CA2390972A1

CA2390972A1 - Bovine viral diarrhea virus (bvdv) p80 and p80.delta.50 proteins as inducers of cell apoptosis

Info

Publication number: CA2390972A1
Application number: CA 2390972
Authority: CA
Inventors: Denis Archambault
Original assignee: Universite du Quebec a Montreal
Current assignee: Individual
Priority date: 2002-05-27
Filing date: 2002-06-19
Publication date: 2003-11-27
Also published as: WO2003099861A1; AU2003233703A1

Abstract

Pestivirus bovine viral diarrhea virus (BVDV) is one of the most important pathogen in cattle. BVDV strains exist as two biotypes, cytopathogenic (cp) and noncytopathogenic (ncp), according to heir effects on tissue culture cells. It has been previously reported that cell death associated to cp BVDV in vitro is mediated by apoptosis. In contrast to the situations described for other members of the Flaviviridae family (for instance, classical swine fever virus); only cp strains of BVDV express the p80 (also designated NS3 according to internationnaly recognized nomenclature) protein in virus-infected cells in vitro, uggesting its role in the virus-associated cytopathogenicity of the virus. In this study, experiments were conducted in order to determine whether the BVDV p80 is a key-factor able to directly induce cell apoptosis.
To do so, the p80-and p80.DELTA.50 (which is the p80 deleted from the NH2-terminal 50 amino acids)-cDNA encoding sequences of BVDV NADL cp strain were cloned into AdTR5-DC-GFPq transfer vector for the generation of recombinant adenoviruses (rec-Adenovirus) from which the BVDV
gene of interest could be expressed from a tetracycline-responsive promoter in a di-cistronic means coexpressing the green fluorescent protein (GFP). A549tTA cells infected in vitro with p80 or p80.DELTA.50-expressing rec-Adenovirus showed cytopathogenic changes characterized by cell rounding and detachment, and nucleus chromatin condensation: DNA fragmentation assays (oligonucleosomal DNA ladder formation on agarose gel and TUNEL) performed on these infected cells clearly correlated the observed cytopathogenic charnges with apoptosis. Moreover, the BVDV p80 or p80.DELTA.50-induced apoptosis process correlated with the activation of cellular proteases of the ICE family (caspases), as determined by cleavage of the death substrate poly(ADP-ribose) polymerase (PARP). The results have also indicated that the BVDV p80.DELTA.50 appears to be a better apoptosis induces than the whole BUDV p80 as determined by the kinetics of PARP cleavage; quantitation of apoptotic cells over time, and by the cythopathogenic effect which appeared significantly earlier in cells infected with the BVDV
p80.DELTA.50-expressing sec-Adenovirus than in cells infected with the BVDV p80-expressing sec-Adenovirus.
These results which might reflect different protein expression levels within the infected cells are consistent with the expression results obtained in bacteria with a procaryotic expression vector containing the p80-encoding sequence which showed no significant expression of the p80 as opposed to plasmid constructs which readily were able to induce expression of either the p80.DELTA.26 (deletion of the NH2-terminal 26 amino acids of the p80) or p80.DELTA.50 (deletion of the NH2-terminal 50 amino acids of the p80). Finally, the results have also hown that the BVDV
p80.DELTA.50-associated apoptotic process was inhibited by baculovirus p35 protein. In addition, preliminary results indicated that BVDV p80 and/or p80.DELTA.50-induced apoptosis occurs at and/or before S phase of the cell cycle. This study constitutes the first exprimental proof that the p80 of BVDV is an induces of cell apoptosis in vitro. The results also identified the BVDV
p80.DELTA.50 as a potent and powerful induces of apoptosis.

Description

FIELD OF THE INVENTION, The present invention relates generally o the field of apoptosis. More particularly, it relates to protein, such as the BVDV p80 protein; that induces apoptosis.
BACKGROUND OF THE INVENTION
Bovine viral diarrhea virus (BVDU) is an economically important and world-wide distributed pathogen in cattle (lVloennig and Plagemann; 1992; Thiel et al., 1996). BVDV, together with classical swine fever virus (CSFV) and border disease virus (BDV), belongs to the genus Pestivi~us of the Flaviviridae family that also includes human hepatitis C virus (Thiel et al., 1996). The pestiviral genome is a positive, single-stranded RNA molecule of usually 12.3 kb in length that encodes one polyprotein of about 4,000 amino acids, which is co-and post-translationally processed by cell- and virus-derived proteases to give rise to the mature viral proteins (Rice; 1996; Meyers and Thiel, 1996). 'The order of cleavage products in the pestivirus polyprotein is as follows: NH2-Np'°-C-EmS-E1-E2-p7-NS2-NS3-NS4A-NS4B-NSSA-NSSB-COOH: The pestivirus structural proteins are composed of the basic nucleocapsid C protein and of the Ems, El, and E2 envelope glycoproteinsNpr° protein exerts an autoproteinase activity whereas the remaining proteins are likely to be enzymatic or structural proteins of the viral RNA
replication complex. Finally, pestivirus NS3 usually possesses RNA binding, RNA-stimulated nucleoside triphosphatase, RNA helicase, and; proteinase activities (Wiskerchen and Collett, 1991; Tamura et al., 1993; Warrener et al.; 1995), whereas NSSB contains the conserved GDD
motif characteristic of RNA-dependent RNA polymerases (Meyers and Thiel;
1996).
BVDV strains are divided into two major genetic groups. Group I contains the classical BVDV strains (for instance, NADL, Oregon and Singer strains); whereas group II
includes thrombocytopenic and highly virulent strains (for instance, 890 and 24515 isolates) (Pellerin et al., 1994, Ridpath et al., 1994; Archambault et al., 2000). Based on 5' untranslated (UTR) sequences; classical BVDVs could be further divided into two subgroups (la and 1b) (Pellerin et al., 1994, Ridpath et al., 1994; Hammers et al., 2001). BVDV strains also exist as two biotypes, cytopathogenic {cp) and noncytopathogenic (ncp), according to their effects on tissue culture cells (Kummerer et al., 2000): This latter 'observation is parralleled with the fact that only the cp biotypes of BVDV express the protein p80 {NS3) protein that is not identified from cells infected with ncp strains (Mendez et al., 1998 ; Kummerer et al:, 2000): The ncp strains, as for the cp strains, express a 125 kDa polypeptide (p 125) 'which is the precursor of the p80 in cp strains (Kummerer et al., 2000). Therefore, expression of the protein p80 is a marker to distinguish cp and ncp BVDV strains.
BVDV often causes subclinical infections or only mild symptoms in cattle (Baker, 1987 ;
Thiel et al.; 1996): However, fetal infection in the early stage of intrauterine development may result in immunotolerant BVDV persistently-infected animals which will propagate BVDV
infection within the herd (Moennig and Plagernann, 1992 ; Thiel et al., 1996).
Such BVDV
persistently-infected animals will develop a, severe fatal syndrome; called mucosal disease {MD);
generally within the first 18 to 24 months of life (Baker; 1987; Thiel et al:, 1996). Both ncp and cp BVDV, the so-called antigenically-related virus pairs, can be isolated from such animals (McClurkin et a1.,1985 ; Thiel et a1:,1996): The cp BVDV detected in animals with MD may be due to superinfection or may result from ,genomic rearrangements (e.g.
insertion of cellular sequences, rearrangement in the viral genorne) or mutations within the genome of the ncp virus (see Kummerer et al., 2000): In all cases-analysed so far, the genomic changes leading to the cp biotype correlated with the production of the non-structural protein p80 described above (Kummerer et al., 2000). One may therefore hypothesize that expression of p80 is a determinant factor for the cytopathogenicity of these viruses.
Apoptosis (the so-called progiarnmed cell death process) and necrosis are mechanisms by which eukaryotic cells die (Duvall and Wyllie, 1986). Necrosis results from a pathological reaction in response to perturbations in the cell environment, whereas apoptosis is an innate mechanism by which the host eliminates unvuanted cells with no inflammation response. In that regard, apoptosis is considered the physiological form of cell death which occurs during embryonic development, tissue remodeling and tumor regression (Schulze-Osthoff et al., 1998).
Several marnrnalian DNA and RNA viruses have been associated with cell apoptosis (Teodoro and Branton, 1997; O'Brien, 1998)). viruses possess various biochemical and genetic mechanisms to evade and7or induce apoptosis in infected cells through interactions at different stages of the apoptotic pathway. Thus, in the early phases of infection; it would be advantageous for the virus to inhibit host cell death to ensure optimal genomic replication, whereas at late stages of infection, it would be beneficial for the virus to induce apoptosis for maximal production of new virions.
In BVDV, cells infected with the cp biotype has been shown to undergo apoptosis (Zhang et al., 1996). This apoptosis process was associated' with cleavage of poly(ADP-ribose) polymerase (PARP) (Hoff and Donis, 1997) and was prevented by certain antioxidants (Schweizer and Peterhans; 1999). However; the viral determinants involved in cp BVDV-associated apoptosis in the course of cell infection in vitro have never been directly determined. In this report, we clearly demonstrate for the first time that the protein p80 (and p80~50, see below) of BVDV expressed from an adenovirus promoter-inducible expression system is enable to induce programmed cell death (apoptosis) in vitro, as determined by cell DNA fragmentation assays and cleavage of the PARP death substrate, an indicator of caspase activation. In addition, BVDV
p80 (p80~50)-associated cell apoptosis was inhibited by baculovirus p35 protein. Finally;
experiments conducted with a recombinant adenovirus (rec-Adenovirus) expressing a deletion mutated form of the p8U protein (p80~50) have shown that the NH2-terminal filthy amino acids of the protein are not involved in BVDV p80-induced apoptosis. Thus, the BVDV p80050 is also a potent inducer of cell' apoptosis in vitro.
SUMMARY OF THE INVENTION
An object of the invention is to provide an isolated and purified protein capable of inducing apoptosis and its use in the treatment or prevention of cancer diseases andlor immunological or any other physiological disorders.

According to an aspect of the invention; the protein is the BVDV p80 protein or functional fragments thereof.
DESCRIPTION OF THE INVENTION
Materials And Methods Cells and viruses The cells used in this study were free of mycoplasmas, and fetal bovine serum was exempt of BVDV antigen and BVDV-specific antibodies. BVDV-free MDBK cells (a gift from Susy Carman, Animal Diagnostic Laboratory, Guelphs Ontario) were maintained in Dulbecco minimal essential medium (DMEM) with high glucose concentration supplemented with 2 mM
L-glutamine, 0.2% (w/v) lactalbumin HCI, 10% fetal bovine serum (FBS) (GibcoBRL, Gaithersburg, ' MD) and antibiotics. For cell infection, confluent 2-day old cultures were inoculated with type 1 cp NADL reference strain of BVDy (ATCC # VR-534) and were further incubated with 2% FBS in DMEM until 50 to 70% of the cells exhibited a cytopathic effect.
After one cycle of cell freezing and thawing, the cell culture supernatant was collected by centrifugation: The viral titers were determined and calculated as the median tissue culture infective dose (TCIDSO) per ml (St-Laurent et al:; 1994).
BMAdEl 220-8, 293A, and 293rtTA (Jani et al., 1997; Massie et al., 1998a, b) were propagated in antibiotic-free DMEM supplemented with 10% tetracycline-free FBS
{Clontech Laboratories Inc., Palo Alto, CA). 293rtTA cells were used to generate recombinant adenoviruses (rec-Adenovirus) expressing the protein of interest and to titrate the adenovirus stocks by measuring green fluorescent protein (GFP) signal by cytofluorometry, whereas BMAdEl 220-8 or 293A cells were used for virus amplification to generate adenovirus stocks (Jani et al., 1997). A549 cells (derived from human lung carcinoma tissues) which were genitically transformed to express the tetracycline transactivation factor (tTA) (A549tTA) (Massie et al:; 1998a, b) were used in the cell 'apoptosis experiments-conducted with the rec-Adenoviruses.
Viral RNA isolation and oligonucleotide primers Viral genomic RNA was extracted using the guanidium isothiocyanate method from the supernatant of infected MDBK cells as described (Abed et al., 1999): The oligonucleotide primers for reverse transcription-PCR (RT-PCR) amplification of nucleic acid sequences that encode BVDV p80 protein (nucleotides 5423 to 7471 of the viral genome; amino acids 1 to 683 of the p80) and truncated forms of p80 e:g. the p80~26 protein (nucleotides SSOl to 7471 of the viral genome, ;amino acids 27 to 683 of-the p80) and the p80050 protein (nucleotides 5573 to 7471 of the viral genome; amino acids 51 to 6'83 of the p80) were selected according to the BVDV NADL strain genomic sequence (Genbank Database accession number M31182), and to the predicted NH2- and COOH-termini of the protein (Xu et al:, 1997). Primers (listed in Table 1 ) contained short 5' extensions in which restriction endonuclease cleavage sites; initation or termination codons and/or histidine codons' were present for cloning/subcloning and expression purposes.

Reverse transcription-PCR amplification, cloning, and sequencing The BVDV genomic RNA was converted to complementary DNA (cDNA) by reverse transcription using random hexadeoxyribonucleotides (pd(N)6 ; Pharmacia Biotech Inc., Uppsala, Sweden) as previously described (St-Laurent et al., 1994). The cDNA
was then amplified by ;using the appropriate primer pair with a programmable thermal cycler by 35 successive cycles of denaturation at 95 °C for 1.30 min; primer annealing at 48 °C for 1.30 min, and DNA chain extension at 72 °C for 2.30 min: The amplified cDNA
products were subsequently cloned into the pbluescript/KS+ (pBS) vector according to the manufacturer's instructions (Stratagene; La Jolla; CA) to generate the plasmid constructs pBS/pEt (p80), pBS/pEt (p80026); pBS/pEt (p80050), pBS/Ad (p80), and pBS/Ad (p80~50) (Table 1). All constructs were sequenced by the chain termination method of Sanger et al. ( 1977} to confirm the BVDV-specific nature of the amplified product:
Expression of BVDV p80 in Escherichia coli (E. coh~ and production of BVDV p80-specific antiserum The cDNA sequences encoding BVDV p80, p80026, and p80~50 were excised from the pBS/pEt (p80), pBS/pEt (p80426), and pBS/pEt (p80050) plasmid constructs with the appropriate restriction enzymes, purified by using a low-melting-temperature agarose gel, and ligated into the procaryotic expression vector pEt-21b (Novagen; Madison; WI).
This procedure allowed the BVDV p80-; p80026, or p80~50-encoding sequences to be in frame with a six histidine-tag at the NH2-terminal; generating pEt-21b-p80, pEt-21b-p80026; and pEt-21b-p80050 which then could putatively express 'recombinant rHis-p80, rHis-p80a26, or rHis=
p80050 fusion proteins. The recombinant plasmids were sequenced as above to confirm that the junction sequence was in the correct reading frame.
Protein expression in E. coli strain DHSa was performed as previously described (St-Laurent and Archambault; 2000): The resulting -soluble (bacterial crude extracts) and insoluble (inclusion bodies) fractions were analysed by 12 % sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Kheyar et al., 1997). Recombinant fusion proteins that were mostly present in the insoluble fraction (inclusion bodies) were purified by electroelution (Microeluter, BioRad, Hercules, CA) of the proteins that were cut out of a 8%
SDS-PAGE
(Kheyar et al.; 1997). The purity and concentration of the, purified recombinant proteins were assessed by Coomassie-blue stained-SDS-PAGE. BVDV p80-specific polyclonal antibodies were raised by immunizing a New Zealand white rabbit with rHis-p80~50 fusion protein, according to a standard protocol (Harlow and Lane, 1988). Antiserum was then tested by Western immunoblotting to confirm the presence of specific antibodies to the immunizing protein (Kheyar et al., 1997): This antiserum was used in further experiments (see above) to assess BVDV p80 or p80~50 expression in mammalian cells:
Construction of recombinant adenoviruses (rec-Adenovirus) and cell infection The procedures used were carried out essentially as described (Jani et al. , 1997). To construct the rec-Adenoviruses, the cDNA p80 and p80050-encoding sequences were excised from plasmids pBS/Ad (p80); and pBS/Ad (p80050); respectively, with restriction enzyme Pmel (blunt ends), purified; and cloned in the adenovirus transfer vector AdTRS-DC-GFPq digested with EcoRT~ (blunt ends). This transfer vector enables the gene of interest to be expressed from a tetracycline-inducible promoter in a di-cistronic means coexpressing the green fluorescent protein (GFP) and the BVDV protein of interest: Thereafter, 293A cells were co-transfected with FseI-restricted transfer vector, and the-CIaI-restricted Ad5/~El~E3 viral DNA
to generate recombinant viruses by in vivo homologous recombination between overlapping sequences of linearized transfer vectors pADTRSf DC-GFPq, and AdS/DElDE2 genomic DNA
(Massie et al., 1998a, b). Recombinant adenovirus-containing plaques were screened 10 to 15 days after cell transfection by monitoring basal GFP expression by fluorescence microscopy.
Recombinant adenoviruses were then purified by three further rounds of plaque isolation, and expanded in 293 cells as described. (Jani et al., 1997 Massie et al., 1998b). Titers of the recombinant adenovirus stocks were determined by a method based on the measurement of the GFP signal by cytofluorometry (Massie et al., 1998a). By this means, rec-Adenovirus stocks with transformed viral titers ranging from 3.2 x 101° to 2:2 x 1011 plaque forming units (PFU) per ml were obtained:
In order to determine the apoptotic capability of BVDV p80 or p80050, one-day old (sub-confluent) old A549tTA cells were infected with each of the rec-Adenovirus expressing the respective BVDV protein at multiplicity of infection (MOI) value of 500 PFU/cell (as determined in preliminary experiments where a range of virus titers of 125 to 1,000 PFU/cell was tested). A recombinant adenovirus only expressing GFP (rec-Adenovirus-GFP) with the same genetic background as the rec-Adenoviruses expressing the BVDV proteins was used as a negative control; whereas cells treated with actinomycin D (50 ~g/ml) was used as a positive control of apoptosis (Archambault and St-Laurent, 2000). Briefly; cells wee seeded at densities of 3 X 106 cells per 75 cm2 flask (for cell DNA fragmentation assay on agarose gel, p80 and p80~50 expression by Western blot; and PARP cleavage detection), 2 X 105 cells per well in six-well plates (for flow cytometry analyses), and 3 X 104 cell per well in eight-well Labtek-chambers (Nalge Nunc International, Naperville,, IL) (for TUNEL DNA
fragmentation assay and fluoresence microscopy analyses) in DMEM supplemented with 10% FBS. Cells were then washed with PBSS, pH 7:3, mock-infected, treated with actinomycin D; or inoculated with each of the recombinant virus to 12 ml (75 cm2 flasks), 2 ml (each well of six-well plates) or 300 p1 (each well of eight-well Labtek chamber wells) of DMEM with 5% FBS for 4 h at 37 °C under slow agitation using a rocker platform. Cells -were further incubated without agitation and analysed for cell apoptosis indicators (see below) or BVDV gene expression at different period times pi.
Expression of BVDV p80 and p80050 in mammalian cells by Western irnmunoblotting and' fluorescence microscopy For the Western immunoblotting procedure; cells were washed in phosphate-buffered saline solution (PBS's), pH 7.3, and lysed in standard SDS-PAGE sample buffer:
Proteins were fractionated by 15% SDS-PAGE and - electrotransferred onto nitrocellulose membranes.
Immunoblotting was performed by using; as the blocking reagent solution, 5%
nonfat dried milk solids and 0.05% Tween 20 in PBSS. The blot was then incubated with rabbit preimmune and anti-BVDV p80~50 antiserum (used at a dilution of 1:500) for 2 h at room temperature: The membranes were then washed three times in PBSS before adding a peroxidase-conjugated goat anti-rabbit imrnunoglobulin G (whole molecule) for 1 h at room temperature.
The imrnunological reactivity was revealed after adding the peroxidase substrate (PBSS; ph 7:3, H202, methanol and 4-chloro-naphthol) for 20 min (Abed et al:; 1999).

For fluorescence microscopy; cells were examined with a confocal fluorescence microscope (Model MRC-1024, Biorad). Briefly, cells grown on glass coverslips - (eight-well Labtek chamber) were fixed in 4% paraformaldehyde in PBSS~ pH 7:3, for l h at room temperature and permeabilised with 0.1 % Triton X-100 in 0.1 % sodium citrate for 10 min.
Cells were then exposed to rabbit anti-BVDV p80~50 antiserum (1:100, 1 h at 37 °C in a humidified chamber) in PBSS containing 3% (wfv) bovine serum albumin. Cells were washed three times in PBSS
before adding for l h a Cy3-conjugated goat anti-rabbit immunoglobulin G
(whole molecule) (Sigma Chemical Company, St-Louis, MO) used at a l :500 dilution. Cy3-conjugated antibody was excited with a Green HeNe 543 nm laser beam, and fluorescence emission was collected at 575 nm. GFP was excited with an argon laser at 488 nm, and fluorescence emission was collected at 515 nm. Sequential collection was performed for each sample to avoid overlapping fluorescence.
DNA fragmentation The fragmentation of cellular DNA was analysed by visualizing oligonucleosomal-sized DNA fragments (DNA ladder formation) essentially as described (Archambault and St-Laurent, 2000). In situ DNA fragmentation from cells that were grown in coverslips (8-well Labtek chamber) was assessed using, a colorimetric Tdt-mediated dUTP nick end labeling (TUNEL) commercial kit (In situ Cell Death Detection, POD; Roche Diagnostics, Mannheim, Germany);
according to the supplier's instructions.
Detection of poly(ADP-ribose) polymerase (PARP) cleavage Adherent cells collected at various timepoints following treatment (actinomycin D or infection with each rec-Adenovirus} were washed with PBSS; pooled with detached cells, lysed in standard SDS-PAGE Sample buffer containing 6 M urea, and sonicated for 15 sec on ice. Cell proteins were fractionated by 8% SDS-PAGE and electrotransferred onto nitrocellulose membranes. Immunoblotting was' performed as 'above by using, as primary antibody, a PARP
monoclonal antibody (C-2-10; BioVision Inc., Mountain View; CA), and, as secondary antibody, a peroxidase-conjugated goat anti-mouse immunoglobulin G (H + L chains). The membranes were developed by enhanced chemiluminescence, (ECL; PerkinElmer; Boston; MA).
Cytometry analysis Single cell suspensions {including adherent and nonadherent cells) were prepared at various timepoints following rec-Adenovirus infection by trypsinization, centrifugated and resuspended in 200 ~,1 of a solution containing 25 ~gfml propidium iodide (PI), 0.06%
saponin, 2.5 Ufml RNAse A, and 20 ~,M (EDTA) for 20 min before cytometry analysis using a fluorescence-activated cell ,sorter (FACScan; Becton Dickinson; Mississauga, Ontario). Cell debris were excluded from the analyses by the conventional scatter gating method. The cells or the nuclei doublets were also excluded in analyses by using the pulse processor boards.
Ten thousand events per sample were analysed by using the Cell Quest software system (Becton Dickinson).
Cell cycle analysis in relation with BVDV p80 or BVDV p80050-induced apoptosis In order to determine at which phase of the cell cycle the apoptotic process occurs, A549tTA
cells-were seeded as above, mock-infected or infected with each of the BVDV
rec-Adenovirus expressing either p80 or p80~80; and the apoptotic cells analysed (based on a procedure described by Gorczyca et al., 1993) at various timepoints pi by flow cytometry for TLJNEL using a fluochrome (for instance, Texas Red-conjugated dUTP)-conjugated dUTP.
Alternatively, mimosine or cyclosporine A (CsA) were used to block cells from entry into the S phase of the cell cycle (Terada et al., 1991 ). To do this, mock or virus-infected confluent or sub-confluent A540tTA cells were concomittently incubated with medium containing 200 ~M
mimosine or 1 pg/ml CsA (Hanon et al., 1997), and analysed for apoptotic parameters as above (DNA ladder formation, in situ TLTNEL, PARP cleavage and/or cytometry analysis) at various timepoints pi.
RESULTS
Expression of BVDV p80 in E. coli BVDV sequence encoding full-length p80 protein was successfully inserted into the pEt-21b where the tac promoter could be adequately controlled by isopropyl-(3-D-thiogalacto-pyranoside (IPTG): When bacterial cells were induced with IPTG for 3 hours, no p80 expression was detected from a SDS-polyacrylamide gel stained with Coomassie brilliant blue (Fig. l, lane 3).
IPTG induction of bacterial cells for longer time periods and/or using different temperatures and conditions of expression did not result in significant BVDV p80 expression (data not shown).
These latter results prompted us to generate truncated forms of the BVDV p80 in which the NH2-terminal 26 or 50 amino acids of BVDV p80 were deleted: As shown in Fig.
l, this strategy allowed us to produce BVDV p80~26 (lane 5) and BVDV p80~50 (lane 7) fusion proteins, respectively, in E. coli strain DHSa after 3 hours of'IPTG induction. More intense protein bands were obtained 'when the bacterial cells were incubated for a longer incubation time period of 6 to 12 hours (data not shown). However, the best protein expression levels were consistenly obtained with the plasmid construct containing the BVDV p80050-encoding sequence. The expressed BVDV p80050 fusion protein which was found mostly in cytoplasmic inclusion bodies, was electroeluted from a polyacrylamide gel o obtain relatively purified fusion protein preparation (Fig. 1, lane 8): The purified fusion protein was then used to immunize a laboratory rabbit; and the antiserum obtained was confirmed to contain protein-specific antibodies by using a Western blot assay (not shown). Thus; this BVDV p80~50-specific antiserum was used in subsequent experiments to monitor p80 or p80~50 expression in mammalian cells.
Cytopathogenicity correlates with BVDV p80 and p80050 expressed from rec-Adenovirus Following infection of A549tTA cells with each of the BVDV protein-expressing rec-Adenovirus and the control rec-Adenovirus-GFP, GFP signal was gererally observed under fluorescence microscopy from 6 hours post infection (pi) to reach maximum GFP
fluorescence signal in infected cells (approximately 40 to 50% of cells) at 12 to 18 hours pi (data not shown).
Along with the expression of GFP signal; the cells infected with each rec-Adenovirus carrying the BVDV sequences bowed the first evidence- of morphological changes (cell rounding and shrinking in size and cell detachment in cell culture supernatant) at l8 (for the p80 truncated form) to 24 hours (for the whole p80) pi to reach maximal cythopathogenic effect {CPE) (e.g.
morphological 'changes occurring in 30 to 40% of infected cells) with cell detachment from he substrate at 36 to 40 hours (for the p80 truncated form), or 48 to 60 hours (for the whole p80) pi.
Microscopic observations at 40 (p80d50) or 48 (p80) hours pi showed that most of the shrinking cells carried the characteristic apoptosis nucleus chromatin condensation with reduction in cell volume (Fig. 2B and 2C for the BVDV p80- and p80~50-expressing rec-Adenovirus, respectively). No significant CPE was observed in mock-infected cells (not shown) and in cells infected with the rec-Adenovirus-GFP used as negative control (Fig. 2A) throughout the incubation period. In contrast, CPE was readily observed in cells,treated with actinomycin D or the recombinant Ad5TR5~Rl (Massie et al., 1998b) which were used as positive controls of apoptosis (data not shown).
Along with the appearance of CPE; we analysed whether the infected cells were indeed expressing the relevant BVDV proteins: As shown in Fig. 3A, both BVDV p80 and p80050 proteins, as determined by Western immunoblotting, were expressed from cells infected for 48 or 40 hours with each of the respective rec-Adenovirus (lanes 4 and 5, respectively). No immune reactivity was obtained with the rabbit pre-immune serum' (not shown).
Expression of BVDV
p80~50 protein, as determined by confocal fluorescence microscopy at 40 hours pi; was observed in cells which concomitantly expressed GFP (Fig. 3B; panel d}, demonstrating herein the effectiveness of the di-cistronic adenovirus expression system used in this study.
Tnterestingly, the GFP appeared to be localized mostly in the nucleus of the infected cell (Fig.
3B; panel d). 'On the basis of the results it was concluded that expression of BVDV p80 or p80050 from each rec-Adenovirus correlated with CPE in infected cells.
BVDV p80 and p80050-expressing rec-Adenovirus infections correlate with cell DNA
fragmentation As the oligonucleosomal DNA ladder of multiples of 180-200 base pairs in apopptic cells is considered a hallmark of the programmed cell death process, we carried out DNA
fragmentation assays from rec-Adenovirus-infected A549tTA cells. Fig. 4 shows typical DNA
fragmentation in cells infected with each of the rec-Adenovirus expressing either BVDV p80 or p80~50 (lanes 4 and 5, respectively). DNA fragmentation was observed in cells treated with actinomycin D (lane 3) or in MDBK cells infected with the NADL strain of BVDV (lane 7) which was used as an additional positive control of apoptosis. In contrast; no DNA fragmentation was observed in the mock-infected' and rec-Adenovirus-GFP-infected negative control cell cultures (lanes 1 and 2, respectively). To confirm; by an independent means, the cell DNA
fragmentation, a colorimetric TLTNEL assay was performed to detect in situ' DNA fragmentation. Labelling of cell nuclei typical of DNA fragmentation was readily detected in cells infected with rec-Adenovirus expressing either BVDV p80 (48 hours pi) or p80050 (40 hours pi) (Fig: 2B and C;
respectiuely). 'In contrast, no DNA labeling was detected in cells infected with the rec-Adenovirus-GFP negative control (Fig. 2A), nor in mock-infected cells (data not shown). Since similar results were obtained with BVDV p80 and p80~50, further experiments were mostly conducted with the BVDV p80~50-expressing rec-Adenovirus:
Flow cytometry quantitation of apoptotic cells over time Morphologic changes and DNA fragmentation assays are not indicative of the number of cells undergoing apoptosis. By using flow cytometry analysis, we were able to determine the proportion of apoptotic cells with DNA content that would decrease after sufficient endonucleolytic activity, leading to the cell DNA fragmentation described above. By gating the cells that were GFP positive (and that were also expressing the BVDV protein of interest), and by measuring the DNA content below the diploid (Go/G 1 ) level, we were able to detect cells in a cluster peak associated with apoptosis from cells infected for 40 hours with the p80050-expressing rec-Adenovirus, or treated with actinomycin D (used as an apoptosis control system) (Fig. 5A). In contrast; no sub GO/Gl peak was observed in cells mock-infected or infected with rec-Adenovirus-GFP, thereby indicating the absence of apoptotic process in these cells (Fig: SA).
By conducting cytometry analyses at different time points pi, an increase over time of the percentages of cells undergoing apoptosis, beginning pat 18 hours pi (which correlated with the first evidence of morphologic changes in cell cultures), was obtained in the cell cultures infected with rec-Adenovirus expressing BVDV p80d50or in actinomycin D-treated cell cultures (Fig.
5B). An increase over time of the percentages of apoptotic cells (albeit to a lesser degree than that obtained from cells infected with the rec-Adenovirus expressing BVDV
p80050) was also observed in cells infected with rec-Adenovirus expressing the BVDV 80. In contrast, no significant changes in the percentages of basal apoptotic cells over time was observed in mock-infected cells or in cells infected with the rec-Adenovirus-GFP.
Cleavage of the death substrate, PARP
Chromosome DNA fragmentation requires the activation of cysteine proteases of the interleukin-I (3-converting enzyme (ICE), ermed he caspases. In response to apoptotic stimuli, the caspases (the so-called executioners of cell death in apoptosis} (Cohen, 1997), are involved in a proteolytic cascade that serves to transmit and' amplify the death signals (Cohen, 1997; Cryns and Yuan, 1998). Caspase activation leads to the cleavage of various death substrates, including the 116 kDa PARP (Cohen, 1997; Hoff and Donis, 1997; Cryns and Yuan, 1998). As it was reported that ep BVDV-infected cells undergoing apoptosis express; late in infection, the 85 kDA cleaved-product of PARP (Hoff and'Donis, 1997); we wished to determine whether the rec-Adenovirus-infected cells expressing BVDV p80~50 would also express the cleaved form of PARP. The kinetics of the expression of PARP cleavage product, as determined by Western immunoblotting, was then conducted from cells infected with BVDV p80~50-expressing rec-Adenovirus. As shown in Fig. 6, evidence of PARP cleavage was observed from 24 hours pi at the time where CPE was- readily apparent; and continued to 60 hours pi (lanes 12 to 16), For the BVDV p80-expressing rec-Adenovirus infected cells, PARP cleavage was only detected 60 hours pi (lane 10). Finally, PARP cleavage was observed in cells treated with actinornycin D
(lane 4). The results clearly indicate that BVDV p80 and p80~50-induced apoptosis is mediated through a caspase activation pathway.
BVDV p80~50-induced apoptosis is inhibited by baculovirus p35 The p35 protein of baculovirus has been shown to block apoptosis in insect and mammalian cells by functioning as an inhibitor of caspases (Miller et al., 1998):
Therefore, we wished to determine whether this was also the case for BVDV p8Od50-induced apoptosis using a rec-Adenovirus expressing 'baculovirus p35 (rec-Adenovirus-baculovirus-p35) (B.
Massie, unpublished). To do this, cells were infected as above with both BVDV p80~50 and p35-expressing rec-Adenovirus (with has the same adenovirus genetic background as the other rec-Adenoviruses used in this study) at MOIs of 500 each, and then checked for CPE
and cleavage of PARP. Cytotoxicity developed in cells infected with BVDV p80050-expressing rec-Adenovirus, while cells co-infected with both BVDV p80050-expressing rec-Adenovirus and baculovirus p35-expressing rec-Adenovirus had no significant apoptotic-related CPE up to 60 hours pi. (not shown). Concomitantly; cleavage of PARP was detected in cells infected with BVDV p80~50-expressing rec-Adenovirus (as shown above), whereas no PARP cleavage product was observed from cells co-infected with the rec-Adenoviruses at any timepoint pi (Fig. 6, lanes 18 to 22).
Finally, as a control for adenovirus background, cells were co-infected with BVDV p80050-expressing rec-Adenovirus and GFP-expressing rec-Adenovirus, and showed CPE
typical of apoptosis and PARP cleavage product (not shown) similar to what was observed in cells infected BVDV p80050-expressing rec-Adenovirus alone (nat shown).
BVDV p80 or:BVDV p80~50-induced apoptosis in relation with cell cycle Preliminary results indicated that BVDV p80 and/or p80~50-induced apoptosis occurs at and/or before S phase ofthe cell cycle (not shown).
DISCUSSION
In this paper, the entire BVDV p80-encoding nucleic acid sequence was successfully inserted into the procaryotic pEt-21b expression vector with the aim of obtaining a His-tag recombinant p80 to be used for the generation of a BVDV p80-specific polyclonal antiserum.
This nucleic acid sequence was selected according to the paper of Xue et al.
(1998) in which the NH2-terminus of the BVDV p80 was predicted to be a glycine at amino acid position 1690 of the NADL polyprotein. However; no -significant expression from this plasmid construction in bacterial cells was -obtained. Because the NH2-terminal region of the p80 appears to be somewhat hydrophobic (as determined by using the algorithm of Kyte and Doolittle; 1982), we hypothesize that this hydropathic character could have explain the unsuccessful expression result. Therefore, two other plasmid constructions were, generated by deleting the first 26 or 50 amino acids of the p80 NH2-terminal, and then tested for protein expression.
Although deletion of 26 amino acids from the p80 NH2-terminal resulted in significant protein (p80426) expression; the best protein expression yield was obtained from the plasmid construct containing the p80050-encoding sequence.
In contrast to the expression results obtained in bacterial cells; the eucaryotic adenovirus inducible expression system used in this 'study allowed us to express both the p80 and the p80050 of BVDV. This system also was used to determine directly the involvement of these BVDV proteins in the induction of apoptosis in vitro: The results have shown that both BVDV
proteins expressed in cells infected with the respective rec-Adenovirus was cleaxly associated with the induction of CPE and cell DNA fragmentation typical of apoptosis.
However, the CPE
observed in cells infected with the rec-Adenovirus expressing the p80 was somewhat delayed in time and less intense than in cells infected with the rec-Adenovirus expressing the p80~50: This was confirmed by the much less number of apoptotic cells in the cell cultures infected with the rec-Adenovirus expressing the p80 at the same timepoints pi (Fig: SB); and by the delay in the detection of PARP cleavage, when compared to the cell cultures infected with the p80050-expressing rec-Adenovirus.
As reported elsewhere; infection of cells in vitro with cp BVDV induces apoptosis through the caspase activation pathway (Zhang et al., 1996; Hoff and Donis; 1997).
Oxydative stress (Schweizer and Peterhans, 1999) and intracellular viral RNA viral,accumulation (Vassilev and Donis, 2000) have been reported to be key=factors associated with cp BVDV-induced apoptosis.
On the other hand, it was also shown that macrophages/monocytes constitute, among blood mononuclear cells; the major cell population undergoing apoptosis following in vitro infection with cp BVDV, and that T, B and NK cells, albeit to a lesser degree, also undergo apoptosis (Lambot et a1.1998). Here, expression of either p80 or p80050 of BVDV from an adenovirus inducible expression system correlated v~ith apoptosis of these cells. This p80- or p80450-induced apoptosis is mediated through the caspase activation pathway (as determined by the cleavage of the death substrate, PARP), similar to the apoptosis induced by cell infection with cp BVDV in vitro (Hoff and Donis, 1997). Thus, p80 of BVDV is a viral determinant involved in cp BVDV induced apoptosis in vitro:
To conclude, the results presented here constitute the first experimental proof of a direct link between BVDV p80 (and thereof BVDV p80~50) expression and apoptosis. Moreover, the BVDV p80 (and p80~50) is the first described pestivirus NS3 protein associated with apoptosis.
REFERENCES
Abed, Y., St-Laurent, G:; Zhang, H., Jacobs, R. M:, and Archambault, D.
(1999). Development of a Western blot assay for detection of bovine immunodeficiency-like virus using capsid and transmembrane envelope proteins expressed from recombinant baculovirus: Clin:
Diagn. Lab.
Immunol. 6, 68-172.
Archambault; D., and St-Laurent; G. (2000). Induction of apoptosis by equine arteritis virus infection. Virus Genes 20; 143-147:
Aichambault, D:; Beliveau, C., Couture, Y., and Caiman, 5. (2000). Clinical response and immunomodulation following experimental challenge of calves with type 2 noncytopathogenic bovine viral diarrhea virus. Vet. Res. 31, 215-227:
Baker, J.C. (1987). Bovine viral diarrhea virus: a review. J. Am. Vet. Med:
Assoc. 190; 1449-1458.
Cohen, J. M. (1997). Caspases : the executioners of apoptosis. Biochem. J.
326, 1-16.
Cryns, V., and Yuan, J. (1998). Proteases to die for. Genes Dev. 12, 1551-1570.
Duvall, E:, and Wyllie, A. H. (1986). Death and the cell. Immunol. Today 7, 115-119.
Goiczyca, W., 'Gong, J., Ardelt, B.; Traganos, F.and Darzynkiewicz; Z. (1993).
The cell cycle related differences in susceptibility of HL-60 cells to apoptosis induced by vaious antitumor agents. CancerRes. 53, 3186-3192.

Hammers, C., Dehan, P., Couvreur, B., Letellier, C.,'Kerkhofs; P., and P~toret, P.-P. (2001).
Diversity among bovine pestiviruses. Vet. J. 161, 112-122.
Hanon, E., Hoornaert, 5., Dequiedt, F., Vanderplasschen, A.; Lyaku; J., Willems, L., and Pastoret, P.-P. (1997). Bovine herpesvirus 1-induced apoptosis occures at the GO/G1 phase of the cell cycle. Virology 232; 351-358.
Harlow, E, and Lane, D: (1988): Antibodies; a laboratory manual. New York:
Cold Spring Harbor Laboratory Press.
Hoff H: 5., and Donis, R. O. (1997). Induction of apoptosis and cleavage of poly(ADP-ribose) polymerase by cytopathic bovine viral diarrhea virus infection. Virus Res: 49, 141-113:
Jani, A., Lochmuller, H., Acsadi, G., Simoneau; M., Huard, J., Gamier, A., Karpati, G., and Massie, B. (1997). Generation, validation; and large scale production of adenoviral recombinants with large size inserts such as 6.3 kb human distrophin cDNA. J. Virol:
Methods 64, 111-124.
Kheyar, A, Martin, 5.; St-Laurent; G., Timoney,' P. J:; McCollum, W. H., and Archambault, D.
( 1997). Expression cloning and humoral immune response to the nucleocapsid and membrane proteins of equine arteritis virus. Clin. Diagn. Lab. Immunol. 4, 648-652.
Kummerer; B. M., Tautz, N., Becher; P., Thiel, H.-J., and Meyers, G. (2000).
The genetic basis for cytopathogenicity of pestiviruses: Vet: Microbiol. 77; 117-128.
Kyte, J.; and Doolittle, R. F. (1982). A simple method for dysplaying the hydropathic character of a protein. J. Mol. Biol: 5; 105-132:
Lambot, M., I3anon, E., Lecomte, C., Hamers,C.; Letesson, J:-J., and Pastoret, P.-P. (1998).
Bovine viral diarrhoea virus induces apoptosis ' in blood mononuclear cells by a mechanism largely dependent on monocytes. J: Gen. Virol. 79; 1745-1749.
Massie, B., Mosses, D. D., Koutrowrnanis; M:Vine-Mony; I., Lamoureux, L., Couture, F., Paquet, L., Guilbault, C, Dionne, J., Chahla; D.~ Jolicoeur, P., and Langelier, Y. (1998a): New adenovirus vectors for protein production and gene transfer.
Cytotechnology'28; 53-64.
Massie, B., Couture, F., Lamoureux, L., Mosses, D. D., Guilbault, C., Jolicoeur, P., Belanger, F:, and Langelier,'Y: (1998b): Inducible overexpression of'a toxic protein by an adenovirus vector with a tetracycline-regulatable expression cassette. J. Virol. 72; 2289-2298.
McClurkin; A. W., Coria, M. F., and Bolin 5. R. (1985): Isolation of cytopathic and noncytopathic bovine viral diarrhea virus from the spleen of cattle acutely and chronically affected with bovine viral diarrhea. J. Am. Vet. Med. Assoc: 186, 568-569.
Mendez, E., Ruggli, N.; Coilett, M, S., and'RiceC. M: (1998). Infectious bovine viral diarrhea virus (strain NADL) RNA from stable cDNA clones : a cellular insert determines production and'viral cytopathogenicity. J. Virol. 72, 4737-4745.

Meyers, G., and Thiel, H:-J. (1996): Molecular characterization ofpestiviruses. Adv. Virus Res.
47; 53-118.
Miller, L. K.; Kaiser, W: J., and Seshagiri; S. (1998). Baculovirus regulation of apoptosis. Sem.
Virol. 8, 445-452.
Moennig, V., and Plagemann, P. G. (1992): Thepestiviruses. Adv. Virus Res: 41, 53-98.
Nuttall, P. A., Stott, E. J., and Thomas, L: H. (1980). Experimental infection of calves with two strains of bovine virus diarrhoea virus': virus recovery and clinical reactions. Res. Vet. Sci. 28, 91=95.
O'Brien, V. (1998). Viruses and apoptosis: J: Gen.Virol. 79, 1833-1845.
Pellerin; C., Van der Hurk; J., Lecornte, J.; and Tijssen, P: (1994):
Identification of a new group of bovine diarrhea virus strains associated with severe outbreaks and high mortalities. Virology 203, 265-268.
Rice, C. M. ( 1996): Flaviviridae: the viruses and ,their replication: In:
Fields Virology, Fields, B.
N, Knipe, D. M., and Hewley, P, M., eds3rd Edition, Lippincott-Raven Publishers; pp. 931-939:
Ridpath, J. F., Bolin; 5. R., and Dubovi; E: J. (1994). Segregation of bovine viral diarrhea virus into genotypes. Virology ZOS; 66-74.
Stinger, F., Nicklen, S., and Coulson, A: R . (F977). DNA sequencing with chain-terminating inhibitors: Proc. Natl: Acad. Sci (USA) 74,' 5473 '-5467.
Schulze-Osthoff; K., Ferrari, D.; Los M:, Wesselberg, S., and Peter, M: E.
(1998). Apoptosis signaling by death receptors. Eur. J: Biochem. 254; 439-459.
Schweizer; M:, and Peterhans; E: 1999. Oxydative stress in cells infected with bovine viral diarrhoea virus : a crucial step in the induction of apoptosis. J: Gen. Virol.
801147-1155:
St-Laurent, G., Morin, G.; and Archambault, D. (1994). Detection of equine arteritis virus following amplification of structural and nontructural viral genes by reverse transcription-PCR.
J. Clin. Microbiol. 32; 658-665.
St-Laurent, G, and Archambault, D. (2000). Molecular cloning, phylogenetic analysis and expression of beluga whale (Delphihapterus leucas) interleukin 6. Vet.
Immunol. Immunopathol.
73, 3 i -44.
Tamura, J: K., Warrener, P:, and Collett, M. S. (1993). RNA-stimulated NTPase activity associated with the p80 protein of the pestiVirus bovine viral diarrhea virus:
Virology 193, 1-10.

Teodoro; J. G;; and Branton, P. E. (1997). Regulation of apoptosis by viral gene products, J.
Virol. 71, 1739-1746:
Tereda, N., Lucas, J. J., and Gelfand, E: W: (1991). Differential regulation of the tumor suppresser molecules, retinoblastoma susceptibility gene product (Rb) and p53, during cell cycle progression of normal human T cells. J. Immunol. 147; 698-704:
Thiel; H.-J.; Plagemann, P. G. W., and Moennig; V. (1996). Pestiviruses: In:
Fields Virology, Fields, B. N., Knipe, D. M:, and Hewley; P. M., eds; 3rd Edition, Lippincott-Raven Publishers, pp. 1059-1073:
Vassilev, V. B., and Donis; R. O. (2000). Bovine viral diarrhea virus induced apoptosis correlates with increased intracellular viral RNA accumulation: Virus Res.
6995-107.
Warrener, P, and Collett, M. S. (1995). Pestivirus NS3 (p80) protein possesses RNA helicase activity. J. Virol. 69, 1720-1726.
Wiskerchen, M., and Collett, M. S. (1991). Pestivirus gene expression :
protein p80 of bovine viral diarrhea virus is a proteinase involved in polyprotein processing.
Virology 184, 341-350.
Zhang, G., Aldridge; 5.; Clarke, M. C., and McCauley, J. W. (1996). Cell death induced by cytopathic bovine viral diarrhoea virus is mediated by apoptosis. J. Gen:
Virol. 77, 1677-1681.
Xu; J., Mendez, E., Caron; P. R.; Lin, C., Murcko; M. A., Collett; M. S., and Rice, C. M. (1997).
Bovine viral diarrhea virus NS3 serine proteinase: polyprotein cleavage sites, cofactor requirements; and molecular model of an enzyme essential for pestivirus replication. J. Virol. 71;
5312-5322.

Table 1 Oligonucleotide primers used to generate recombinant plasmids containing BVDV p80- and p80~50-encoding nucleic acid sequences Recombinant Sense plasmids Nucleotide sequences (5'~3') pBS/pEt (p80)CAAACA_TATGGGGCCTGCCGTGTGTAAGAAG +

CAAA CTCGAGCAACCCGGTCACTTGCTTCA

pBS/pEt (p80~50)CAAACATATGGGTCTGGAGACTGCCTGGGCTTA +

CAAACTCGAGCAACCCGGTCACTTGCTTCA -pBS/pEt (p80~26)CAAA CATATGGGGATCATGCCAAGGGGGACTAC +

CAAACTCGAGCAACCCGGTCACTTGCTTCA -pBS/Ad (p80)CAAAGTTTAAACGATCCACCAT GGA CAT CAC CAT CAC CAT +
CAC

GGGCCTGCCGTGTGTAAGAAG

CAAAGTTTAAAC ~CAACCCGGTCACTTGCTTCAGT

pBS/Ad (p8005D)CAAAGTTTAAACGATCCACCATGGGA CAT CAC CAT CAC CAT +
CAC

GGTCTGGAGACTGCCTGGGCTTA

CAAAGTTTAAAC T ACAACCCGGTCACTTGCTTCAGT -The underlined nucleotides refer to restriction endonuclease cleavage sites:
GTTTAAAC: PmeI; CTCGAG: XhoI;
CATAT : NdeI. The initiation ATG ; termination ~ and histidine codons (CAT and CAC) are also shown.

Figure Legends FIG. 1 : SDS-polyacrylamide gel analysis of BVDV p80 and p$0050 fusion proteins expressed in E. coli DHSa after 3 hours post-induction: Lane 1 refers to total protein extract from uninduced E. coli DHSa containing no expression plasrnid vector; lanes 2 and 3 refer to total protein extract from uninduced and induced recombinant bacteria containing the p80-expressing plasmid vector; respectively; lanes 4 and 5 refer to total protein extract from uninduced and induced recombinant bacteria containing 'the p80026-expressing plasrnid vector; respectively;
lanes 6 and 7 refer o total protein extract from uninduced and induced recombinant bacteria containing the p80050-expressing plasmid vector; respectively; lane 8 refers to purified p80~50 protein. Lane M, molecular weight standards in kDa (indicated in the left margin). Proteins were visualized by staining the gel with Coomassie brilliant blue:
FIG. 2: Changes in cell morphology (400X enlargement) induced by BVDV p80 and p80050 proteins. A549tTA cells were infected with GFP-expressing rec-Adenovirus (A), BVDV p80-expressing rec-Adenovirus (B) or BVDV p80050-expressing rec-Adenovirus (C) with an MOI
of 500 PFU per cell, and incubated for 40, 48, and 40 hours; respectively. In situ cell DNA
fragmentation was assessed using a colorimetric Tdt-mediated dUTP nick end labeling (TUNEL) commercial kit: Arrows indicate examples of nucleus condensation and labeling (dark-brownish color) with T'UNEL.
FIG. 3 : Expression analysis of BVDV p80 and p80050 proteins in A549tTA cells.
Cells were mock-infected, treated with actinomycin D (50 ~.g per ml), or infected with rec-Adenoviruses with an MOI of 500 PFU per cell. (A) Western blot immunoblotting on 'cell extracts using BVDV p80050-rabbit antiserum; and a peroxidase-conjugated anti-rabbit antiserum.
Immunological reactivity was revealed after adding the peroxidase substrate (PBSS; ph 7.3 H202; methanol and 4-chloro-naphthol) for 20 min. Lane 1; mock-infected cells (40 hours of incubation); lane 2, actinomycin D treated-cells (30 hours of incubation);
lane 3, cells infected with GFP-expressing rec-Adenovirus (40 hours. pi); lane 4, cells infected with BVDV p80-expressing rec-Adenovirus (48 hours post infection); lane 5, cells infected with BVDV p80050-expressing rec-Adenovirus (40 hours of infection); lane 6; BVDV p80~50 expressed in E. coli used as a positive control. Lane M, molecular weight standards in kDa (indicated in the left margin). (B) Confocal fluorescence microscopy. Cells were infected with p80050-expressing rec-Adenovirus for 40 hours, fixed in paraformaldehyde solution for 1 hour;
and perrneabilised with Triton X-100 solution for 10 min. Cells were then exposed to rabbit anti-BVDV p80~50, washed, and exposed to Cy3-conjugated goat anti-rabbit immunoglobulin G (whole molecule).
a) unlabeled cells; b) GFP expression; c) BVDV p80050 expression; d) co-localization of GFP
and BVDV p80~50- expressed proteins.

FiG. 4 : Cell DNA oligonucleosomal fragmentation-analysis as determined on ethidium bromide stained agarose gel. A549tTA cells were mock-infected; treated with Actinomycin D (SO ~g per ml); or infected with rec-Adenoviruaes with an MOI of 500 PFU per cell. Lane 1, mock infected cells (40 hours of incubation); lane 2, cells infected with GFP-expressing rec-Adenovirus (40 hours post infection); lane 3; actinomycin D-treated cells (30 hours of 'incubation); lane 4, cells infected with BVDV p80-expressing rec-Adenovirus (48 hours post infection);
lane S, cells infected with BVDV p80~5U-expressing rec-Adenovirus (40 hours post infection);
lane 6, mock-infected MDBK cells (72 hours of incubation); lane 7, MDBK cells infected with BVDV (NADL
strain) (72 hours post infection). M: HaeIII-digested ~X-174 and HindIIi=~, replicative- form DNAs as molecular mass markers.
FIG. 5; Determination of subdiploid D1VA content and quantitation of apoptotic cells by flow cytometry. (A) Typical histograms of cell DNA fragmentation obtained after 40 hours of cell incubation are shown. A549tTA cells were mock-infected, treated with actinomycin D (50 ~.g per ml), or infected with GFP- or BVDV p80 or p80050=expressing rec-Adenovirus with an MOL of SOO PFU per cell. Single cell susperisiori were fixed and permeabilized, and stained with propidium iodide (PI) before flow cytometry analysis. PI fluorescence was detected at 660 nrn (x axis): 1VI1 refers to areas showing lower DNA content. (B) Kinetics of percentages of cells undergoing apoptosis at different timepoints of cell incubation. Full boxes;
mock-infected cells;
open boxes, cells infected with GFP-expressing rec-Adenovirus; open circles;
actinomycin D-treated cells; full circles; BVDV p8U050-expressing rec-Adenovirus; open triangles, BVDV p80-expressing rec-Adenovirus. Results are means + SD for duplicate samples:
FIG: 6 : Kinetics of the expression of PARP cleavage product by Western immunoblotting analysis. A549tTA cells were mock-infected, treated with actinomycin L7 (50 ~.g per ml), infected with GFP- or BVDV p80 or p80~50-expressing 'rec-Adenovirus, or co-infected with BVDV p80050-expressing rec-Adenovirus and rec-Adenovirus expressing baculovirus p35 protein with MOIs of 500 PFU per cell: '~Uestern blot immunoblatting on cell extracts was conducted using, as primary antibody, a PARP monoclonal antibody, and, as secondary antibody, a peroxidase-conjugated goat anti-mouse immunogtobulin G (I-I + L
chains). The membranes were developed -by enhanced chemiluminescence. Lanes 1 and 2 refer to mock-infected cells after 12 h and 60 hours of incubation; respectively; lane 3 refers to aetinomycin D-treated cells after 12 and 40 hours of incubation; respectively; lanes 5 to 10 refer to cells infected with BVDV p80-expressing rec-Adenovirus at 12, 24, 30,, 40, 48, and 60 hours post infection, respectively; lanes 11 to 16 refer to cells infected with BVDV p80050-expressing rec-Actenovirus at 12, 24, 30; 40; 48, and 60 hours post infection; respectively;
lane 17 refers to cells infected with GFP-expressing rec-Adenovirt~s at 40 hours post infection; lanes 18 to 22 refer to cells. co-infected with BVDV p80~50-expressing rec-Adenovirus and rec-Adenovirus expressing baculovirus p35 protein at 12; 24, 30, 40, and 60 hours post infection: