Struct. Funct. 21: 63-72).
1o Antigens useful for treatment of autoimmune disorders of the skin that can be modified according to the invention include, but are not limited to, the 450 kD human epidermal autoantigen (Fujiwara et al. (1996) J. Invest. Dermatol. 106: 1125-1130), the 230 kD and 180 kD bullous pemphigoid antigens (Hashimoto (1995) Keio J. Med. 44: 115-123;
Murakami et al. (1996) J. Dennatol. Sci. 13: 112-117), pemphigus foliaceus antigen (desmoglein I), pemphigus vulgaris antigen (desmoglein 3), BPAg2, BPAgl, and type VII collagen (Batteux et al. (1997) J. Clin. Imrnunol. 17: 228-233; Hashimoto et al. (1996) J.
Dermatol. Sci. 12: 10-17), a 168-kDa mucosal antigen in a subset of patients with cicatricial pemphigoid (Ghohestani et al. (1996) J. luvest. Dermatol. I07: 136-139), and a 218-kd nuclear protein (218-kd Mi-2) (Seelig et al. (1995) Artlaritis Rheum. 38: 1389-1399).
Antigens for treating insulin dependent diabetes mellitus can also be modified; these, include, but are not limited to, insulin, proinsulin, GAD65 and GAD67, heat-shock protein 65 (hsp65), and islet-cell antigen 69 (ICA69) (French et al. (1997) Diabetes 46:
34-39; Roep (1996) Diabetes 45: 1147-1156; Schloot et al. (1997) Diabetologia 40: 332-338), viral proteins homologous to GAD65 (Jones and Crosby (1996) Diabetologia 39: 1318-1324), islet cell antigen-related protein-tyrosine phosphatase (PTP) (Cui et al. (1996) J. Biol.
Chem. 271:
24817-24823), GM2-1 ganglioside (Cavallo et al. (1996) J. Endocrinol. 150: 113-120; Dotta et al. (1996) Diabetes 45: 1193-l I96), glutamic acid decarboxylase (GAD) (Nepom (1995) Curr.
Opih. Immuhol. 7: 825-830; Panina-Bordignon et al. (1995) J. Exp. Med. 181:
1923-1927), an islet cell antigen (ICA69) (Karges et al. (1997) Biochim. Bioplays. Acta 1360:
97-101; Roep et al. (I996) Eur. J. Immunol. 26: 1285-1289), Tep69, the single T cell epitope recognized by T
cells from diabetes patients (Karges et al. (1997) Biochim. Biophys. Acta 1360: 97-101), ICA
512, an autoantigen of type I diabetes (Solimena et al. (1996) EMBO J. 15:
2102-2114), an islet-cell protein tyrosine phosphatase and the 37-kDa autoantigen derived from it in type 1 diabetes (including IA-2, IA-2) (La Gasse et al. (1997) Mol. Med. 3: I63-I73), the 64 kDa SUBSTITUTE SHEET (RULE 26) protein from In-111 cells or human thyroid follicular cells that is immunoprecipitated with sera from patients with islet cell surface antibodies (ICSA) (Igawa et al. (1996) Endocr. J. 43: 299-306), phogrin, a homologue of the human transmembrane protein tyrosine phosphatase, an autoantigen of type 1 diabetes (Kawasaki et al. (1996) Biochenz. Biophys. Res.
Conzmun. 227:
5 440-447), the 40 kDa and 37 kDa tryptic fragments and their precursors IA-2 and IA-2 in IDDM (Lampasona et al. (1996) J. Irnmunol. 157: 2707-2711; Notkins et al.
(1996) J.
Autoimmuyz. 9: 677-682), insulin or a cholera toxoid-insulin polypeptide (Bergerot et al. (1997) Proc. Nat'). Acad. Sci. USA 94: 4610-4614), carboxypeptidase H, the human homologue of gp330, which is a renal epithelial glycoprotein involved in inducing Heymann nephritis in rats, 10 and the 38-kD islet mitochondria) autoantigen (Arden et al. (1996) J. Clin.
Invest. 97: 551-561.
Useful antigens for rheumatoid arthritis treatment that can be modified according to the invention include, but are not limited to, the 45 kDa DEK nuclear antigen, in particular onset juvenile rheumatoid arthritis and iridocyclitis (Murray et al. (1997) J.
Rheumatol. 24: 560-567), human cartilage glycoprotein-39, an autoantigen in rheumatoid arthritis (Verheijden et al.
15 (1997) Arthritis Rlaeum. 40: 1115-1125), a 68k autoantigen in rheumatoid arthritis (B)ass et al.
(1997) Ann. Rheum. Dis. 56: 317-322), collagen (Rosloniec et al. (1995) J.
Imnzunol. 155:
4504-4511), collagen type II (Cook et al. (1996) Arthritis Rheum. 39: 1720-1727; Trentham (1996) Ann. N. Y. Acad. Sci. 778: 306-314), cartilage link protein (Guerassimov et al. (1997) J.
Rheumatol. 24: 959-964), ezrin, radixin and moesin, which are auto-immune antigens in 2o rheumatoid arthritis (Wagatsuma et al. (1996) Mol. Immunol. 33: 1171-1176), and mycobacterial heat shock protein 65 (Ragno et al. (1997) Arthritis Rheunz. 40:
277-283).
Antigens useful for treatment are autoimmune thyroid disorders that can be modified include, for example, thyroid peroxidase and the thyroid stimulating hormone receptor (Tandon and Weetman (1994) J. R. Col). Physicians Lond. 28: 10-18), thyroid peroxidase from human 25 Graves' thyroid tissue (Gardas et al. (1997) Biochem. Biophys. Res. Commun.
234: 366-370;
Zimmer et al. (1997) Histoclzern. Cell. Biol. 107: 115-120), a 64-kDa antigen associated with thyroid-associated ophthalmopathy (Zhang et al. (1996) Clin. Imnzunol.
Immunopathol. 80:
236-244), the human TSH receptor (Nicholson et al. (1996) J. Mol. Endocrinol.
16: 159-170), and the 64 kDa protein from In-111 cells or human thyroid follicular cells that is 30 immunoprecipitated with sera from patients with islet cell surface antibodies (ICSA) (Igawa et al. (1996) Endocr. J. 43: 299-306).
Other associated antigens that can be modified include, but are not limited to, Sjogren's syndrome (-fodrin; Haneji et al. (1997) Science 276: 604-607), myastenia gravis (the human M2 acetylcholine receptor or fragments thereof, specifically the second extracellular loop of SUBSTITUTE SHEET (RULE 26) the human M2 acetylcholine receptor; Fu et al. (1996) Clin. Immuhol.
Immuyaopathol. 78: 203-207), vitiligo (tyrosinase; Fishman et al. (1997) Cancer 79: 1461-1464), a 450 kD human epidermal autoantigen recognized by serum from individual with blistering skin disease, and ulcerative colitis (chromosomal proteins HMG1 and HMG2; Sobajima et al. (1997) Clirc. Exp.
Immuyaol. 107: 135-140).
Sperm Antigens Sperm antigens which can be used in the genetic vaccines include, for example, lactate dehydrogenase (LDH-C4), galactosyltransferase (GT), SP-10, rabbit sperm autoantigen (RSA), to guinea pig (g)PH-20, cleavage signal protein (CS-1), HSA-63, human (h)PH-20, and AgX-1 (Zhu and Naz (1994) Arch. Androl. 33: 141-144), the synthetic sperm peptide, PlOG (O'Rand et al. (1993) J. Reprod. Immuhol. 25: 89-102), the 135kD, 95kD, 65kD, 47kD, 4lkD and 23kD
proteins of sperm, and the FA-1 antigen (Naz et al. (1995) Arch. Androl. 35:
225-231), and the 35 kD fragment of cytokeratin 1 (Lucas et al. (1996) AyZticancer Res. 16: 2493-2496).
Also, examples of antigens are set forth in Punnonen et al. (1999) WO
99/41369; Punnonen et al. (1999) WO 99/41383; Punnonen et al. (1999) WO 99/41368; and Punnonen et al. (1999) WO 99/41402), the contents of all of which are incorporated herein by reference in their entirety for all purposes. Other useful antigens have been described in the literature or can be discovered using genomics approaches.
Peptide addition In principle the peptide addition X can be any stretch of amino acid residues ranging from a single amino acid residue to a large protein, e.g. a mature protein. Usually, the peptide addition X comprises 1-500 amino acid residues, such as 2-500, normally 2-50 or 3-50 amino acid residues, such as 3-20 amino acid residues. The length of the peptide addition to be used for modification of a given polypeptide is dependent of or determined on the basis of a number of factors including the type of polypeptide of interest and the desired effect to be achieved by the modification. Normally, the peptide addition has less than 90% identity to the amino acid sequence of a native full length polypeptide, in particular less than 80%
identity, such as less 3o than 70% identity or even lower degree of identity to a full length protein. In one embodiment the peptide addition may constitute a part of a full length protein (e.g. 1-50 amino acid residues thereof.
The peptide addition may be designed by a site-specific or random approach, e.g as out-lined in further detail in the Methods section below. This section also comprises a set of SUBSTITUTE SHEET (RULE 26) guidelines useful for preparing a peptide addition for use in the present invention are described.
It will be understood that those guidelines are intended for illustration purposes only and that a person skilled in the art will be aware of alternative useful routes for design of peptide addition. Thus, the method of designing a peptide addition for use herein should not be considered limited to that described in the Materials section.
The number of glycosylation sites should be sufficient to provide the desired effect.
Typically, the peptide addition X comprises 1-20, such as 1-10 glycosylation sites. For instance, the peptide addition X comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 glycosylation sites. It is well known that one frequently occurring consequence of modifying an amino acid sequence l0 of, e.g., a human protein is that new epitopes are created by such modification. In order to shield any new epitopes created by the peptide addition, it is desirable that sufficient glycosylation sites are present to enable shielding of all epitopes introduced into the sequence.
This is e.g. achieved when the peptide addition X comprises at least one glycosylation site within a stretch of 30 contiguous amino acid residues, such as at least one glycosylation site within 20 amino acid residues or at least one glycosylation site within 10 amino acid residues, in particular 1-3 glycosylation sites within a stretch of 10 contiguous amino acid residues in the peptide addition X.
Thus, in one embodiment the peptide addition X comprises at least two glycosylation sites, wherein two of said sites are separated by at most 10 amino acid residues, none of which 2o comprises a glycosylation site. Furthermore, the polypeptide Pp can comprise at Ieast one introduced glycosylation site, in particular 1-5 introduced glycosylation sites. Analogously, the polypeptide Pp can comprise at least one removed glycosylation site, in particular 1-5 removed glycosylation sites.
The glycosylation site of the peptide addition may be an iyz vivo or in vitro glycosylation site. Prefererably, the glycosylation site is an in vivo glycosylation site, in particular an N-glycosylation site since glycosylation of such site is more easy to control than to an O-glycosylation site. Accordingly, in a preferred embodiment the peptide addition X
comprises at least one N-glycosylation site, typically at least two N-glycosylation sites. For instance, the peptide addition X has the structure Xl-N-X2-[T/S]/C-Z, wherein Xi is a peptide 3o comprising at least one amino acid residue or is absent, X2 is any amino acid residue different from Pro, and Z is absent or a peptide comprising at least one amino acid residue. For instance, Xl is absent, X2 is an amino acid residue selected from the group consisting of I, A, G, V and S
(all relatively small amino acid residues), and Z comprises at least 1 amino acid residue.
SUBSTITUTE SHEET (RULE 26) For instance, Z can be a peptide comprising 1-50 amino acid residues and, e.g., 1-10 glycosylation sites.
In another polypeptide of the invention Xl comprises at least one amino acid residue, e.g. 1-50 amino acid residues, X2 is an amino acid residue selected from the group consisting of I, A, G, V and S, and Z is absent. For instance, Xl comprises 1-10 glycosylation sites.
For instance, the peptide addition for use in the present invention can comprise a peptide sequence selected from the group consisting of INA[TlS], GNI[T/S], VNI[T/S], SNI[T/S], ASNI[T/S], NI[T/S], SPINA[T/S], ASPINA[TlS], ANI[T/S]ANI[T/S]ANI, ANI[T/S]GSNI[T/S]GSNI[T/S], FNI[T/S]VNI[T/S]V
to YNI[T/S]VNI[T/S]V, AFNI[T/S]VNI[T/S]V, AYNI[T/S]VNI[T/S]V, APND[T/S]VNI[T/S]V, ANI[T/S], ASNS[T/S]NNG[T/S]LNA[T/S], ANH[TlS]NE[T/S]NA[T/S], GSPINA[T/S], ASPINA[T/S]SPINA[T/S], ANN[T/S]NY[T/S]NW[T/S], ATNI[T/S]LNY[T/S]AN[T/S]T, AANS[T/S]GNI[T/S]ING[T/S], AVNW[T/S]SND[T/S]SNS[T/S], GNA[T/S], AVNW[T/S]SND[T/S]SNS[T/S], ANN[T/S]NY[T/S]NS[TlS], ANNTNYTNWT, ANI[T/S]VNI[TlS]V, ND[T/S]VNF[T/S] and NI[T/S]VNI[T/S]V wherein [T/S] is either a T
or an S residue, preferably a T residue. Other non-limiting examples include a peptide addition comprising the sequence NSTQNATA, which corresponds to positions 231 to 238 of the human calcium activated channel 2 precursor (to add two N-glycosylation sites), or the sequence ANLTVRNLTRNVTV, which corresponds to positions 538 to 551 of the human G
2o protein coupled receptor 64 (to add three N-glycosylation sites).
The peptide addition can comprise one or more of these peptide sequences, i.e.
at least two of said sequences either directly linked together or separated by one or more amino acid residues, or can contain two or more copies of any of these peptide sequence.
It will be understood that the above specific sequences are given for illustrative purposes and thus do not constitute an exclusive list of peptide sequences of use in the present invention.
In a more specific embodiment the peptide addition X is selected from the group consisting of lNA[T/S], GNI[T/S], VNI[T/S], SNI[T/S], ASNI[T/S], NI[T/S], SP1NA[T/S], ASPINA[T/S], ANI[T/S]ANI[T/S]ANI, and ANI[T/S]GSNI[T/S]GSNI[T/S], wherein [T/S] is either a T or an S residue, preferably a T residue.
3o As stated further above the polypeptide Pp can be a native polypeptide that may or may not comprise one or more glycosylation sites. In order to further modify the glycosylation of the polypeptide Pp of interest (in terms of the number of oligosaccharide moieties attached to the polypeptide), the polypeptide Pp can be a variant of a native polypeptide that differs from said polypeptide in at least one introduced or at least one removed glycosylation site.
SUBSTITUTE SHEET (RULE 26) For instance, the polypeptide Pp comprises at least one introduced glycosylation site, in particular 1-5 introduced glycosylation sites, such as 2-5 introduced glycosylation sites.
In order to affect the total glycosylation of the polypeptide of interest the glycosylation site is introduced so that the N residue of said glycosylation site is exposed at the surface of the polypeptide, when folded in its active form. Likewise, a glycosylation site to be removed is selected from those having an N residue exposed at the surface of the polypeptide.
In one embodiment, the peptide addition X has an N residue in position -2 or -1, and the polypeptide Pp or Px has a T or an S residue in position +1 or +2, respectively, the residue numbering being made relative to the N-terminal amino acid residue of Pp or PX, whereby an 1o N-glycosylation site is formed.
Glycosylatio~z The polypeptide of the invention is glycosylated (i.e. comprises an in vivo attached N- or O-linked oligosaccharide moiety or if2 vitro attached oligosaccharide moiety) and furthermore has an altered glycosylation profile as compared to that of the polypeptide Pp.
For instance, the altered glycosylation profile is a consequence of an altered, normally increased, number of attached oligosaccharide moieties and/or an altered type or distribution of attached oligosaccharide moieities.
Furthermore, for polypeptides intended for therapeutic or veterinary uses or to which a 2o human or animal is otherwise exposed, the type of oligosaccharide moiety to be attached should normally be one that does not lead to increased immunogenicity of the polypeptide as compared to that of the polypeptide Pp. The coupling of an oligosaccharide moiety may take place ifz vivo or iyz vitro. In order to achieve in vivo glycosylation of a a nucleotide sequence encoding the polypeptide should be inserted in a glycosylating, eucaryotic expression host. The expression host cell may be selected from fungal (filamentous fungal or yeast), insect, mammalian cells or transgenic plant cells as disclosed in further detail in the section entitled "Methods of preparing a polypeptide of the invention" . Also, the glycosylation may be achieved in the human body when using a nucleotide sequence encoding the polypeptide of the invention in gene therapy.
In vitro glycosylation can be achieved by attaching chemically synthesized oligosaccharide structures to the polypeptide using a variety of different chemistries e.g. the chemistries employed for attachment of PEG to proteins, wherein the oligosaccharide is linked to a functional group, optionally via a short spacer (see the section entitled Conjugation to a Non-Oligosaccharide Macromolecular Moiety). The irz vitro glycosylation can be carried out SUBSTITUTE SHEET (RULE 26) in a suitable buffer at pH 4-7 in protein concentrations of 0.5-2 mg/ml and a volume of 0.02-2 ml. The activated mannose compound is present in 2-200 fold molar excess, and reactions are incubated at 4-25°C for periods of 0.1-3 hours. h2 vitro glycosylated GCB polypeptides are purified by dialysis and standard chromatographic techniques.
Other i~ vitro glycosylation methods are described, for example in WO
87/05330, by Aplin etl al., CRC Crit Rev. Biochem., pp. 259-306, 1981, by Lundblad and Noyes, Chemical Ragents for Protein Modification, CRC Press Inc. Boca Raton, FI, by Yan and Wold, Biochemistry, 1984, Jul. 31: 23(I6): 3759-65, and by Doebber et al., J. Biol.
Chem., 257, pp2193-2199, 1982.
10 Furthermore, in vitro glycosylation to protein- and peptide-bound Gln-residues can be carried out by transglutaminases (TGases). Transglutaminases catalyse the transfer of donor amine-groups to protein- and peptide-bound Gln-residues in a so-called cross-linking reaction.
The donor-amine groups can be protein- or peptide-bound e.g. as the E-amino-group in Lys-residues or it can be part of a small or large organic molecule. An example of a small organic 15 molecule functioning as amino-donor in TGase-catalysed cross-linking is putrescine (1,4-diaminobutane). An example of a larger organic molecule functioning as amino-donor in TGase-catalysed cross-linking is an amine-containing PEG (Sato et al., Biochemistry 35, 1996, 13072-13080).
TGases, in general, are highly specific enzymes, and not every Gln-residues exposed on 2o the surface of a protein is accessible to TGase-catalysed cross-linking to amino-containing substances. In order to render a protein susceptible to TGase-catalysed cross-linking reactions stretches of amino acid sequence known to function very well as TGase substrates are inserted at convenient positions in the amino acid sequence encoding a GCB polypeptide.
Several amino acid sequences are known to be or to contain excellent natural TGase substrates e.g.
25 substance P, elafin, fibrinogen, fibronectin, a,~-plasmin inhibitor, a-caseins, and (3-caseins and may thus be inserted into and thereby constitute part of the amino acid sequence of a polypeptide of the invention.
The nature and number of oligosaccharide moieties of a glycosylated polypeptide of the invention may be determined by a number of different methods known in the art e.g.by lectin 3o binding studies (Reddy et al., 1985, Biochem. Med. 33: 200-210; Cummings, 1994, Meth.
Enzymol. 230: 66-86; Protein Protocols (Walker ed.), 1998, chapter 9); by reagent array analysis method (RAAM) sequencing of released oligosaccharides (Edge et aL, I992, Proc.
Natl. Acad. Sci. USA 89: 6338-6342; Prime et al., 1996, J. Chrom. A 720: 263-274); by RAAM sequencing of released oligosaccharides in combination with mass spectrometry SUBSTITUTE SHEET (RULE 26) (Klausen, et al., 1998, Molecular Biotechnology 9: 195-204); or by combining proteolytic degradation, glycopeptide purification by HPLC, exoglycosidase degradations and mass spectrometry (Krogh et al, 1997, Eur. J. Biochem. 244: 334-342). Specific methods for determining the glycosylation profile is described in the examples section hereinafter.
Normally, the glycosylated polypeptide of the invention comprises 1-15 oligosaccharide moieties, such as 1-10 or 1-6 oligosachharide moieties. Usually, at least one of these is attached to the peptide addition and further oligosaccharide structures are attached to the peptide addition or the polypeptide Pp.
Polypeptide of the if2vention corzjugated to a second non peptide moiety It can be advantageous that the glycosylated polypeptide of the invention further comprises at least one second non-peptide moiety. The term "second non-peptide moeity" is intended to indicate a non-peptide moiety different from an oligosaccharide moiety, e.g. a polymer molecule, a lipophilic compound and an organic derivatizing agent.
For this purpose the polypeptide must comprise at least one attachment group for the second non-peptide moiety. The attachment group can be one present on an amino acid residue, e.g., selected from the group consisting of the N-terminal or C-terminal amino acid residue of the polypeptide of the invention, lysine, cysteine, arginine, glutamine, aspartic acid, glutamic acid, serine, tyrosine, histidine, phenylalanine and tryptophan, or on an oligosaccharide moiety attached to the polypeptide. For instance, the attachment group for the non-peptide moiety is an epsilon-amino group.
It will be understood that an attachment group for the second non-peptide moiety may be provided by the N-terminal peptide addition, within the polypeptide Pp, andlor as a C-terminal peptide addition (having similar properties to those described above for the peptide addition X). In one embodiment, the peptide addition X comprising or contributing to an attachment site further comprises an attachment group for a second non-peptide moeity. For instance, the peptide addition may comprise 1-20, such as 1-10 attachment groups for a second non-peptide moiety. Such attachment groups may be distributed in a similar manner as that described immediately above for glycosylation sites. Also, the peptide addition X can comprise at least two attachment groups for the second non-peptide moiety.
Also, the polypeptide Pp can be a variant of a native polypeptide, which as compared to said native polypeptide, comprises at least one introduced andlor at least one removed attachment group for the second non-peptide moiety. For instance, the polypeptide Pp SUBSTITUTE SHEET (RULE 26) comprises at least one introduced attachment group, in particular 1-5 introduced attachment groups, such as 2-5 introduced attachment groups.
The attachment group is preferably located in a position that is exposed at the surface of the folded protein and thus accessible for conjugation to the polymer molecule. For instance, attachment to one or more polymer molecules increases the molecular weight of the polypeptide and can further serve to shield one or more epitopes thereof. The polymer molecule may be any of the molecules mentioned in the section entitled "Conjugation to a polymer molecule", but is preferably selected from the group consisting of linear or branched polyethylene glycol or polyalkylene oxide. Most preferably, the polymer molecule is mPEG-lo SPA, mPEG-SCM, mPEG-BTC from Shearwater Polymers, Inc, SC-PEG from Enzon, Inc., tresylated mPEG (US 5,880,255) or oxycarbonyl-oxy-N-dicarboxyimide PEG (US
5,122,614) (and the relevant attachment group is one present on a lysine or N-terminal residue).
Alternatively, the polymer molecule is an activated PEG molecule reactive with a cysteine residue, e.g. VS-PEG from Shearwater Polymers.
Especially, when the polypeptide Pp is an' industrial enzyme, the second non-peptide moiety may be one which is capable of cross-linking and thereby of being immobilized on a suitable solid support. Such cross-linking polymers are available from Shearwater Polymers, Inc. It will be understood that the peptide addition of the polypeptide according to this embodiment comprises an attachment group for the cross-linking polymer in question. In 2o connection with this embodiment the polypeptide Pp is preferably an amyloglucosidase, an alpha-amylase, a glucose isomerase, an amidase, or a lipolytic enzyme.
In the following sections "Conjugation to a lipophilic compound", "Conjugation to a polymer molecule", and "Conjugation to an organic derivatizing agent"
conjugation to specific types of non-peptide moieties is described.
It will be understood that a conjugation step of any method of the invention only finds relevance when a non-polypeptide moiety other than an ire vivo attached oligosaccharide moiety is to be conjugated to the polypeptide, since in vivo glycosylation takes place during the expression step when using an appropriate glycosylating host cell as expression host.
Accordingly, whenever a conjugation step occurs in the present invention this is intended to be 3o conjugation to a non-polypeptide moiety other than an oligosaccharide moiety attached by in vivo glycosylation during expression in a glycosylating organism. In vitro glycosylation methods are described in the section entitled "glycosylation".
Conjugation to a lipophilzc compound SUBSTITUTE SHEET (RULE 26) The polypeptide and the lipophilic compound can be conjugated to each other, either directly or by use of a linker. The lipophilic compound can be a natural compound such as a saturated or unsaturated fatty acid, a fatty acid diketone, a terpene, a prostaglandin, a vitamine, a carotenoide or steroide, or a synthetic compound such as a carbon acid, an alcohol, an amine and sulphonic acid with one or more alkyl-, aryl-, alkenyl- or other multiple unsaturated compounds. Furthermore, the lipophilic compound may be any of the lipophilic substituents disclosed in WO 97/31022, the contents of which are incorporated herein by reference. The conjugation between the polypeptide and the lipophilic compound, optionally through a linker can be done according to methods known in the art, e.g. as described by Bodanszky in Peptide 1o Synthesis, John Wiley, New York, 1976 and in WO 96/12505 and further as described in WO
97!31022.
Cofijugatiora to a polywer molecule The polymer molecule to be coupled to the polypeptide of the invention can be any suitable polymer molecule, such as a natural or synthetic homo-polymer or heteropolymer, typically with a molecular weight in the range of 300-100,000 Da, such as 300-20,000 Da, more preferably in the range of 500-10,000 Da, even more preferably in the range of 500-5000 Da.
Examples of homo-polymers include a polyol (i.e. poly-OH), a polyamine (i.e.
poly-NH~) and a polycarboxylic acid (i.e. poly-COOH). A hetero-polymer is a polymer that 2o comprises different coupling groups, such as a hydroxyl group and an amine group.
Examples of suitable polymer molecules include polymer molecules selected from the group consisting of polyalkylene oxide (PAO), including polyalkylene glycol (PAG), such as polyethylene glycol (PEG) and polypropylene glycol (PPG), branched PEGs, poly-vinyl alcohol (PVA), poly-carboxylate, poly-(vinylpyrolidone), polyethylene-co-malefic acid anhydride, polystyrene-co-malic acid anhydride, dextran, including carboxymethyl-dextran, or any other biopolymer suitable for the intended purpose, such as for reducing immunogenicity and/or increasing functional ih vivo half-life and/or serum half life, or for providing immobilization properties to the polypeptide (as discussed in the section entitled "Polypeptide of interest". Another example of a polymer molecule is human albumin or another abundant 3o plasma protein. Generally, polyalkylene glycol-derived polymers are biocompatible, non-toxic, non-antigenic, non-immunogenic, have various water solubility properties, and are easily excreted from living organisms.
PEG is the preferred polymer molecule for reducing immunogenicity, allergenicity andlor increasing half-life, since it has only few reactive groups capable of cross-linking SUBSTITUTE SHEET (RULE 26) compared, e.g., to polysaccharides such as dextran, and the like. In particular, monofunctional PEG, e.g. methoxypolyethylene glycol (mPEG), is of interest since its coupling chemistry is relatively simple (only one reactive group is available for conjugating with attachment groups on the polypeptide). Consequently, the risk of cross-linking is eliminated, the resulting polypeptide conjugates are more homogeneous and the reaction of the polymer molecules with the polypeptide is easier to control.
To effect covalent attachment of the polymer molecules) to the polypeptide, the hydroxyl end groups of the polymer molecule must be provided in activated form, i.e. with reactive functional groups. Suitable activated polymer molecules are commercially available, e.g. from Shearwater Polymers, Inc., Huntsville, AL, USA. Alternatively, the polymer molecules can be activated by conventional methods known in the art, e.g. as disclosed in WO
90/13540. Specific examples of activated linear or branched polymer molecules for use in the present invention are described in the Shearwater Polymers, Inc. 1997 and 2000 Catalogs (Functionalized Biocompatible Polymers for Research and pharmaceuticals, Polyethylene Glycol and Derivatives, incorporated herein by reference). Specific examples of activated PEG
polymers include the following linear PEGs: NHS-PEG (e.g. SPA-PEG, SSPA-PEG, SBA-PEG, SS-PEG, SSA-PEG, SC-PEG, SG-PEG, and SCM-PEG), and NOR-PEG), BTC-PEG, EPOX-PEG, NCO-PEG, NPC-PEG, CDI-PEG, ALD-PEG, TRES-PEG, VS-PEG, IODO-PEG, and MAL-PEG, and branched PEGs such as PEG2-NHS and those disclosed in US
5,932,462 2o and US 5,643,575, both of which are incorporated herein by reference.
Furthermore, the following publications, incorporated herein by reference, disclose useful polymer molecules and/or PEGylation chemistries: US 5,824,778, US 5,476,653, WO 97/32607, EP
229,108, EP
402,378, US 4,902,502, US 5,281,698, US 5,122,614, US 5,219,564, WO 92/16555, WO
94/04193, WO 94/14758, WO 94/17039, WO 94/18247, WO 94128024, WO 95/00162, WO
95/11924, W095/13090, WO 95/33490, WO 96/00080, WO 97/18832, WO 98/41562, WO
98/48837, WO 99/32134, WO 99/32139, WO 99/32140, WO 96/40791, WO 98/32466, WO
95/06058, EP 439 508, WO 97/03106, WO 96/21469, WO 95/13312, EP 921 131, US
5,736,625, WO 98/05363, EP 809 996, US 5,629,384, WO 96/41813, WO 96/07670, US
5,473,034, US 5,516,673, EP 605 963, US 5,382,657, EP 510 356, EP 400 472, EP

3o and EP 154 316.
The conjugation of the polypeptide and the activated polymer molecules is conducted by use of any conventional method, e.g. as described in the following references (which also describe suitable methods for activation of polymer molecules): R.F. Taylor, (1991), "Protein immobilisation. Fundamental and applications", Marcel Dekker, N.Y.; S.S. Wong, (1992), SUBSTITUTE SHEET (RULE 26) "Chemistry of Protein Conjugation and Crosslinking", CRC Press, Boca Raton;
G.T.
Hermanson et al., (1993), "Immobilized Affinity Ligand Techniques", Academic Press, N.Y.).
The skilled person will be aware that the activation method and/or conjugation chemistry to be used depends on the attachment groups) of the polypeptide (examples of which are given 5 further above), as well as the functional groups of the polymer (e.g. being amine, hydroxyl, carboxyl, aldehyde, sulfydryl, succinimidyl, maleimide, vinysulfone or haloacetate). The PEGylation can be directed towards conjugation to all available attachment groups on the polypeptide (i.e. such attachment groups that are exposed at the surface of the polypeptide) or can be directed towards one or more specific attachment groups, e.g. the N-terminal amino to group (US 5,985,265). Furthermore, the conjugation can be achieved in one step or in a stepwise manner (e.g. as described in WO 99/55377).
It will be understood that the PEGylation is designed so as to produce the optimal molecule with respect to the number of PEG molecules attached, the size and form of such molecules (e.g. whether they are linear or branched), and where in the polypeptide such 15 molecules are attached. For instance, the molecular weight of the polymer to be used can be chosen on the basis of the desired effect to be achieved. For instance, if the primary purpose of the conjugation is to achieve a polypeptide having a high molecular weight (e.g. to reduce renal clearance) it is usually desirable to conjugate as few high Mw polymer molecules as possible to obtain the desired molecular weight. When a high degree of epitope shielding is desirable this 2o can be obtained by use of a sufficiently high number of low molecular weight polymer molecules (e.g. with a molecular weight of about 5,000 Da) to effectively shield all or most epitopes of the polypeptide. For instance, 2-8, such as 3-6 such polymers can be used.
In connection with conjugation to only a single attachment group on the protein (as described in US 5,985,265), it can be advantageous that the polymer molecule, which can be 25 linear or branched, has a high molecular weight, e.g. about 20 kDa.
Normally, the polymer conjugation is performed under conditions aiming at reacting all available polymer attachment groups with polymer molecules. Typically, the molar ratio of activated polymer molecules to polypeptide is up to about 1000-1, in particular 200-1, preferably 100-1, such as 10-1 or 5-1, but also equimolar ratios can be used in order to obtain 30 optimal reaction.
It is also contemplated according to the invention to couple the polymer molecules to the polypeptide through a linker. Suitable linkers are well known to the skilled person. A
preferred example is cyanuric chloride (Abuchowski et al., (1977), J. Biol.
Chem., 252, 3578-3581; US 4,179,337; Shafer et al., (1986), J. Polym. Sci. Polym. Chem.
Ed., 24, 375-378.
SUBSTITUTE SHEET (RULE 26) Subsequent to the conjugation residual activated polymer molecules are blocked according to methods known in the art, e.g. by addition of primary amine to the reaction mixture, and the resulting inactivated polymer molecules are removed by a suitable method.
In a specific embodiment, the polypeptide of the invention is one that comprises one or more PEG molecules attached to the peptide addition, but not to the polypeptide P. For instance, the PEG molecule is attached to one or more cysteine residues present in the peptide addition X and, if necessary, one or more cysteine residues have been removed from the polypeptide P of interest in order to avoid conjugation thereto.
In another specific embodiment, the polypeptide of the invention comprises at least one l0 PEG molecule attached to a lysine residue of the peptide addition X, in particular a linear or branched PEG molecule with a molecular weight of at least 5kDa.
Methods of preparing a polypeptide of the ifZVeratioyz The invention further comprises a method of producing the polypeptide of the invention, which method comprises culturing a host cell transformed or transfected with a nucleotide sequence encoding the polypeptide under conditions permitting the expression of the polypeptide, and recovering the polypeptide from the culture.
Apart from recombinant production, polypeptides of the invention may be produced, albeit less efficiently, by chemical synthesis or a combination of chemical synthesis and recombinant DNA technology.
The nucleotide sequence of the invention encoding a polypeptide of the invention may be constructed by isolating or synthesizing a nucleotide sequence encoding the parent polypeptide and fusing a nucleotide sequence encoding the relevant peptide addition in accordance with established technologies. To the extent amino acid modifications are to be made in the parent polypeptide, these are conveniently done by mutagenesis, e.g. using site-directed mutagenesis in accordance with well-known methods, e.g. as described in Nelson and Long, Analytical Biochemistry 180, 147-151, 1989, random mutagenesis or shuffling.
The nucleotide sequence may be prepared by chemical synthesis, e.g. by using an oligonucleotide synthesizer, wherein oligonucleotides are designed based on the amino acid sequence of the desired polypeptide, and preferably selecting those codons that are favoured in the host cell in which the recombinant polypeptide will be produced. For example, several small oligonucleotides coding for portions of the desired polypeptide may be synthesized and assembled by polymerase chain reaction (PCR), ligation or ligation chain reaction (LCR). The individual oligonucleotides typically contain 5' or 3' overhangs for complementary assembly.
SUBSTITUTE SHEET (RULE 26) Once assembled (by synthesis, site-directed mutagenesis or another method), the nucleotide sequence encoding the polypeptide may be inserted into a recombinant vector and operably linked to control sequences necessary for expression of thereof in the desired transformed host cell.
It should of course be understood that not all vectors and expression control sequences function equally well to express the nucleotide sequence encoding the polypeptide part of the invention. Neither will all hosts function equally well with the same expression system.
However, one of skill in the art may make a selection among these vectors, expression control sequences and hosts without undue experimentation. For example, in selecting a vector, the l0 host must be considered because the vector must replicate in it or be able to integrate into the chromosome. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered. In selecting an expression control sequence, a variety of factors should also be considered. These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the nucleotide sequence encoding the polypeptide, particularly as regards potential secondary structures. Hosts should be selected by consideration of their compatibility with the chosen vector, the toxicity of the product coded for by the nucleotide sequence, their secretion characteristics, their ability to fold the polypeptide correctly, their fermentation or culture requirements, and the ease of purification of the products coded for by the nucleotide sequence.
The recombinant vector may be an autonomously replicating vector, i.e. a vector existing as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector is one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosomes) into which it has been integrated.
The vector is preferably an expression vector, in which the nucleotide sequence encoding the polypeptide of the invention is operably linked to additional segments required for transcription of the nucleotide sequence. The vector is typically derived from plasmid or viral DNA. A number of suitable expression vectors for expression in the host cells mentioned 3o herein are commercially available or described in the literature. Useful expression vectors for eukaryotic hosts, include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Specific vectors are, e.g., pCDNA3.1(+)~Iiyg (Invitrogen, Carlsbad, CA, USA) and pCI-neo (Stratagene, La Jolla, CA, USA). Useful expression vectors for yeast cells include the 2~, plasmid and derivatives thereof, SUBSTITUTE SHEET (RULE 26) the POT1 vector (US 4,931,373), the pJSO37 vector described in (Okkels, Ann.
New York Acad. Sci. 782, 202-207, 1996) and pPICZ A, B or C (Invitrogen, Carlsbad, CA, USA). Useful vectors for insect cells include pVL941, pBG311 (Gate et al., "Isolation of the Bovine and Human Genes for Mullerian Inhibiting Substance And Expression of the Human Gene In Animal Cells", Cell, 45, pp. 685-98 (1986), pBluebac 4.5 and pMelbac (both available from Invitrogen, Carlsbad, CA, USA).
Other vectors for use in this invention include those that allow the nucleotide sequence encoding the polypeptide of the invention to be amplified in copy number. Such amplifiable vectors are well known in the art. They include, for example, vectors able to be amplified by to DHFR amplification (see, e.g., Kaufman, U:S. Pat. No. 4,470,461, Kaufman and Sharp, "Construction Of A Modular Dihydrafolate Reductase cDNA Gene: Analysis Of Signals Utilized For Efficient Expression", Mol. Cell. Biol., 2, pp. 1304-19 (1982)) and glutamine synthetase ("GS") amplification (see, e.g., US 5,122,464 and EP 338,841).
The recombinant vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question. An example of such a sequence (when the host cell is a mammalian cell) is the SV40 origin of replication. When the host cell is a yeast cell, suitable sequences enabling the vector to replicate are the yeast plasmid 2~, replication genes REP 1-3 and origin of replication.
The vector may also comprise a selectable marker, e.g. a gene the product of which 2o complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P.R. Russell, Gene 40, 1985, pp. 125-130), or one which confers resistance to a drug, e.g.
ampicillin, kanamycin, tetracyclin, chloramphenicol, neomycin, hygromycin or methotrexate. For filamentous fungi, selectable markers include amdS, pyre, arcB, niaD, sC.
The term "control sequences" is defined herein to include all components, which are necessary or advantageous for the expression of the polypeptide of the invention. Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, enhancer or upstream activating sequence, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter operably linked to the nucleotide sequence encoding the polypeptide.
"Operably linked" refers to the covalent joining of two or more nucleotide sequences, by means of enzymatic ligation or otherwise, in a configuration relative to one another such that the normal function of the sequences can be performed. For example, the nucleotide SUBSTITUTE SHEET (RULE 26) sequence encoding a presequence or secretory leader is operably linked to a nucleotide sequence for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide: a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the nucleotide sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adaptors or linkers are used, in conjunction with standard recombinant DNA methods.
1o A wide variety of expression control sequences may be used in the present invention.
Such useful expression control sequences .include the expression control sequences associated with structural genes of the foregoing expression vectors as well as any sequence known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
Examples of suitable control sequences for directing transcription in mammalian cells include the early and late promoters of SV40 and adenovirus, e.g. the adenovirus 2 major late promoter, the MT-1 (metallothionein gene) promoter, the human cytomegalovirus immediate-early gene promoter (CMV), the human elongation factor la (EF-la) promoter, the Drosoplaila minimal heat shock protein 70 promoter, the Rous Sarcoma Virus (RSV) promoter, 2o the human ubiquitin C (UbC) promoter, the human growth hormone terminator, SV40 or adenovirus Elb region polyadenylation signals and the Kozak consensus sequence (Kozak, M.
J Mol Biol 1987 Aug 20;196(4):947-50).
In order to improve expression in mammalian cells a synthetic intron may be inserted in the 5' untranslated region of the nucleotide sequence encoding the polypeptide of the invention. An example of a synthetic intron is the synthetic intron from the plasmid pCI-Neo (available from Promega Corporation, WI, USA).
Examples of suitable control sequences for directing transcription in insect cells include the polyhedrin promoter, the P10 promoter, the Autographa califonZica polyhedrosis virus basic protein promoter, the, baculovirus immediate early gene 1 promoter and the baculovirus 39K delayed-early gene promoter, and the SV40 polyadenylation sequence.
Examples of suitable control sequences for use in yeast host cells include the promoters of the yeast a-mating system, the yeast triose phosphate isomerase (TP~
promoter, promoters from yeast glycolytic genes or alcohol dehydogenase genes, the ADH2-4c promoter and the inducible GAL promoter.
SUBSTITUTE SHEET (RULE 26) Examples of suitable control sequences for use in filamentous fungal host cells include the ADH3 promoter and terminator, a promoter derived from the genes encoding Aspergillus oryzae TAKA amylase triose phosphate isomerase or alkaline protease, an A.
niger a-amylase, A. Niger or A. nidulafZS glucoamylase, A. >zidulans acetamidase, Rhizomucor nzielzei aspartic 5 proteinase or lipase, the TPI1 terminator and the ADH3 terminator.
The nucleotide sequence of the invention may or may not also include a nucleotide sequence that encode a signal peptide. The signal peptide is present when the polypeptide is to be secreted from the cells in which it is expressed. Such signal peptide, if present, should be one recognized by the cell chosen for expression of the polypeptide. The signal peptide may be l0 homologous (e.g. be that normally associated with the parent polypeptide in question) or heterologous (i.e. originating from another source than the parent polypeptide) to the polypeptide or may be homologous or heterologous to the host cell, i.e. be a signal peptide normally expressed from the host cell or one which is not normally expressed from the host cell. Accordingly, the signal peptide may be prokaryotic, e.g. derived from a bacterium, or 15 eukaryotic, e.g. derived from a mammalian, or insect, filamentous fungal or yeast cell.
The presence or absence of a signal peptide will, e.g., depend on the expression host cell used for the production of the polypeptide, the protein to be expressed (whether it is an intracellular or extracelluar protein) and whether it is desirable to obtain secretion. For use in filamentous fungi, the signal peptide may conveniently be derived from a gene encoding an 20 Aspergillus sp. amylase or glucoamylase, a gene encoding a Rhizomucor nziehei lipase or protease or a Humicola lazzuginosa lipase. The signal peptide is preferably derived from a gene encoding A. oryzae TAKA amylase, A. zziger neutral oc-amylase, A. niger acid-stable amylase, or A. rziger glucoamylase. For use in insect cells, the signal peptide may conveniently be derived from an insect gene (cf. WO 90/05783), such as the lepidopteran Manduca sexta 25 adipokinetic hormone precursor, (cf. US 5,023,328), the honeybee melittin (Invitrogen, Carlsbad, CA, USA), ecdysteroid UDPglucosyltransferase (egt) (Murphy et al., Protein Expression and Purification 4, 349-357 (1993) or human pancreatic lipase (hpl) (Methods in Enzymology 284, pp. 262-272, 1997).
Specific examples of signal peptides for use in mammalian cells include that of human 30 glucocerebrosidase apparent from the examples hereinafter or the murine Ig kappa light chain signal peptide (Coloma, M (1992) J. Imrn. Methods 152:89-104). For use in yeast cells suitable signal peptides have been found to be the a-factor signal peptide from S.
cereviczae. (cf. US
4,870,008), the signal peptide of mouse salivary amylase (cf. O. Hagenbuchle et al., Nature 289, 1981, pp. 643-646), a modified carboxypeptidase signal peptide (cf. L.A.
SUBSTITUTE SHEET (RULE 26) Valls et al., Cell 48, 1987, pp. 887-897), the yeast BAR1 signal peptide (cf.
WO 87/02670), and the yeast aspartic protease 3 (YAP3) signal peptide (cf. M. Egel-Mitani et al., Yeast 6, 1990, pp. 127-137).
Any suitable host may be used to produce the polypeptide of the invention, including bacteria, fungi (including yeasts), plant, insect, mammal, or other appropriate animal cells or cell lines, as well as transgenic animals or plants. When a non-glycosylating organism such as E. coli is used, and the polypeptide is to be a glycosylated polypeptide, the expression in E. coli is preferably followed by suitable izz vitro glycosylation.
Examples of bacterial host cells include grampositive bacteria such as strains of to Bacillus, e.g. B. brevis or B. subtilis, Pseudomozzas or Streptomyces, or gramnegative bacteria, such as strains of E. coli. The introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular Gefzeral Gezzetics 168: 111-115), using competent cells (see, e.g., Young and Spizizin, 1961, Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechzziques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, Jounzal of Bacteriology 169: 5771-5278).
Examples of suitable filamentous fungal host cells include strains of Aspergillus, e.g. A.
oryzae, A. sZiger, or A. z2idulans, Fusarium or Trichodenzza. Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and US 5,679,543. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156 and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.L, editors, Guide to Yeast Ge>zetics and Molecular Biology, Methods i>z Eszzyuzology, Volume 194, pp 182-187, Academic Press, Inca, New York;
Ito et al., 1983, Jounzal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedi>zgs of the NatiofZal Academy of Sciences USA 75: 1920.
When the polypeptide of the invention is to be in vivo glycosylated, the host cell is 3o selected from a group of host cells capable of generating the desired glycosylation of the polypeptide. Thus, the host cell may advantageously be selected from a yeast cell, insect cell, or mammalian cell.
Examples of suitable yeast host cells include strains of Saccharomyces, e.g.
S. cerevisiae, Schizosacclzaronzyces, Klyveronzyces, Pichia, such as P. pastoris or P.
methanolica, SUBSTITUTE SHEET (RULE 26) Haf2senula, such as H. polymorpha or yarrowia. Of particular interest are yeast glycosylation mutant cells, e.g. derived from S. cereviciae, P. pastoris or Hahsenula spp.
(e.g. the S.
cereviciae glycosylation mutants ochl, ochi mnml or ochl mnml alga described by Nagasu et al. Yeast 8, 535-547, 1992 and Nakanisho-Shindo et al. J. Biol. Chem. 268, 26338-26345, 1993). Methods for transforming yeast cells with heterologous DNA and producing heterologous polypeptides therefrom are disclosed by Clontech Laboratories, Inc, Palo Alto, CA, USA (in the product protocol for the Yeastmaker~ Yeast Tranformation System Kit), and by Reeves et al., FEMS Microbiology Letters 99 (1992) 193-198, Manivasakam and Schiestl, Nucleic Acids Research, 1993, Vol. 21, No. 18, pp. 4414-4415 and Ganeva et al., FEMS
to Microbiology Letters 121 (1994) 159-164.
Examples of suitable insect host cells include a Lepidoptora cell line, such as Spodoptera frugiperda (Sf9 or Sf21) or Trichoplusia ~i cells (High Five) (US
5,077,214).
Transformation of insect cells and production of heterologous polypeptides therein may be performed as described by Invitrogen, Carlsbad, CA, USA.
Examples of suitable mammalian host cells include Chinese hamster ovary (CHO) cell lines, (e.g. CHO-K1; ATCC CCL-61), Green Monkey cell lines (COS) (e.g. COS 1 (ATCC
CRL-1650), COS 7 (ATCC CRL-1651)); mouse cells (e.g. NS/O), Baby Hamster Kidney (BHK) cell lines (e.g. ATCC CRL-1632 or ATCC CCL-10), and human cells (e.g. HEK 293 (ATCC
CRL-1573)), as well as plant cells in tissue culture. Additional suitable cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Rockville, Maryland. Of interest for the present purpose are a mammalian glycosylation mutant cell line, such as CHO-LEC1, CHOL-LEC2 or CHO-LEC18 (CHO-LEC1: Stanley et al.
Proc.
Natl. Acad. USA 72, 3323-3327, 1975 and Grossmann et al., J. Biol. Chem. 270, 29378-29385, 1995, CHO-LEC18: Raju et al. J. Biol. Chem. 270, 30294-30302, 1995).
Methods for introducing exogeneous DNA into mammalian host cells include calcium phosphate-mediated transfection, electroporation, DEAF-dextran mediated transfection, liposome-mediated transfection, viral vectors and the transfection method described by Life Technologies Ltd, Paisley, UK using Lipofectamin 2000. These methods are well known in the art and e.g. described by Ausbel et al. (eds.), 1996, Current Protocols in Molecular Biology, 3o John Wiley & Sons, New York, USA. The cultivation of mammalian cells are conducted according to established methods, e.g. as disclosed in (Animal Cell Biotechnology, Methods and Protocols, Edited by Nigel Jenkins, 1999, Human Press Inc, Totowa, New Jersey, USA
and Harrison MA and Rae 1F, General Techniques of Cell Culture, Cambridge University Press I997). .
SUBSTITUTE SHEET (RULE 26) In the production methods of the present invention, cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art. For example, cells are cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermenters performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art.
Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the to polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
The resulting polypeptide may be recovered by methods known in the art. For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.
The polypeptides may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or 2o extraction (see, e.g., Proteizz Purification, J-C Janson and Lars Ryden, editors, VCH
Publishers, New York, 1989).
Other methods of the ifzveyztiofz In accordance with a specific aspect a nucleotide sequence encoding the polypeptide of the invention is prepared by a method comprising a) subjecting a nucleotide sequence encoding the polypeptide Pp to elongation mutagenesis, b) expressing the mutated nucleotide sequence obtained in step a) in a suitable host cell, optionally c) conjugating polypeptides expressed in step b) to a second non-peptide moiety, d) selecting polypeptides of step b) or c) which comprises at least one oligosaccharide moiety and optionally second non-peptide moiety attached to the peptide addition part of the polypeptide, and e) isolating a nucleotide sequence encoding the polypeptide selected in step d).
SUBSTITUTE SHEET (RULE 26) In the present context the term "elongation mutagenesis" is intended to indicate any manner in which the nucleotide sequence encoding the parent polypeptide Pp can be extended to further encode the peptide addition. For instance, a nucleotide sequence encoding a peptide addition of a suitable length may be synthesized and fused to a nucleotide sequence encoding the polypeptide Pp: The resulting fused nucleotide sequence may then be subjected to further modification by any suitable method, e.g. one which involves gene shuffling, other recombination between nucleotide sequences, random mutagenesis, random elongation mutagenesis or any combination of these methods. Such methods are further described in the Methods section herein.
l0 The expression and optional conjugation steps are conducted as described in further detail elsewhere in the present application, and the selection step d) using any suitable method available in the art.
In one embodiment the above method further comprises screening polypeptides resulting from step b) or c) for at least one improved property, in particular any of those improved properties listed herein, prior to the selection step, and wherein the selection step d) further comprises selecting polypeptides having such improved property.
Furthermore, in the above method the elongation mutagenesis can be conducted so as to enrich for codons encoding a glycosylation site and/or an amino acid residue comprising an attachment group for a second non-peptide moiety., in particular an ifz vivo glycosylation site.
2o Still further, the above method can comprise subjecting the part of the nucleotide sequence encoding the polypeptide Pp of interest to mutagenesis to remove and/or introduce glycosylation sites) and/or amino acid residues) comprising an attachment group for the second non-peptide moiety. The nucleotide sequence may be subjected to any type of mutagenesis, e.g. any of those described herein. The mutagenesis of the nucleotide sequence encoding the polypeptide Pp of interest can be conducted prior to assembling the sequence with that encoding the peptide addition, concomitantly with or after any mutagenesis of the peptide addition part of the assembled nucleotide sequence.
In a further aspect, the invention relates to a method of producing a glycosylated polypeptide encoded by a nucleotide sequence of the invention prepared by the above method, wherein the nucleotide sequence encoding the polypeptide selected in step c) is expressed in a glycosylating host cell and the resulting glycosylated expressed polypeptide is recovered.
In a still further aspect the invention relates to a method of improving one or more selected properties of a polypeptide Pp of interest, which method comprises SUBSTITUTE SHEET (RULE 26) a) preparing a nucleotide sequence encoding a polypeptide comprising or consisting essentially of the primary structure NH2-X-Pp-COOH, wherein X is a peptide addition comprising or contributing to a glycosylation site and/or an attachment group for a second non-peptide moiety that is capable of conferring the selected improved propertylies to the polypeptide Pp, 1o b) expressing the nucleotide sequence of a) in an suitable host cell, optionally c) conjugating the expressed polypeptide of b) to a second non-peptide moiety, and d) recovering the polypeptide resulting from step b) or c).
For instance, the polypeptide is any of those described herein. For instance the nucleotide sequence of step a) is prepared by subjecting a nucleotide sequence encoding the 15 polypeptide Pp to elongation mutagenesis, e.g. to enrich for codons encoding an amino acid residue comprising or contributing to a glycosylation site and/or an attachment group for a second non-peptide moiety, in particular an irZ vivo glycosylation site. Also, in the preparation of the nucleotide. sequence of a), the part of the nucleotide sequence encoding the polypeptide Pp can be subjected to mutagenesis to remove and/or introduce glycosylation sites) and/or 2o attachment groups) for a second non-peptide moiety.
The method according to this aspect can further comprise a screening step (after step c)), wherein the polypeptide resulting from step b) or c) is screened for one or more improved properties, in particular any of those improved properties which are described hereinabove.
Usually, when a polypeptide has been selected in a screening step of a method of the 25 invention the nucleotide sequence encoding the polypeptide is isolated and used for expression of larger amounts of the polypeptide. The amino acid sequence of the resulting polypeptide is determined and the polypeptide may be subjected to conjugation in a larger scale.
Subsequently, the polypeptide is assayed with respect to the property to be improved.
3o Uses of a poly~eptide of the invention It will be understood that polypeptides of the invention can be used for a variety of purposes, depending on the type and nature of polypeptide. For instance, it is contemplated that a polypeptide of the invention prepared from a therapeutic polypeptide is useful for the same SUBSTITUTE SHEET (RULE 26) therapeutic purposes as the parent polypeptide, i.e. for the treatment of a particular disease.
Accordingly, the polypeptide of the invention may be formulated into a pharmaceutical composition. Also, when the polypeptide of the invention is an i~c vivo glycosylated polypeptide which does not comprise any other type of non-peptide moiety, a nucleotide sequence encoding the polypeptide can be used in gene therapy in accordance with established principles. When the polypeptide Pp is an antigen the polypeptide of the invention may be provided in the form of a vaccine.
METHODS
Nucleotide sequef2ee modifieatioyz methods For example, a peptide addition may be constructed from two or more nucleotide sequences encoding a polypeptide of interest with a peptide addition, the sequences being sufficiently homologous to allow recombination between the sequences, in particular in the part thereof encoding the peptide addition. The combination of nucleotide sequences or sequence parts is conveniently conducted by methods known in the art, for instance methods which involve homologous cross-over such as disclosed in US 5,093,257, or methods which involve gene shuffling, i.e., recombination between two or more homologous nucleotide sequences resulting 2o in new nucleotide sequences having a number of nucleotide alterations when compared to the starting nucleotide sequences. In order for homology based nucleic acid shuffling to take place the relevant parts of the nucleotide sequences are preferably at least 50%
identical, such as at least 60% identical, more preferably at least 70% identical, such as at least 80% identical. The recombination can be performed in vitro or in vivo. Examples of suitable in vitro gene shuffling methods are disclosed by Stemmer et al (1994), Proc. Natl. Acad.
Sci. USA; vol. 91, pp. 10747-10751; Stemmer (1994), Nature, vol. 370, pp. 389-391; Smith (1994), Nature vol.
370, pp. 324-325; Zhao et al., Nat. Biotechnol. 1998, Mar; 16(3): 258-61; Zhao H. and Arnold, FB, Nucleic Acids Research, 1997, Vol. 25. No. 6 pp. 1307-1308; Shao et al., Nucleic Acids Research 1998, Jan 15; 26(2): pp. 681-83; and WO 95/17413. Example of a suitable in vivo shuffling method is disclosed in WO 97/07205.
Furthermore, a peptide addition can be constructed by preparing a randomly mutagenized library, conveniently prepared by subjecting a nucleotide sequence encoding the polypeptide of the invention or the peptide addition to random mutagenesis to create a large SUBSTITUTE SHEET (RULE 26) number of mutated nucleotide sequences. While the random mutagenesis can be entirely random, both with respect to where in the nucleotide sequence the mutagenesis occurs and with respect to the nature of mutagenesis, it is preferably conducted so as to randomly mutate only the part of the sequence that encode the peptide addition. Also, the random mutagenesis can be directed towards introducing certain types of amino acid residues, in particular amino acid residues containing an attachment group, at random into the polypeptide molecule or at random into peptide addition part thereof. Besides substitutions, random mutagenesis can also cover random introduction of insertions or deletions. Preferably, the insertions are made in reading frame, e.g., by performing multiple introduction of three nucleotides as described by Hallet et to al., Nucleic Acids Res. 1997, 25(9):1866-7 and Sondek and Shrotle, Proc Natl. Acad. Sci USA
1992, 89(8):3581-5.
The random mutagenesis (either of the whole nucleotide sequence or more preferably the part thereof encoding the peptide addition) can be performed by any suitable method. For example, the random mutagenesis is performed using a suitable physical or chemical mutagenizing agent, a suitable oligonucleotide, PCR generated mutagenesis or any combination of these mutagenizing agentsand/or other methods according to state of the art technology, e.g. as disclosed in WO 97!07202.
Error prone PCR generated mutagenesis, e.g. as described by J.O. Deshler (1992), GATA 9(4): 103-106 and Leung et al., Technique (1989) Vol. 1, No. 1, pp. 11-15, is particularly useful for mutagenesis of longer peptide stretches (corresponding to nucleotide sequences containing more than 100 bp) or entire genes, and are preferably performed under conditions that increase the misincorporation of nucleotides.
Random mutagenesis based on doped or spiked oligonucleotides or by specific sequence oligonucleotides, is of particular use for mutagenesis of the part of the nucleotide sequence encoding the peptide addition.
Random mutagenesis of the part of the nucleotide sequence encoding the peptide addition can be performed using PCR generated mutagenesis, in which one or more suitable oligonucleotide primers flanking the area to be mutagenized are used. In addition, doping or spiking with oligonucleotides can be used to introduce mutations so as to remove or introduce 3o attachment groups for the relevant non-peptide moiety. State of the art knowledge and computer programs (e.g. as described by Siderovski DP and Mak TW, Comput.
Biol. Med.
(1993) Vol. 23, No. 6, pp. 463-474 and Jensen et al. Nucleic Acids Research, 1998, Vol. 26, No. 3) can be used for calculating the most optimal nucleotide mixture for a given amino acid preference. The oligonucleotides can be incorporated into the nucleotide sequence encoding the SUBSTITUTE SHEET (RULE 26) peptide addition by any published technique using e.g. PCR, LCR or any DNA
polymerase or ligase.
According to a convenient PCR method the nucleotide sequence encoding the polypeptide of the invention and in particular the peptide addition thereof is used as a template and, e.g., doped or specific oligonucleotides are used as primers. In addition, cloning primers localized outside the targetted region can be used. The resulting PCR product can either directly be cloned into an appropriate expression vector or gel purified and amplified in a second PCR reaction using the cloning primers and cloned into an appropriate expression vector.
1o In addition to the random mutagenesis methods described herein, it is occasionally useful to employ site specific mutagenesis techniques to modify one or more selected amino acids in the peptide addition, in particular to optimise the peptide addition with respect to the number of attachment groups.
Furthermore, random elongation mutagenesis as described by Matsuura et al, op cit can be used to construct a nucleotide sequence encoding a polypeptide having a C-terminal peptide addition. Construction of a nucleotide sequence encoding the polypeptide of the invention having an N-terminal peptide addition can be constructed in an analogous way.
Also, the methods disclosed in WO 97/04079, the contents of which are incorporated herein by reference, can be used for constructing a nucleotide sequence encoding the 2o polypeptide of the invention.
The nucleotide sequences) or nucleotide sequence regions) to be mutagenized is typically present on a suitable vector such as a plasmid or a bacteriophage, which as such is incubated with or otherwise exposed to the mutagenizing agent. The nucleotide sequences) to be mutagenized can also be present in a host cell either by being integrated into the genome of said cell or by being present on a vector harboured in the cell.
Alternatively, the nucleotide sequence to.be mutagenized is in isolated form. The nucleotide sequence is preferably a DNA
sequence such as a cDNA, genomic DNA or synthetic DNA sequence.
Subsequent to the incubation with or exposure to the mutagenizing agent, the mutated nucleotide sequence, normally in amplified form, is expressed by culturing a suitable host cell 3o carrying the nucleotide sequence under conditions allowing expression to take place. The host cell used for this purpose is one, which has been transformed with the mutated nucleotide sequence(s), optionally present on a vector, or one which carried the nucleotide sequence during the mutagenesis, or any kind of gene library.
SUBSTITUTE SHEET (RULE 26) Design of peptide addition One example of a useful guide for designing an N-terminal peptide addition containing N-glycosylation sites is characterized by the following formula:
Xl(NX2[T/S])X3(NX2[T/S])n~.-I'1~
wherein each of Xl, X3 and X4 independently is absent or 1, 2, 3 or 4 amino acid residues of any type, X2 a single amino acid residue of any type except for proline, n any integer between 0 and 6, [T/S] a threonine or serine residue, preferably a threonine residue, and N and Pp has the meaning defined elsewhere herein. It has been found that sometimes the nature of the amino acid residue occupying position -1 to -4 relative to the N-residue of an N-glycosylation site to may be important for the degree to which said N-glycosylation site is used.
Accordingly, Xl, X3, and X4 may be chosen so as to obtain an increased utilization of the relevant site (as determined by a trial and error type of experiment). In a first step about 10 different muteins are made that has the above formula. For instance, the about 10 muteins are designed on the basis that each of Xl, X3 and X4independently is 1 or 2 alanine residues or is absent, Z any integer between 0 and 5, [T/S] threonine, and Alanine. Based on, e.g., in vitro bioactivity and half-life results obtained with these muteins (or any other relevant property), optimal numbers) of amino acids and glycosylation(s) can be determined and new muteins can be constructed based on this information. The process is repeated until an optimal glycosylated polypeptide is obtained.
2o Alternatively, random mutagenesis may be used for creating N-terminally extended polypeptides. For instance, a random mutagenized library is made on the basis of the above formula. Doped oligonucleotides are synthesized coding for one amino acid residue in position B (the amino acid residue being different from proline), each of Xl, X3, and X4 independently is 0, 1 or 2 amino acid residues of any type, n is 2 and T is threonine and used for constructing the random mutagenized library.
One example of a useful guide for designing an N-terminal peptide addition containing a PEGylation attachment group is characterized by the following formula using a lysine residue as an example of a PEGylation site. It will be understood that peptide additions with other attachment groups can be designed in an analogous way.
Y1(K)Y2(K)nY3-I'P
wherein each of Yl, Y2 and Y3 independently is 0, 1, 2, 3 or 4 amino acid residues of any type except lysine, n an integer between 0 and 6, K lysine, and Pp is as defined elsewhere herein.
SUBSTITUTE SHEET (RULE 26) In a first step about 10 different muteins are made that has the above formula. For instance, the about 10 muteins are designed on the basis that each of Yl, YZ
and Y3 independently is 1 or 2 alanine residues or is absent, n any integer between 0 and 5. The muteins are then PEGylated withl0 kDa PEG (e.g. using mPEG-SPA). Based on, e.g., izz vitro 5 bioactivity and half-life results obtained with these muteins (or any other relevant property), optimal numbers) of amino acids and PEGylation sites can be determined and new muteins can be constructed based on this information. The process is repeated until an optimal PEGylated polypeptide is obtained.
Alternatively, random mutagenesis may be performed by making a random l0 mutagenized library based on the above formula. Doped oligonucleotides are synthesized coding for one amino acid residue in position Yl, Y2° and/or Y3 independently is 0, 1 or 2 amino acid residues of any type, and n is 2 and used for constructing the random mutagenized library.
15 Glucocerebrosidase (GCB) Activity Assay using PNP-glucopyranoside substrate The enzymatic activity of recombinant GCB is measured using p-nitrophenyl-~3-D-glucopyranoside (PNP-Glu) as a substrate. Hydrolysis of the PNP-Glu substrate generates p-nitrophenyl, which can be quantified by measuring absorption at 405 nm using a spectrophotometer, as previously described (Friedmann et al., 1999, Blood 93;
2807-2816).
20 The assay is carried out under conditions which partially inhibit non-GCB
glucosidase activities, such conditions being achieved by using a phosphate/citrate buffer pH=5.5, 0.25 %
Triton X-100 and 0.25 % taurocholate.
The assay is run in a final volume of 200 ~l, containing GCB Activity Assay Buffer and 4 mM PNP-Glu. The enzymatic hydrolysis is initiated by adding GCB and the reaction is 25 allowed to proceed for 1 hour at 37°C before being stopped by adding 50 ~l 1 M NaOH and measuring absorption at 405 nm. A reference standard curve of p-nitrophenyl, assayed in parallel, is used to quantify concentrations of GCB in samples to be tested.
Irt vitro uptake and stability of GCB polypeptide in fzzacrophages 30 The murine monocyte/macrophage cells line, J774E (Mukhopadhyay and Stahl, Arch Biochem Biophys 1995 Dec 1;324(1):78-84 and Diment et al., JLeukoc Biol 1987 Nov;42(5):485-90) is used to study the uptake and stability of GCB
polypeptides. Cells are grown in alpha-MEM (supplemented with 10 % fetal calf serum, 1X Pen/Strep, and 60 ~.M 6-SUBSTITUTE SHEET (RULE 26) thioguanine), seeded (200,000 cells pr. well) in the above-mentioned media containing 10 p,M
conditol B epoxide, CBE (an irreversible GCB inhibitor) and incubated for 24 hr at 37°C.
Before starting the uptake assay, cells are washed in 0.5 ml HBSS (Hanks balanced salt solution). The uptake is done in a 200 ~l volume, containing the appropriate concentration of GCB polypeptide (a dosis response curve is made with GCB concentrations in the range of 25 400 mU/ml). As a control, yeast mannan (final concentration 1.4 mg/ml) is added to inhibit the uptake through the macrophage mannose receptor. The cells are incubated for 1 hr at 37°C and washed three times with 0.5 ml cold HBSS.
To measure the amount of GCB taken up by the J774E cells, cells are lyzed in 200 p1 1o GCB Activity Assay Buffer with 4 mM PMP-Glu and incubated for 1 hr at 37°C. Then, the hydrolysis is stopped by addition of 50 ~.1 1M NaOH and OD405 is measured. The data are analysed by non-linear regression using GraphPad Prizm 2.0 (GraphPad Software, San Diego, CA) To study the stability of GCB polypeptides in J774E cells, CBE treated cells are incubated with 400 mU/mI GCB for 1 hr at 37°C. Then, cells are washed 3 times in HBSS to remove extracellular GCB and incubated in HBSS. A time-course study is done by lyzing the cells after 30 min, 1 hr, 2 hr, 3hr, 4 hr, and 5 hr in 200 ~l GCB Activity Assay Buffer with 4mM PNP-Glu and incubating the samples for 1 hr at 37°C before stopping the hydrolysis with 50 ~1 1 M NaOH and measuring OD405. The data are analysed by non-linear regression using 2o GraphPad Prizm 2.0 (GraphPad Software, San Diego, CA).
Site-directed muta~enesis Constructions of site-directed mutations were performed using PCR with oligonucleotides containing the desired amino acid exchanges or additions (e.g. to introduce glycosylation sites).
The resulting PCR fragment was cloned into the GCB expression vector using approparite restriction enzymes and subsequently DNA sequenced in order to confirm that the construct contained the desired exchanges.
3o MATERIALS
GCB Activity Assay Buffer:
SUBSTITUTE SHEET (RULE 26) 120 mM phosphate/citrate buffer, pH=5.5, 1 mM EDTA, pH=8.0, 0.25 % Triton X-100, 0.25 % taurocholate, 4 mM ~3-mercaptoethanol pGC-12 vector pVL1392 (Pharmingen, USA) with GCB wt cDNA sequence (SEQ m NO 2) inserted between EcoRV and XbaI.
Table 1 Sequence of primers used for cloning the wt GCB coding region and inserting signal peptides into the pGCBmat plasmid as described in Example 1.
5049 (WT-sp-BgllI): 5'-CGCAGATCTGATGGCTGGCAGCCTCACAGGATTGC-3' 5050 (WT-stop-EcoRl): 5'-CCGGAATTCCCATCACTGGCGACGCCACAGGTAGGTG-3' 5051 (WT-mature-Sacl): 5'-ACGCGAGCTCGCCCCTGCATCCCTAAAAGCTTCGG-3' 5052 (SPegt-NheIlSacI-as): 5'-GCGTTGACGGCAGTCAGAGTTGACAGAAGGGCCAGCCAGCAAAGGATAGTCATG-3' S053 (SPegt-NheI/SacI-s): 5'-CTAGCATGACTATCCTTTGCTGGCTGGCCCTTCTGTCAACTCTGACTGCCGTCAACG
2o CAGCT-3' 5054 (SPegt-Nhei/SacI-as): 5'-CCTGCTACTGCTCCCAGCAGCAGTGAAAGAGTCCAAAGTGGCAGCATG-3' 5055 (SPegt-NheI/SacI-s): 5'-CTAGCATGCTGCCACTTTGGACTCTTTCACTGCTGCTGGGAGCAGTAGCAGGAGCT
-3' Cerezynae was kindly provided by Dr. E. Beutler, Scripps Institute, CA, USA.
J774E was kindly provided by G. Grabowski, Cincinnati, Ohio, US

SUBSTITUTE SHEET (RULE 26) PRODUCTION OF WT GCB
Cloning_and Expression in Insect Cells A human fibroblast cDNA library was obtained from Clontech (Human fibroblast skin cDNA
cloned in lambda-gtll, cat# HL1052b). Lambda DNA was prepared from the library by standard methods and used as a template in a PCR reaction with either 5049 and 5050 as primer (amplifies the GCB coding region with the human signal peptide from the second ATG) or S050 and 5051 as primer (amplifies the mature part of the GCB coding region) (see Table 1 in the Materials section).
to The PCR products were reamplified with the same primers and agarose gel purified.
Subsequently the 5049/50 PCR product was digested with BglII and EcoRI and cloned into the pBlueBac 4.5 vector (InVitrogenInvitrogen, Carlsbad, CA, USA, Carlsbad, CA, USA) digested with BamHI and EcoRI. Sequencing confirmed that the insert is identical to the wtGCB sequence as given in SEQ ID NO 2. The resulting plasmid was used for infection of insect cells with the GCB being partly secreted from the cells due to the human signal sequence as described in Martin et al., DNA 7, pp. 99-106, 1988. The 5050/51 PCR
product was digested with SacI and EcoRI and cloned into the pBlueBac 4.5 vector (InVitrogenInvitrogen, Carlsbad, CA, USA) digested with the same enzymes resulting in the pGCBmat plasmid. Two different signal sequences were inserted upstream of the mature GCB codons in order to 2o increase the secreted amount of enzyme. The baculovirus ecdysteroid UDPglucosyltransferase (egt) signal sequence (Murphy et al., Protein Expression and Purification 4, 349-357, 1993) was inserted by annealling 5052 and 5053 (Table 1) and the human pancreatic lipase signal sequence (Lowe et al., J. Biol. Chem. 264, 20042, 1989) was inserted by annealling 5054 and 5055 (Table 1) and cloning them into the NheI and SacI digested pGCBmat plasmid. Infection of Spodoptera frugiperda (Sf9) cells of the resulting plasmid was done according to the protocols from InVitrogenInvitrogen, Carlsbad, CA, USA.
Purificatio>z of GCB polypeptides produced in insect cells Polypeptides with GCB activity were purified as described in US 5,236,838, with some modifications. Cells were removed from the culture medium by centrifugation (10 min at 4000 rpm in a Sorvall RCSC centrifuge) and the supernatant microfiltrated using a 0.22 ~m filter prior to purification. DTT was added to 1 mM and the culture supernatant was ultrafiltrated to approximately 1/10 of the starting volume using a Vivaflow 200 system (Vivascience). The concentrated media was centrifuged to remove possible aggregates before application on a SUBSTITUTE SHEET (RULE 26) Toyopearl Buty1650C resin (TosoHaas) previously equilibrated in 50 mM sodium citrate, 20 %
(v/v) ethylene glycol, 1 mM DTT, pH 5Ø This chromatographic step was performed at room temperature. The resin was washed with at least 3 column volumes of 50 mM
sodium citrate, 20 % (v/v) ethylene glycol, 1 mM DTT, pH 5.0 (until the absorbance at 280 nm reaches baseline level) and GCB was eluted with a linear gradient from 0% to 100% 50 mM sodium citrate, 80% (v/v) ethylene glycol, 1 mM DTT, pH 5Ø Fractions were collected and assayed for GCB activity using the GCB Activity Assay. Usually, wt GCB starts to elute at approx.
70% (v/v) ethylene glycol. a The subsequent purification was done by either of the following two methods.
#2 method results in GCB of a higher purity.
Method #1 GCB enriched fractions from the first process step were pooled and diluted approx. 4 times with a buffer containing 50 mM sodium citrate, 5 mM DTT, pH 5.0 to reduce the ethylene glycol content to 20% (or lower). In the second HIC purification step the diluted and partially purified GCB was applied on a Toyopearl phenyl resin (TosoHaas) equilibrated in 50 mM
sodium citrate, I mM DTT, pH 5.0 (Buffer A) before use. After application, the resin was washed with at least 3 column volumes of 50 mM sodium citrate, pH 5 (until the absorbance at 280 nm reaches baseline level) and GCB was then eluted with a linear ethanol gradient from 0% to 100% buffer B (50 mM sodium citrate, 50% (v/v) ethanol, 1 mM DTT, pH
5.0). Highly purified fractions of GCB (wildtype >_ 95% pure), identified using the GCB
Activity Assay, start to elute at approx. 40% ethanol. The purified GCB bulls product was dialyzed against 50 mM sodium citrate, 0.2 M mannitol, 0.09% tween80, pH 6.1 to retain the GCB
activity upon subsequent storage at 4-8°C or at -80°C.
Method #2 GCB enriched fractions eluted from the Toyopearl buty1650C resin were pooled and applied at 4°C on a SP sepharose resin (Amersham Pharmacia Biotech) previously equilibrated in 25 mM sodium citrate, 1 mM DTT, 10% ethylene glycol, pH 5Ø After application, the resin was 3o washed with 25 mM sodium citrate, 1 mM DTT, 10% ethylene glycol, pH 5.0 (until absorption at 280 nm reached baseline level) and GCB was then eluted with a linear gradient from 0 to100% 0.25 M sodium citrate, 1 mM DTT, 10% ethylene glycol, pH 5Ø GCB
begins to elute around 0.15 M sodium citrate. Fractions containing GCB were pooled and applied at room temperature onto a Phenyl sepharose High Performance (Pharmacia Biotech) previously SUBSTITUTE SHEET (RULE 26) equilibrated in 25 mM sodium citrate 1 mM DTT, pH 5Ø After application, the resin was washed with 25 mM sodium citrate 1 mM DTT, pH 5.0 until absorption at 280 nm reached baseline level, and GCB was then eluted with a linear ethanol gradient from 0 to100% 25 mM
sodium citrate 1 mM DTT 50 % ethanol pH 5Ø GCB typically elutes around 35 %
ethanol.
5 The purified GCB bulk product was dialyzed against either 50 mM sodium citrate, 1 mM DTT, pH 5.0 or 50 mM sodium citrate, 0.2 M mannitol, 1 mM DTT, pH 6.1 to retain the GCB
activity upon subsequent storage. The purified GCB was concentrated and sterilfiltrered before storage at 4 - 8°C or at -80°C. Typically, GCB purified by this method is >95% pure.

Preparatiofi of GCB witla N tenninal peptide additions usifZg a site-directed or randoy2 mutagefaesis approach Nucleotide sequences encoding the following N-terminal peptide additions were added to the nucleotide sequence shown in SEQ ID NO 2 encoding wtGCB: (A-4)+(N-3)+(I-2)+(T-1) (representing an extension to the N-terminal of the amino acid sequence shown in SEQ ID NO
1 with the amino acid residues ANIT), and (A-7)+(S-6)+(P-5)+(I-4)+(N-3)+(A-2)+(T-1) (ASPINAT).
A nucleotide sequence encoding the N-terminal peptide addition (A-4)+(N-3)+(I-2)+(T-1) was prepared by PCR using the following conditions:
PCR 1:
Template: 10 ng pBlueBac5 with wt GCB cDNA sequence primer 5060: 5'-CAGCTGGCCATGGGTACCCGG-3' and primer 5085:
5'-TGGGCATCAGGTGCCAACATTACAGCCCGCCCCTGCATCCCTAAAAGC-3' BIO-X-ACTS DNA polymerase (Bioline, London, U.K.) lxOptiBuffer~ (Bioline, London, U.K.) 30 cycles of 96°C 30s, 55°C 30s, 72°C 1 min PCR 2:
Template: 10 ng pBlueBac5 with wt GCB, Baculo virus forward primer: 5'-TTTACTGTTTTCGTAACAGTTTTG-3' and PrimerS086:
SUBSTITUTE SHEET (RULE 26) 5'-GCAGGGGCGGGCTGTAATGTTGGCACCTGATGCCCACGACACTGCCTG-3' BIO-X-ACTS DNA polymerase (Bioline, London, U.K.) lxOptiBuffer~ (Bioline, London, U.K.) 30 cycles of 96°C 30s, 55°C 30s, 72°C 1 min PCR 3:
3 ~1 of agarose gel purified PCR1 and PCR2 products (app. 10 ng) Baculo virus forward primer: 5'-TTTACTGTTTTCGTAACAGTTTTG-3' and primer 5060.
BIO-X-ACTS DNA polymerase (Bioline, London, U.K.) lxOptiBuffer~ (Bioline, London, U.K.) 30 cycles of 96°C 30s, 55°C 30s, 72°C 1 min PCR 3 was agarose gel purified and digested with NheI and NcoI and cloned into pBluebac4.5+wtGCB digested with NheI and NcoI.
After confirmation of the correct mutations by DNA sequencing the plasmid was transfected into insect cells using the Bac-N-Blues transfection lcit from Invitrogen, Carlsbad, CA, USA. Expression of the muteins was tested by western blotting and by activity measurement of the muteins using the GCB Activity Assay.
Enzymatic activity of wtGCB (SEQ ID NO 1) expressed in the expression vector pVL1392 in insect cells (Sf9) using an analogous method to that described in Example 1 gave 13 units/L, while the N-terminal peptide addition ASPINAT gave 28.5 units/L.
Construction of libraries of GCB with N-terminal p~tide addition Using random mutagenesis two different libraries were constructed on the basis of GCB
polypeptides with an N-terminal extension - library A with an N-terminal extension encoding the following amino acid sequence AXNXTXNXTXNXT, and library B with an N-terminal extension encoding ANXTNXTNXT.
Primers for library A were designed:
50167: 5'-GTGTCGTGGGCATCAGGTGCCNN(G/C)AA(C/T)(T/A/G)N(G/C)AC(A/T/C)(T/A/G)N(G/
3o C)AA(C/T)(T/A/G)N(G/C)AC(A/T/C)(T/A/G)N(G/C)AA(C/T)(T/A/G)N(G/C)AC(A/T/C)GC
CCGCCCCTGCATCCCTAAAAGC
SO 168 : 5'-GGCACCTGATGCCCACGACACTGCCTG
Primers for library B were designed using trinucleotides in the random positions.
SUBSTITUTE SHEET (RULE 26) X is a mixture of trinucleotide codons for all natural amino acid residues, except proline. The trinucleotide codons used were the same as described by Kayushin et al., Nucleic Acids Research, 24, 3748-3755, 1996.
50165: 5'-CGTGGGCATCAGGTGCCAAC(X)AC(A/T/C)AA(C/T)(X)AC(A/T/C)AA(C/T)(X)AC(A/T/
C)GCCCGCCCCTGCATCCCTAAAAGC
50166:5'-GTTGGCACCTGATGCCCACGACACTGCCTG
l0 For both libraries:
5060 and pBRlO: 5'- TTT ACT GTT TTC GTA ACA GTT TTG
In all PCR reactions BIO-X-ACTS DNA polymerase (Bioline, London, U.K.) and 1*Optibuffer~ (Bioline, London, U.K.) were used. The PCR conditions were 30 cycles of 94°C 30s, 55°C 1 min, and 72°C 1 min.
Templates and primers used for preparing a nucleotide sequence encoding the N-terminal extension by the above PCR were as follows:
PCR 1A:
Template: pGC 12 Primers: 5060 + 50167 PCR 1B:
Template: pGCl2 Primers: S060 + 50165 PCR 2A:
Template: pGCl2 Primers: 50168 + pBRlO
PCR 2B:
Template: pGCl2 Primers: 50166 + pBRlO
PCR 3A:
SUBSTITUTE SHEET (RULE 26) Template: 1 ~1 of agarose gel purified PCR 1A and 2A products Primers: 5060 + pBRlO
PCR 3B:
Template: 1 ~,1 of agarose gel purified PCR 1B and 2B products Primers: 5060 + pBRlO
PCR 3A and 3B were agarose gel purified and digested with NheI and NcoI and ligated into pGC-12 digested with NheI and NcoI. The ligation mixture is transformed into competent E.
to coli. The diversity of the library was examined by DNA sequencing of different E. coli clones and gave rise to the following amino acid sequences:
Library A:
l: AFNXTLNKTWN(F/L)T
2: TMNNTWNWTWNWT
3: -EXT wt 4: ALNSTGNLTVDGT
5: ASNSTFNLTENLT

6: TRNVTINCTUNST

7: -EXT wt 8: ALNWTYNGTKNVT

9: AANWTVNF"TGNFT

10: -EXT wt 11: AXNXTVNSTUNVT

12: ANNFTFNGTLNLT

13: AGNWTANVTVNVT

14: AGNSTSNVTGNWT

15: AVNST1~~VIHAIPP ( 1 deletion - nonsens) 16: AGNGTVNGTINGT

17: AVNSTGNXTGNWT

18: AGNGTLTNGTSNLT

19: -EXT wt 20: AMNSTKNSTLNIT

21: AFNYTSKNST
SUBSTITUTE SHEET (RULE 26) 22: -EXT wt 23: AVNATMNWTANGT

24: ASNSTNNGTLNAT

25: ARNKTKNFTINLT

26: APNITUNDTVNMT

27: AQNKTFNFTMNCT

28: ALNVTWNCTLNLT

29: ALNTTWTNLT
to Library B:
1: ANTTNFTNET
2: ANWTNRTNCT
3: ANWTNFTNWT
4: PTGLIGTNFT
5: ANWTNKTNFT
6: ANNTNLTNAT
7: ANYTNWTNFT
8: ANTTNQTNDT
9: - EXT wt 10: ANRTNWTNTT
11: PTATNHTNST
12: - EXT wt 13: ANWTNQTNQT
14: ANWTNWTNAT
15: ANFTNKTNMT
16: ANHTNETNAT
17: AN(C/W)TNFTNET
18: ANLDKLHKUH (insertion - nonsens) 19: ANCFTNQTNFT
20: ANWTNWTNEWT
21: ANCTNWTNCT
22: - EXT wt 23: - EXT wt 24: CHPYNWTNWT
SUBSTITUTE SHEET (RULE 26) 25: ANETNYTNET
26: ANWTNWT
27: AKPYKSYKFY (insertion - nonsens) 28: ANITNKTNWT
5 29: ANWTNMTNIT

30: ANNTNRTNFT

31: ANWTNWTNWT

32: ANWRTNHTNKT

33: - EXT wt l0 34: ANQTNITNWT
Library B was transfected into insect cells using the Bac-N-Blues transfection kit from Invitrogen, Carlsbad, CA, USA. First, 96 plaques from Library B were picked and tested by activity measurement (GCB Activity Assay). Plaques were selected as follows: 3 with high 15 activity, 3 with medium activity and 3 with low or no activity, and virus was purified for DNA
sequencing resulting in the following amino acid sequences:
High activity:
1-1: Mixed sequence 1-2: ANFTNVATNQT
20 1-3: (A)(N)TTXLTN(K)T
Medium activity:
2-1: ANKTN(S/C)TNIT
2-2: Mixed sequence 25 2-3: ANWTNCTN(I)T
Low activity:
3-1: ANWTN(F/L)TNWT
3-2: CQLDURSTNET
30 3-3: No sequence From both libraries 96 plaques were picked and tested by activity measurement (GCB Activity Assay). From each library 6 plaques with high activity were selected and virus were purified for DNA sequencing. The amino acid sequence encoded by the different clones were:
SUBSTITUTE SHEET (RULE 26) Library A:
l: Mixed sequence 2: Mixed sequence 3: Mixed sequence 4: WT
5: ANNTNYTNWT
6: ANNTNYTNWT
Library B:
1: AANDTUNWTVNCT
2: ATNITLNYTANTT
3: WT
4: AANSTGNITINGT
5: AVNWTSNDTSNST
GCB polypeptides of the invention were tested for various properties, including GCB activity, stability in J774E cells and uptake in J774E cells. Unless otherwise stated the properties were tested by use of the methods described in the Methods section herein.
2o In the below table the GCB activity of various GCB polypeptides of the invention is listed together with the activity of the positives from Library A and B after plaque purification.
Table 2 Activity after # Glycosylation Plaque Isolation Plasmid VectorMutations sires introduced (u~L) pGC-1 PBlueBac4.5 0 6 Wt pGC-6 pBlueBac4.5 N-termANIT 1 3 ~

pGC-12 pVL1392Wt 0 13 pGC-13 pVL1392N-termASPINAT 1 29 pGC-36 pVL1392N-term: ASPINATSPINAT 2 16 pGC-38 pVL1392N-term: ASPINAT,K194N, 3 16 pGC-40 pVL1392N-term: ASPINAT,T132N, 3 3.5 K293N, V295T

pGC-47 pVL1392N-term: AGNGTVNGTINGT 3 30 pGC-48 pVL1392N-term: ASNSTNNGTLNAT 3 36 SUBSTITUTE SHEET (RULE 26) pGC-56 pVL1392N-term: ASPINATSPINAT, K194N,4 24 pGC-57 pVL1392N-term: ASPINAT, T132N, K194N,4 20 pGC-58 pVL1392N-term: ASPINAT, T132N, K194N3 10 pGC-60 pVL1392N-term:ANNTNYTNWT 3 P2: 14 pGC-61 pVL1392N-term: ATNITLNYTANTT 3 P2: 38 pGC-62 pVL1392N-term: AANSTGNITINGT 3 P2: 35 pGC-63 pVL1392N-term: AVNWTSNDTSNST 3 P2: 66 pGC-68 pVL1392AN N-term extension + R2T 1 37 Table 2: The plasmid column shows the number of the GCB polypeptide. The vector column shows the plasmid vector used for expression of the polypeptide. The mutation column shows the amino acid exchanges of the GCB polypeptide_ N-terminal extentions are described as N-term followed by the amino acid residues that makes up the extension. The Activity column gives the units per liter of GCB activity measured by the GCB Activity Assay on the supernatant from Sf9 insect cells infected with one single plaque and grown in 3 ml of media in a 6-well plate. Those labelled with P2 are activity measured of supernatant from virus infection cells grown in 15 ml T75 flasks.
Table 3 GCB polypeptide Vmax Km VJildtype 0.57 87.7 Cerezyme 0.52 91.9 pGC36 0.60 70.6 pGC38 0.48 44.0 pGC56 0.39 32.2 pGC60 0.57 79.1 pGC61 0.74 100.5 pGC62 0.86 110.8 pGC63 0.51 83.1 Table 3: Calculated Vmax and Km for uptake in the J774E macrophage cell line of the different GCB polypeptides. Vmax and Km was calculated from dosis response curve (See Fig.
1). The uptake of selected GCB polypeptides are shown in Figure 1 As can be seen from table 3, an increase in Vm~ was observed for the N-terminally extended GCB polypeptides (pGC60, pGC6l, and pGC62).
SUBSTITUTE SHEET (RULE 26) Glycosylation of GCB polypeptides of the ifzvezztiozz expressed in izzsect cells MALDI-TOF mass spectrometry was used to investigate the amount of carbohydrate attached to GCB polypeptides expressed in Sf9 cells.
The 6 GCB polypeptide variants investigated all contained additional potential N-glycosylation sites compared to wtGCB.
WtGCB contains 5 potential N-glycosylation sites of which only 4 are used.
The 6 GCB polypeptide variants were:
GC-36: ASPINATSPINAT-GCB, GC-38: ASPINAT-GCB(K194N,K321N), GC-60: ANNTNYTNWT-GCB, GC-61: ATNITLNYTANTT-GCB, GC-62: AANSTGNITINGT-GCB, and GC-63: AVNWTSNDTSNST-GCB.

WtGCB:
The theoretical peptide mass of wtGCB is 55 591 Da. WtGCB has 5 potential N-glycosylation sites of which only 4 are used. As the two most common N-glycan structures on recombinant proteins expressed in Sf9 cells are Man3GlcNAc2Fuc and Man3GlcNAc2 having masses of 1038.38 Da and 892.31 Da, respectively, the expected mass of wtGCB carrying 4 N-glycans is between 59 159 Da and 59 743 Da.
MALDI-TOF mass spectrometry of wtGCB shows the broad peak typical of glycoproteins with a peak mass of 59.3 kDa in accordance with the expected mass of wtGCB
carrying 4 N-glycans.
GC-36 (ASPINATSPINAT-GCB):
The theoretical peptide mass of GC-36 is 56 829 Da. The N-terminal extension contains two additional potential glycosylation sites at N5 and N11 compared to wtGCB.
Assuming that the wtGCB part of the variant is glycosylated like wtGCB, the variant has 6 potential N-glycosylation sites.
As the two most common N-glycan structures on recombinant proteins expressed in Sf9 cells are Man3GlcNAc2Fuc and Man3GlcNAc2 having masses of 1038.38 Da and 892.31 Da, SUBSTITUTE SHEET (RULE 26) respectively, the expected mass of GC-36 carrying 4 N-glycans is between 60 397 Da and 60 981 Da, the expected mass of GC-36 carrying 5 N-glycans is between 61 289 Da and 62 019 Da, and the expected mass of GC-36 carrying 6 N-glycans is between 62 181 Da and 63 057 Da.
MALDI-TOF mass spectrometry of GC-36 shows a rather broad peak with a peak mass between 61.5 kDa and 62.9 kDa in accordance with the expected mass of GC-36 carrying either 5 or 6 N-glycans.
N-terminal amino acid sequence analysis of GC-36 showed that N5 is completely glycosylated while N11 is partially glycosylated in complete agreement with the result obtained using mass spectrometry.
GC-38 (ASPINAT-GCB(K194N,K321N)):
The theoretical peptide mass of GC-38 is 56 217 Da. The N-terminal extension contains one additional potential glycosylation sites at N5 compared to wtGCB. In addition, the substitutions of Lys194 and Lys321 with Asn-residues introduce two additional potential N-glycosylation sites. Assuming that the wtGCB part of the variant is glycosylated like wtGCB, the variant has 7 potential N-glycosylation sites.
Based on the same considerations as those used for GC-36, the expected mass of carrying 4 N-glycans is between 59 785 Da and 60 369 Da, the expected mass of carrying 5 N-glycans is between 60 677 Da and 61 407 Da, the expected mass of carrying 6 N-glycans is between 61 569 Da and 62 445 Da, and the expected mass of GC-38 carrying 7 N-glycans is between 62 461 Da and 63 483 Da.
MALDI-TOF mass spectrometry of GC-38 shows a major peak with a peak mass of 63.1 kDa in accordance with the expected mass of GC-38 carrying 7 N-glycans.
In addition, a minor peak with a peak mass of 62.3 kDa is seen which corresponds to GC-38 carrying 6 N-glycans.
N-terminal amino acid sequence analysis of GC-38 showed that N5 is completely glycosylated.
GC-60 (ANNTNYTNWT-GCB):
The theoretical peptide mass of GC-60 is 56 770 Da. The N-terminal extension contains three additional potential glycosylation sites at N2, N5 and N8 compared to wtGCB.
Assuming that the wtGCB part of the variant is glycosylated like wtGCB, the variant has 7 potential N-glycosylation sites.
SUBSTITUTE SHEET (RULE 26) Based on the same considerations as those used for GC-36 the expected mass of carrying 4 N-glycans is between 60 338 Da and 60 922 Da, the expected mass of carrying 5 N-glycans is between 61230 Da and 61 960 Da, the expected mass of carrying 6 N-glycans is between 62122 Da and 62 998 Da, and the expected mass of GC-60 carrying 7 N-glycans is between 63 014 Da and 64 036 Da.
MALDI-TOF mass spectrometry of GC-60 shows two broad peaks with peak masses of 61.9 kDa and 62.8 kDa in accordance with the expected mass of GC-60 carrying either 5 or 6 N-glycans.
N-terminal amino acid sequence analysis of GC-60 showed that N2 is mainly glycosylated, N5 is completely glycosylated while N8 is only seldom glycosylated in acceptable agreement with the result obtained using mass spectrometry.
GC-61 (ATNITLNYTANTT-GCB):
The theoretical peptide mass of GC-61 is 56 970 Da. The N-terminal extension contains three additional potential glycosylation sites at N3, N7 and N11 compared to wtGCB.
Assuming that the wtGCB part of the variant is glycosylated like wtGCB, the variant has 7 potential N-glycosylation sites.
Based on the same considerations as used for GC-36, the expected mass of GC-61 carrying 4 N-glycans is between 60 538 Da and 61 122 Da, the expected mass of carrying 5 N-glycans is between 61430 Da and 62 160 Da, the expected mass of carrying 6 N-glycans is between 62 322 Da and 63 198 Da, and the expected mass of GC-61 carrying 7 N-glycans is between 63 214 Da and 64 236 Da.
MALDI-TOF mass spectrometry of GC-61 shows a very broad peak with peak mass between 61.5 kDa and 63.0 kDa in accordance with the expected mass of GC-61 carrying either 5 or 6 N-glycans.
N-terminal amino acid sequence analysis of GC-61 showed that N3 is completely glycosylated while N7 and N11 are partially glycosylated in acceptable agreement with the result obtained using mass spectrometry.
GC-62 (AANSTGNITINGT-GCB):
The theoretical peptide mass of GC-62 is 56 806 Da. The N-terminal extension contains three additional potential glycosylation sites at N3, N7 and Nl l compared to wtGCB.
Assuming that the wtGCB part of the variant is glycosylated like wtGCB, the variant has 7 potential N-glycosylation sites.
SUBSTITUTE SHEET (RULE 26) Based on the same considerations as those used for GC-36, the expected mass of carrying 4 N-glycans is between 60 374 Da and 60 958 Da, the expected mass of carrying 5 N-glycans is between 61266 Da and 61996 Da, the expected mass of GC-carrying 6 N-glycans is between 62158 Da and 63 034 Da, and the expected mass of GC-62 carrying 7 N-glycans is between 63 050 Da and 64 072 Da.
MALDI-TOF mass spectrometry of GC-62 shows two broad peaks with peak masses of 61.6 kDa and 62.7 kDa in accordance with the expected mass of GC-62 carrying either 5 or 6 N-glycans.
N-terminal amino acid sequence analysis of GC-62 showed that N3 is completely glycosylated while N7 and Nl 1 are partially glycosylated in acceptable agreement with the result obtained using mass spectrometry.
GC-63 (AVNWTSNDTSNST-GCB):
The theoretical peptide mass of GC-63 is 56 969 Da. The N-terminal extension contains three additional potential glycosylation sites at N3, N7 and N11 compared to wtGCB.
Assuming that the wtGCB part of the variant is glycosylated like wtGCB, the variant has 7 potential N-glycosylation sites.
Based on the same considerations as those used for GC-36, the expected mass of carrying 4 N-glycans is between 60 537 Da and 61 121 Da, the expected mass of carrying 5 N-glycans is between 61429 Da and 62 159 Da, the expected mass of carrying 6 N-glycans is between 62 321 Da and 63 197 Da, and the expected mass of GC-63 carrying 7 N-glycans is between 63 213 Da and 64 235 Da:
MALDI-TOF mass spectrometry of GC-63 shows a major peak with a peak mass of 61.9 kDa in accordance with the expected mass of GC-63 carrying 5 N-glycans.
In addition, a minor peak with a peak mass of 62.9 kDa is seen which corresponds to GC-63 carrying 6 N-glycans.
N-terminal amino acid sequence analysis of GC-63 showed that N3 ans N7 are partially glycosylated. It was not possible to evaluate the glycosylation status of N11.
Furthermore, insect cell expressed N-terminally extended glycosylated polypeptide (GC-6 and GC-13) was subjected to N-terminal amino acid sequence analysis (using Procize from PE Biosystems, Foster City, CA). The sequencing cycle was blank for the Asn residue in both ANIT and ASP1NAT N-terminal peptide additions, demonstrating that the introduced glycosylation site is glycosylated.
SUBSTITUTE SHEET (RULE 26) When subjecting GC-13 to mass spectrophometry using the MALDI-TOF techniques on the Voyager DERP instrument (from PE-Biosystems, Foster City, CA) the following results were obtained:
The wildtype and ASPINAT-extended wildtype expressed in insect cells gave average masses very close to the calculated mass of 59,727 Da and 61,421 Da, respectively, assuming that four glycosylation sites were occupied by the carbohydrates FucGlcNAc2Man3.

Constructiof2~plasmids for ex~ressiof2 of FSH
A gene encoding the human FSH-alpha subunit was constructed by assembly of synthetic oligonucleotides by PCR using methods similar to the ones described in Stemmer et al. (I995) GefZe I64, pp. 49-53. The native FSH-alpha signal sequence was maintained in order to allow secretion of the gene product. The codon usage of the gene was optimised for high expression in mammalian cells. Furthermore, in order to achieve high gene expression, an intron (from pCI-Neo (Promega)) was included in the 5' untranslated region of the gene. The synthetic gene was subcloned behind the CMV promoter in pcDNA3.l/Hygro (Invitrogen).
The sequence of the resulting plasmid, termed pBvdH977, is given in SEQ ID
N0:3 (FSH-alpha-coding sequence at position 1225 to 1570). Similarly, a synthetic gene encoding the wildtype human FSH-beta subunit was constructed. Also in this construct, the native signal sequence was maintained (except for a Lys to Glu mutation at position 2) in order to allow secretion, and the codon usage was optimised for high expression and an intron was included in the recipient vector (pcDNA3.1/Zeo (Invitrogen)). The sequence of the resulting FSH-beta -containing plasmid, termed pBvdH1022, is given in SEQ 117 N0:4 (FSH-beta-coding sequence at position 1231 to 1617). A plasmid containing both the FSH-alpha and the FSH-beta 2o encoding synthetic genes was generated by subcloning the FSH-alpha containing NruI-PvuII
fragment from pBvdH977 into pBvdH1022 linearized with NruI. The resulting plasmid, in which the FSH-alpha and FSH-beta-expression cassettes are in direct orientation, was termed pBvdH1100.
Expression of FSH ifa CHO cells FSH was expressed in Chinese Hamster Ovary (CHO) Kl cells, obtained from the American Type Culture Collection (ATCC, CCL-61).
SUBSTITUTE SHEET (RULE 26) For transient expression of FSH, cells were grown to 95% confluency in serum-containing media (MEMa with ribonucleotides and deoxyribonucleotides (Life Technologies Cat # 32571-028) containing 1:10 FBS (BioWhittaker Cat # 02-701F) and 1:100 penicillin and streptomycin (BioWhittaker Cat # 17-602E), or Dulbecco's MEM/Nut.-mix F-12 (Ham) L-glutamine, 15 mM Hepes, pyridoxine-HCl (Life Technologies Cat # 31330-038) with the same additives. FSH-encoding plasmids were transfected into the cells using Lipofectamine 2000 (Life Technologies) according to the manufacturer's specifications. 24-48 hrs after transfection, culture media were collected, centrifuged and filtered through 0.22 micrometer filters to remove cells.
to Stable clones expressing FSH were generated by transfection of CHO Kl cells with FSH-encoding plasmids followed by incubation of the cells in selective media (for instance one of the above media containing 0.5 mg/ml zeocin for cells transfected with plasmid pBvdH1100). Stably transfected cells were isolated and sub-cloned by limited dilution. Clones that produced high levels of FSH were identified by ELISA.
More specifically, the concentration of FSH in samples was quantified by use of a commercial immunoassay (DRG FSH EIA, DRG Instruments GmbH, Marburg, Germany).
DRG FSH EIA is a solid phase immunosorbent assay (ELISA) based on the sandwich principle. The microtiter wells are coated with a monoclonal antibody directed towards a unique antigenic site on the FSH-0 subunit. An aliquot of FSH-containing sample (diluted in 2o H20 with 0.1% BSA) and an anti-FSH antiserum conjugated with horseradish peroxidase are added to the coated wells. After incubation, unbound conjugate is washed off with water. The amount of bound peroxidase is proportional to the concentration of FSH in the sample. The intensity of colour developed upon addition of substrate solution is proportional to the concentration of FSH in the sample.
Large-scale production of FSH in CHO cells The cell line CHO Kl 1100 5, stably expressing human FSH, was passed 1:10 from a confluent culture and propagated as adherent cells in serum-containing medium Dulbecco's MEM/Nut.-mix F-12 (Ham) L-glutamine, 15 mM Hepes, pyridoxine-HCl (Life Technologies 3o Cat # 31330-038), 1:10 FBS (BioWhittaker Cat # 02-701F), 1:100 penicillin and streptomycin (BioWhittaker Cat # 17-602E) until confluence in a 10 layer cell factory (NUNC
#165250).
The media was then changed to serum-free media: Dulbecco's MEM/Nut.-mix F-12 (Ham) L-glutamine, pyridoxine-HCl (Life Technologies Cat # 21041-025) with the addition of 1:500 ITS-A (Gibco/BRL # 51300-044), 1:500 EX-CYTE VLE (Serological Proteins Inc. #
81-129) SUBSTITUTE SHEET (RULE 26) and 1:100 penicillin and streptomycin (BioWhittaker Cat # 17-602E).
Subsequently, every 24 h, culture media were collected and replaced with 1 fresh liter of the same serum-free media.
The collected media was filtered through 0.22 ~ m filters to remove cells.
Growth in cell factories was continued with daily harvests and replacements of the culture media until FSH
yields dropped below one-fourth of the initial expression level (typically after 10-15 days).

l0 Puri 'catiore of FSH wildtype ayad variaf~ts Three chromatographic steps were employed to obtain highly purified FSH. First an anion exchanger step, then hydrophobic interaction chromatography (HIC) and finally an immunoaffinity step using an FSH-(3 specific monoclonal antibody.
Culture supernatants were prepared as described in Example 4. Filtered culture supernatants were concentrated 10 to 20 times by ultrafiltration (10 kD cut-off membrane), pH
was adjusted to 8.0 and conductivity to 10 - 15 mS/cm, before application on a DEAE
Sepharose (Pharmacia) anion exchanger column, which had been equilibrated in ammonium acetate buffer (0.16 M, pH 8.0). Semipurified FSH was recovered both in the unbound flow-through fraction as well as in the wash fraction using 0.16 M ammonium acetate, pH 8Ø The flow through and wash fractions were pooled and ammonium sulfate was added from a stock solution (4.5 M) to obtain a final concentration of 1.5 M (NH4)2SO4. The pH
was adjusted to 7Ø
The partially purified FSH was subsequently applied on a 25 ml butyl Sepharose (Pharmacia) HIC column. After application, the column was washed with at least 3 column volumes of 1.5 M (NH4)2504, 20 mM ammonium acetate, pH 7 (until the absorbance at 280 nm reached baseline level) and FSH was eluted with 4 column volumes of buffer B (20 mM
ammonium acetate, pH 7). FSH enriched fractions from the HIC step were pooled, concentrated and diafiltrated using Vivaspin 20 modules, 10 kD cut-off membrane (Vivascience), to a 50 mM sodium phosphate, 150 mM NaCl, pH 7.2.
3o For the third chromatographic step, an anti-FSH-(3 monoclonal antibody (RDI-FSH909, Research Diagnostics) was immobilized to CNBr-activated Sepharose (Pharmacia) using a standard procedure from the supplier. Approximately 1 mg antibody was coupled per ml resin.
SUBSTITUTE SHEET (RULE 26) The immunoaffinity resin was packed in plastic columns and equilibrated with 50 mM sodium phosphate, 150 mM NaCI, pH 7.2 before application.
The buffer exchanged eluate from the butyl HIC step was applied on the antibody column by use of gravity flow. This was followed by several washing steps in 50 mM sodium 5 phosphate solutions (0.5 M NaCl and 1 M NaCI, both pH 7.2). Elution was performed using either 1 M NH3 or 0.6 M NH3, 40% (v/v) isopropanol and the eluate was immediately neutralized with 1 M acetic acid to pH 6-8.
The purified FSH bulk product was concentrated and diafiltrated using Vivaspin modules, 10 kD cut-off membrane (Vivascience), to a 50 mM sodium phosphate, 150 mM
to NaCI, pH 7.2. For subsequent storage, BSA was added to 0.1% (w/v) and the purified FSH was microfiltrated using a 0.22 ~m filter prior to storage at - 80°C.
SDS-PAGE, run under non-dissociating conditions (without boiling), showed wildtype FSH migrating as an apparant 42~3 kDa band, slightly diffuse due to heterogeneity in the attached carbohydrates. The purity was about 80-90%. N-terminal sequencing showed that the 15 a-chain had the expected N-terminal sequence starting with residue 1 (SEQ
1D N0:5) and the (3-chain starting with residue 3 (SEQ ID N0:6). These N-terminal sequences have been found previously for recombinant FSH produced in CHO cells (Olijve, W. et al. (1996) Mol. Hufn.
Reprod. 2, 371-382).
2o EXAMPLE 6 FSH in vitro activi , assay 6.1 FSH assay Outline It has previously been published that activation of the FSH receptor by FSH
Ieads to an increase in the intracellular concentration of cAMP. Consequently, transcription is activated at 25 promoters containing multiple copies of the cAMP response element (CRE). It is thus possible to measure FSH activity by use of a CRE luciferase reporter gene introduced into CHO cells expressing the FSH receptor.
6.2 Construction of a CHO FSH-R / CRE-luc cell line 30 Stable clones expressing the human FSH receptor were produced by transfection of CHO Kl cells with a plasmid containing the receptor cDNA inserted into pcDNA3 (Invitrogen) followed by selection in media containing 600 microg/ml 6418.
Using a SUBSTITUTE SHEET (RULE 26) commercial CAMP-SPA RIA (Amersham), clones were screened for the ability to respond to FSH stimulation. On the basis of these results, an FSH receptor-expressing CHO
clone was selected for further transfection with a CRE-luc reporter gene. A plasmid containing the reporter gene with 6 CRE elements in front of the Firefly luciferase gene was co-transfected with a plasmid conferring Hygromycin B resistance. Stable clones were selected in the presence of 600 microg/ml 6418 and 400 microg/ml Hygromycin B. A clone yielding a robust luciferase signal upon stimulation with FSH (ECSO ~ 0.01 ICT/ml) was obtained.
This CHO
FSH-R / CRE-luc cell line was used to measure the activity of samples containing FSH.
6.3 FSH luciferase assay To perform activity assays, CHO FSH-R / CRE-luc cells were seeded in white 96 well culture plates at a density of about 15,000 cells/well. The cells were in 100 ~1 DMEM/F-12 (without phenol red) with 1.25% FBS. After incubation overnight (at 37°C, 5% C02), 25 ~,1 of sample or standard diluted in DMEM/F-12 (without phenol red) with 10% FBS was added to each well. The plates were further incubated for 3 hrs, followed by addition of 125 ~,1 LucLite substrate (Packard Bioscience). Subsequently, plates were sealed and luminescence was measured on a TopCount luminometer (Packard) in SPC (single photon counting) mode.

Construction afzd afzal serf a varia>2t form of FSH coz2tai>2in~ two N=linked ,~lycosylatior2s,at the N-termiszus of the alpha suburzit A construct encoding a modified form of FSH-alpha, having two additional sites for N-linked glycosylation at its N-terminus was generated by site-directed mutagenesis using standard DNA techniques known in the art. A DNA fragment encoding the sequence Ala-Asn-lle-Thr-Val-Asn-Ile-Thr-Val was inserted immediately upstream of the mature FSH-alpha sequence in pBvdH977. The sequence of the resulting plasmid, termed pBvdH1163, is given in SEQ ID N0:7 (modified FSH-alpha-encoding sequence at position 1225 to 1599). A
plasmid encoding both subunits was constructed by subcloning the FSH-containing NruI-PvuII
3o fragment from pBvdHl 163 into pBvdH1022 (Example 4), which had been linearized with PvuII. The resulting plasmid was termed pBvdH1208.
For expression of the variant form of FSH containing two N-linked glycosylations at the N-terminus of the alpha subunit (termed FSH1208), CHO K1 cells were transfected with SUBSTITUTE SHEET (RULE 26) pBvdH1208 or co-transfected with a combination of pBvdH1163, encoding the modified alpha subunit and pBvdH1022, encoding the wildtype beta subunit. Transient expressions, isolation of stable expression clones, and large-scale production of FSH1208 were performed as described for wildtype FSH in Example 4.
The FSH content of samples was analysed by Western Blotting: Proteins were separated by SDS-PAGE and a standard Western blot was performed using rabbit anti human FSH (AHP519, Serotec) or mouse anti human FSH-alpha (MCA338, Serotec) as primary antibody, and an ImmunoPure Ultra Sensitive ABC Peroxidase Staining Kit (Pierce) for detection. Western blotting showed that FSH1208 had a larger molecular mass than wildtype to FSH, indicating that the introduction of acceptor sites for N-linked glycosylation at the N-terminus of the alpha subunit indeed lead to hyperglycosylation of FSH. For analysis of pI, samples were separated on pH 3-7 IEF gels (NOVEX). After electrophoresis, proteins were blotted onto Immobilon-P (Millipore) membranes and a Western blot was performed as described above, using the same antibodies and detection kit. Isoelectric focusing demonstrated that the FSH forms in the FSH1208 samples were found in a lower pI range than wildtype FSH. Thus, the pH interval for FSH1208 isoforms was about 3.0-4.5 versus about 4.0-5.2 for wildtype FSH. This indicated that FSHI208 molecules are on average more negatively charged than the wild type, which is attributed to the presence of additional sialic acid residues.
FSH1208 was purified and characterized as described in Example 5. SDS-PAGE, run under non-dissociating conditions (without boiling), showed FSH1208 migrating as an apparent 55~5 kDa band, slightly diffuse due to heterogeneity in the attached carbohydrates.
The purity was about 80-90%. N-terminal sequencing showed that while the (3-chain had the same N-terminal sequence as wildtype FSH, the sequence of a-chain was in agreement with this subunit carrying the expected N-terminal extension ANITVNITV, in which both asparagines residues are glycosylated.
The specific activity of FSH1208 was determined by measurement of the ih vitro bioactivity (FSH luciferase assay, Example 6) and the FSH content of the samples by ELISA.
The specific activity of FSH1208 was found to be about one-third of that of the wildtype reference.
3o A pharmacokinetic study performed as follows:
Immature 26-27 days old female Sprague-Dawley rats were injected i.v. with 3-4 microg FSH, produced, purified and analyzed as described above. Subsequently, blood samples were taken at various time-points after injection. FSH concentrations in serum samples were determined by ELISA, as described above.
SUBSTITUTE SHEET (RULE 26) Ih vivo bioactivity of wildtype recombinant FSH and variant forms may be evaluated by the ovarian weight augmentation assay (Steelman and Pohley (1953) E>zdocrinology 53, 604-616). Furthermore, the ability of FSH and variant forms to stimulate maturation of follicles in laboratory animals may be detected with e.g. ultrasound equipment. The experiment showed that 24 hours after injection of equal amounts of wildtype FSH and FSH1208, the sera of FSH1208-treated animals contained more than 10 fold more remaining immunoreactive material than the sera from animals treated with wildtype FSH.

Cozzstruction ayzd anal s~fotheY FSH variayzts containin,~ additional ~lycosylatiorz sites Plasmids encoding variant forms of FSH-alpha and FSH-beta containing additional sites for N-linked glycosylation were generated by site-directed mutagenesis using standard DNA techniques known in the art. The following amino acid substitutions and/or insertions were generated:
FSH1147: Amino acid Tyr58 of mature FSH-beta altered to Asn FSH1349: N-terminus of mature FSH-alpha altered from APD QDC... to: APNDTVNFT
QDC
FSH1354: N-terminus of mature FSH-beta altered from NS CEL ... to: NSNITVNITV
CEL ...
Plasmids encoding the variant forms were transiently expressed in CHO K1 cells as 2o described in Example 4. Plasmids encoding FSH-alpha variants were co-transfected with a plasmid encoding wild-type FSH-beta and vice versa.
Western and isoelectric focusing were performed on culture media samples as described above. The variant forms had higher molecular weights than the wild-type, indicating that the additional acceptor sites for N-linked glycosylation had indeed been glycosylated.
Furthermore, isoelectric focusing showed that the different isoforms of the three FSH variants were spread over a lower pI range than the wildtype. This strongly suggests that the variant forms had a higher sialic acid content than the wildtype.
In vitro FSH activities of the resulting media samples were analysed as described in Example 6.3. All three variant forms were able to stimulate the CHO FSH-R /
CRE-luc cells, indicating that these variant FSH forms have retained significant FSH
activity.
While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that SUBSTITUTE SHEET (RULE 26) various changes in form and detail can be made without departing from the true scope of the invention. For example, all the techniques, methods, compositions, apparatus and systems described above may be used in various combinations. All publications, patents, patent applications, or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, or other document were individually indicated to be incorporated by reference for all purposes.
SUBSTITUTE SHEET (RULE 26) SEQUENCE LISTING
<110> MAXYGEN APS
<120> N-TERMINALLY EXTENDED POLYPEPTIDES
<130> 0217W0210 <170> PatentIn Ver. 2.1 <210> 1 <211> 497 <212> PRT
<213> Homo sapiens <220>
<221> MOD_RES
<222> (495) <223> R or H
<400> 1 Ala Arg Pro Cys Ile Pro Lys Ser Phe Gly Tyr Ser Ser Val Val Cys Val Cys Asn Ala Thr Tyr Cys Asp Ser Phe Asp Pro Pro Thr Phe Pro Ala Leu Gly Thr Phe Ser Arg Tyr Glu Ser Thr Arg Ser Gly Arg Arg Met Glu Leu Ser Met Gly Pro Ile Gln Ala Asn His Thr Gly Thr Gly Leu Leu Leu Thr Leu Gln Pro Glu Gln Lys Phe Gln Lys Val Lys Gly Phe Gly Gly Ala Met Thr Asp Ala Ala Ala Leu Asn Ile Leu Ala Leu Ser Pro Pro Ala Gln Asn Leu Leu Leu Lys Ser Tyr Phe Ser Glu Glu Gly Ile Gly Tyr Asn Ile Ile Arg Val Pro Met Ala Ser Cys Asp Phe Ser Ile Arg Thr Tyr Thr Tyr Ala Asp Thr Pro Asp Asp Phe Gln Leu His Asn Phe Ser Leu Pro Glu Glu Asp Thr Lys Leu Lys Ile Pro Leu Ile His Arg Ala Leu Gln Leu Ala Gln Arg Pro Val Ser Leu Leu Ala 165 17 0 17 5.
Ser Pro Trp Thr Ser Pro Thr Trp Leu Lys Thr Asn Gly Ala Val Asn Gly Lys Gly Ser Leu Lys Gly Gln Pro Gly Asp Ile Tyr His Gln Thr Trp Ala Arg Tyr Phe Val Lys Phe Leu Asp Ala Tyr Ala Glu His Lys Leu Gln Phe Trp Ala Val Thr Ala Glu Asn Glu Pro Ser Ala Gly Leu Leu Ser Gly Tyr Pro Phe Gln Cys Leu Gly Phe Thr Pro Glu His Gln Arg Asp Phe Ile Ala Arg Asp Leu Gly Pro Thr Leu Ala Asn Ser Thr His His Asn Val Arg Leu Leu Met Leu Asp Asp Gln Arg Leu Leu Leu Pro His Trp Ala Lys Val Val Leu Thr Asp Pro Glu Ala Ala Lys Tyr Val His Gly Ile Ala Val His Trp Tyr Leu Asp Phe Leu Ala Pro Ala Lys Ala Thr Leu Gly Glu Thr His Arg Leu Phe Pro Asn Thr Met Leu Phe Ala Ser Glu Ala Cys Val Gly Ser Lys Phe Trp Glu Gln Ser Val Arg Leu Gly Ser Trp Asp Arg Gly Met Gln Tyr Ser His Ser Ile Ile Thr Asn Leu Leu Tyr His Val Val Gly Trp Thr Asp Trp Asn Leu Ala Leu Asn Pro Glu Gly Gly Pro Asn Trp Va1 Arg Asn Phe Val Asp Ser Pro Ile Ile Val Asp Ile Thr Lys Asp Thr Phe Tyr Lys Gln Pro Met Phe Tyr His Leu Gly His Phe Ser Lys Phe Ile Pro Glu Gly Ser Gln Arg Val Gly Leu Val Ala Ser Gln Lys Asn Asp Leu Asp Ala Val Ala Leu Met His Pro Asp Gly Ser Ala Val Val Val Val Leu Asn Arg Ser Ser Lys Asp Val Pro Leu Thr Ile Lys Asp Pro Ala Val Gly Phe Leu Glu Thr Ile Ser Pro Gly Tyr Ser Ile His Thr Tyr Leu Trp Xaa Arg Gln <210> 2 <211> 1551 <212> DNA
<213> Homo Sapiens <400> 2 atggctggca gcctcacagg attgcttcta cttcaggcag tgtcgtgggc atcaggtgcc 60 cgcccctgca tccctaaaag cttcggctac agctcggtgg tgtgtgtctg caatgccaca 120 tactgtgact cctttgaccc cccgaccttt cctgcccttg gtaccttcag ccgctatgag 180 agtacacgca gtgggcgacg gatggagctg agtatggggc ccatccaggc taatcacacg 240 ggcacaggcc tgctactgac cctgcagcca gaacagaagt tccagaaagt gaagggattt 300 ggaggggcca tgacagatgc tgctgctctc aacatccttg ccctgtcacc ccctgcccaa 360 aatttgctac ttaaatcgta cttctctgaa gaaggaatcg gatataacat catccgggta 420 cccatggcca gctgtgactt ctccatccgc acctacacct atgcagacac ccctgatgat 480 ttccagttgc acaacttcag cctcccagag gaagatacca agctcaagat acccctgatt 540 caccgagcac tgcagttggc ccagcgtccc gtttcactcc ttgccagccc ctggacatca 600 cccacttggc tcaagaccaa tggagcggtg aatgggaagg ggtcactcaa gggacagccc 660 ggagacatct accaccagac ctgggccaga tactttgtga agttcctgga tgcctatgct 720 gagcacaagt tacagttctg ggcagtgaca gctgaaaatg agccttctgc tgggctgttg 780 agtggatacc ccttccagtg cctgggcttc acccctgaac atcagcgaga cttaattgcc 840 cgtgacctag gtcctaccct cgccaacagt actcaccaca atgtccgcct actcatgctg 900 gatgaccaac gcttgctgct gccccactgg gcaaaggtgg tgctgacaga cccagaagca 960 gctaaatatg ttcatggcat tgctgtacat tggtacctgg actttctggc tccagccaaa 1020 gccaccctag gggagacaca ccgcctgttc Cccaacacca tgctctttgc ctcagaggcc 1080 tgtgtgggct ccaagttctg ggagcagagt gtgcggctag gctcctggga tcgagggatg 1140 cagtacagcc acagcatcat cacgaacctc ctgtaccatg tggtcggctg gaccgactgg 1200 aaccttgccc tgaaccccga aggaggaccc aattgggtgc gtaactttgt cgacagtccc 1260 atcattgtag acatcaccaa ggacacgttt tacaaacagc ccatgttcta ccaccttggc 1320 catttcagca agttcattcc tgagggctcc cagagagtgg ggctggttgc cagtcagaag 1380 aacgacctgg acgcagtggc attgatgcat cccgatggct ctgctgttgt ggtcgtgcta 1440 aaccgctcct ctaaggatgt gcctcttacc atcaaggatc ctgctgtggg cttcctggag 1500 acaatctcac ctggctactc cattcacacc tacctgtggc gtcgccagtg a 1551 <210> 3 <211> 6186 <212> DNA
<213> Artificial sequence <220>
<221> exon <222> (1225)..(1572) <223> Coding sequence for human FSH-alpha <400> 3 gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 60 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240 gattattgactagttattaa tagtaatcaa ttacggggtcattagttcatagcccatata300 tggagttccgcgttacataa cttacggtaa atggcccgcctggctgaccgcccaacgacc360 cccgcccattgacgtcaata atgacgtatg ttcccatagtaacgccaatagggactttcc420 attgacgtcaatgggtggac tatttacggt aaactgcccacttggcagtacatcaagtgt480 atcatatgccaagtacgccc cctattgacg tcaatgacggtaaatggcccgcctggcatt540 atgcccagtacatgacctta tgggactttc ctacttggcagtacatctacgtattagtca600 tcgctattaccatggtgatg cggttttggc agtacatcaatgggcgtggatagcggtttg660 actcacggggatttccaagt ctccacccca ttgacgtcaatgggagtttgttttggcacc720 aaaatcaacgggactttcca aaatgtcgta acaactccgccccattgacgcaaatgggcg780 gtaggcgtgtacggtgggag gtctatataa gcagagctctctggctaactagagaaccca840 ctgcttactggcttatcgaa attaatacga ctcactatagggagacccaagctggctagc900 ttattgcggtagtttatcac agttaaattg ctaacgcagtcagtgcttctgacacaacag960 tctcgaacttaagctgcagt gactctctta aggtagccttgcagaagttggtcgtgaggc1020 actgggcaggtaagtatcaa ggttacaaga caggtttaaggagaccaatagaaactgggc1080 ttgtcgagacagagaagact cttgcgtttc tgataggcacctattggtcttactgacatc1140 cactttgcctttctctccac aggtgtccac tcccagttcaattacagctcttaaaagctt1200 ggtaccgagctcggatccgc cacc atg gac gcc gcc 1251 tac tac egc aag tac Met Asp Tyr Tyr Arg Lys Ala Ala Tyr atc ttc gtg acc ctg agc gtg ttc gtg ctg agc gcc 1299 ctg ctg cac cac Ile Phe Val Thr Leu Ser Val Phe Val Leu Ser Ala Leu Leu His His ccc gac cag gac tgc ccc gag tgc cag gag ccc ttc 1347 gtg acc ctg aac Pro Asp Gln Asp Cys Pro Glu Cys Gln Glu Pro Phe Val Thr Leu Asn ttc age ccc ggc gcc ccc atc ctg atg ggc tgc ttc 1395 cag cag tgc tgc Phe Ser Pro Gly Ala Pro Ile Leu Met Gly Cys Phe Gln Gln Cys Cys agc cgc tac ccc acc ccc ctg cgc aag acc ctg gtg 1443 gcc agc aag atg Ser Arg Tyr Pro Thr Pro Leu Arg Lys Thr Leu Val Ala Ser Lys Met cag aag gtg acc agc gag agc acc gtg gcc agc tac 1491 aac tgc tgc aag Gln Lys Val Thr Ser Glu Ser Thr Val Ala Ser Tyr Asn Cys Cys Lys aac cgc acc gtg atg ggc ggc ttc gag aac acc gcc 1539 gtg aag gtg cac Asn Arg Val Thr Val Met Gly Gly Phe Lys Val Glu Asn His Thr Ala tgc cac tgc agc acc tgc tac tac cac aag agc taatctagag ggcccgttta 1592 Cys His Cys Ser Thr Cys Tyr Tyr His Lys Ser aacccgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctc1652 ccccgtgccttccttgaccctggaaggtgCcactcccactgtcctttcctaataaaatga1712 ggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggca1772 ggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctc1832 tatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgcgccctg1892 tagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgc1952 cagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccgg2012 ctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacg2072 gcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctg2132 atagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgtt2192 ccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggatttt2252 ggggatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaatta2312 attctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccaggcaggcag2372 aagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctc2432 cccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcc2492 cctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatgg2552 ctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattcca2612 gaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttg2672 tatatccattttcggatctgatcagcacgtgatgaaaaagcctgaactcaccgcgacgtc2732 tgtcgagaagtttctgatcgaaaagttcgacagcgtctccgacctgatgcagctctcgga2792 gggcgaagaatctcgtgctttcagcttcgatgtaggagggcgtggatatgtcctgcgggt2852 aaatagctgcgccgatggtttctacaaagatcgttatgtttatcggcactttgcatcggc2912 cgcgctcccgattccggaagtgcttgacattggggaattcagcgagagcctgacctattg2972 catctcccgc cgtgcacagg gtgtcacgtt gcaagacctg cctgaaaccg aactgcccgc 3032 tgttctgcag ccggtcgcgg aggccatgga tgcgatcgct gcggccgatc ttagccagac 3092 gagcgggttcggcccattcggaccgcaaggaatcggtcaatacactacatggcgtgattt3152 catatgcgcgattgctgatccccatgtgtatcactggcaaactgtgatggacgacaccgt3212 cagtgcgtccgtcgcgcaggctctcgatgagctgatgctttgggccgaggactgccccga3272 agtccggcacctcgtgcacgcggatttcggctccaacaatgtcctgacggacaatggccg3332 cataacagcggtcattgactggagcgaggcgatgttcggggattcccaatacgaggtcgc3392 caacatcttcttctggaggccgtggttggcttgtatggagcagcagacgcgctacttcga3452 gcggaggcatccggagcttgcaggatcgccgcggctccgggcgtatatgctccgcattgg3512 tcttgaccaactctatcagagcttggttgacggcaatttcgatgatgcagcttgggcgca3572 gggtcgatgcgacgcaatcgtccgatccggagccgggactgtcgggcgtacacaaatcgc3632 ccgcagaagcgcggccgtctggaccgatggctgtgtagaagtactcgccgatagtggaaa3692 ccgacgccccagcactcgtccgagggcaaaggaatagcacgtgctacgagatttcgattc3752 caccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggat3812 gatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgc3872 agcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcattttt3932 ttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtat3992 accgtcgacctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaa4052 ttgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctg4112 gggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttcca4172 gtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcgg4232 tttgcgtattgggcgctcttCCC,~'CttCCtCgctcactgactcgctgcgctcggtcgttcg4292 gctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcagg4352 ggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaa4412 ggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcg4472 acgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccc4532 tggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgc4592 ctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttc4652 ggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccg4712 ctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcc4772 actggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacaga4832 gttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgc4892 tctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaac4952 caccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagg5012 atctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactc5072 acgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaa5132 ttaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagtta5192 ccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagt5252 tgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccag5312 tgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaacca5372 gccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtc5432 tattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgt5492 tgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcag5552 ctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggt5612 tagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcat5672 ggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgt5732 gactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctc5792 ttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcat5852 cattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccag5912 ttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgt5972 ttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacg6032 gaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggtta6092 ttgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttcc6152 gcgcacattt ccccgaaaag tgccacctga cgtc 6186 <210> 4 <211> 5651 <212> DNA
<213> Artificial sequence <220>
<221> exon <222> (1231)..(1617) <223> Coding sequence for human FSIi-beta <400>

gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatg60 ccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcg120 cgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgc180 ttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacatt240 gattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatata300 tggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacc360 cccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttcc420 attgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgt480 atcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcatt540 atgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtca600 tcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttg660 actcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcacc720 aaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcg780 gtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaaccca840 ctgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagc900 ttattgcggtagtttatcacagttaaattgctaacgcagtcagtgcttctgacacaacag960 tctcgaacttaagctgcagtgactctcttaaggtagccttgcagaagttggtcgtgaggc1020 actgggcaggtaagtatcaaggttacaagacaggtttaaggagaccaatagaaactgggc1080 ttgtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatc1140 cactttgcctttctctccacaggtgtccactcccagttcaattacagctcttaaaagctt1200 ggtaccgagctcggatctatcgatgccaccatg gag ctg cag 1254 acc ttc ttc ttc Met Glu Leu Gln Thr Phe Phe Phe ctg ttc tgc tgc tgg aag gcc atc tgc tgc aac agc tgc gag ctg acc 1302 Leu Phe Cys Cys Trp Lys Ala Ile Cys Cys Asn Ser Cys Glu Leu Thr aac atc acc atc gcc atc gag aag gag gag tgc cgc ttc tgc atc agc 1350 Asn Ile Thr Ile Ala Ile Glu Lys Glu Glu Cys Arg Phe Cys Ile Ser atc aac acc acc tgg tgc gcc ggc tac tgc tac acc cgc gac ctg gtg 1398 Ile Asn Thr Thr Trp Cys Ala Gly Tyr Cys Tyr Thr Arg Asp Leu Val tacaag gaccccgcc cgccccaagatc cagaagacctgc accttcaag 1446 TyrLys AspProAla ArgProLysIle GlnLysThrCys ThrPheLys gagctg gtgtacgag acggtccgggtg cccggctgcgcc caccacgcc 1494 GluLeu ValTyrGlu ThrValArgVal ProGlyCysAla HisHisAla gacagc ctgtacacc taccccgtggcc acccagtgccac tgcggcaag 1542 AspSer LeuTyrThr TyrProValAla ThrGlnCysHis CysGlyLys tgcgac agcgacagc accgactgcacc gtgcgcggcctg ggccccagc 1590 CysAsp SerAspSer ThrAspCysThr ValArgGlyLeu GlyProSer tactgc agcttcggc gagatgaaggag taactcgaga ctagagggcc 1637 TyrCys SerPheG1y GluMetLysGlu cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 1697 cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 1757 aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 1817 ggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggt1877 gggctctatggcttctgaggcggaaagaaccagctggggctctagggggtatccccacgc1937 gccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctac1997 acttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgtt2057 cgccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgc2117 tttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatc2177 gccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggact2237 cttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagg2297 gattttggggatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgc2357 gaattaattctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccaggc2417 aggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtcccc2477 aggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagt2537 CCCgCCCCtaactccgcccatCCCgCCCCtaactccgcccagttccgcccattctccgcc2597 ccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagct2657 attccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccggg2717 agcttgtatatccattttcggatctgatcagcacgtgttgacaattaatcatcggcatag2777 tatatcggcatagtataatacgacaaggtgaggaactaaaccatggccaagttgaccagt2837 gccgttccggtgctcaccgcgcgcgacgtcgccggagcggtcgagttctggaccgaccgg2897 ctcgggttctcccgggacttcgtggaggacgacttcgccggtgtggtccgggacgacgtg2957 accctgttcatcagcgcggtccaggaccaggtggtgccggacaacaccctggcctgggtg3017 tgggtgcgcggcctggacgagctgtacgccgagtggtcggaggtcgtgtccacgaacttc3077 cgggacgcctccgggccggccatgaccgagatcggcgagcagccgtgggggcgggagttc3137 gccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggactgacac3197 gtgctacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgtt3257 ttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcc3317 caccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaat3377 ttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaat3437 gtatcttatcatgtctgtataccgtcgacctctagctagagcttggcgtaatcatggtca3497 tagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccgga3557 agcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttg3617 cgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggc3677 caacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgac3737 tcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaata3797 cggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaa3857 aaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccct3917 gacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataa3977 agataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccg4037 cttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctca4097 cgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaa4157 ccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccg4217 gtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgagg4277 tatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagg4337 acagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagc4397 tcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcag4457 attacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgac4517 gctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatc4577 ttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgag4637 taaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgt4697 ctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggag4757 ggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctcca4817 gatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaact4877 ttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgcca4937 gttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcg4997 tttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatccccc5057 atgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttg5117 gccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgcca5177 tccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgt5237 atgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagc5297 agaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatc5357 ttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagca5417 tcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaa5477 aagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattat5537 tgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaa5597 aataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtc 5651 <210> 5 <211> 92 <212> PRT
<213> Homo Sapiens <400> 5 Ala Pro Asp Val Gln Asp Cys Pro Glu Cys Thr Leu Gln Glu Asn Pro Phe Phe Ser Gln Pro Gly Ala Pro Ile Leu Gln Cys Met Gly Cys Cys Phe Ser Arg Ala Tyr Pro Thr Pro Leu Arg Ser Lys Lys Thr Met Leu Val Gln Lys Asn Val Thr Ser Glu Ser Thr Cys Cys Val Ala Lys Ser Tyr Asn Arg Val Thr Val Met Gly Gly Phe Lys Val Glu Asn His Thr Ala Cys His Cys Ser Thr Cys Tyr Tyr His Lys Ser <210> 6 <211> 111 <212> PRT
<213> Homo Sapiens <400> 6 Asn Ser Cys Glu Leu Thr Asn Ile Thr Ile Ala Ile Glu Lys Glu Glu Cys Arg Phe Cys Ile Ser Ile Asn Thr Thr Trp Cys Ala Gly Tyr Cys Tyr Thr Arg Asp Leu Val Tyr Lys Asp Pro AIa Arg Pro Lys Ile Gln Lys Thr Cys Thr Phe Lys Glu Leu Val Tyr Glu Thr Val Arg Val Pro Gly Cys Ala His His Ala Asp Ser Leu Tyr Thr Tyr Pro Val Ala Thr Gln Cys His Cys Gly Lys Cys Asp Ser Asp Ser Thr Asp Cys Thr Val Arg Gly Leu Gly Pro Ser Tyr Cys Ser Phe Gly Glu Met Lys Glu <210> 7 <211> 6213 <212> DNA
<213> Artificial sequence <220>
<221> exon <222> (1225)..(1599) <223> Coding sequence for modified FSH-alpha <400> 7 gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 60 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120 cgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgc180 ttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacatt240 gattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatata300 tggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacc360 cccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttcc420 attgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgt480 atcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcatt540 atgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtca600 tcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttg660 actcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcacc720 aaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcg780 gtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaaccca840 ctgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagc900 ttattgcggtagtttatcacagttaaattgctaacgcagtcagtgcttctgacacaacag960 tctcgaacttaagctgcagtgactctcttaaggtagccttgcagaagttggtcgtgaggc1020 actgggcaggtaagtatcaaggttacaagacaggtttaaggagaccaatagaaactgggc1080 ttgtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatc1140 cactttgcctttctctccacaggtgtccactcccagttcaattacagctcttaaaagctt1200 ggtaccgagctcggatccgccacc atg gcc gcc 1251 gac tac tac cgc aag tac Met Asp Ala Ala Tyr Tyr Arg Lys Tyr atc ttc gtg acc gtg ctg agc gcc 1299 ctg ctg cac agc gtg ttc ctg cac Ile Phe Val Thr Val Leu Ser Ala Leu Leu His Ser Val Phe Leu His aac atc gtt aac gtg cag tgc ccc 1347 acc atc gac acc gtg gcc ccc gac Asn Ile Val Asn e Thr Val Gln Cys Pro Thr Il Val Ala Asp Pro Asp gag tgc acc ctg cag gag aac ccc ttc ttc agc cag ccc ggc gcc ccc 1395 Glu Cys Thr Leu Gln Glu Asn Pro Phe Phe Ser Gln Pro Gly Ala Pro atc ctg cag tgc atg ggc tgc tgc ttc agc cgc gcc tac ccc acc ccc 1443 Ile Leu Gln Cys Met Gly Cys Cys Phe Ser Arg Ala Tyr Pro Thr Pro ctg cgc agc aag aag acc atg ctg gtg cag aag aac gtg acc agc gag 1491 Leu Arg Ser Lys Lys Thr Met Leu Val Gln Lys Asn Val Thr Ser Glu agc acc tgc tgc gtg gcc aag agc tac aac cgc gtg acc gtg atg ggc 1539 Ser Thr Cys Cys Val Ala Lys Ser Tyr Asn Arg Val Thr Val Met Gly ggc ttc aag gtg gag aac cac acc gcc tgc cac tgc agc acc tgc tac 1587 Gly Phe Lys Val Glu Asn His Thr Ala Cys His Cys Ser Thr Cys Tyr tac cac aag agc taatctagag ggcccgttta aacccgctga tcagcctcga 1639 Tyr His Lys Ser ctgtgccttctagttgccagCCatCtgttgtttgCCCCtCCCCCgtgCCttCCttgaCCC1699 tggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtc1759 tgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggatt1819 gggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaa1879 gaaccagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcgg1939 cgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctc1999 ctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaa2059 atcggggcatccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaac2119 ttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctt2179 tgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactca2239 accctatctcggtctattcttttgatttataagggattttggggatttcggcctattggt2299 taaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtca2359 gttagggtgtggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatgcatc2419 tcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgc2479 aaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgc2539 ccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttattt2599 atgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggctttt2659 ttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctg2719 atcagcacgtgatgaaaaagcctgaactcaccgcgacgtctgtcgagaagtttctgatcg2779 aaaagttcgacagcgtctccgacctgatgcagctctcggagggcgaagaatctcgtgctt2839 tcagcttcgatgtaggagggcgtggatatgtcctgcgggtaaatagctgcgccgatggtt2899 tctacaaagatcgttatgtttatcggcactttgcatcggccgcgctcccgattccggaag2959 tgcttgacattggggaattcagcgagagcctgacctattgcatctcccgccgtgcacagg3019 gtgtcacgttgcaagacctgcctgaaaccgaactgcccgctgttctgcagccggtcgcgg3079 aggccatggatgcgatcgctgcggccgatcttagccagacgagcgggttcggcccattcg3139 gaccgcaaggaatcggtcaatacactacatggcgtgatttcatatgcgcgattgctgatc3199 cccatgtgtatcactggcaaactgtgatggacgacaccgtcagtgcgtccgtcgcgcagg3259 ctctcgatgagctgatgctttgggccgaggactgccccgaagtccggcacctcgtgcacg3319 cggatttcggctccaacaatgtcctgacggacaatggccgcataacagcggtcattgact3379 ggagcgaggcgatgttcggggattcccaatacgaggtcgccaacatcttcttctggaggc3439 cgtggttggcttgtatggagcagcagacgcgctacttcgagcggaggcatccggagcttg3499 caggatcgccgcggctccgggcgtatatgctccgcattggtcttgaccaactctatcaga3559 gcttggttgacggcaatttcgatgatgcagcttgggcgcagggtcgatgcgacgcaatcg3619 tccgatccggagccgggactgtcgggcgtacacaaatcgcccgcagaagcgcggccgtct3679 ggaccgatggctgtgtagaagtactcgccgatagtggaaaccgacgccccagcactcgtc3739 cgagggcaaaggaatagcacgtgctacgagatttcgattccaccgccgccttctatgaaa3799 ggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatc3859 tcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaat3919 aaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtg3979 gtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctaga4039 gcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattc4099 cacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagct4159 aactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgcc4219 agctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctctt4279 ccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcag4339 ctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaaca4399 tgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttt4459 tccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggc4519 gaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgct4579 ctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcg4639 tggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctcca4699 agctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaact4759 atcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggta4819 acaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggccta4879 actacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacct4939 tcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtt4999 tttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttga5059 tcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtca5119 tgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaat5179 caatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgagg5239 cacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgt5299 agataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgag5359 acccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagc5419 gcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaag5479 ctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggca5539 tcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaa5599 ggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccga5659 tcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcata5719 attctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaacca5779 agtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacggg5839 ataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcgg5899 ggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtg5959 cacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacag6019 gaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatac6079 tcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggataca6139 tatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaag6199 tgccacctgacgtc 6213 <210> 8 <211> 5 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (5) <223> T or S
<400> 8 Ala Ser Asn Ile Xaa <210> 9 <211> 6 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide , <220>
<221> MOD RES
<222> (6) <223> T or S
<400> 9 Ser Pro Ile Asn Ala Xaa <210> 10 <211> 7 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD RES
<222> (7)-<223> T or S
<400> 10 Ala Ser Pro Ile Asn Ala Xaa <210> 11 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD RES
<222> (4) <223> T or S
<220>
<221> MOD_RES
<222> (8) <223> T or S
<400> 11 Ala Asn Ile Xaa Ala Asn Ile Xaa Ala Asn Ile <210> 22 <211> 14 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD RES
<222> (4) <223> T or S
<220>
<221> MOD RES
<222> (9) <223> T or S
<220>
<221> MOD_RES
<222> (14) <223> T or S
<400> 12 Ala Asn Ile Xaa Gly Ser Asn Ile Xaa Gly Ser Asn Ile Xaa <210> 13 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD RES
<222> (5) <223> T or S
<220>
<221> MOD_RES
<222> (9) <223> T or S
<220>
<221> MOD_RES
<222> (13) <223> T or S
<400> 13 Ala Ser Asn Ser Xaa Asn Asn Gly Xaa Leu Asn Ala Xaa <210> 14 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD RES
<222> (4) <223> T or S
<220>
<221> MOD RES
<222> (7)-<223> T or S
<220>
<221> MOD_RES
<222> (10) <223> T or S
<400> 14 Ala Asn His Xaa Asn Glu Xaa Asn Ala Xaa <210> 15 <211> 7 <212> PRT

<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (7) <223> T or S
<400> 15 Gly Ser Pro Ile Asn Ala Xaa <210> 16 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD RES
<222> (7)-<223> T or S
<220>
<221> MOD_RES
<222> (13) <223> T or S
<400> 16 Ala Ser Pro Ile Asn Ala Xaa Ser Pro Ile Asn Ala Xaa <210> 17 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (4) <223> T or S
<220>
<221> MOD_RES
<222> (7) <223> T or S
<220>
<221> MOD_RES
<222> (10) <223> T or S
<400> 17 Ala Asn Asn Xaa Asn Tyr Xaa Asn Trp Xaa <210> 18 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD RES
<222> (5) <223> T or S
<220>
<221> MOD_RES
<222> (9) <223> T or S
<220>
<221> MOD_RES
<222> (12) <223> T or S
<400> 18 Ala Thr Asn Ile Xaa Leu Asn Tyr Xaa Ala Asn Xaa Thr <210> 19 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (5) <223> T or S
<220>
<221> MOD_RES

<222> (9) <223> T or S
<220>
<221> MOD_RES
<222> (13) <223> T or S
<400> 19 Ala Ala Asn Ser Xaa Gly Asn Ile Xaa Ile Asn Gly Xaa <210> 20 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (5) <223> T or S
<220>
<221> MOD_RES
<222> (9) <223> T or S
<220>
<221> MOD_RES
<222> (13) <223> T or S
<400> 20 Ala Val Asn Trp Xaa Ser Asn Asp Xaa Ser Asn Ser Xaa <210> 21 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (5) <223> T or S
<220>

<221> MOD_RES
<222> (9) <223> T or S
<220>
<221> MOD_RES
<222> (13) <223> T or S
<400> 21 Ala Val Asn Trp Xaa Ser Asn Asp Xaa Ser Asn Ser Xaa <210> 22 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (4) <223> T or S
<220>
<221> MOD_RES
<222> (7) <223> T or S
<220>
<221> MOD_RES
<222> (10) <223> T or S .
<400> 22 Ala Asn Asn Xaa Asn Tyr Xaa Asn Ser Xaa <210> 23 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 23 Ala Asn Asn Thr Asn Tyr Thr Asn Trp Thr <210> 24 <211> 15 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Linker <400> 24 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser <210> 25 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 25 cgcagatctg atggctggca gcctcacagg attgc 35 <210> 26 <211> 37 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 26 ccggaattcc catcactggc gacgccacag gtaggtg 37 <210> 27 <211> 35 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 27 acgcgagctc gcccctgcat ccctaaaagc ttcgg 35 <210> 28 <211> 54 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 28 gcgttgacgg cagtcagagt tgacagaagg gccagccagc aaaggatagt catg 54 <210> 29 <211> 62 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 29 ctagcatgac tatcctttgc tggctggccc ttctgtcaac tctgactgcc gtcaacgcag 60 ct 62 <210> 30 <211> 48 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 30 cctgctactg ctcccagcag cagtgaaaga gtccaaagtg gcagcatg 48 <210> 31 <211> 56 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 31 ctagcatgct gccactttgg actctttcac tgctgctggg agcagtagca ggagct 56 <210> 32 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 32 cagctggcca tgggtacccg g 21 <210> 33 <211> 4 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: N-terminal peptide addition <400> 33 Ala Asn Ile Thr <210> 34 <211> 7 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: N-terminal peptide addition <400> 34 Ala Ser Pro Ile Asn Ala Thr <210> 35 <211> 48 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 35 tgggcatcag gtgccaacat tacagcccgc ccctgcatcc ctaaaagc 48 <210> 36 <211> 24 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 36 tttactgttt tcgtaacagt tttg 24 <210> 37 <211> 48 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 37 gcaggggcgg gctgtaatgt tggcacctga tgcccacgac actgcctg 48 <210> 38 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (1) .(13) <223> "Xaa" represents a variable amino acid <400> 38 Ala Xaa Asn Xaa Thr Xaa Asn Xaa Thr Xaa Asn Xaa Thr <210> 39 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (1) .(10) <223> "Xaa" represents a variable amino acid <400> 39 Ala Asn Xaa Thr Asn Xaa Thr Asn Xaa Thr <220> 40 <211> 81 <212> DNA
<213> Artificial Sequence <220>
<221> modified_base <222> (1)..(81) <223> "n" represents a, t, c, g, other or unknown <220>
<223> Description of Artificial Sequence: Primer <400> 40 gtgtcgtggg catcaggtgc cnnsaaydns achdnsaayd nsachdnsaa ydnsachgcc 60 cgcccctgca tccctaaaag c 81 <210> 41 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 42 ggcacctgat gcccacgaca ctgcctg 27 <210> 43 <211> 68 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <220>
<221> modified_base <222> (1)..(68) <223> "nnn" is a mixture of trinucleotide colons for all natural amino acid residues, except proline <400> 43 cgtgggcatc aggtgccaac nnnachaayn nnachaaynn nachgcccgc ccctgcatcc 60 ctaaaagc 68 <210> 44 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 44 gttggcacct gatgcccacg acactgcctg 30 <210> 45 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (4) <223> variable amino acid <220>
<221> MOD_RES
<222> (12) <223> F or L
<400> 45 Ala Phe Asn Xaa Thr Leu Asn Lys Thr Trp Asn Xaa Thr <210> 46 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial. Sequence: Synthetic peptide <400> 46 Thr Met Asn Asn Thr Trp Asn Trp Thr Trp Asn Trp Thr <210> 47 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 47 Ala Leu Asn Ser Thr Gly Asn Leu Thr Val Asp Gly Thr <210> 48 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 48 Ala Ser Asn Ser Thr Phe Asn Leu Thr Glu Asn Leu Thr <210> 49 <211> 12 <212> PRT

<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 49 Thr Arg Asn Val Thr Ile Asn Cys Thr Asn Ser Thr 1 5 l0 <210> 50 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 50 Ala Leu Asn Trp Thr Tyr Asn Gly Thr Lys Asn Val Thr <210> 51 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 51 Ala Ala Asn Trp Thr Val Asn Phe Thr Gly Asn Phe Thr <210> 52 <211> 12 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD RES
<222> (2) <223> variable amino acid <220>
<221> MOD_RES
<222> (4) <223> variable amino acid <400> 52 Ala Xaa Asn Xaa Thr Val Asn Ser Thr Asn Val Thr <210> 53 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 53 Ala Asn Asn Phe Thr Phe Asn Gly Thr Leu Asn Leu Thr 1 5 l0 <210> 54 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 54 Ala Gly Asn Trp Thr Ala Asn Val Thr Val Asn Val Thr <210> 55 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 55 Ala Gly Asn Ser Thr Ser Asn Val Thr Gly Asn Trp Thr <210> 56 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 56 Ala Val Asn Ser Thr Met Asn Ile His Ala Ile Pro Pro <210> 57 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 57 Ala Gly Asn Gly Thr Val Asn Gly Thr Ile Asn Gly Thr <210> 58 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD RES
<222> (8)-<223> variable amino acid <400> 58 Ala Val Asn Ser Thr Gly Asn Xaa Thr G1y Asn Trp Thr <210> 59 <211> 12 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 59 Ala Gly Asn Gly Thr Asn Gly Thr Ser Asn Leu Thr <210> 60 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 60 Ala Met Asn Ser Thr Lys Asn Ser Thr Leu Asn Ile Thr <210> 61 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 61 Ala Phe Asn Tyr Thr Ser Lys Asn Ser Thr <210> 62 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 62 Ala Val Asn Ala Thr Met Asn Trp Thr Ala Asn Gly Thr <210> 63 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 63 Ala Ser Asn Ser Thr Asn Asn Gly Thr Leu Asn Ala Thr <210> 64 <211> 13 <212> PRT
<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Synthetic peptide <400> 64 Ala Arg Asn Lys Thr Lys Asn Phe Thr I1e Asn Leu Thr <210> 65 <211> 12 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 65 Ala Pro Asn Ile Thr Asn Asp Thr Val Asn Met Thr <210> 66 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 66 Ala Gln Asn Lys Thr Phe Asn Phe Thr Met Asn Cys Thr <210> 67 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 67 Ala Leu Asn Val Thr Trp Asn Cys Thr Leu Asn Leu Thr <210> 68 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 68 Ala Leu Asn Thr Thr Trp Thr Asn Leu Thr <210> 69 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 69 Ala Asn Thr Thr Asn Phe Thr Asn Glu Thr <210> 70 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 70 Ala Asn Trp Thr Asn Arg Thr Asn Cys Thr <210> 71 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 71 Ala Asn Trp Thr Asn Phe Thr Asn Trp Thr <210> 72 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 72 Pro Thr Gly Leu Ile Gly Thr Asn Phe Thr <210> 73 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 73 Ala Asn Trp Thr Asn Lys Thr Asn Phe Thr <210> 74 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 74 Ala Asn Asn Thr Asn Leu Thr Asn Ala Thr <210> 75 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 75 Ala Asn Tyr Thr Asn Trp Thr Asn Phe Thr <210> 76 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 76 Ala Asn Thr Thr Asn Gln Thr Asn Asp Thr <210> 77 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 77 Ala Asn Arg Thr Asn Trp Thr Asn Thr Thr <210> 78 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 78 Pro Thr Ala Thr Asn His Thr Asn Ser Thr <210> 79 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 79 Ala Asn Trp Thr Asn Gln Thr Asn Gln Thr <210> 80 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 80 Ala Asn Trp Thr Asn Trp Thr Asn Ala Thr <210> 81 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 82 Ala Asn Phe Thr Asn Lys Thr Asn Met Thr <210> 83 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 83 Ala Asn His Thr Asn Glu Thr Asn Ala Thr <210> 84 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (3) <223> C or W
<400> 84 Ala Asn Xaa Thr Asn Phe Thr Asn Glu Thr <210> 85 <211> 9 <212> PRT
<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Synthetic peptide <400> 85 Ala Asn Leu Asp Lys Leu His Lys His <210> 86 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 86 Ala Asn Cys Phe Thr Asn G1n Thr Asn Phe Thr <210> 87 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 87 Ala Asn Trp Thr Asn Trp Thr Asn Glu Trp Thr <210> 88 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 88 Ala Asn Cys Thr Asn Trp Thr Asn Cys Thr <210> 89 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 89 Cys His Pro Tyr Asn Trp Thr Asn Trp Thr <210> 90 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 90 Ala Asn Glu Thr Asn Tyr Thr Asn Glu Thr <210> 91 <211> 7 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 91 Ala Asn Trp Thr Asn Trp Thr <210> 92 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 92 Ala Lys Pro Tyr Lys Ser Tyr Lys Phe Tyr <210> 93 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 93 Ala Asn Ile Thr Asn Lys Thr Asn Trp Thr <210> 94 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 94 Ala Asn Trp Thr Asn Met Thr Asn Ile Thr <210> 95 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 95 Ala Asn Asn Thr Asn Arg Thr Asn Phe Thr <210> 96 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 96 Ala Asn Trp Thr Asn Trp Thr Asn Trp Thr <210> 97 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 97 Ala Asn Trp Arg Thr Asn His Thr Asn Lys Thr <210> 98 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 98 Ala Asn Gln Thr Asn 21e Thr Asn Trp Thr <210> 99 <211> 11 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 99 Ala Asn Phe Thr Asn Val Ala Thr Asn Gln Thr <210> 100 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (1) <223> most probable amino acid <220>
<221> MOD_RES
<222> (2) <223> most probable amino acid <220>
<221> MOD_RES
<222> (5) <223> variable amino acid <220>
<221> MOD RES
<222> (9) <223> most probable amino acid <400> 100 A1a Asn Thr Thr Xaa Leu Thr Asn Lys Thr <210> 101 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (6) <223> S or C
<400> 101 A1a Asn Lys Thr Asn Xaa Thr Asn Ile Thr <210> 102 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <220>
<221> MOD_RES
<222> (9) <223> most probable amino acid <400> 102 Ala Asn Trp Thr Asn Cys Thr Asn Ile Thr <210> 103 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide WO 02/02597 ~ PCT/DKO1/00459 <220>
<221> MOD_RES
<222> (6) <223> F or L
<400> 103 Ala Asn Trp Thr Asn Xaa Thr Asn Trp Thr <210> 104 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 104 Cys Gln Leu Asp Arg Ser Thr Asn Glu Thr <210> 105 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 105 Ala Asn Asn Thr Asn Tyr Thr Asn Trp Thr <210> 106 <211> 10 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 106 Ala Asn Asn Thr Asn Tyr Thr Asn Trp Thr <210> 107 <211> 12 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 107 Ala Ala Asn Asp Thr Asn Trp Thr Val Asn Cys Thr <210> 108 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 108 Ala Thr Asn Ile Thr Leu Asn Tyr Thr Ala Asn Thr Thr <210> 109 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 109 Ala Ala Asn Ser Thr Gly Asn Ile Thr Ile Asn Gly Thr <210> 110 <211> 13 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 110 Ala Val Asn Trp Thr Ser Asn Asp Thr Ser Asn Ser Thr <210> 111 <211> 13 <212> PRT
<213> Artificial Sequence <220>

<223> Description of Artificial Sequence: Synthetic peptide <400> 111 Ala Ser Pro Ile Asn Ala Thr Ser Pro Ile Asn Ala Thr <210> 112 <211> 4 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Linker <400> 112 Gly Gly Gly Gly <210> 113 <211> 4 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Linker <400> 113 Gly Asn Ala Thr <210> 114 <211> 8 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 114 Asn Ser Thr Gln Asn Ala Thr Ala <210> 115 <211> 14 <212> PRT
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Synthetic peptide <400> 115 Ala Asn Leu Thr Val Arg Asn Leu Thr Arg Asn Val Thr Val

Claims (57)

1. A glycosylated polypeptide comprising the primary structure NH2-X-Pp-COOH

wherein X is a peptide addition comprising or contributing to a glycosylation site, and Pp is a polypeptide of interest.

2. A glycosylated polypeptide comprising the primary structure NH2-Px-x-Py-COOH, wherein Px is an N-terminal part of a polypeptide Pp of interest, Py is a C-terminal part of said polypeptide Pp, and X is a peptide addition comprising or contributing to a glycosylation site.

3. The polypeptide according to claim 1 or 2, wherein Pp is a mature polypeptide.

4. The polypeptide according to claim 2 or 3, wherein Px is a non-structural N-terminal part of a mature polypeptide Pp, and Py is a structural C-terminal part of said mature polypeptide.

5. The polypeptide according to any of claims 1-4, wherein Pp is a native polypeptide.

6. The polypeptide according to any of claims 1-5, wherein Pp is a variant of a native polypeptide.

7. The polypeptide according to claim 6, wherein Pp comprises at least one introduced and/or at least one removed glycosylation site for a non-peptide moiety as compared to the corresponding native polypeptide.

8. The polypeptide according to any of claims 1-7, wherein Pp is of mammalian origin.

9. The polypeptide according to claim 8, wherein Pp is of human origin.

10. The polypeptide according to any of claims 1-9, wherein Pp is a therapeutic polypeptide.

11. The polypeptide according to any of claims 1-10, wherein Pp is selected from the group consisting of an antibody or antibody fragment, a plasma protein, an erythrocyte or thrombocyte protein, a cytokine, a growth factor, a profibrinolytic protein, a protease inhibitor, an antigen, an enzyme, a ligand, a receptor, or a hormone.

12. The polypeptide according to any of claims 1-7, 10 or 11, wherein Pp is of microbial origin.
tcctgaagca cccagataca cagagccttg tcggtcatca aa

13. The polypeptide according to claim 12, wherein Pp is a microbial enzyme.

14. The polypeptide according to claim 13, wherein Pp is selected from the group consisting of protease, amylase, amyloglucosidase, pectinase, lipase and cutinase.

15. The polypeptide according to any of claims 1-14, wherein X comprises 1-500 amino acid residues.

16. The polypeptide according to claim 15, wherein X comprises 2-50 amino acid residues, such as 3-20 amino acid residues.

17. The polypeptide according to any of claims 1-16, wherein X comprises 1-20, in particular 1-10 glycosylation sites.

18. The polypeptide according to any of the preceding claims, wherein X
comprises at least one glycosylation site within a stretch of 30 amino acid residues, such as at least one within 20 amino acid residues, in particular at least one within 10 amino acid residues, in particular 1-3 glycosylation sites.

19. The polypeptide according to any of claims 1-18, wherein X comprises at least two glycosylation sites, wherein two of said sites are separated by at most 10 amino acid residues, none of which comprises a glycosylation site.

20. The polypeptide according to any of claims 6-19, wherein the polypeptide Pp is a variant of a native polypeptide which, as compared to said native polypeptide, comprises at least one introduced or at least one removed glycosylation site.

21. The polypeptide according to claim 20, wherein the polypeptide Pp comprises at least one introduced glycosylation site, in particular 1-5 introduced glycosylation sites.

22. The polypeptide according to any of claims 1-21, wherein X has an N
residue in position -2 or -1, and Pp has a T or an S residue in position +1 or +2, respectively, the residue numbering being made relative to the N-terminal amino acid residue of Pp.

23. The polypeptide according to any of claims 1-22, wherein X has the structure X1-N-X2-[T/S]-Z, wherein X1 is a peptide comprising at least one amino acid residue or is absent, X2 is any amino acid residue different from a proline residue, and Z is absent or a peptide comprising at least one amino acid residue, the N-terminal amino acid residue of which is different from a proline.

24. The polypeptide according to claim 23, wherein X1 is absent, X2 is an amino acid residue selected from the group consisting of I, A, G, V and S, and Z
comprises at least one amino acid residue, the N-terminal amino acid residue of which is different from proline.

25. The polypeptide according to claim 24, wherein Z is a peptide comprising 1-amino acid residues, preferably comprising 1-10 glycosylation sites.

26. The polypeptide according to claim 25, wherein X1 comprises at least one amino acid residue, X2 is an amino acid residue selected from the group consisting of I, A, G, V and S, and Z is absent.

27. The polypeptide according to claim 26, wherein X1 is a peptide comprising amino acid residues, preferably comprising 1-10 glycosylation sites.

28. The polypeptide according to any of claims 1-27, wherein X comprises a peptide sequence selected from the group consisting of INA[T/S], GNI[T/S], VNI[T/S], SNI[T/S], ASNI[T/S], NI[T/S], SPINA[T/S], ASPINA[T/S], ANI[T/S]ANI[T/S]ANI, ANI[T/S]GSNI[T/S]GSNI[T/S],FNI[T/S]VNI[T/S]V
YNI[T/S]VNI[T/S]V, AFNI[T/S]VNI[T/S]V, AYNI[T/S]VNI[T/S]V, APND[T/S]VNI[T/S]V, ANI[T/S], ASNS[T/S]NNG[T/S]LNA[T/S], ANH[T/S]NE[T/S]NA[T/S], GSPINA[T/S], ASPINA[T/S]SPINA[T/S], ANN[T/S]NY[T/S]NW[T/S], ATNI[T/S]LNY[T/S]AN[T/S]T, AANS[T/S]GNI[T/S]ING[T/S], AVNW[T/S]SND[T/S]SNS[T/S], GNA[T/S], AVNW[T/S]SND[T/S]SNS[T/S], ANN[T/S]NY[T/S]NS[T/S], ANNTNYTNWT, ANI[T/S]VNI[T/S]V, ND[T/S]VNF[T/S] and NI[T/S]VNI[T/S]V wherein [T/S] is either a T
or an S residue, preferably a T residue.

29. The polypeptide according to any of claims 1-29, wherein the peptide addition X
comprises the sequence NSTQNATA or ANLTVRNLTRNVTV.

30. The polypeptide according to any of the preceding claims, further comprising an attachment group for a second non-peptide moiety, said attachment group being linked to the second non-peptide moiety.

31. The polypeptide according to claim 30, wherein the non-peptide moiety is selected from the group consisting of a polymer molecule, a lipophilic group and an organic derivatizing agent.

32. The polypeptide according to claim 30 or 31, wherein the attachment group for the non-peptide moiety is one present on an amino acid residue selected from the group consisting of the N-terminal amino acid residue, the C-terminal amino acid residue, lysine, cysteine, arginine, glutamine, aspartic acid, glutamic acid, serine, tyrosine, histidine, phenylalanine and tryptophan.

33. The polypeptide according to any of claims 30-32, wherein the polypeptide Pp is a variant of a native polypeptide, which as compared to said native polypeptide, comprises at least one introduced and/or at least one removed attachment group for the second non-peptide moiety.

34. The polypeptide according to claim 33, wherein the polypeptide Pp comprises at least one introduced attachment group, in particular 1-5 introduced attachment groups.

35. The polypeptide according to any of the preceding claims, which has a molecular weight of at least 67 kDa, in particular at least 70 kDa.

36. The polypeptide according to any of the preceeding claims, which has at least one of the following properties relative to the polypeptide Pp, the properties being measured under comparable conditions:
if vitro bioactivity which is at least 25% of that of the polypeptide Pp as measured under comparable conditions, increased affinity for a mannose receptor or other carbohydrate receptors, increased serum half-life, increased functional in vivo half-life, reduced renal clearance, reduced immunogenicity, increased resistance to proteolytic cleavage, improved targeting to lysosomes, macrophages and/or other subpopulations of human cells, improved stability in production, improved shelf life, improved formulation, e.g. liquid formulation, improved purification, improved solubility, and/or improved expression.

37. A nucleotide sequence encoding the polypeptide according to any of claims 1-36.

38. A vector comprising the nucleotide sequence according to claim 37.

39. A host cell transformed or transfected with a nucleotide sequence according to claim 37, or a vector according to claim 38.

40. The host cell according to claim 39, which is a glycosylating host cell.

41. The host cell according to claim 40, which is a mammalian cell, an invertebrate cell such as an insect cell, a yeast cell or a plant cell, or a transgenic animal.

42. A method of producing the polypeptide according to any of claims 1-36, comprising culturing a host cells according to any of claims 39-41 under conditions permitting expression of the polypeptide and recovering the polypeptide from the culture.

43. A method of producing a polypeptide according to any of claims 30-36 attached to a second non-peptide moiety, which method comprises subjected the polypeptide to conjugation to the non-peptide moiety under conditions for the conjugation to take place.

44. The method according to claim 43, wherein the polypeptide is prepared by the method according to 42 or 43.

45. A method of preparing a nucleotide sequence according to claim 37, which method comprises a) subjecting a nucleotide sequence encoding the polypeptide Pp to elongation mutagenesis, b) expressing the mutated nucleotide sequence obtained in step a) in a suitable host cell, optionally c) conjugating polypeptides expressed in step b) to a second non-peptide moiety, d) selecting polypeptides obtained in step b) or c) which comprises at least one oligosaccharide moiety and optionally a second non-peptide moiety attached to the peptide addition part of the polypeptide, and e) isolating a nucleotide sequence encoding the polypeptide selected in step d).

46. The method according to claim 45, which further comprises screening polypeptides resulting from step b) or c) for at least one improved property, and wherein the selection step d) further comprises selecting polypeptideshaving such improved property.

47. The method according to claim 45 or 46, wherein the elongation mutagenesis is conducted so as to enrich for codons encoding an amino acid residue comprising a glycosylation site.

48. The method according to claim 45 or 46, wherein the elongation mutagenesis is conducted so as to enrich for codons required for introduction of an attachment group for a second non-peptide moiety.

49. The method according to any of claims 44-48, which further comprises subjecting the part of the nucleotide sequence encoding Pp to mutagenesis to remove and/or introduce glycosylation sites and optionally amino acid residues comprising an attachment group for the second non-peptide moiety.

50. The method according to any of claims 45-49, wherein the selection in step d) is performed so as to select a conjugate having at least one of the properties defined in claim 36.

51. A method of producing a glycosylated polypeptide encoded by a nucleotide sequence prepared according to claims 45-50, wherein the nucleotide sequence encoding the polypeptide selected in step c) is expressed in a glycosylating host cell and the resulting glycosylated expressed polypeptide is recovered.

52. A method of improving one or more selected properties of a polypeptide Pp of interest, which method comprises a) preparing a nucleotide sequence encoding a polypeptide with the primary structure NH2-X-Pp-COOH, wherein X is a peptide addition comprising or contributing to a glycosylation site that is capable of conferring the selected improved property/ies to the polypeptide Pp, b) expressing the nucleotide sequence of a) in an suitable host cell, optionally c) conjugating the expressed polypeptide of b) to a second non-peptide moiety, and d) recovering the polypeptide resulting from step c).

53. The method according to claim 52, wherein the polypeptide Pp and/or the peptide addition X is as defined in any of claims 1-40.

54. The method according to claim 52 or 53, wherein the nucleotide sequence of step a) is prepared by subjecting a nucleotide sequence encoding the polypeptide Pp to random elongation mutagenesis.

55. The method according to claim 54, wherein the random elongation mutagenesis is conducted so as to enrich for codons encoding an amino acid residue comprising or contributing to a glycosylation site and/or an attachment group for the second non-peptide moiety.

56. The method according to any of claims 52-55, wherein, in the preparation of the nucleotide sequence of a), the part of the nucleotide sequence encoding the polypeptide Pp is subjected to mutagenesis to remove and/or introduce a glycosylation site or to remove and/or introduce an attachment group for a second non-peptide moiety.

57. The method according to any of claims 52-56, wherein the property/ies to be improved is/are selected from the properties defined in claim 37.