CA2339595A1 - Binary viral expression system in plants - Google Patents
Binary viral expression system in plants Download PDFInfo
- Publication number
- CA2339595A1 CA2339595A1 CA002339595A CA2339595A CA2339595A1 CA 2339595 A1 CA2339595 A1 CA 2339595A1 CA 002339595 A CA002339595 A CA 002339595A CA 2339595 A CA2339595 A CA 2339595A CA 2339595 A1 CA2339595 A1 CA 2339595A1
- Authority
- CA
- Canada
- Prior art keywords
- site
- gene
- viral
- replication
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8203—Virus mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8217—Gene switch
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
- C12N15/8238—Externally regulated expression systems chemically inducible, e.g. tetracycline
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/12011—Geminiviridae
- C12N2750/12022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- General Chemical & Material Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to plant transgene expression systems comprising chromosomally-integrated components that are individually heritable. The systems are useful for the regulated expression of foreign genes through gen e amplification in plant tissue.
Description
.._ . . , -ii v __y ' 't~ V r '! . V J1 na CA 02339595 2001-02-05 .~... _ ~ ~
v . _ 29-11-2000 _I 12~_C
BINARI' ~~IRAL EXPRESSION SYSTEM IN PLANTS
FIELD OF INIVENTION
This application claims the benefit of U.S, Provisional AppIicaticn i No. 641I50,255_flcd, August 23, 1999, and U.S. Provisional Application No. 601130,086, filed April 20, 1999 and U.S. Provisional Application I
No. 601101,558, filed, September 23, 1998.
The present invention relates to the field of molecular biology and the !
gez~ebic transformation of plants with foreign gene fragments. More particularly.
the invention relates to a binary expression system useful for conditionally expressing txarsgencs in plants.
?wo serious tcchtucal problems beset plant transgenics. First, plant ' transgene expression attains only low and inconsistent levels. These poor expression ler; els arc attributable in part to random chromosomal integration ('position effects') and in part to a general lack of gene copy number-dependent expression. Episomal vectors are expected to overcome these problems. In constrast to plants, microbes can attain high-level expression through episomal (plasnud) vectors because these vectors can be maintained by setcction.
Although plant viruses have been used as episomat expression vectors, their use has been i I
restricted to transient expression because of lack of selection and/or their cellular toxicity (U.S. Patent NQ_ 4,855,237, VSO 9534668).
Second, non-specific expression of transgenes in non-desited cells arzd tissues hinders plant transgenic work. This is important where the goal is to produce high levels of phytetoxic materials in transgenic plants. Conditional transgene expression will enable economic production of desixed chemicals, znonomecs, and polymers at levels likely to be phytotoxic to growing plants by restricting their production to pzoduction tissue of transgenic plants either just !
pzior to or after harvest. Therefore, lack of a commercially usable conditional expression system and the difhcuIty in attaining a reliable, high-level expression both limit development oftransgene expression in plants. ;
Plant viruses Viruses arc infectious agents with relatively simple organization and uni.quc modes of replication. A given plant virus may contain either RNA or 3~ DNA, and may be either single- or doable-stranded.
RNA Plant yiruses Double-stranded RNA plant viruses include rice dwarf virus (RDy and wound tumor virus (WTV). Single-stranded RNA plant viruses include tobacco AMENDED SHEET
mosaic virus (TMV) and potato virus X (PVX), turnip yellow mosaic virus (TYMV), rice necrosis virus (RNV) and brome mosaic virus (BMV). The RNA in single-stranded RNA viruses may be either a plus (+1 or a minus (-) strand.
Although many plant viruses have RI~'A <,enomes, organization of emetic information differs between groups (the major groupings designated as monopartite, bipartite and tripartite). The genome of most monopartite plant R'B'A--viruses is a single-stranded molecule of (+)-sense. There are at least 11 major groups of viruses with this type of genome. Examples of this type of virus are TMV and PVX. At least six major groups of plant RNA viruses have a bipartite 10 genome. In these, the genome usually consists of two distinct (+)-sense single-stranded RNA molecules encapsidated in separate particles. Both RNAs are required for infectivity. Cowpea mosaic virus (CPMV~ is one example of a bipartite plant virus. A third major group, containing at least six major types of plant viruses, is tripartite, with three (+)-sense single-stranded RNA
molecules.
1 ~ Each strand is separately encapsidated. and all tluee are required for infectivity.
An example of a tripartite plant virus is alfalfa mosaic virus (AMV). Many plant viruses also have smaller subgenomic mRNAs that are synthesized to amplify a specific gene product.
DNA Plant Viruses 20 Plant viruses with a double-stranded DNA genome include Cauliflower Mosaic virus (CaMV).
Plant viruses with single-stranded DNA genomes include geminiviruses, and more specifically, include African Cassava Mosaic Virus (ACMV), Tomato Golden Mosaic Virus (TGMV). and Maize Streak Virus (MSV). Geminiviruses '_'~ are subdivided on the basis of whether they infect monocots or dicots and whether their insect rector is a leafhopper or a whitefly. Subgroup I geminiviruses are leafhopper-transmitted and infect monocotyledonous plants (e.g,.. Vrlteat Dwarf Virus): Subgroup II geminiviruses are leafhopper-transmitted and infect dicotvledonous plants (e.g., Beet Curly Top Virus: and Subgroup III
30 geminiviruses are w~hitefly-transmitted and infect dicotvledonous plants (e.c., Tomato Golden Mosaic Virus, TGMV, and African Cassava Mosaic Virus, ACMV).
Subgroup I and II geminiviruses have a single (monopartite) genome.
Subgroup III geminiviruses have a bipartite genome. For example. Subgroup III
3~ geminiviruses TGMV and ACMV consist of two circular single-stranded DNA
genomes. A and B, of ca. 2.8 kB each in size. DNA A and B of a given Subgroup III virus have little sequence similarity. except for an almost identical common region of about 200 bp. While both DNA A and DNA B are required for mv~. ~.. iuuu :.~~:au CA 02339595 2001-02-05 "w ----infection, only D~!RA A is nccessar~r and su~cient for replication and DNA 8 encodes functions required for movement of the virus tluough the infected plant.
In both TGMV and ACMV, DNA A contains four open reading frames (ORFs) that art expressed in a bidirectionat manner and art~ange~d similarly.
The ORFs arc named according to their orientation relative to the common region, i.c., complementary (C) versus viral (V) in ACMY anrl leftward (L) or rightward (R) in TGMV. Thus, ORFs AL1, AT.2, AL3, and ARl of TGMV are homologous to AC1, ACZ, AG3, aad AVl, respectively, of ACMV. Three major transcripts have been identif ed in ACMV DNA A and these map to the AV 1 and AC 1 OltF s, separately and the AC21AC3 OlZFs together. There is experimeatal evidence for the function of these ORFs. Thus, in ACMV AC1 encodes a replication protein that is essential and sufficient for replication; AC2 is required for transactivation of the coat protein gene, AC3 encodes a protein that is not essential for replication but enhances viral DNA acetunulation; and AV1 is the coat protein gene. Except I5 for the esscnt?al viral replication protein (encoded by AC 1 and ALI ua ACMV and TGMV, respectively), geminivins replication relies on host replication and transcription machinery. Although geminiviruses are single-stranded plant DNA
viruses, they replicate via double-stranded DNA intermediate by 'rolling circle replication'.
24 The contribution of the AC2 coding sequence when removed from tha context of the AChrIV genome and expressed froze a potato virus X (PVX] based vector has been investigated in Hong et at. (Transactivation of dianthin transgcne expression by African cassava mosaic virus AC2; Virology 228(?): 383-387 (1997))_ Ueing a PVX vector to express the AC2 protein in planra, it was found 25 that AC2 ex~prcssion can induce necrosis in transgenic plants.
While both DNA A and DNA E arc required for infection, only DNA A is necessary and sufficient for replication and Dh'A B encodes functions required far movement of the virus through the infected plant. This has been examined in detail by Hayes et al. (Replication of tomato golden mosaic virus DNA B in 30 transgenic plants erGpressing open reading &a~mes ORFs of DNA A-Requirement of ORE AL2 for production of single-stranded DNA; Nucleic Acids Res.
17(24):10213-10222). It was determined that plants transgcnic for TGMV ORE
AL1 are able to support the replication of the double-stranded farms of DNA B, but ORE AL2 is required in addition to produce single stranded DNA B.
35 Viruses as Ex~sion Vectors Constructing plant viruses to introduce and express non-viral foreign genes in plants has been demonstrated (U'.S. Patent No. 4,855,237, WO
9534668).
When the virus is a DNA virus, the constructions can be made to the virus itself.
i i AMENDED SHEET
CA 02339595 2001-02-05 w ~ ~ ~ ~ ~ ' ' ifVr, LJ. ~VV'J .,U~~~W ' r i Alternatively, the virus can first be cloned into a bacterial pIasmid for ease in constructing the desired vital vector with the foreign DNA. If the virus is an RNA
virus, the virus is generally cloned as a cDNA and inserted into a plasmid.
The ;
DNA plasmid its then used to make all of the constructions. The RNA virus is S then pmduccd by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat proteins) which encapsidate the viral RNA.
_ The cDNA of RNA viral genome can be cloned behind a heterologous plant promoter. Such a chimeric gene, called an 'auonplicon', can be introduced into a plant cell and used to transcribe the viral RNA that can replicate autonomously , I4 [Sablows,ki~ et al. (1995) Proc. NatL Acad Sci. USA vol 92, pp 6901-6905].
ueminiviruses have many advantages as potential plant expression vectors. These include 1) replication to high copy numbers, 2) small, well-chata~ctteriz~d genomcs, 3) assembly into nucleosomes, and 4) nuclear replication and transcription. The DNA A component of these viruses is capable of 15 autonomous replication in plant calls in the abxz~ce of DNA H. Vectors in which the coat protein ORF hays been replaced by a hcterologous coding sequence have been developed and the hetexologous coding sequence expressed from the coat protein promoter [Hayes et al., Stability and expression of bacterial genes in replicating geminivirus vectors in plants. Nucleic Acids Rer. 17:2391-403 (1989);
20 liayes et al., Gene amplification and expression in plants by a replicating geminivirus vector. Nature (London) 334:179-82 {19$8)].
A geminivirus-based vector system fox obtaining controlled expression of a nucleic acid fragment of interest has been reported (W09419477). This vector sustern enables transformed plants having cells, tissues, or parts to display an 2S altered genotype andlor express modified phenotypic properties. A
transfected plant cell is produced by contacting a plant cell with the recombinant geminivirus tl~ansfcr vector.
Limited methods for induction of transgcne expression have been developed. W0952580I discloses a viral replicon whose construction enables the 30 replicon to be non-coding in the absence of a virus or viral components.
Conversely, in thin presence of a virus or viral components, the replicon is activated by viral rrplicase which converts non-coding negative-sense DNA into positive-sense RNA., thereby allowing expression of the gcne(s). This permits plants to gain resistance to viral infection, since activation of a resistance response 35 is linked directly to the replication of the virus. Further, as viral replication increases, the resistance response is also increased.
Qreater than full length copies of wild-type TCiMV A and H genomes were transformed into petunia [Ropers et al., Tomato golden mosaic virus A
AMENDED SHEET
CA 02339595 2001-02-05 .. -. v ~ - .
n.... ~..,.~..
W ~ ~. v 7, 'v'J V~~=~. .
component DNA replicates autonomously in transgenic plants. Cell (Cambridge, Mass.) 45:593-600 (1986)). Replication was reported in the primary transformants and in some of the selfed pmgeny consistent with its rncndelian inheritance, indicating that the ehromosamally-integrated master copy, aot the replicon, is inherited. 'This suggests that gametophytic znd/or developing seed tissues rack the ability to support replication. The repoxt did not demonstrate whether the virus replicated in non-gerrairtating seed tissue. Prior art shoes that geminiviruses ar not seed-transmitted in nature [Goodman, R M. f 198 t ) Geaoninivirus. J. Gen. Vlrol, vol. 54, p 9-21 ]. Thus, there was no evidence tl~t they canreplicate in gametophytic tissue or developing xcd.
Tomato Golden Mosaic Virus (TGN1V) DNA A was modi.~ed by replacing its coat protein coding sequence with that of NPT II or GUS reporter genes or with that of 35S:NPT II gene dnd a grater than full length copy of the modified viruses were transformed into tobacco [Hayes et aL, Stability and expression of bacterial genes in replicating geminivirus vectors in plants.
Nu~leie Acids R~s, 17:2391-403 (1989); Hayes et al., Gcne amplification and expression in plants by a replicating geminivirus vector. Nature LT.ondon) 334:179-82 (1988)J. Leaves of transgenic plants showed that the high levels of the rEporter enzymes was gene copy ~aumber-dependent. However, replication of the vector and reporUer gel~e rx~pressioa were not repoxted in seal and the genetic stability of the vector in transgenic plants in subsequent generations was not reported.
Use of the African Cassava Mosaic Virus (ACMV) in similar fashion has net been reported and it is not known that ACNTV DNA or the replication proteins) can be ' stably maintained in progeny pleat' and whether it caa replicate in seed tissues. ;
ZS In one report, a chimeric gene (in wfiich the constitutive plant promoter, 358, was fused to the TGMV sequence containing ORFs AL1, AL?, and A.L3) was transformed into Nicotl~xna benthumiana. Different transge~uic lines showed signifcattt non-uniformity in the Levels of 35S:AL1-3 gene expression as well as in their ability to complement viral replication [IIanley-Bowdoin et al., Functional expression of the leftward open reading frames of the A component of tomato golden mosaic virus in transgenic tobacco plants. Plant Cell 1:1057-b7 (1989)].
In another report, chirneric genes (in which the constitutive plant promoter, 355, was fused to the coding sequence of TGMV replication protein AL1) were ' transformed into tobacco, The expression of TGMV replication protein in the primary transformattts supported tht replication of a mutant genome A lacking the replication protein. [Henley-Howdoin et aL, Expression of funetiozlal replication protein from tomato golden mosaic virus in transgenic tobacco plauts_ Proc.
Natl.
Aced. Sci. U.SA. 87:1446-50 (1990)J. However, neither publication reported on I
S
I
AMENDED SHEET
!C("V. V VI\ ~ CYt1-rvl~'r.lV~.nr-IV v.7 ~ 02339595 2001-02-05 ..... . . .._ .
--- --- - - : - -~GG' 1!' v - -_ _ _ 11L~~'Jl.v: -, . . ' 1. U V V 'f ' J l . irt 29- 91-2000 U S 009921989 ', i the gcacric stability of the chimcric replication protein gene through subsequent generations nor its ability to support viral replication in seed tissue. In aaothex report, chimeric genes (in which the constitutive plant promoter, 355, was fused separately to the coding sequences of TGlIiV replication proteins AL1, AL2, and AL3) were transformed into tobacco [Hayes et al., Replication of tomato golden ';
mosaic virus DNA B in transgenic plants expressing open reading frames (dRFs) of DNA A: requirement .of ORF AL2 for production of single-stranded DNA.
Nucleic .Alcids Res 17:10213-22 (1989)]. The TGMV replication protein was i expressed in progeny but the genetic stability of the chirneric replication prouin gene through subsequent generations was aot reported. Furthermore, it was not reported whether the transgenic plants will support replication in seed tis3ue.
In another disclosure, Rogers et al. (F.p 221044) demonstrated the expression of foreign proteins in plant tissue using a modified ''A" genomc of the TGMV gemini viru5r The foreign gene was inserted in place of the gene encoding the viral coat protein and tL~e resulting plasmid tt~ansformcd into plant tissue.
Rogers et al. did not roport tissue specific expression of the foreign protein and are silent as to the genetic stability of the transforming plasrnid.
All of the reported viral vectors have a major disadvantage. They weze either not shown to be stabIy maintained in fransgenic plants and/or not practically useful. Thus, despite intense ef~ts to develop plant viral vectors and viruses, no co~dunercially useR~I plant virus-based recombinant vectors have been developed that are heritable and capable of episomal replication and expression ire desired 'ssue(s) of the trFUasgenie host plant without the need for infection every generation. In fact, replication of plant viruses is expected to be detrimental to the growth and development of plant cells. Fur example, when greater than full length copy of TGMV genome A is introduced into plant cell one-tenth as many transgenic plants are obtained than when genome B is used or when control transfazznations are done [Rodgezs et al., Tomato golden mosaic virus A
component DNA replicates autonomously in transgenic plants. Cell (Cambridge, MA) 45:593-600 (1986)]. The authors suggest this may be due to expression of a gene in TGNIY A DNA. Furthormore, crude extract of plants expressing tandem v copies of both TCrNN A and TGrMV B genomes are unable to infect Nicotiana . benthamiana plants. This is consistent with having a low vines titer. Thus, transgenic plants that do regenerate could be selected for low level expression of a 36 toxic viral gene product and low level of viral replication or are silenced by the host. This is also consistent with the authors' finding that relatively few cells initiate release of the virus, a conclusion based on their observation that most of the tissues remain viable and nonsymptonxatic. Similarly, poor replication in AMENDED SHEET
__ _ CA 02339595 2001-02-05 . ~, v~ _ ~ ..
a.... ~ 11V ~~..LJ. ,LVV~V __~...U .ll~
29- i 1-2000 US 009921989 transgenic plants containing 35S:replication protein in otherreports suggests plants are either selected far poor expression of the replication protein (presumably because of its toxicity), or that the tissue-specific expression profiles of the replication gene is different from that of viral replication.
To date, no plant virus-based recombinant vectors are known that are heritable and capable of episomal replication and expression of foreign proteins in target tissues) of a transgeaic host plant without the need for infection in every generation_ ?he use viral vectors for gene silencing has been reported [[Covey, S. N, IO et al. (1997) Nature (London) 38:781-782; Kumagai, et aL {1995) Prac. Natl.
Acud. Sci. (L.S.A.) 92:1679-1683; Kjezuixup, S, etal. (1998) Plant J. 14:91-100;
Raxclid~, F, of al. (1997) Science (Washington, DG') 276:1558-1560; Ruin, M_ T. et al. (1998) Plant Cell 10:937-946; Baulcombe, D. C. and A,ngell, S. M, (1998) Virus amplicons for gene silencing in transgenic plants, PCT Znt.
Appl.WO 9836083]. In one report it was concluded that replicating viral RNA is v a potent trigger for gene silencing (Baulcombe, D. C. and Angell, S. M.
Consistent gene silencing in uaasgenic plants expzessing a replicating potato virus ;
~ RNA. $MBO 16(12):3675-3184 (1997)). It was suggested that amplicon- ;
mediated gene silencing may provide an important new strategy for the consistent 24 activation of gene silencing in transgcnic pleats. ' A further study by Pruss et al. (Plant Cell 9:959-8d8 (1997)1 teach that the P IIHC Pro sequence of the tobacco etch virus (TEV) acts as a general , pathogenicity enhancer during co-infection by three different groups:
potexvirus ' (PV7~, tobamovirus (TM~, and cucuuaovirus (CM'S). Although the mtchanistn of the interaction is not yet well undcrsiood, the fact that expression of the P1 JHC ' Pro sequence alters disease induction by each of these unrelated heterolgous viruses suggest that it affects a common step in vial infection. Additionally, it is known that the control domain of I-iC Fro is also involved in RhTA replication of potyviruses.
Despite these reports where viral vectors are used for gene silencing its use in transgenic plants under the control of conditional or regulated site-specific recombination has not been reported thus far. In the absence of such regulation, current viral gene silencing is constitutively on. This could be detrimental to a plant and restricts transgenic viral silencing to non-essential genes.
Although the use silencing suppressors genes for overcoming silencing of transgenic gents has been demonstrated, their use in preventing silencing of transgenes in viral episotnes has yet not been demonstrated.
AMENDED SHEET
CA 02339595 2001-02-05 ~ -~ . - ~ - -alw~. LJ, L'~Jt' t.vl-is Transgenic viral vectors for foreign protein production andior gene silencing differ from infecting viral vectors in not requiring systemic movement.
Use of constitutively exprossed viral trazrsgenes for viral resistance has been reported. However, conditiotaal expression of such transgenes, preferably through conditional activation of replicon, say upon viral infection, is likely to provide a more effective control.
Conditional or regulated expression has been reported in plants jsee De Veylder, L. et al., Plant Cell Physiot. 38:568-577 (1997); Cratz, C., Anna Rev.
PIantPhysiol. Plant.~4iol. BivT. 48:89-108 (1997); Hansen, G. et al., Mol.
Ger~
IO Genet. 254:337-343 (1997); Jepson, L, PCT Int. Appl. (1997} WO 9706269 A1, Jepson, I, et al. PCT Int. Appl. (1997) WO 9711189 A2, and other references within this application]. FIowcver, when tested for stringently for basal non-specific expression, very few have been scrictty specific [Odell, J. T. et al., Plant Phystol. 91994} 106:44 7-458; van der Geest et al., Plant Physiol. (1995), 109(4), 1151-58; Ma, ct al., Rust. J. Plant Physiol. (1998), 25(1 ), 53-59; Czako, et al., Mol. Gen. Genet. (1992), 235(1), 33-40]. Suchprornoters arc not suitable for some applications, such as the ux of transgenes for expressing novel phytotoxic proteins, enzymes that lead to the biosynthesis of phytotoxic products, and~or gene silencing.
Dirks et al. (PCT Int. Appl. (1998) WO 9828431) teach a~aArabidopsis promoter (AtDMCI) that may be used in meiosis-specific expression of a heterologous gene sequence in transgenic plants. Further embodiments of their invention permit the removal of any unwanted DNA sequence during the fnrst cycle of sexual reproduction in a transgenic plant (using a Crellox system}
and ' meiosis-specific traascription of a cytotoxic gene and meiotic cell death (for .
production of apomietic seed or for detection of apomietic mutarns). These teachings are limited in that conditional or regulated e:cpression is necessarily linked to meiosis.
Site-specific recombinations in plants (Odell et al_, Plant Physiol.
10b:447-458 (I994); Odell et al., PCT Int. Appl. (1991) WO 9109957; Surin et al., .PCT Int. Appl.{1997} WO 9737012: Dirks et al., PCT Int. Appl. (1998) WO
9828431) and the reduction in the proficiency of Ce-mediated recombination by mutant lox P sites and their use in increasing the frequency of Cre-I ox based integration have been reported [Albert et al., Plant J. 7:649-59 (1995); Arald at al., Nucleic Acids Res. 25:868-872 (1997)]. However, the use of the mutant sites to enhance the specificity Cre-mediated recombination in conjuetion with chimcric Cre genes under the control of available regu),atcd promoters has not been demonstrated. Thus, there is a need for an appropriately strinscnt, site-AMENDED SHEET
CA 02339595 2001-02-05 y I 1 L L~.~. ~ - --RCY,\'ON~EPA-hIUENCHEN U3 ~'.f~~-ll- V - __ __ uu,~JL."!'~ 1"__.-__ vV'JV ?. VViu.
i specific recombination system for a cozmncrcialIy-attractive, conditional site-' f . specific recombination.
~~~2,~R Y of TTY rNVENTrorr ;
?he present invention provides a binary transgenic viral expression system ~ i I
coniprisiztg: ' (i) a chromosornally-integrated inactive replicon comprising:
a) cis-acting viral elements required for viral replication;
b) a target gene comprising at least one suitable regulatory , sequence; and c) site-specific sequences responsive to a site-specific recombittase; and '.
(ii) a ehrourosomally-integrated chimer~c transactivating gene comprising a regulated plaztt promoter operably-linked to a ' i site-specific recombinase coding sequence; ;
wherein expression of the chimeric transactiwting gene in cells containing the ' inactive rcplicon results in the site-specific recombination, activation of replicon replication, and increased expression of the target gene. !
The imrcntion further provides that inactive repIicon be derivod from a I
gezninivirus or a single stranded RNA virus. , i I
i ;
7B ;
, AMENDED SHEET
Additionally the invention provides that the re;ulated plant promoter may be tissue-specific, constitutive or inducible and the wild-type or mutant.
site-specific sequences responsive to a site-specific recombinase. the site-specific sequences may be lox sequences. responsive to the Cre recombinase protein.
The invention further provides a method of alt~~rin~_ the levels of a protein encoded by a target gene in a plant comprising: (i) transforming a plant with the _ instant viral expression system; and (ii) growing the transformed plant seed under - conditions wherein the protein is expressed.
Additionally the invention provides a method of altering the levels of a protein encoded by a target gene in a plant comprising:
(i) transforming a first plant with a inactive replicon to form a first priman~ transformant. the inactive replicon comprising:
a) cis-acting viral elements required for viral replication;
b) a target gene comprising at least one suitable regulatory 1 ~ sequence; and c) site-specific sequences responsive to a site-specific recombinase, (ii) transforming a second plant with a chimeric transactivating gene to form a second primary transformant comprising a --regulated plant promoter operably-linked to a transactivating site-specific recombinase coding sequence;
(iii) growin; the first and second priman~ transformants wherein progeny from both seeds are obtained; and (iv'1 crossing the progeny of the first and second transformants wherein the target gene is expressed.
In an alternate embodiment the invention provides a method of altering the levels of a protein encoded by a target gene in a plant comprising:
(i) transforming a plant with a inactive replicon the inactive replicon comprising:
a) cis-acting viral elements required for viral replication;
b) a target gene comprising at least one suitable regulatory sequence; and c) site-specific sequences responsive to a site-specific recombinase:
3~ (ii) infecting the transformant with a virus containing a chimeric transactivating gene comprising a regulated plant promoter operably-linked to a transactivating site-specific recombinase coding sequence:
S
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination. activation of replicon replication. and increased expression of the target gene.
In another embodiment the invention provides a binary transgcnic expression system comprising an inactive transgene and a chimeric transactivating gene. the inactive transgene comprising; -(il cis-acting transcription regulatory elements inoperable-linked to the coding sequence or functional RNA, and (ii) site-specific sequences responsive to a site specific recombinase;
the chimeric transactivatinL ~lene comprising a regulated plant promoter operably-linl:ed to a transactivating site-specific recombinase coding sequence.
wherein expression of the chimeric transactivating gene in cells containing the inactiv°e transgene results in an operable linkage of cis-acting transcription regulatory 1 s elements to the codin~l sequence or functional RNA through the site-specific recombination and increased expression of the target gene.
In an alternate embodiment the invention provides a binary transgenic expression system comprising:
(i) a chromosomally integrated blocking fragment bounded by -- site-specific sequences responsive to a site-specific recombinase; and (ii) a chromosomally integrated inactive silencing suppresser transgene;
wherein expression of the site specific recombinase results in the site-specific recombination that activates the silencing suppressor gene.
Additionally the invention provides a transgenic viral expression system comprising:
(i) a chromosomally-integrated geminivirus proreplicon comprising:
a) cis-acting viral elements required for viral replication:
bj a target gene comprising at least one suitable regulatory sequence;and c ) flanking sequences that enable the excision of the elements of a) and bj.
wherein the proreplicon lacks a functional replication gene for episomai replication:
c) (ii) a chromosomally-integrated chimeric traps-acting replication gene comprising a regulated plant promoter operable-linked to a geminivirus viral replication protein coding sequence: and (iii) a dimer of the geminiyirus B ~enome;
wherein expression of the traps-acting replication gene in cells eontainin~
the proreplicon results in the replication of the proreplicon and the B-aenome.
and increased expression of the target gene.
A further object of the invention is to provide a transgenic geminivirus expression system comprising:
(i) a chromosomally-integrated inactive replicon comprising:
a) cis-acting viral elements required for viral replication:
b) a target gene comprising at least one suitable regulaton°
sequence; and c) site-specific sequences responsive to a site-specific 1 ~ recombinase:
(ii) a chromosomally-integrated chimeric transactivating gene comprising a regulated plant promoter operably-linked to a site-specific recombinase coding sequence;
(iii j a dimer of a geminivirus B genome;
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination, activation of replicon and B-genome replication, and increased expression of the target gene.
Yet another object of the invention is to provide a method of increasing vial resistance in a plant comprising:
( i) transforming a first plant with a inactive replicon to form a first primary transformant. the inactive replicon comprising:
a1 cis-acting viral elements required for viral replication:
b) viral sequences homologous to the infecting virus capable of conferring homology-dependent resistance:
0 c) site-specific sequences responsive to a site-specific recombinase;
(ii 1 transforming a second plant with a chimeric transactivating gene to form a second primary transformant comprising a regulated plant promoter operable-linked to a transactivatin~
>j site-specific recombinase coding sequence:
(iii) growing the first and second primary transformants wherein progeny from both seeds are obtained: and (iv) crossing the progeny of the first and second transformants wherein the viral sequences homologous to the infecting virus are expressed. conveying viral resistance to the plant.
The present invention is useful in transgenic plants for controlled replicon replication and expression of transgenes with or without replicon replication.
Both components of the system are chromosomaily-integrated and independently -heritable. One component is an inactive replicon that is unable to replicate episomally unless a transactivating protein is provided in traps. The second component is a chimeric traps-activating gene in which the coding sequence of a 10 transactivating protein is placed under the control of a tissue- or development-specific andior inducible promoter. The transactivating protein can be either a viral replication protein or a site-specific recombination protein. When it is a viral replication protein(s). the inactive replicon is of the proreplicon type that lacks a functional replication proteins) and cannot replicate episomallv unless the 1 ~ replication proteins) is provided in traps. ~w'hen it is a site-specific recombinase.
it can mediate site-specific recombination involving cognate site-specific sequences) in the inactive replicon to convert it into an active one capable of autonomous or cis replication. The two systems involving a replicon can be used independently or in combination.
20 The site-specific recombination system can also be applied to transactivation of an inactive transgene with or without involving episomal replication.
The different components of the invention are heritable independently and may be introduced together into a transgenic plant or brought together by crossing ~5 transgenic plants cam~ina the separate components, such as by the method to produce TopCross~ high oil corn seed [L.~.S. Patent No. 5.704,160]. Also provided are methods of making the expression cassettes and methods of using them to produce transformed plant cells having an altered genotype and/or phenotype.
30 B_ RIFF DESCRIPTIO'~' OF FIGURES AND SEOLTENCE DESCRIPTIONS
Figure 1 illustrates excising and regulating the expression of a replicon and generating an active transgene from an inactive replicon containing site-specific sequences responsive to a site-specific recombinase.
Fi~Ture '_' illsst~ates excising and regulating the expression of a replicon and 35 generating an active transgene from an inactive replicon containing site-specific sequences responsive to a site-specific recombinase where the one site-specific sequence is in the J' non-coding transcribed sequence and the other is in an inverted orientation in the promoter.
i I
. _ . ii v~ ~ . c. .:. ~ t~ v :' ~r ~ v v ~ i'_ ~ 02339595 2001-02-05 .. .. .
_ . _ ~ . . .
I
Figure 3 illustrates excising and regulating the expression of a rcplican ~
containing a transcription stop fragment inserted between site-specific sequences a where replication is mediated by a siroe-specific rccombinasc.
Figure 4 illustrates excising and activating a proreplicon via the expression of a chimeric transacting replication gene.
The following sequence descriptions and sequences listings attached hereto comply with the rules governing nucleotide and/or amino acid sequence ' disclosures in patent applications as set forth in 37 C.F.R. ~1,821-1.825 ~
("Requiremexrts for Patent Applications Containing Nucleotide Seqv:ences 3ndlor Amino Acid Sequence Disclosures -the Sequence Rubs") and are consistent a~'ith World Tnteltxtual Property Organization (WIPO) Standard ST2S (1898) and the sequence listing requirements of the EfO and PCT (Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C of the Administration Instructions). The Sequence Descriptions cozttain the one letter code for nucleotide sequence chara: ttcrs and the three letter codes for amino acids as def ncd in conformity with the IUPAC-TYtTB
standards described inNuelelrAeids Ras. 13:3021-3030 (1955) and inthc Biochemical Journal 219:345-373 ( 1984). .
Sequences 1-42 are given in the present application, all corres~pvnding to v primers used in gene amplification.
DETA_n ED DESCRIPTION OF TI-IE INVENTION ' The present invention provides a binary expression system that uses ~;
various genetic elements of plant DNA or RNA viruses. regulated proznotcrs, andlor site-specif c rceombinatlon systems. Tire expression system is useful far conditional cpisomal replication, transgene expression with or wi~out cpisomal , replication, ~c~irus-induced host gene silencing, and viral resistance. Such replicans can be either capable or incapable ef cell to-cell or systemic movement.
Applicant solved the statal problems by methods providing a tcvo- ' component expression system, at least one of which is chromosomally-integrated_ .
In another method, the expression system comprises an inactive replicon and a regulated chimeric transactivating site-specific xecombinase gene. The inactive r~rplicon comprises of wild-type or mutant site-specific recombination sequences acrd is unable to replicate either because it cannot excise from the chromosome (ia the case of DNA replicon) and/or because one or more viral genes cannot be properly transcribed (in the case of both DNA repliccn and RNA
virus arnplicon). The transactivating site-specific rccombinaso mediates site-specific recombination between wild-type andlor mutant site-specific sequences in i or around the inactive replicon that r~cnders the Inactive replicon active and able to I
i AMENDED SHEET
replicate. Such replicons can be either capable or incapable of cell to-cell or systemic movement. Thus, the site-specific recombination mediates DNA
rearrangement (excision or inversion) in the chromosome that results in either excision of a DNA replicon or RNA amplicon and/or proper transcription of one s or more Genes that lead to the release and autonomous (i.e.. cis) replication of the replicon (Figures 1. ?l. Figure 1 shows a scheme for regulated transactivation of -an inactive replicon or transgene by DNA excision mediated by a site-specific recombination.as for example, Cre-lox. The open triangle represents a wild type or mutant lox P site. DNA A and C can be promoter and ORF/3' untranslated region. respectively, of a transgene or they can be any DNA. DNA B can be a repIicon and/or a Transcription Stop Fragment. When the construct is a geminivirus replicon inserted between the promoter (solid box) and ORF (open boil of its replication gene. the replication gene is inactive. When the replicon also serves as a Transcription Stop Fragment. its insertion inactivates the 1 ~ transgene and upon site-specific recombination. both replication and chromosomal transgene genes become active and the latter can be reporter for replicon excision.
Similarly. Figure 2 is a scheme illustrating the transactivation of an inactive replicon (amplicon) by DNA inversion mediated by a site-specific recombination, as for example Cre-lox. Lox sequences are denoted by arrows above the amplicon. The open arrow denotes the replicon. The open reading frames in the replicon are denoted below the amplicon by arrows. TATA and TSS
are the TATA box and the Transcription start site for the plant promoter. ATAT
and SST are the TATA and TSS site, respectively. in the reverse order. M1, M2, M3 are the three movement proteins, RdRP is th RNA-dependent RNA
?s polvmerase. CP is the coat protein and the triangles are the duplicated CP
promoters. Pro' and 3' polv A are regions containing the promoter and 3' polyadenylation signal.
Alternatively, Applicant has developed a method of transactivating inactive transgenes by the above site-specific recombination system without the use of replicons (Figure 3). Figure 3 presents a scheme for transactivation of an inactive replicon (amplicon} by DNA excision of a Transcription Stop Fragment mediated by site-specific recombination. as for example Cre-log. The Transcription Stop Fraement is denoted by filled box. The open arrow denotes the replicon. The open reading frames in the replicon are denoted belo« the ampiico:;
5 by arrow s. Lox seauences are denoted by arrows above the amplicon. TATA and TSS are the T.ATA box and the Transcription start (initiation) site for the plant promoter. M 1. M?. M3. RdRP. CP is the coat protein. Pro' and 3' poly A are as described in Ficure ?.
l, In another embodiment. the expression system comprises a proreplicon and a regulated chimeric transactivating replication gene. A proreplicon contains the cis-acting viral sequences required for replication but is incapable of episomal replication in plant cells because it lacks a functional replication genes) essential for replication. The transactivating gene expresses the viral replication protein missing in the 'proreplicon~ and allows the proreplicon to replicate in traps -(Figure 4~. Figure 4 illustrates a scheme for transactivating replication of an inactive replicon (proreplicon) in traps. Regulated expression of a chromosomally integrated chimeric replication gene will result in the replicative release and replication of the replicon from a chromosomally integrated master copy of the proreplicon.
Plant cells containing an inactive replicon replicate the replicon episomally only in the presence of a site-specific recombinase. Thus. regulated expression of a chimeric site-specific recombinase gene in such cells results in regulated 1 ~ replicon replication and target gene amplification. V~'hile the individual elements of the invention are heritable, the gene expression system may be heritable or limited to the progeny of the crosses that genetically combine the two elements.
Thus in some applications the transgene or target genes expression will be restricted to progeny of the crosses. such as in the method for producing TopCross~' high oil corn seed.
Using the present system, Applicant has demonstrated that:
(i) soybean and corn seed tissue will support gemini virus replication;
(ii) the expression system will effect the expression of foreign genes in tobacco.
(iii) PVh amplicons can replicate in developing soybean seed; and (ivj both geminivinis and PV?i viruses can be activated to replicate by the cre-lox recombination system. The present invention advances the art by providing plant viral vectors (a) which are maintained stably in the chromosome of transgenic plants:
(b) whose replication is controlled by the rertulated expression of a site-specific recombinase: and (c j which can contain nucleic acid sequences encoding foreign proteins that may be expressed in the transgenic plant for foreign protein production or for silencing host plant genes. The present invention also advances the art by providing a method of conditional. high-Ieve1 expression of transgenes using a regulated site-specific recombination system using mutant site-specific sequences and regulated expression of the site-specific recombinase.
The following tet~rns and definitions shall be used to fully understand the specification and claims.
j "Gene' refers to a nucleic acid fragment that expresses mRNA, functional RNA. or specific protein. including regulator, sequences. The terns "Native -gene'~ refers to gene as found in nature. The term "chitneric gene" refers to any gene that contains 1 ) DNA sequences. including regulatory and coding sequences, that are not found together in nature. or 2) sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not naturally adjoined.
Accordin~lv. a chimeric gene may comprise regulatory sequences and codin<~
sequences that are derived from different sources. or comprise regulatory sequences and coding sequences derived from the same source. but arranged in a manner different from that found in nature. A "transgene" refers to a gene that has been introduced into the genome by transformation and is stably maintained.
Transgenes may include. for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed. Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes. The term "endogenous gene" refers to a native gene in its natural location in the genome of an organism.
"Coding sequence" refers to a DNA or RNA sequence that codes for a specific amino acid sequence and excludes the non-coding sequences. The terms "open reading frame" and "ORF" refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence.
The 5 terms ''initiation codori ' and "termination codon " refer to a unit of three adjacent nucleotides ('codon'1 in a coding sequence that specifies initiation and chain termination. respectively. of protein synthesis (mRNA translation).
A "functional RNA'' refers to an antisense RNA, ribozyme, or other RNA
that is not translated.
"Regulatory sequences'' and "suitable regulatory sequences" each refer to nucleotide sequences located upstream (~' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence. and which influence the transcription. RNA processing or stability. or translation of the associated codin~~ sequence. Regulatory sequences include enhancers. promoters.
translatiur;
3~ leader sequences. introns. and polyadenylation signal sequences. They include natural and synthetic sequences as ~.~~ell as sequences which may be a combination of synthetic and natural sequences. As is noted above. the term wsuttamc reculatory sequences~~ is not limited to promoters. however. some suitable - - l regulatory sequences useful in the present invention will include, but are not limited to constitutive plant promoters, plant tissue-specific promoters.
plant development-specific promoters, inducible plant promoters and viral promoters.
''~' non-coding sequence" refers to a nucleotide sequence located ~' (upstream) to the coding sequence. It is present in the fully processed mIL'~IA
upstream of the initiation codon and may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. (Turner et al., Molecular Biotechnology 3:225 ( 1995)).
"3' non-coding sequence" refers to nucleotide sequences located 3' 10 (downstream) to a coding sequence and include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA
processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenvlic acid tracts to the 3' end of the mRNA precursor. The use of different 3' non-coding sequences is exemplified 1~ by Ingelbrecht et al., Plant Cell 1:671-680. (1989).
"Promoter'' refers to a nucleotide sequence. usually upstream (~') to its coding sequence. which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. "Promoter" includes a minimal promoter that is a short DNA
20 sequence comprised of a TATA- box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression. "Promoter'' also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an "ennancer" is a DNA
sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. It is capable of operating in both orientations (normal or 30 flipped), and is capable of functioning even when mooed either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects.
Promoters may be derived in their entirety from a native gene. or be composed of different elements derived from different promoters found in nature. or even be 3 ~ comprised of synthetic DNA segments. A promoter may also contain DNA
sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.
CA 02339595 2001-02-05 ---~ ---- --._.. ~ ii~~--~~. C,VVU T~UU'o:
29-11-2000 US 0099219$9 "Constitutive expression" refers to expression using a constitutive or regulated promoter. ''Coaditional" and "regulated exprcssioa" refer to expression contolled by regulated promoter.
"Constitutive promotes ' refers to promoters that direct gene expression in atl tissues and at all times.
"Regulated promoter" refers to promoters that direct gene expression not constitutively but in a temporally- andlor spatially-regulated manner and include both tissue-specific and indu~cible promoters. It includes natural. and synthetic sequences as well as sequences which may be a combizuttion of synthetic and natural sequences. Different promoters may direct the expression ova gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okatnuro et al., Bfochernistry of Plants 15:1-82,1. 989.
Since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of differeztt lengths may have identical promoter activity. Typical regulated promoters useful in plants include but arc not limited to sa~ener-inducible promoters, promoters derived from the tetracycline-inducible system, promoters derived from salicylaxe-inducible systems, (Gatz, C, 2Q Curr. Opin- Biotechnol. (1996), 7(2), 168-72) promoters derived from aLcohol-inducible systems, promoters derived from glucocor4icoid-inducible system promoters derived from pathogen-inducible systems, and prozz~otcrs derived from ecdysome-inducible systems (Martinez et al., Inducible Gene Expression PLC
(1999), 23-41. Editors}: Reynolds, Paul H. S- Publisher: CABI Publishing, Wallingford, UK.; Thompson et al-, Mol. Cell Bial. (1992),12(3}, 1443-53).
"Tissue-specific gromoter" refers to regulated promoters that arc not expressed in all plant cells but only in one or more cell typos in specific organs (such as leaves ox seeds}, specific tissues (such as embryo or cotyledon), or specific cell types (such as leaf parenchyma or srxd storage cells). These also include promoters that aro temporally regulated. such as in early or late embryogenesis, during fruit ripening in developing seeds or fruit, in fully differentiated leaf, or at the onset of senescence.
"N'on-specific expression" refers to constitutive expression or low level, basal ('leaky') expression in nondesired cells or tissues from a 'regulated promoter'.
AMENDED SHEET
.__. _ _, ~--' _, L V ~J a .~ . a V: u. CA 02339595 2001-02-05 .. . ",.. . _ .
. _ ~~ ~ i "Inducible promote" refez~ to those regulated promoters that can be turned on in one or more cell types by an external stimulus, such as a chemical, light, hormone, stress, or a pathogen.
"Operably-linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other.
For example, a promoter is operably-linked with a coding sequence or functional ' ,, f r AMENDED SHEET ' RNA when it is capable of affecting the expression of that coding sequence or functional RNA (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Codin<, sequences can be operable-linked to regulatory sequences in sense or antisense orientation.
'~E~pression~~ refers to the transcription and stable accumulation of sense (mRNA) or functional R.'~A. Expression may also refer to the production of -protein.
"Altered levels' refers to the level of expression in transgenic organisms that differs from that of normal or untransformed organisms.
10 "Overexpression" refers to the level of expression in transgenic organisms that exceeds levels of expression in normal or untransformed organisms.
"Antisense inhibition" refers to the production of antisense RNA
transcripts capable of suppressing the expression of protein from an endogenous or transEene.
1 ~ "Co-suppression" and "transwitch~' each refer to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar transgene or endogenous genes (U.S. Patent No. 5,231,020).
"Gene silencing" refers to homology-dependent suppression of viral genes.
transgenes. or endogenous nuclear genes. Gene silencing may be transcriptional, 20 when the suppression is due to decreased transcription of the affected genes, or post-transcriptional. when the suppression is due to increased turnover (degradation) of RNA species homologous to the affected genes [see English.
et al., (1996) Plant Cell 8:179-188]. Gene silencing includes virus induced gene silencing [see Teresa Ruiz et al., ( 1998) Plant Cell 10:937-946].
v . _ 29-11-2000 _I 12~_C
BINARI' ~~IRAL EXPRESSION SYSTEM IN PLANTS
FIELD OF INIVENTION
This application claims the benefit of U.S, Provisional AppIicaticn i No. 641I50,255_flcd, August 23, 1999, and U.S. Provisional Application No. 601130,086, filed April 20, 1999 and U.S. Provisional Application I
No. 601101,558, filed, September 23, 1998.
The present invention relates to the field of molecular biology and the !
gez~ebic transformation of plants with foreign gene fragments. More particularly.
the invention relates to a binary expression system useful for conditionally expressing txarsgencs in plants.
?wo serious tcchtucal problems beset plant transgenics. First, plant ' transgene expression attains only low and inconsistent levels. These poor expression ler; els arc attributable in part to random chromosomal integration ('position effects') and in part to a general lack of gene copy number-dependent expression. Episomal vectors are expected to overcome these problems. In constrast to plants, microbes can attain high-level expression through episomal (plasnud) vectors because these vectors can be maintained by setcction.
Although plant viruses have been used as episomat expression vectors, their use has been i I
restricted to transient expression because of lack of selection and/or their cellular toxicity (U.S. Patent NQ_ 4,855,237, VSO 9534668).
Second, non-specific expression of transgenes in non-desited cells arzd tissues hinders plant transgenic work. This is important where the goal is to produce high levels of phytetoxic materials in transgenic plants. Conditional transgene expression will enable economic production of desixed chemicals, znonomecs, and polymers at levels likely to be phytotoxic to growing plants by restricting their production to pzoduction tissue of transgenic plants either just !
pzior to or after harvest. Therefore, lack of a commercially usable conditional expression system and the difhcuIty in attaining a reliable, high-level expression both limit development oftransgene expression in plants. ;
Plant viruses Viruses arc infectious agents with relatively simple organization and uni.quc modes of replication. A given plant virus may contain either RNA or 3~ DNA, and may be either single- or doable-stranded.
RNA Plant yiruses Double-stranded RNA plant viruses include rice dwarf virus (RDy and wound tumor virus (WTV). Single-stranded RNA plant viruses include tobacco AMENDED SHEET
mosaic virus (TMV) and potato virus X (PVX), turnip yellow mosaic virus (TYMV), rice necrosis virus (RNV) and brome mosaic virus (BMV). The RNA in single-stranded RNA viruses may be either a plus (+1 or a minus (-) strand.
Although many plant viruses have RI~'A <,enomes, organization of emetic information differs between groups (the major groupings designated as monopartite, bipartite and tripartite). The genome of most monopartite plant R'B'A--viruses is a single-stranded molecule of (+)-sense. There are at least 11 major groups of viruses with this type of genome. Examples of this type of virus are TMV and PVX. At least six major groups of plant RNA viruses have a bipartite 10 genome. In these, the genome usually consists of two distinct (+)-sense single-stranded RNA molecules encapsidated in separate particles. Both RNAs are required for infectivity. Cowpea mosaic virus (CPMV~ is one example of a bipartite plant virus. A third major group, containing at least six major types of plant viruses, is tripartite, with three (+)-sense single-stranded RNA
molecules.
1 ~ Each strand is separately encapsidated. and all tluee are required for infectivity.
An example of a tripartite plant virus is alfalfa mosaic virus (AMV). Many plant viruses also have smaller subgenomic mRNAs that are synthesized to amplify a specific gene product.
DNA Plant Viruses 20 Plant viruses with a double-stranded DNA genome include Cauliflower Mosaic virus (CaMV).
Plant viruses with single-stranded DNA genomes include geminiviruses, and more specifically, include African Cassava Mosaic Virus (ACMV), Tomato Golden Mosaic Virus (TGMV). and Maize Streak Virus (MSV). Geminiviruses '_'~ are subdivided on the basis of whether they infect monocots or dicots and whether their insect rector is a leafhopper or a whitefly. Subgroup I geminiviruses are leafhopper-transmitted and infect monocotyledonous plants (e.g,.. Vrlteat Dwarf Virus): Subgroup II geminiviruses are leafhopper-transmitted and infect dicotvledonous plants (e.g., Beet Curly Top Virus: and Subgroup III
30 geminiviruses are w~hitefly-transmitted and infect dicotvledonous plants (e.c., Tomato Golden Mosaic Virus, TGMV, and African Cassava Mosaic Virus, ACMV).
Subgroup I and II geminiviruses have a single (monopartite) genome.
Subgroup III geminiviruses have a bipartite genome. For example. Subgroup III
3~ geminiviruses TGMV and ACMV consist of two circular single-stranded DNA
genomes. A and B, of ca. 2.8 kB each in size. DNA A and B of a given Subgroup III virus have little sequence similarity. except for an almost identical common region of about 200 bp. While both DNA A and DNA B are required for mv~. ~.. iuuu :.~~:au CA 02339595 2001-02-05 "w ----infection, only D~!RA A is nccessar~r and su~cient for replication and DNA 8 encodes functions required for movement of the virus tluough the infected plant.
In both TGMV and ACMV, DNA A contains four open reading frames (ORFs) that art expressed in a bidirectionat manner and art~ange~d similarly.
The ORFs arc named according to their orientation relative to the common region, i.c., complementary (C) versus viral (V) in ACMY anrl leftward (L) or rightward (R) in TGMV. Thus, ORFs AL1, AT.2, AL3, and ARl of TGMV are homologous to AC1, ACZ, AG3, aad AVl, respectively, of ACMV. Three major transcripts have been identif ed in ACMV DNA A and these map to the AV 1 and AC 1 OltF s, separately and the AC21AC3 OlZFs together. There is experimeatal evidence for the function of these ORFs. Thus, in ACMV AC1 encodes a replication protein that is essential and sufficient for replication; AC2 is required for transactivation of the coat protein gene, AC3 encodes a protein that is not essential for replication but enhances viral DNA acetunulation; and AV1 is the coat protein gene. Except I5 for the esscnt?al viral replication protein (encoded by AC 1 and ALI ua ACMV and TGMV, respectively), geminivins replication relies on host replication and transcription machinery. Although geminiviruses are single-stranded plant DNA
viruses, they replicate via double-stranded DNA intermediate by 'rolling circle replication'.
24 The contribution of the AC2 coding sequence when removed from tha context of the AChrIV genome and expressed froze a potato virus X (PVX] based vector has been investigated in Hong et at. (Transactivation of dianthin transgcne expression by African cassava mosaic virus AC2; Virology 228(?): 383-387 (1997))_ Ueing a PVX vector to express the AC2 protein in planra, it was found 25 that AC2 ex~prcssion can induce necrosis in transgenic plants.
While both DNA A and DNA E arc required for infection, only DNA A is necessary and sufficient for replication and Dh'A B encodes functions required far movement of the virus through the infected plant. This has been examined in detail by Hayes et al. (Replication of tomato golden mosaic virus DNA B in 30 transgenic plants erGpressing open reading &a~mes ORFs of DNA A-Requirement of ORE AL2 for production of single-stranded DNA; Nucleic Acids Res.
17(24):10213-10222). It was determined that plants transgcnic for TGMV ORE
AL1 are able to support the replication of the double-stranded farms of DNA B, but ORE AL2 is required in addition to produce single stranded DNA B.
35 Viruses as Ex~sion Vectors Constructing plant viruses to introduce and express non-viral foreign genes in plants has been demonstrated (U'.S. Patent No. 4,855,237, WO
9534668).
When the virus is a DNA virus, the constructions can be made to the virus itself.
i i AMENDED SHEET
CA 02339595 2001-02-05 w ~ ~ ~ ~ ~ ' ' ifVr, LJ. ~VV'J .,U~~~W ' r i Alternatively, the virus can first be cloned into a bacterial pIasmid for ease in constructing the desired vital vector with the foreign DNA. If the virus is an RNA
virus, the virus is generally cloned as a cDNA and inserted into a plasmid.
The ;
DNA plasmid its then used to make all of the constructions. The RNA virus is S then pmduccd by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat proteins) which encapsidate the viral RNA.
_ The cDNA of RNA viral genome can be cloned behind a heterologous plant promoter. Such a chimeric gene, called an 'auonplicon', can be introduced into a plant cell and used to transcribe the viral RNA that can replicate autonomously , I4 [Sablows,ki~ et al. (1995) Proc. NatL Acad Sci. USA vol 92, pp 6901-6905].
ueminiviruses have many advantages as potential plant expression vectors. These include 1) replication to high copy numbers, 2) small, well-chata~ctteriz~d genomcs, 3) assembly into nucleosomes, and 4) nuclear replication and transcription. The DNA A component of these viruses is capable of 15 autonomous replication in plant calls in the abxz~ce of DNA H. Vectors in which the coat protein ORF hays been replaced by a hcterologous coding sequence have been developed and the hetexologous coding sequence expressed from the coat protein promoter [Hayes et al., Stability and expression of bacterial genes in replicating geminivirus vectors in plants. Nucleic Acids Rer. 17:2391-403 (1989);
20 liayes et al., Gene amplification and expression in plants by a replicating geminivirus vector. Nature (London) 334:179-82 {19$8)].
A geminivirus-based vector system fox obtaining controlled expression of a nucleic acid fragment of interest has been reported (W09419477). This vector sustern enables transformed plants having cells, tissues, or parts to display an 2S altered genotype andlor express modified phenotypic properties. A
transfected plant cell is produced by contacting a plant cell with the recombinant geminivirus tl~ansfcr vector.
Limited methods for induction of transgcne expression have been developed. W0952580I discloses a viral replicon whose construction enables the 30 replicon to be non-coding in the absence of a virus or viral components.
Conversely, in thin presence of a virus or viral components, the replicon is activated by viral rrplicase which converts non-coding negative-sense DNA into positive-sense RNA., thereby allowing expression of the gcne(s). This permits plants to gain resistance to viral infection, since activation of a resistance response 35 is linked directly to the replication of the virus. Further, as viral replication increases, the resistance response is also increased.
Qreater than full length copies of wild-type TCiMV A and H genomes were transformed into petunia [Ropers et al., Tomato golden mosaic virus A
AMENDED SHEET
CA 02339595 2001-02-05 .. -. v ~ - .
n.... ~..,.~..
W ~ ~. v 7, 'v'J V~~=~. .
component DNA replicates autonomously in transgenic plants. Cell (Cambridge, Mass.) 45:593-600 (1986)). Replication was reported in the primary transformants and in some of the selfed pmgeny consistent with its rncndelian inheritance, indicating that the ehromosamally-integrated master copy, aot the replicon, is inherited. 'This suggests that gametophytic znd/or developing seed tissues rack the ability to support replication. The repoxt did not demonstrate whether the virus replicated in non-gerrairtating seed tissue. Prior art shoes that geminiviruses ar not seed-transmitted in nature [Goodman, R M. f 198 t ) Geaoninivirus. J. Gen. Vlrol, vol. 54, p 9-21 ]. Thus, there was no evidence tl~t they canreplicate in gametophytic tissue or developing xcd.
Tomato Golden Mosaic Virus (TGN1V) DNA A was modi.~ed by replacing its coat protein coding sequence with that of NPT II or GUS reporter genes or with that of 35S:NPT II gene dnd a grater than full length copy of the modified viruses were transformed into tobacco [Hayes et aL, Stability and expression of bacterial genes in replicating geminivirus vectors in plants.
Nu~leie Acids R~s, 17:2391-403 (1989); Hayes et al., Gcne amplification and expression in plants by a replicating geminivirus vector. Nature LT.ondon) 334:179-82 (1988)J. Leaves of transgenic plants showed that the high levels of the rEporter enzymes was gene copy ~aumber-dependent. However, replication of the vector and reporUer gel~e rx~pressioa were not repoxted in seal and the genetic stability of the vector in transgenic plants in subsequent generations was not reported.
Use of the African Cassava Mosaic Virus (ACMV) in similar fashion has net been reported and it is not known that ACNTV DNA or the replication proteins) can be ' stably maintained in progeny pleat' and whether it caa replicate in seed tissues. ;
ZS In one report, a chimeric gene (in wfiich the constitutive plant promoter, 358, was fused to the TGMV sequence containing ORFs AL1, AL?, and A.L3) was transformed into Nicotl~xna benthumiana. Different transge~uic lines showed signifcattt non-uniformity in the Levels of 35S:AL1-3 gene expression as well as in their ability to complement viral replication [IIanley-Bowdoin et al., Functional expression of the leftward open reading frames of the A component of tomato golden mosaic virus in transgenic tobacco plants. Plant Cell 1:1057-b7 (1989)].
In another report, chirneric genes (in which the constitutive plant promoter, 355, was fused to the coding sequence of TGMV replication protein AL1) were ' transformed into tobacco, The expression of TGMV replication protein in the primary transformattts supported tht replication of a mutant genome A lacking the replication protein. [Henley-Howdoin et aL, Expression of funetiozlal replication protein from tomato golden mosaic virus in transgenic tobacco plauts_ Proc.
Natl.
Aced. Sci. U.SA. 87:1446-50 (1990)J. However, neither publication reported on I
S
I
AMENDED SHEET
!C("V. V VI\ ~ CYt1-rvl~'r.lV~.nr-IV v.7 ~ 02339595 2001-02-05 ..... . . .._ .
--- --- - - : - -~GG' 1!' v - -_ _ _ 11L~~'Jl.v: -, . . ' 1. U V V 'f ' J l . irt 29- 91-2000 U S 009921989 ', i the gcacric stability of the chimcric replication protein gene through subsequent generations nor its ability to support viral replication in seed tissue. In aaothex report, chimeric genes (in which the constitutive plant promoter, 355, was fused separately to the coding sequences of TGlIiV replication proteins AL1, AL2, and AL3) were transformed into tobacco [Hayes et al., Replication of tomato golden ';
mosaic virus DNA B in transgenic plants expressing open reading frames (dRFs) of DNA A: requirement .of ORF AL2 for production of single-stranded DNA.
Nucleic .Alcids Res 17:10213-22 (1989)]. The TGMV replication protein was i expressed in progeny but the genetic stability of the chirneric replication prouin gene through subsequent generations was aot reported. Furthermore, it was not reported whether the transgenic plants will support replication in seed tis3ue.
In another disclosure, Rogers et al. (F.p 221044) demonstrated the expression of foreign proteins in plant tissue using a modified ''A" genomc of the TGMV gemini viru5r The foreign gene was inserted in place of the gene encoding the viral coat protein and tL~e resulting plasmid tt~ansformcd into plant tissue.
Rogers et al. did not roport tissue specific expression of the foreign protein and are silent as to the genetic stability of the transforming plasrnid.
All of the reported viral vectors have a major disadvantage. They weze either not shown to be stabIy maintained in fransgenic plants and/or not practically useful. Thus, despite intense ef~ts to develop plant viral vectors and viruses, no co~dunercially useR~I plant virus-based recombinant vectors have been developed that are heritable and capable of episomal replication and expression ire desired 'ssue(s) of the trFUasgenie host plant without the need for infection every generation. In fact, replication of plant viruses is expected to be detrimental to the growth and development of plant cells. Fur example, when greater than full length copy of TGMV genome A is introduced into plant cell one-tenth as many transgenic plants are obtained than when genome B is used or when control transfazznations are done [Rodgezs et al., Tomato golden mosaic virus A
component DNA replicates autonomously in transgenic plants. Cell (Cambridge, MA) 45:593-600 (1986)]. The authors suggest this may be due to expression of a gene in TGNIY A DNA. Furthormore, crude extract of plants expressing tandem v copies of both TCrNN A and TGrMV B genomes are unable to infect Nicotiana . benthamiana plants. This is consistent with having a low vines titer. Thus, transgenic plants that do regenerate could be selected for low level expression of a 36 toxic viral gene product and low level of viral replication or are silenced by the host. This is also consistent with the authors' finding that relatively few cells initiate release of the virus, a conclusion based on their observation that most of the tissues remain viable and nonsymptonxatic. Similarly, poor replication in AMENDED SHEET
__ _ CA 02339595 2001-02-05 . ~, v~ _ ~ ..
a.... ~ 11V ~~..LJ. ,LVV~V __~...U .ll~
29- i 1-2000 US 009921989 transgenic plants containing 35S:replication protein in otherreports suggests plants are either selected far poor expression of the replication protein (presumably because of its toxicity), or that the tissue-specific expression profiles of the replication gene is different from that of viral replication.
To date, no plant virus-based recombinant vectors are known that are heritable and capable of episomal replication and expression of foreign proteins in target tissues) of a transgeaic host plant without the need for infection in every generation_ ?he use viral vectors for gene silencing has been reported [[Covey, S. N, IO et al. (1997) Nature (London) 38:781-782; Kumagai, et aL {1995) Prac. Natl.
Acud. Sci. (L.S.A.) 92:1679-1683; Kjezuixup, S, etal. (1998) Plant J. 14:91-100;
Raxclid~, F, of al. (1997) Science (Washington, DG') 276:1558-1560; Ruin, M_ T. et al. (1998) Plant Cell 10:937-946; Baulcombe, D. C. and A,ngell, S. M, (1998) Virus amplicons for gene silencing in transgenic plants, PCT Znt.
Appl.WO 9836083]. In one report it was concluded that replicating viral RNA is v a potent trigger for gene silencing (Baulcombe, D. C. and Angell, S. M.
Consistent gene silencing in uaasgenic plants expzessing a replicating potato virus ;
~ RNA. $MBO 16(12):3675-3184 (1997)). It was suggested that amplicon- ;
mediated gene silencing may provide an important new strategy for the consistent 24 activation of gene silencing in transgcnic pleats. ' A further study by Pruss et al. (Plant Cell 9:959-8d8 (1997)1 teach that the P IIHC Pro sequence of the tobacco etch virus (TEV) acts as a general , pathogenicity enhancer during co-infection by three different groups:
potexvirus ' (PV7~, tobamovirus (TM~, and cucuuaovirus (CM'S). Although the mtchanistn of the interaction is not yet well undcrsiood, the fact that expression of the P1 JHC ' Pro sequence alters disease induction by each of these unrelated heterolgous viruses suggest that it affects a common step in vial infection. Additionally, it is known that the control domain of I-iC Fro is also involved in RhTA replication of potyviruses.
Despite these reports where viral vectors are used for gene silencing its use in transgenic plants under the control of conditional or regulated site-specific recombination has not been reported thus far. In the absence of such regulation, current viral gene silencing is constitutively on. This could be detrimental to a plant and restricts transgenic viral silencing to non-essential genes.
Although the use silencing suppressors genes for overcoming silencing of transgenic gents has been demonstrated, their use in preventing silencing of transgenes in viral episotnes has yet not been demonstrated.
AMENDED SHEET
CA 02339595 2001-02-05 ~ -~ . - ~ - -alw~. LJ, L'~Jt' t.vl-is Transgenic viral vectors for foreign protein production andior gene silencing differ from infecting viral vectors in not requiring systemic movement.
Use of constitutively exprossed viral trazrsgenes for viral resistance has been reported. However, conditiotaal expression of such transgenes, preferably through conditional activation of replicon, say upon viral infection, is likely to provide a more effective control.
Conditional or regulated expression has been reported in plants jsee De Veylder, L. et al., Plant Cell Physiot. 38:568-577 (1997); Cratz, C., Anna Rev.
PIantPhysiol. Plant.~4iol. BivT. 48:89-108 (1997); Hansen, G. et al., Mol.
Ger~
IO Genet. 254:337-343 (1997); Jepson, L, PCT Int. Appl. (1997} WO 9706269 A1, Jepson, I, et al. PCT Int. Appl. (1997) WO 9711189 A2, and other references within this application]. FIowcver, when tested for stringently for basal non-specific expression, very few have been scrictty specific [Odell, J. T. et al., Plant Phystol. 91994} 106:44 7-458; van der Geest et al., Plant Physiol. (1995), 109(4), 1151-58; Ma, ct al., Rust. J. Plant Physiol. (1998), 25(1 ), 53-59; Czako, et al., Mol. Gen. Genet. (1992), 235(1), 33-40]. Suchprornoters arc not suitable for some applications, such as the ux of transgenes for expressing novel phytotoxic proteins, enzymes that lead to the biosynthesis of phytotoxic products, and~or gene silencing.
Dirks et al. (PCT Int. Appl. (1998) WO 9828431) teach a~aArabidopsis promoter (AtDMCI) that may be used in meiosis-specific expression of a heterologous gene sequence in transgenic plants. Further embodiments of their invention permit the removal of any unwanted DNA sequence during the fnrst cycle of sexual reproduction in a transgenic plant (using a Crellox system}
and ' meiosis-specific traascription of a cytotoxic gene and meiotic cell death (for .
production of apomietic seed or for detection of apomietic mutarns). These teachings are limited in that conditional or regulated e:cpression is necessarily linked to meiosis.
Site-specific recombinations in plants (Odell et al_, Plant Physiol.
10b:447-458 (I994); Odell et al., PCT Int. Appl. (1991) WO 9109957; Surin et al., .PCT Int. Appl.{1997} WO 9737012: Dirks et al., PCT Int. Appl. (1998) WO
9828431) and the reduction in the proficiency of Ce-mediated recombination by mutant lox P sites and their use in increasing the frequency of Cre-I ox based integration have been reported [Albert et al., Plant J. 7:649-59 (1995); Arald at al., Nucleic Acids Res. 25:868-872 (1997)]. However, the use of the mutant sites to enhance the specificity Cre-mediated recombination in conjuetion with chimcric Cre genes under the control of available regu),atcd promoters has not been demonstrated. Thus, there is a need for an appropriately strinscnt, site-AMENDED SHEET
CA 02339595 2001-02-05 y I 1 L L~.~. ~ - --RCY,\'ON~EPA-hIUENCHEN U3 ~'.f~~-ll- V - __ __ uu,~JL."!'~ 1"__.-__ vV'JV ?. VViu.
i specific recombination system for a cozmncrcialIy-attractive, conditional site-' f . specific recombination.
~~~2,~R Y of TTY rNVENTrorr ;
?he present invention provides a binary transgenic viral expression system ~ i I
coniprisiztg: ' (i) a chromosornally-integrated inactive replicon comprising:
a) cis-acting viral elements required for viral replication;
b) a target gene comprising at least one suitable regulatory , sequence; and c) site-specific sequences responsive to a site-specific recombittase; and '.
(ii) a ehrourosomally-integrated chimer~c transactivating gene comprising a regulated plaztt promoter operably-linked to a ' i site-specific recombinase coding sequence; ;
wherein expression of the chimeric transactiwting gene in cells containing the ' inactive rcplicon results in the site-specific recombination, activation of replicon replication, and increased expression of the target gene. !
The imrcntion further provides that inactive repIicon be derivod from a I
gezninivirus or a single stranded RNA virus. , i I
i ;
7B ;
, AMENDED SHEET
Additionally the invention provides that the re;ulated plant promoter may be tissue-specific, constitutive or inducible and the wild-type or mutant.
site-specific sequences responsive to a site-specific recombinase. the site-specific sequences may be lox sequences. responsive to the Cre recombinase protein.
The invention further provides a method of alt~~rin~_ the levels of a protein encoded by a target gene in a plant comprising: (i) transforming a plant with the _ instant viral expression system; and (ii) growing the transformed plant seed under - conditions wherein the protein is expressed.
Additionally the invention provides a method of altering the levels of a protein encoded by a target gene in a plant comprising:
(i) transforming a first plant with a inactive replicon to form a first priman~ transformant. the inactive replicon comprising:
a) cis-acting viral elements required for viral replication;
b) a target gene comprising at least one suitable regulatory 1 ~ sequence; and c) site-specific sequences responsive to a site-specific recombinase, (ii) transforming a second plant with a chimeric transactivating gene to form a second primary transformant comprising a --regulated plant promoter operably-linked to a transactivating site-specific recombinase coding sequence;
(iii) growin; the first and second priman~ transformants wherein progeny from both seeds are obtained; and (iv'1 crossing the progeny of the first and second transformants wherein the target gene is expressed.
In an alternate embodiment the invention provides a method of altering the levels of a protein encoded by a target gene in a plant comprising:
(i) transforming a plant with a inactive replicon the inactive replicon comprising:
a) cis-acting viral elements required for viral replication;
b) a target gene comprising at least one suitable regulatory sequence; and c) site-specific sequences responsive to a site-specific recombinase:
3~ (ii) infecting the transformant with a virus containing a chimeric transactivating gene comprising a regulated plant promoter operably-linked to a transactivating site-specific recombinase coding sequence:
S
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination. activation of replicon replication. and increased expression of the target gene.
In another embodiment the invention provides a binary transgcnic expression system comprising an inactive transgene and a chimeric transactivating gene. the inactive transgene comprising; -(il cis-acting transcription regulatory elements inoperable-linked to the coding sequence or functional RNA, and (ii) site-specific sequences responsive to a site specific recombinase;
the chimeric transactivatinL ~lene comprising a regulated plant promoter operably-linl:ed to a transactivating site-specific recombinase coding sequence.
wherein expression of the chimeric transactivating gene in cells containing the inactiv°e transgene results in an operable linkage of cis-acting transcription regulatory 1 s elements to the codin~l sequence or functional RNA through the site-specific recombination and increased expression of the target gene.
In an alternate embodiment the invention provides a binary transgenic expression system comprising:
(i) a chromosomally integrated blocking fragment bounded by -- site-specific sequences responsive to a site-specific recombinase; and (ii) a chromosomally integrated inactive silencing suppresser transgene;
wherein expression of the site specific recombinase results in the site-specific recombination that activates the silencing suppressor gene.
Additionally the invention provides a transgenic viral expression system comprising:
(i) a chromosomally-integrated geminivirus proreplicon comprising:
a) cis-acting viral elements required for viral replication:
bj a target gene comprising at least one suitable regulatory sequence;and c ) flanking sequences that enable the excision of the elements of a) and bj.
wherein the proreplicon lacks a functional replication gene for episomai replication:
c) (ii) a chromosomally-integrated chimeric traps-acting replication gene comprising a regulated plant promoter operable-linked to a geminivirus viral replication protein coding sequence: and (iii) a dimer of the geminiyirus B ~enome;
wherein expression of the traps-acting replication gene in cells eontainin~
the proreplicon results in the replication of the proreplicon and the B-aenome.
and increased expression of the target gene.
A further object of the invention is to provide a transgenic geminivirus expression system comprising:
(i) a chromosomally-integrated inactive replicon comprising:
a) cis-acting viral elements required for viral replication:
b) a target gene comprising at least one suitable regulaton°
sequence; and c) site-specific sequences responsive to a site-specific 1 ~ recombinase:
(ii) a chromosomally-integrated chimeric transactivating gene comprising a regulated plant promoter operably-linked to a site-specific recombinase coding sequence;
(iii j a dimer of a geminivirus B genome;
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination, activation of replicon and B-genome replication, and increased expression of the target gene.
Yet another object of the invention is to provide a method of increasing vial resistance in a plant comprising:
( i) transforming a first plant with a inactive replicon to form a first primary transformant. the inactive replicon comprising:
a1 cis-acting viral elements required for viral replication:
b) viral sequences homologous to the infecting virus capable of conferring homology-dependent resistance:
0 c) site-specific sequences responsive to a site-specific recombinase;
(ii 1 transforming a second plant with a chimeric transactivating gene to form a second primary transformant comprising a regulated plant promoter operable-linked to a transactivatin~
>j site-specific recombinase coding sequence:
(iii) growing the first and second primary transformants wherein progeny from both seeds are obtained: and (iv) crossing the progeny of the first and second transformants wherein the viral sequences homologous to the infecting virus are expressed. conveying viral resistance to the plant.
The present invention is useful in transgenic plants for controlled replicon replication and expression of transgenes with or without replicon replication.
Both components of the system are chromosomaily-integrated and independently -heritable. One component is an inactive replicon that is unable to replicate episomally unless a transactivating protein is provided in traps. The second component is a chimeric traps-activating gene in which the coding sequence of a 10 transactivating protein is placed under the control of a tissue- or development-specific andior inducible promoter. The transactivating protein can be either a viral replication protein or a site-specific recombination protein. When it is a viral replication protein(s). the inactive replicon is of the proreplicon type that lacks a functional replication proteins) and cannot replicate episomallv unless the 1 ~ replication proteins) is provided in traps. ~w'hen it is a site-specific recombinase.
it can mediate site-specific recombination involving cognate site-specific sequences) in the inactive replicon to convert it into an active one capable of autonomous or cis replication. The two systems involving a replicon can be used independently or in combination.
20 The site-specific recombination system can also be applied to transactivation of an inactive transgene with or without involving episomal replication.
The different components of the invention are heritable independently and may be introduced together into a transgenic plant or brought together by crossing ~5 transgenic plants cam~ina the separate components, such as by the method to produce TopCross~ high oil corn seed [L.~.S. Patent No. 5.704,160]. Also provided are methods of making the expression cassettes and methods of using them to produce transformed plant cells having an altered genotype and/or phenotype.
30 B_ RIFF DESCRIPTIO'~' OF FIGURES AND SEOLTENCE DESCRIPTIONS
Figure 1 illustrates excising and regulating the expression of a replicon and generating an active transgene from an inactive replicon containing site-specific sequences responsive to a site-specific recombinase.
Fi~Ture '_' illsst~ates excising and regulating the expression of a replicon and 35 generating an active transgene from an inactive replicon containing site-specific sequences responsive to a site-specific recombinase where the one site-specific sequence is in the J' non-coding transcribed sequence and the other is in an inverted orientation in the promoter.
i I
. _ . ii v~ ~ . c. .:. ~ t~ v :' ~r ~ v v ~ i'_ ~ 02339595 2001-02-05 .. .. .
_ . _ ~ . . .
I
Figure 3 illustrates excising and regulating the expression of a rcplican ~
containing a transcription stop fragment inserted between site-specific sequences a where replication is mediated by a siroe-specific rccombinasc.
Figure 4 illustrates excising and activating a proreplicon via the expression of a chimeric transacting replication gene.
The following sequence descriptions and sequences listings attached hereto comply with the rules governing nucleotide and/or amino acid sequence ' disclosures in patent applications as set forth in 37 C.F.R. ~1,821-1.825 ~
("Requiremexrts for Patent Applications Containing Nucleotide Seqv:ences 3ndlor Amino Acid Sequence Disclosures -the Sequence Rubs") and are consistent a~'ith World Tnteltxtual Property Organization (WIPO) Standard ST2S (1898) and the sequence listing requirements of the EfO and PCT (Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C of the Administration Instructions). The Sequence Descriptions cozttain the one letter code for nucleotide sequence chara: ttcrs and the three letter codes for amino acids as def ncd in conformity with the IUPAC-TYtTB
standards described inNuelelrAeids Ras. 13:3021-3030 (1955) and inthc Biochemical Journal 219:345-373 ( 1984). .
Sequences 1-42 are given in the present application, all corres~pvnding to v primers used in gene amplification.
DETA_n ED DESCRIPTION OF TI-IE INVENTION ' The present invention provides a binary expression system that uses ~;
various genetic elements of plant DNA or RNA viruses. regulated proznotcrs, andlor site-specif c rceombinatlon systems. Tire expression system is useful far conditional cpisomal replication, transgene expression with or wi~out cpisomal , replication, ~c~irus-induced host gene silencing, and viral resistance. Such replicans can be either capable or incapable ef cell to-cell or systemic movement.
Applicant solved the statal problems by methods providing a tcvo- ' component expression system, at least one of which is chromosomally-integrated_ .
In another method, the expression system comprises an inactive replicon and a regulated chimeric transactivating site-specific xecombinase gene. The inactive r~rplicon comprises of wild-type or mutant site-specific recombination sequences acrd is unable to replicate either because it cannot excise from the chromosome (ia the case of DNA replicon) and/or because one or more viral genes cannot be properly transcribed (in the case of both DNA repliccn and RNA
virus arnplicon). The transactivating site-specific rccombinaso mediates site-specific recombination between wild-type andlor mutant site-specific sequences in i or around the inactive replicon that r~cnders the Inactive replicon active and able to I
i AMENDED SHEET
replicate. Such replicons can be either capable or incapable of cell to-cell or systemic movement. Thus, the site-specific recombination mediates DNA
rearrangement (excision or inversion) in the chromosome that results in either excision of a DNA replicon or RNA amplicon and/or proper transcription of one s or more Genes that lead to the release and autonomous (i.e.. cis) replication of the replicon (Figures 1. ?l. Figure 1 shows a scheme for regulated transactivation of -an inactive replicon or transgene by DNA excision mediated by a site-specific recombination.as for example, Cre-lox. The open triangle represents a wild type or mutant lox P site. DNA A and C can be promoter and ORF/3' untranslated region. respectively, of a transgene or they can be any DNA. DNA B can be a repIicon and/or a Transcription Stop Fragment. When the construct is a geminivirus replicon inserted between the promoter (solid box) and ORF (open boil of its replication gene. the replication gene is inactive. When the replicon also serves as a Transcription Stop Fragment. its insertion inactivates the 1 ~ transgene and upon site-specific recombination. both replication and chromosomal transgene genes become active and the latter can be reporter for replicon excision.
Similarly. Figure 2 is a scheme illustrating the transactivation of an inactive replicon (amplicon) by DNA inversion mediated by a site-specific recombination, as for example Cre-lox. Lox sequences are denoted by arrows above the amplicon. The open arrow denotes the replicon. The open reading frames in the replicon are denoted below the amplicon by arrows. TATA and TSS
are the TATA box and the Transcription start site for the plant promoter. ATAT
and SST are the TATA and TSS site, respectively. in the reverse order. M1, M2, M3 are the three movement proteins, RdRP is th RNA-dependent RNA
?s polvmerase. CP is the coat protein and the triangles are the duplicated CP
promoters. Pro' and 3' polv A are regions containing the promoter and 3' polyadenylation signal.
Alternatively, Applicant has developed a method of transactivating inactive transgenes by the above site-specific recombination system without the use of replicons (Figure 3). Figure 3 presents a scheme for transactivation of an inactive replicon (amplicon} by DNA excision of a Transcription Stop Fragment mediated by site-specific recombination. as for example Cre-log. The Transcription Stop Fraement is denoted by filled box. The open arrow denotes the replicon. The open reading frames in the replicon are denoted belo« the ampiico:;
5 by arrow s. Lox seauences are denoted by arrows above the amplicon. TATA and TSS are the T.ATA box and the Transcription start (initiation) site for the plant promoter. M 1. M?. M3. RdRP. CP is the coat protein. Pro' and 3' poly A are as described in Ficure ?.
l, In another embodiment. the expression system comprises a proreplicon and a regulated chimeric transactivating replication gene. A proreplicon contains the cis-acting viral sequences required for replication but is incapable of episomal replication in plant cells because it lacks a functional replication genes) essential for replication. The transactivating gene expresses the viral replication protein missing in the 'proreplicon~ and allows the proreplicon to replicate in traps -(Figure 4~. Figure 4 illustrates a scheme for transactivating replication of an inactive replicon (proreplicon) in traps. Regulated expression of a chromosomally integrated chimeric replication gene will result in the replicative release and replication of the replicon from a chromosomally integrated master copy of the proreplicon.
Plant cells containing an inactive replicon replicate the replicon episomally only in the presence of a site-specific recombinase. Thus. regulated expression of a chimeric site-specific recombinase gene in such cells results in regulated 1 ~ replicon replication and target gene amplification. V~'hile the individual elements of the invention are heritable, the gene expression system may be heritable or limited to the progeny of the crosses that genetically combine the two elements.
Thus in some applications the transgene or target genes expression will be restricted to progeny of the crosses. such as in the method for producing TopCross~' high oil corn seed.
Using the present system, Applicant has demonstrated that:
(i) soybean and corn seed tissue will support gemini virus replication;
(ii) the expression system will effect the expression of foreign genes in tobacco.
(iii) PVh amplicons can replicate in developing soybean seed; and (ivj both geminivinis and PV?i viruses can be activated to replicate by the cre-lox recombination system. The present invention advances the art by providing plant viral vectors (a) which are maintained stably in the chromosome of transgenic plants:
(b) whose replication is controlled by the rertulated expression of a site-specific recombinase: and (c j which can contain nucleic acid sequences encoding foreign proteins that may be expressed in the transgenic plant for foreign protein production or for silencing host plant genes. The present invention also advances the art by providing a method of conditional. high-Ieve1 expression of transgenes using a regulated site-specific recombination system using mutant site-specific sequences and regulated expression of the site-specific recombinase.
The following tet~rns and definitions shall be used to fully understand the specification and claims.
j "Gene' refers to a nucleic acid fragment that expresses mRNA, functional RNA. or specific protein. including regulator, sequences. The terns "Native -gene'~ refers to gene as found in nature. The term "chitneric gene" refers to any gene that contains 1 ) DNA sequences. including regulatory and coding sequences, that are not found together in nature. or 2) sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not naturally adjoined.
Accordin~lv. a chimeric gene may comprise regulatory sequences and codin<~
sequences that are derived from different sources. or comprise regulatory sequences and coding sequences derived from the same source. but arranged in a manner different from that found in nature. A "transgene" refers to a gene that has been introduced into the genome by transformation and is stably maintained.
Transgenes may include. for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed. Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes. The term "endogenous gene" refers to a native gene in its natural location in the genome of an organism.
"Coding sequence" refers to a DNA or RNA sequence that codes for a specific amino acid sequence and excludes the non-coding sequences. The terms "open reading frame" and "ORF" refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence.
The 5 terms ''initiation codori ' and "termination codon " refer to a unit of three adjacent nucleotides ('codon'1 in a coding sequence that specifies initiation and chain termination. respectively. of protein synthesis (mRNA translation).
A "functional RNA'' refers to an antisense RNA, ribozyme, or other RNA
that is not translated.
"Regulatory sequences'' and "suitable regulatory sequences" each refer to nucleotide sequences located upstream (~' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence. and which influence the transcription. RNA processing or stability. or translation of the associated codin~~ sequence. Regulatory sequences include enhancers. promoters.
translatiur;
3~ leader sequences. introns. and polyadenylation signal sequences. They include natural and synthetic sequences as ~.~~ell as sequences which may be a combination of synthetic and natural sequences. As is noted above. the term wsuttamc reculatory sequences~~ is not limited to promoters. however. some suitable - - l regulatory sequences useful in the present invention will include, but are not limited to constitutive plant promoters, plant tissue-specific promoters.
plant development-specific promoters, inducible plant promoters and viral promoters.
''~' non-coding sequence" refers to a nucleotide sequence located ~' (upstream) to the coding sequence. It is present in the fully processed mIL'~IA
upstream of the initiation codon and may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. (Turner et al., Molecular Biotechnology 3:225 ( 1995)).
"3' non-coding sequence" refers to nucleotide sequences located 3' 10 (downstream) to a coding sequence and include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA
processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenvlic acid tracts to the 3' end of the mRNA precursor. The use of different 3' non-coding sequences is exemplified 1~ by Ingelbrecht et al., Plant Cell 1:671-680. (1989).
"Promoter'' refers to a nucleotide sequence. usually upstream (~') to its coding sequence. which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. "Promoter" includes a minimal promoter that is a short DNA
20 sequence comprised of a TATA- box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression. "Promoter'' also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an "ennancer" is a DNA
sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. It is capable of operating in both orientations (normal or 30 flipped), and is capable of functioning even when mooed either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects.
Promoters may be derived in their entirety from a native gene. or be composed of different elements derived from different promoters found in nature. or even be 3 ~ comprised of synthetic DNA segments. A promoter may also contain DNA
sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.
CA 02339595 2001-02-05 ---~ ---- --._.. ~ ii~~--~~. C,VVU T~UU'o:
29-11-2000 US 0099219$9 "Constitutive expression" refers to expression using a constitutive or regulated promoter. ''Coaditional" and "regulated exprcssioa" refer to expression contolled by regulated promoter.
"Constitutive promotes ' refers to promoters that direct gene expression in atl tissues and at all times.
"Regulated promoter" refers to promoters that direct gene expression not constitutively but in a temporally- andlor spatially-regulated manner and include both tissue-specific and indu~cible promoters. It includes natural. and synthetic sequences as well as sequences which may be a combizuttion of synthetic and natural sequences. Different promoters may direct the expression ova gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okatnuro et al., Bfochernistry of Plants 15:1-82,1. 989.
Since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of differeztt lengths may have identical promoter activity. Typical regulated promoters useful in plants include but arc not limited to sa~ener-inducible promoters, promoters derived from the tetracycline-inducible system, promoters derived from salicylaxe-inducible systems, (Gatz, C, 2Q Curr. Opin- Biotechnol. (1996), 7(2), 168-72) promoters derived from aLcohol-inducible systems, promoters derived from glucocor4icoid-inducible system promoters derived from pathogen-inducible systems, and prozz~otcrs derived from ecdysome-inducible systems (Martinez et al., Inducible Gene Expression PLC
(1999), 23-41. Editors}: Reynolds, Paul H. S- Publisher: CABI Publishing, Wallingford, UK.; Thompson et al-, Mol. Cell Bial. (1992),12(3}, 1443-53).
"Tissue-specific gromoter" refers to regulated promoters that arc not expressed in all plant cells but only in one or more cell typos in specific organs (such as leaves ox seeds}, specific tissues (such as embryo or cotyledon), or specific cell types (such as leaf parenchyma or srxd storage cells). These also include promoters that aro temporally regulated. such as in early or late embryogenesis, during fruit ripening in developing seeds or fruit, in fully differentiated leaf, or at the onset of senescence.
"N'on-specific expression" refers to constitutive expression or low level, basal ('leaky') expression in nondesired cells or tissues from a 'regulated promoter'.
AMENDED SHEET
.__. _ _, ~--' _, L V ~J a .~ . a V: u. CA 02339595 2001-02-05 .. . ",.. . _ .
. _ ~~ ~ i "Inducible promote" refez~ to those regulated promoters that can be turned on in one or more cell types by an external stimulus, such as a chemical, light, hormone, stress, or a pathogen.
"Operably-linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other.
For example, a promoter is operably-linked with a coding sequence or functional ' ,, f r AMENDED SHEET ' RNA when it is capable of affecting the expression of that coding sequence or functional RNA (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Codin<, sequences can be operable-linked to regulatory sequences in sense or antisense orientation.
'~E~pression~~ refers to the transcription and stable accumulation of sense (mRNA) or functional R.'~A. Expression may also refer to the production of -protein.
"Altered levels' refers to the level of expression in transgenic organisms that differs from that of normal or untransformed organisms.
10 "Overexpression" refers to the level of expression in transgenic organisms that exceeds levels of expression in normal or untransformed organisms.
"Antisense inhibition" refers to the production of antisense RNA
transcripts capable of suppressing the expression of protein from an endogenous or transEene.
1 ~ "Co-suppression" and "transwitch~' each refer to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar transgene or endogenous genes (U.S. Patent No. 5,231,020).
"Gene silencing" refers to homology-dependent suppression of viral genes.
transgenes. or endogenous nuclear genes. Gene silencing may be transcriptional, 20 when the suppression is due to decreased transcription of the affected genes, or post-transcriptional. when the suppression is due to increased turnover (degradation) of RNA species homologous to the affected genes [see English.
et al., (1996) Plant Cell 8:179-188]. Gene silencing includes virus induced gene silencing [see Teresa Ruiz et al., ( 1998) Plant Cell 10:937-946].
2~ "Silencing suppressor' gene refers to a gene whose expression leads to counteracting gene silencing and enhanced expression of silenced genes.
Silencing suppressor gen;.s may be of plant. non-plant. or viral origin.
Examples include. but are not limited to HC-Pro, PI-HC-Pro, and 2b proteins. Other examples include one or more genes in TGMV-B genome.
30 "Homologous to" refers to the similarity between the nucleotide sequence of two nucleic acid molecules or between the amino acid sequences of two protein molecules. Estimates of such homology are provided by either DNA-DNA or DNA-RNA hybridization under conditions of stringency as is well understood by those skilled in the art [as described in Hames and Higgins (eds.) Nucleic Acid 3~ Hybridisation. IRL Press. Oxford. U.K.] or by the comparison of sequence .
similarity between two nucleic acids or proteins.
"Amplicori ' refers to a chimeric gene in which the cDNA of a RNA virus is operationally-linked to plant regulatory sequences such that the primary transcript is the 'plus suand of RNA virus.
"Binary viral expression system" describes the expression system s comprised of two elements. at least one of which is chomosomally integrated.
The first element is an inactive replicon that may contains a target gene whose _ expression is desired in a plant or plant cell. The second element is comprised of a regulated promoter operably-linked to a transactivating gene. The first element may be a proreplicon or may be an inactive replicon. The inactive replicon or proreplicon and a chimeric transactivating gene, functioning together, will effect replicon replication and expression of a target gene in a plant in a regulated manner. Both elements of the system may be chromosomally-integrated and may be inherited independently. Stimulating the regulated promoter driving the transactivating gene releases the replicon from the chromosome and its subsequent 1 ~ episomal replication. The release can be physical excision of the replicon from the chromosome involving site-specific recombination. a replicative release from a master chromosomal copy of a proreplicon in the presence of the replication protein. or transcriptional release from a master chromosomal copy of an amplicon.
?0 "Binary transgenic viral replication system'-"-refers to a replication system comprised of two chomosomally integrated elements. The first element may be a proreplicon or may be an inactive replicon which lacks a target gene encoding a foreign protein. The second element is comprised of a regulated promoter operably-linked to a site-specific recombinase gene. The inactive repiicon and a 2~ chimeric site-specific recombinase gene. functioning together. will effect replicon replication in a plant in a regulated manner. Such a system is useful where replication of the virus is desired in a regulated manner but where no foreign gene expression is sought. For example. the regulated expression of virus may be useful in conferring resistance to a plant to viral infection.
30 "Transgene activation system" refers to the expression system comprised of an inactive transgene and a chimeric site-specific recombinase gene, functioning together. to effect transgene expression in a regulated manner.
The specifictv of the recombination will be determined by the specificity of regulated promoters as well as the use of wildtyp or mutant site-specific sequences.
Both 3~ elements of the system can be chromosomaily-integrated and inherited independently. Such site specific sequences are well hrtov,n in the art. see for example the Cre-Lox system (Sauer. B.. U.S. 4.959.317) as well as the FLP/FRT
WO 00117365 PCT/1;S99/21989 site-specific recombination system (Lyznik et al., iV.lfClL'lC ~l cids Res. ( I 993 ).
21 (4). 969-7~).
''Target gene" refers to a gene on the replicon that expresses the desired target coding sequence. functional RMA. or protein. The target gene is not essential for replicon replication. ~'~dditionallv. target genes may compri:~e natiu:
non-viral genes inserted into a non-native organism. or chimeric genes and v~ill be_ under the control of suitable regulatory sequences. Thus. the regulatory sequences in the target gene may come from any source. includinb the virus. Target genes may include coding sequences that are either heterologous or homologot s to the I 0 genes of a particular plant to be transformed. However, target genes do not include native viral genes. Typical target genes included but are not limited to genes encoding a structural protein, a seed storage protein, a protein that conveys herbicide resistance, and a protein that conveys insect resistance. Proteins encoded by target genes are known as ''foreign proteins". The expression of a 1 ~ target gene in a plant will typically produce an altered plant trait.
The term "altered plant trait'' means any phenotypic or genotypic chan~~e in a transgenic plant relative to the wildtype or non-transgenic plant host.
"Transcription Stop Fragment" refers to nucleotide sequences that contain one or more regulatory signals. such as polyadenylation signal sequences, capable 20 of terminating transcription. Examples include the 3' non-regulatory regions of genes encoding nopaline synthase and the small subunit of ribulose bisphosphate carboxylase.
"Translation Stop Fragment' refers to nucleotide sequences that contain one or more regulatory signals. such as one or more termination colons in all ?~ three frames, capable o: terminating translation. Insertion of translation stop fragment adjacent to or near the initiation colon at the ~' end of the coding sequence will result in no translation or improper translation. Excision of the translation stop fragment by site-specific recombination will leaves a site-specific sequence in the coding sequence that does not interfere with proper translation 30 using the initiation colon.
"Blocking fragment" refers to a DNA fragment that is flanked by site-specific sequences that can block the transcription and/or the proper translation of a coding sequence resultin'; in an inactive transgene. When the blocking fragment contains polvadenylation signal sequences and other sequences encoding 3~ regulatory signals capable of terminating transcription it can block the transcription of a coding sequence when placed in the 5' non-translated region, i.e.. between the transcription start site and the ORF. When inserted in the coding sequence a blocking fragment can block proper translation bv_ disrupting its open reading frame. DNA rearrangement by site-specific recombination can restore transcription and!or proper translatability. For example. excision of the blocking fragment by site-specific recombination leaves behind a site-specific sequence that allov~~s transcription and/or proper translatability. A Transcription or Translational Stop Fragment «-ill be considered a blocking fragment.
The terms "in ci.s~" and "in craps°' refer to the presence of DNA
elements.
such as the viral origin of replication and the replication proteins) gene. on the same DNA molecule or different DNA molecules. respectively.
The terms "cis-acting sequence' and ''cis-acting element'' refer to DNA or R~IA sequence. whose function require them to be on the same molecule. An example of a ci.s-acting sequence on the replicon is the viral replication origin.
The terms "~rans-acting sequence' and "traps-acting element'' refer to DNA or RNA sequences. whose function does not require them to be on the same molecule. Examples of traps-acting sequence is the replication gene IACI or I ~ in ACMV or TGMV geminiviruses, respectively). that can function in replication without being on the replicon.
"Cis-acting viral sequences" refers to viral sequences necessary for viral replication (such as the replication origin) and in cis orientation.
"Transactivating gene" refers to a gene encoding a transactivating protein.
It can encode a viral replication proteins) or a site-specific replicase. It can be a natural gene, for example. a viral replication gene, or a chimeric gene. for example, when plant regulatory sequences are operably-linked to the open reading frame of a site-specific recombinase or a viral replication protein.
''Transactivating genes" may be chromosomally integrated or transiently ?s expressed.
"Episome'~ and "replicon" refer to a DNA or RNA virus or a vector that undergoes episomal replication in plant cells. It contains cis-acting viral sequences, such as the replication origin, necessary for replication. It may or may not contain traps-acting viral sequences necessary for replication, such as the viral 30 replication genes lfor example. the ACI and AL1 genes in ACMV and TGM~' geminiviruses. respectively). It may or may not contain a target gene for expression in the host plant.
"Inactive replicon~~ refers to a replication-defective replicon that contains cis-acting viral s:aue!~ces. such as the replication origin, necessary for replication 3 > but is defective in replication because it lacks either a functional viral gene necessary for replication and!or the ability to be released from the chromosom°
due to its DNA arrangement involving site-specific recombination sequences.
Consequently. an inactive replicon can replicate episomally only when it is ~i provided with the essential replication protein in traps, as in the case of geminivirus proreplicon. or when its non-functional replication gene is rendered functional by site-specific recombination with or without release of the active replicon DN.A from the chromosome. "Activation of replicon replication' refers to the process in which an inactive replicon is rendered active for episomai replication. _ "FIoxed replicon'' refers to a replicon flanked by tandemly (i.e., directly, repeated) site-specific sequences. The replicon can be a full length copy of a DNA virus or RNA virus amplicon. The replicon is excised as LNA following site-specific recombination.
"Episomal replication' and "replicon replication'' refer to replication of DNA or, RNA viruses or virus-derived replicons that are not chromosomally-integrated. It requires the presence of viral replication proteins) essential for replication, is independent of chromosomal replication, and results in the I ~ production of multiple copies of virus or replicons per host genome copy.
"Autonomous" or ''cis'' replication refers to replication of a replicon that contains all cis- and traps-acting sequences (such as the replication gene) required for replication.
"Replication origin" refers to a cis-acting replication sequence essential for viral or episomal replication.
"Proreplicon" refers to an inactive replicon that is comprised of cis-acting viral sequences required for replication, and flanking sequences that enable the release of the replicon from it. It is integrated into a bacterial plasmid or host plant chromosome and may contain a target gene. Proreplicon lacks a gene 2~ encoding a replication protein essential for replication. Therefore. it is unable to undergo episomal replication in the absence of the replication protein. Its replication requires both release from the integration and the presence of the essential replication gene ijr traps. The release from integration can be triggered in different ways. For example, the proreplicon can be present as a partial or 30 complete tandem duplication. such that a full-length replicon sequence is flanked by virus sequences and such that the duplicated viral sequence includes the viral replication origin. Thus. in this case, the proreplicon serves as a master copy from which replicons can be excised by replicational release in the presence of replication proteins) [Bisaro, David. Recombination in geminiviruses:
3~ Mechanisms for maintaining genome size and generating genomic diversity.
Homologous Recomb. Gene Silencing Plants (1.994), 219-70. Editor(s):
Paszkowski, Jerzy. Publisher: Kluwer. Dordrecht. Germany]. Alternatively, the proreplicon can be excised by site-specific recombination between sequences flanking it in the presence of an appropriate site-specific recombinase (as described in site-specific recombination systems. such as Cre-lox and FLP/FRT
systems. Odell et al. Use of site-specific recombination systems in plants.
Homologous Recomb. Gene Silencing Plants (1994). 219-70. Editor(sl:
Paszkowski. Jerzy. Publisher: hluwer, Dordrecht. Germanyj. In the case of RNA virus proreplicons. the amplicon sequences flanking the inactive replicon, -which include regulatory sequences. allow generation of the replicon as R~IA
transcripts that can replicate in traps in the presence of replication protein. These regulatory sequences can be for constitutive or regulated expression.
10 "Viral replication protein" and "replicase" refer to the viral protein essential for viral replication. It can be provided in tran.s to the replicon to support its replication. Examples include viral replication proteins encoded by ACl and ALl genes in ACMV and TGMV geminiviruses. respectively. Some viruses have only one replication protein: others may have more than one.
1 ~ "Replication gene" refers to a gene encoding a viral replication protein.
In addition to the ORF of the replication protein, the replication gene may also contain other overlapping or non-overlapping ORF(s) as are found in viral sequences in nature. While not essential for replication. these additional ORFs may enhance replication and/or viral DNA accumulation. Examples of such 20 additional ORFs are AC3 and AL3 in ACMV and TGMV geminiviruses, respectively.
"Chimeric traps-acting replication gene" refers either to a replication gene in which the coding sequence of a replication protein is under the control of a regulated plant promoter other than that in the native viral replication gene or a modified native viral replication gene. for example. in which a site-specific sequence(sl is inserted in the s' transcribed but untranslated region. Such chimeric genes aiso include insertion of the known sites of replication protein binding between the promoter and the transcription start site that attenuate transcription of viral replication protein gene.
s0 "Chromosomally-integrated" refers to the integration of a foreign gene or DNA construct into the host DNA by covalent bonds. ~~'here genes are not "chomosomally integrated" they may be "transiently expressed". Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but is function independently. either as part of an autonomously replicating plasmid or expression cassette for example. or as part of another biolo<~icai system such as a virus.
"Production tissue' refers to mature, harvestable tissue consisting of non-dividing, terminally-differentiated cells. It excludes young, growing tissue consisting of germline. meristematic. and not-fully-differentiated cells.
''Germiine cell." refer to cells that are destined to be gametes and whose genetic material is heritable.
''T'rans-activatiou~ refers to switching on of gene expression or replicon -replication by the expression of another (regulatory) gene in tran.s.
"Transformation" refers to the transfer of a foreign gene into the genome of a host organism. Examples of methods of plant transfoartation include 10 Agrobacterium-mediated transformation (De Blaere et al. (1987) Meth.
Enrymol.
143:?77j and particle-accelerated or "gene gun" transformation technology (Klein et al. ( 1987) Nature (London) 327:70-73; U.S. Patent No. 4,94,050). The terms ''transformed". "transformant" and "transgenic" refer to plants or calli that have been through the transformation process and contain a foreign gene integrated into 1 ~ their chromosome. The term "untransformed" refers to normal plants that have not been through the transformation process.
"Transiently transformed" refers to cells in which transgenes and- foreign DNA have been introduced (for example. by such methods as a~robacterium-mediated transformation or biolistic bombardment), but not selected for stable 20 maintenance.
"Stably transformed'' refers to cells that have been selected and regenerated on a selection media followin; transformation.
"Transient expression" refers to expression in cells in which virus or transgene is introduced by viral infection or by such methods as agrobacterium-25 mediated transformation. electroporation. or biolistic bombardment. but not selected for its stable maintenance.
"Genetically stabl;: ' and "heritable'' refer to chromosomallv-integrated genetic elements that are stably maintained in the plant and stably inherited by progeny through successive generations.
30 ''Primaw transformant'' and "TO generation" refer to transgenic plants that are of the same genetic generation as the tissue which was initially transformed (i.e.. not having gone through meiosis and fertilization since transformation).
"Secondan~ transformants" and the ''T1, T?. T3, etc. generations'' refer to transgenic plants derived from primar~~ transformants through one or more meiotic 3~ and fertilization cycles. They may be derived by self fertilization of primary or secondary transformants or crosses of primary or secondary transformants with other transformed or untransformed plants.
-,-1 WO 00/17365 PC'TIUS99/21989 "Wild-type~~ refers to the normal gene. virus, or organism found in nature without anv knov~m mutation.
"Genome" refers to the complete genetic material of an organism.
The term "dimes ~ when used in reference to the eeminivirus B ~enome refers to at least one partial or complete tandem copy of the B genome. As used herein 'dimes' therefore refers to partial or complete tandem dimes of a -geminivirus genome. such that a single replicon is flanked by cis-acting viral sequences. including the replication origin. necessary for viral replication.
'these geminivirus dimers can serve as master copies from which replicons can be i 0 excised by replicative release in the presence of the replication protein in traps (Bisaro. David. Recombination in geminiviruses: Mechanisms for maintaining genome size and generating genomic diversity. Homologous Recomb. Gene Silencing Plants (19941. 219-70. Editor(sj: Paszkowski. Jerzy. Publisher:
Kluwer. Dordrecht. Germany).
1 s "TopCross~ high oil corn seed method" refers to a commercial method of making hybrid corn seeds in the field, as described. for example. in U.S.
Patent No. 5.704,160.
The invention provides a two-component, expression system in transgenic plants. Both components are chromosomally-integrated and. thus, stably 20 maintained by themselves.
In one embodiment of the invention. one component is an inactive replicon carrying site-specific sequences) that is unable to replicate by itself. The second component is a chimeric site-specific recombinase gene in which the coding sequence of a site-specific recombinase is operably-linked to a regulated promoter. Expressing the recombinase under appropriate stimulus will result in recombination between the cognate wild-type or mutant site-specific sequences in or around the inactive replicon which will activate release of the replicon ancL' replicon replication.
In yet another embodiment of the invention, one component is an inactive 30 transgene cam~ing site-specific sequences) and the second component is a chimeric transactivating gene in which the coding sequence of a site-specific recombinase is operable-linked to a regulated promoter. Expressing the recombinase under appropriate stimulus will result in recombination between the cognate vwild-teoe or mutant site-specific sequences in or around the inacti~
a transgene vwhich will activate transgene expression, without involvin~~ viral replication.
Thus. repiicon replication and/or transgene expression can be targeted to specific plant cells by controlling the expression of replication proteini s) or recombinase to those cells. Plants will be most sensitive to cellular toxicity andior the detrimental effect of replicon replication and/or the expression of the transgene or replication gene in early stages of plant growth and differentiation that involve cell division and differentiation. 'Thus. controlling such expression entirely or largely to non-dividing. terminally-differentiated cells will reduce the detrimental effect of replicon replication on plant growth and development. Examples of such terminally-differentiated cells are those in production tissue and include, but are Ilot limited to, the storage cells of seed and root tissues and mature leaf cells.
This invention provides for a regulated. tr ~nsgenic expression system.
10 Since the components of this system are stably transformed, this invention solves the problem of episomal instability through cell divisions, since episomes are unstable in the absence of selection. When recombination between site-specific sequences in an inactive replicon or inactive transgene activates its replication or transgene expression, respectively, the system will be heritable unless the site-1 > specific recombination involves DNA excision in eern~ line cells.
The replicon will. be cell-autonomous. if the necessary viral movement proteins) are not expressed in the cell. This is the case using only DNA A of geminiviruses or in using PVX with a mutation in a movement protein. The replicon will spread cell-to-cell systemically, if the necessary viral movement 20 proteins) are also expressed in the cell.
Transgenic plants with different constructs will be selected and regenerated into plants in tissue culture by methods known to one skilled in the art and referred to above. The ability of a transactivating chimeric site-specific recombinase gene to activate an inactive replicon in plant chromosome into ?s replication via site-specific recombination will be tested following one of the follow~in~ methods:
infecting the transgenic plants carrying the inactive repiicon with viruses carrying the Cre gene, crossinc plants where one parent contains the correctly regulated s0 chimeric Cre gene and the other the inactive replicon.
3. making two agrobacterium strains containing binary vectors with different plant selectable markers, one containing a chimeric Cre gene under the control of an appropriately regulated promoter and the other the inactive replicon.
The two components can be introduced into plants together by co-transformation 3 ~ or by sequential transformations.
Replication in transgenic plant tissue will be monitored by reporter gene expression or analysis of viral nucleic acids by Southern blot in the case of DNA
viruses and by Northern blot in the case of RNA viruses.
~6 WO 00/17365 PCT/US99/2i989 Site-specific Recombination for Conditional Expression of Transeenes Use of developmentally-regulated or chemically-induced promoters for conditional transgene expression is usually limited either by their insufficient strength in the 'fully-on~ stage or. more often. by their basal non-specific (i.e..'leaky- expression) in the 'off stage, depending on the application.
One can increase both the level and specificity of conditional expression -by putting the coding sequence of the gene of interest under the control of a strong constitutive or regulated promoter for expression in the production tissue in such a manner that the gene is transcriptionally inactive unless it undergoes a site-10 specific recombination through the conditional expression of the cognate site-specific recombinase. Thus. conditional expression of the gene of interest is now dependent on the conditional expression of the recombinase. In this manner, determinants for high-level expression and for specificity are separated and one can then focus on the basal non-specific (i.e.. 'leaky) expression of recombinase.
1 ~ Since the levels of the recombinase enzyme required are not expected to be high, several 'specific promoters can be used that may otherwise be too weak to express the gene of interest. Furthermore, since site-specific recombination depends on a threshold level of the recombinase. there may be a tolerance for leaky transcription that results in sub-threshold levels of recombinase.
20 Furthermore, increased 'tissue-selectivity' to available regulated promoters is provided by decreasing the efficiency of wild-type Cre-mediated recombination, raising the threshold of recombinase required by using either a mutant site for site-specific recombination and/or a mutant recombinase that are not proficient in recombination. Such mutants are well known. at least for the Cre-lox system.
25 The applicants have shown that when using safener-inducible Cre expression to activate the expression of a transgene (35S:luciferase j. the use of a mutant lox sit:
(1ox72) and a wild type lox P site in Cre-mediated activation of the transgene reduces the basal activity of the promoter compared to using both wild type lox P
sites.
s0 The non-specificity of recombinase expression can be further reduced (i.e..
its expression specificity further increased) by other post-transcriptional approaches including: -1. using a chimeric recombinase gene that is poorly translated (such as having a non-ideal context sequence around the initiation codor 3~ followine Itozak's rule or having additional short ORFs in the ~' untranslated region as in yeast GCN4 mRNA, or having 3' UTR
sequences that makes mRNA unstable as described by Pamela Green -"
(Department of Biochemistry. Michigan State University. East Lansing. MI 4$824-131?, U.S.A.) '_'. using a mutant recombinase that has less cellular stability (i.e..
shorter half life). Such mutants could be made by adding PEST sequences ~Sekhar Et al...lnl. Receptnn SignG~l Tran.scxuctinn Res. 18 (2-3), I 13-13? (1998)]. _ Once a system is developed in a given crop. it can be easily adapted for conditional expression of a variety of target trait genes with or without involvement of replicon.
Furthermore, replicon replication is expected to achieve high-level expression of target genes through gene amplification that is heritable. In addition, high-level transcription from these vectors may be used for gene silencing by antisense inhibition or co-suppression.
The invention further encompasses novel recombinant virus constructs I ~ including transfer vectors and methods for making them and using them.
Vvhen used to transform a plant cell the vectors provide a transgenic plant capable of regulated, high-level expression though gene amplification. This regulated expression could be in response to a particular stimulus, such as the development stage, wounding of the plant (for example, by insect attack or pathogen). an environmental stress (such as heat or high salinityj, or chemicals that induce specific promoters. Plants in which particular tissues and/or plant parts have a new or altered phenotype may be produced by the subject method.
The constructs include vectors. expression cassettes and binary plasmids depending upon the intended use of a particular construct. Two basic DIvTA
2~ constructs are required which may be combined in a variety of ways for transforming a plant cell and obtaining a transgenic plant. For agrobacterium-mediated transformation. the inactive replicon and chimeric replication gene may be combined in one binary plasmid or the two may be introduced into a cell on separate binary plasmids by either co-transformation or sequential transformations. Alternatively, the two constructs may be combined by crossing two transgenic lines containing one or the other construct.
The termination region used in the target gene in the inactive replicon as well as in the chimeric replication protein gene will be chosen primarily for convenience, since the termination regions appear to be relatively interchangeable.
3~ The termination region which is used may be native with the transcriptional initiation region. may be native with the DNA sequence of interest. or may be derived from another source. The termination region may be naturally occurring, or wholly or partially synthetic. Convenient termination regions are available ?8 from the Ti-plasmid of ~l. rumefaciens. such as the octopine synthase and nopaline svnthase termination regions or from the genes for [3-phaseolin. the chemically inducible lant gene. pIN (Hershey et al.. Isolation and characterization of cDNA
clones for RNA species induced by substituted benzenesulfonamides in corn.
Plant ~Lfol. Biol. ( 19911. 17(4 i. 679-90; U.S. Patent No. 5.364.780).
The Constructs: -In one aspect of the invention. a novel system of transaetivatin~T replication of plant viruses is developed using a site-specific recombination system. The system has the advantage of better tolerating non-specific basal expression {i.e., leakiness) of 'regulated" promoters and provides a more stringent control of transactivation. Furthermore. when a properly regulated site-specific recombination is developed. it can be applied generically to the activation of inactive replicons of different viruses as well as for transactivating expression of trans~enes without replicon. The non-specific expression (i.e.. ieakiness) of some available regulated promoters expressing a site-specific recombinase (such as Cre recombinase) will be more readily tolerated by the plants since the recombinase has to reach a threshold level before it can effect recombination [(Araki et al..
Targeted integration of DNA using mutant lox sites in embryonic stem cells.
Nucelic ,Acids Res. 25:868-872 (1997)]). The 'specificity' of the promoters can be further increased by increasing the threshold level of the recombinase required by using either known mutant recombinase proteins, as described for Cre [Abremski, K., et al.. Properties of a mutant Cre protein that alters the topological linkage of recombination products. J. AToI. Biol. 202:59-66 ( 19881: Wierzbicki et al.. A
mutational analysis of the bacteriophage P 1 recombinase Cre.. J a~lol. Bio?.
195:785-94 ( 1987) and/or mutant site-specific sequences. such as lox P sites [Albert et al.. Site-specific integration of DNA into wild-type and mutant lox sizes placed in the plant genome. Plant J. 7:659-59 (1995)], that render recombination less proficient than its wild-type site-specific recomination system and, thus.
requires a higher level of the recombinase.
In this system. the inactive replicon construct contains wild-type or mutant site-specific sequences within or flanking the replicon. Recombination between the site-specific recognition sequences makes the replicon active and activates replicon replication. When the site-specific sequences are directly oriented (i.e..
are in tandeml. site-specific recombination will result in excision of the D\.~, between the site-specific sequences (Figures 1 and ~). When they are in an inverted orientation {i.e.. in head-to-head or tail-to-tail orientation). site-specific recombination will result in inversion of the DNA between the site-specific sequences (Figure ?).
'_' 9 In another embodiment (Figure 1 ), the inactive replicon construct comprises a single copy of the replicon (either a geminivirus replicon or RIvTA
virus ampliconl flanked by tandem site-specific sequences and integrated in the chromosome. In this integrated state the replicon is inactive and unable to replicate. Site-specific recombination will excise the single copy of the replicon containing a single site-specific sequence that is capable of replication.
When the replicon is inserted between the site-specific sequences at a site that is between the transcription start site and the open reading frame (i.e., in the S' transcribed but untranslated region of the repli~~ation gene), the replication gene is non-functional 10_ and the site-specific recombination also reconstitutes the functional replication gene (Figure ?). When the RNA amplicon is inserted between the promoter and its transcription start site, the RNA replicon is not transcribed and the site-specific recombination excises the amplicon from the chromosome as well as reconstitutes a functional aamplicon. In either case, site-specific recombination removes the 1 ~ replicon from the chromosome. which is preferable when avoiding virus-induced gene silencing. When the replicon is flanked by two tandem lox sites, it is refered to as a 'lloxed replicon'. The floxed replicon may be integrated within a reporter gene such that it serves as a Transcription Stop Fragment and blocks proper transcription of the reporter gene. Site-specific recombination will excise the 20 replicon and reconstitite a functional reporter gene. Such reporter gene will be useful in developing screening plants for a properly regulated Cre-lox activation system. It is preferable that a Transcription Stop Fragment is inserted near the floxed amplicon to prevent inadvertant transcription of the replication gene from sequences adjacent to the floxed amplicons, such as the context plant DNA in transgenic plants. However, it is not required that the insertion of the floxed replicon in a gene or a Transcription Stop Fragment be inserted, as long as the replication gene is not ey.essed in its integrated state. Inactivating the replication gene in the inactive replicon is important when its expression is detrimental to plant d:velopment.
30 As has been noted. gene silencing is an important obstacle in plant transgene expression and the present expression and replication systems may be modified to address this problem. Recently, pathogenicity determinants Pl-HC-Pro and HC-Pro polypeptides of Tobacco Etch Virus and 2b protein of Cucumber Mosaic t% irus were shown to suppress gene silencing in plants of 3 ~ transgenes and/or RNA virus genes [Anandalakshmi, R., Pruss. G. J., Ge, X..
Marathe, Pv., Mallory. A. C.. Smith, T. H.. Vance. V, B.: A viral suppressor of gene silencing in plants. Proc. Natl. Acad. Sci. G'. S. M. 9:13079-13084 ( 1998):
Brigneti, G.. Voinnet. O.. Li. W.-X., Ji. L.-H.. Ding. S.-W.. Baulcombe. D.
C.:
Viral pathogenicity determinants are suppressers oftransgene silencing in Nicotiana hetTrhamiana. EATBO J. 17:6739-6746 ( 1998); Carrington. J. C., Whitham. S. A.: Viral invasion and host defense: strategies and counter-strategies. Ctrrr Opin. Plant Biol. 1:336-341 ( 1998): Vance, V. B.. Pruss. G.
J..
Carrington. J.. Martin, L.. Dawson. W. O.: Potyvirus booster sequence and helper component proteinase for enhancing expression of a foreign or endogenous gene -product in plants. PCT lnt. Appl. WO 9844097 (1998)]. However, constitutive expression of such silencing suppressers in transgenic plants will be detrimental to plants, since it will constitutively suppress gene silencing. a fundamental plant 10 process. This detrimental effect is especially strong in conjunction with viral vectors. since the above silencing suppressers also increase viral pathogenicity. In fact, plants infected with Potato Virus X containing HC-Pro showed severe symptoms. necrosis and stunting, while those infected with 2b protein became highly necrogenic and died in 3 weeks [Brigneti. G.. Voinnet. O.. Li, W.-X., Ji.
1~ L.-H.. Ding. S.-W.. Baulcombe. D. C.: Viral pathogenicitv determinants are suppressers of transgene silencing in Nicotiana benthamiana EATBO J.
17:6739-6746 (1998)]. Therefore. localized and/or regulated expression of these silencing suppressers in production tissue of transgenic crops will be critically important for their practical application in increasing viral vector replication 20 and/or for higher level gene expression, especially foreign protein production.
Applicant has observed that TGMV-B genome can also suppress virus-induced gene silencing. For example. when leaves of transgenic tobacco plants transformed with T-DNA containing floxed TGMV genome A in which the coat protein ORF was replaced with GUS ORF were co-bombarded with 3~S:Cre gene '_'> and a dimer of TGMV-B aenome show sianificantlv higher expression of the GUS than those transformed with 3~S:Cre gene alone. Furthermore, co-bombardment of wild type Nicotiana benthamiana with PVX-GFP and TGMV-B
resulted in longer persistence of GFP activity than when bombarded with PVC-GFP along. The applicant has discovered that infection of wild type 30 Nicotiana benthamiana plant with TGMV carrying GFP resulted in GFP
expression that did not fade or silence for at least 2 months. This infection was achieved by biolistic co-bombardment of two plasmids, collectively referred here to as 'TGMV-GFP dimers~. one containine a partial dimer of TGMV-A-GFP. in which the coat protein ORF is replaced with that of briehter (mutant) form of GFP. and one containin~~ a partial dimer of wild type TGMV-B. Furthermore. the applicant has discovered that TGivIV-GFP expression was similarly persistent in plants that were silenced for PVX-GFP expression. For this. transgenic .fir. berrthamiar7a plant. desienated 714B-LL 1. containing an inactive RNA
virus WO 00!17365 PCT/US99/21989 PVX-GFP ampiicon was used. These transgenic plants do not express any GFP
because the inactive form of PVX-GFP is unable to replicate unless it undergoes Cre-lox mediated site-specific recombination. When line 714B-LL1 is bombarded with 3~S:Cre gene. it results in activation of PVX-GFP replication and GFP
expression that is silenced in about ? weeks. When such a silenced 714B-LL1 plant was infected with 'TGMV-GFP dimers'. GFP expression from TGMV-GFP. -which is distinguishable from that in PVX-GFP by its brighter fluorescence, persisted as long as in untransformed control. Moreover. when line 714B LL-1 was co-bombarded wit'i 35S:Cre and 'TGMV-GFP dimers', GFP expression from TGMV-GFP persisted as long as in untransformed control and beyond the time GFP from PVX-GFP was silenced. Since, the expression of a foreign gene in TGMV in the presence of TGMV-B is persistent and not silenced with time, TGMV-B may be used to enhance high level expression by suppressing silencing of transgenes present in viral vectors. It is anticipated that ail geminiviruses have 1 ~ such silencing suppressor activity, whether with monopartite or bipartite genome.
It is likely that this persistent expression of foreign gene in grminivirus results is derived from the geminivirus movement. The silencing suppressor activity of geminivirus genome B can be used in different ways. TGMV-B genome can be transformed into the host plant chromosome by one skilled in the art and 20 combined with the cognate proreplicon or floxed genome-A. For example, TGMV-B genome can be present in its entirety as a partial dimer in the chromosome or its replication and expression may also be under the controlled activation by site-specific recombination. When present as a diner, it may suppress silencing with or without its replication. For the former.
replication may ?> be transactivated directly by the expression of the replication proteins under the control of a regulated promoter or indirectly by the activation of an inactive genome A via site-specific recombination. As an alternative to using the entire genome B. one could identify the silencing suppressor gene in genome B and use it to enhance foreign gene expression. Since TGMV-B has only two large ORFs.
~0 BL1 and BRl. which encode viral movement proteins, one skilled in the art can readily identify v~rhich ORF(s) is a silencing suppressor. For example leaves may be co-bombarded with 3~S:Cre and TGMV-B diner with mutant BR1 (or PVX:BL1 chimeric gene) or 3~S:Cre and TGMV-B diner with mutant BLl (or PVX:BRI chimeric gene) and the relative expression of GtJS expression measured. The identified silencing suppressor gene may then be used for enhancing transgene expression.
Regulated expression of silencing suppresser genes can be achieved by putting them under the control of appropriately regulated promoters or.
preferably.
3'' by regulated activation by site-specifc recombination. Thus. in one embodiment of the invention chimeric silencing suppressers genes will be Cre-activated.
However. it would be most desirable to have the activation of both viral expression system and silencing suppresser gene expression under a common control ensuring simultaneous viral replication and suppression of gene silencing for high level viral replication and for producing high levels of foreign proteins. -Thus. in another embodiment of this invention. conditional viral replication system will incorporate a conditional expression of a silencing suppresser gene.
For example referring to Figure 1. element A could be a plant promoter, such as 35S promoter. element B could be an inactive RNA virus-derived amplicon that also serves as a transcriptional and/or translational Stop fragment of element C.
and element C is the ORF of silencing suppresser gene, such PI-HC-Pro. HC-Pro.
or the 2b protein (as described above) and 3' untranslated region. Regulated site-specific recombination will activate at the same time the excision and replication 1 ~ of the RNA viral replicon and expression of the silencing suppresser Gene under the control of the promoter in element A. Similarly. referring to Figure 1, element A could be a plant promoter. such as 35S promoter. element B could be an inactive geminivirus-derived replicon that also serves as a transcriptional and/or translational Stop fragment of element C. and element C is the ORF of silencing suppresser gene from TGMV-B genome~nd 3' untranslated region. Regulated site-specific recombination will activate at the same time the excision and replication of the geminivirus viral replicon and expression of the geminivirus silencing suppresser gene under the control of the promoter in element A.
Alternatively. the silencing suppresser gene can be expressed as a target '?i ~Tene on an inactive replicon. For example. inactive PVX amplicons with lox sites as described above (Figures 2 and 3l will contain in addition of the target gene of interest a silencing suppresser gene under the control of viral promoter. The target gene of interest and silencing suppresser gene in the virus replicon could be present either as tandem genes under the control of duplicated viral CP
promoter or as a N- or C-terminal protein fusion with the target protein, as described by jAnandalakshmi. R.. Pruss. G. J., Ge,1.. Marathe, R., Mallory. A. C., Smith.
T. H.. Vance. V. B.: A viral suppressor of gene silencing in plants. Proc.
.~~atl.
.-lcad. Sci. L'. S. A. 9:13079-13084 (1998)]. In transgenic plants. such virus-based vectors may or may not be capable of systemic spread. For example. in geminivirus-based replicons the coat protein ORF mar' be replaced by that of a silencing suppresser gene. Insert size limitation in replicons can be circumvented by having 2 replicons. one carrying the silencing suppresser gene and the other target Gene of interest.
In another embodiment, the transcription of an essential replication gene(s;i of a replicon is blocked by a Transcription Stop Fragment flanked by tandem site-specific sites and site-specific recombination excises the Transcription Stop Fragment leaving behind a single site-specific sequence that allows transcription of the previously blocked gene and subsequent repiicon release and replication.
For example. in TGMV and ACMV viruses, the Transcription Stop Fragment _ flanked by tandem site-specific sites may be inserted in the ~' transcribed but untranslated region of the replication gene, AC 1 (for example. at the Mfe I
site) in a viral dimer. For RNA virus amplicons, the lox site is inserted between the 10. TATA box of the promoter and the transcription start site (Figure 3).
In another embodiment, a region in or around a replicon is inverted by site-specific sequences to disrupt the replicon genome or the RNA virus amplicon.
The inverted region can be entirely within the replicon ~enome resulting in disruption of the viral genome. Site-specific recombination restores the 1 ~ organization of the replicon, including amplicon (except for the residual site-specific sequence(s)) that allows replication. Alternatively, the inversion can be in part of the replicon and/or a plant regulatory sequence of an amplicon that disrupts proper transcription of essential replication gene(s). Site-specific recombination restores proper transcription that allows replicon release and replication. __ 20 The site-specific sequences and their cognate recombinase enzymes can be from any natural site-specific recombination systems. Well-known examples include Cre-lox, FLP/FRT, R/RS, Gin/gix systems. These are described in Odell et al., Use of site-specific recombination systems in plants. Homologous Recomb.
Gene Silencing Plants ( 1994), 219-70. Editor(s): Paszkowski. Jerzv.
Publisher:
?5 Kluwer. Dordreeht. Germany).
In one embodiment of the invention (Figure 4), the basic inactive replicon construct is the proreplicon. which. in the case of a geminivirus replicon, is preferably present as a partial or complete tandem dimer in T-DNA, such that a single replicon is flanked by cis-acting viral sequences necessary for viral 30 replication. including the replication origin. These geminivirus dimers can serve as master copy from which replicons can be excised by replicative release (Bisaro.
David. Recombination in geminiviruses: Mechanisms for maintaining genome size and venerating genomic diversity. Homologous Recomb. Gene Silencing , Plants ( 1994). ? 19-70. Editor(s): Paszkowski, Jerzv. Publisher: Kluwer, 3~ Dordrecht. Germany] in the presence of the replication protein in traps.
The.
preferable source of proreplicon sequences is from a geminivirus (such as ACMV
and TGMV) in which the essential replication gene (for example, AC 1 ) is rendered non-functional by mutation (addition. rearrangement. or a partial or complete deletion of nucleotide sequences). The mutation can be in the non-coding sequence. such as the promoter, and/or it can be in the coding sequence of the replication protein so as to result either in one or more altered amino acids in the replication protein or in a frame shift. Preferentially. the mutation is a s frameshift mutation at or close to the initiation codon of the replication protein so that not even a truncated replication protein is made. 1\-lore preferably. the entire -replication tene is deleted from the proreplicon such that there is no homolog5-between the transactivating replication gene and the replicon in order to prevent virus-induced homology-based silencing of the transactivating replication gene 10 during replicon replication. In addition, the proreplicon preferentially has most or all of the coat protein gene deleted and replaced by a restriction site for cloning target gene.
In this embodiment the other basic construct is a chimeric traps-actine replication gene consisting of a regulated plant promoter operable-linked to the 1 ~ codin~l sequence of a replication protein. For ACMV and TGMV
geminiviruses.
the replication proteins are encoded by the AC1 and AL1 ORFs, respectively.
Preferably, AC2 and AC3 ORFs are included with the ACl ORF in ACMV and AL? and AL3 ORFs are included with the ALl ORF in TGMV.
In the case of RNA virus proreplicons. the amplicon sequences flanking 20 the inactive replicon, which include regulatory sequences, allow generation of the replicon as RNA transcripts that can replicate in traps in the presence of replication protein. These regulatory sequences can be for constitutive or regulated expression. Preferably, the promoter used in these amplicons will be a weak promoter in order to minimize virus-induced gene silencing [Ruiz et al..
23 (199F1 Plant Cell. ~'ol 19. pp 937-946]. Also included are the replication proteins of single-stranded RNA viruses (such as the RNA-dependent RNA polymerases) when they can support viral replication in traps (for example. Brome Mosaic Virus (BMV)).
Site-specific recombination can reconstitute a functional viral replicase 30 gene and transactivate the cis replication of the replicon. which in turn can provide the replication protein in ~rans for the replication of the proreplicon.
The skilled person appreciates that the instant expression systems (involving inactive replicon) may be used to effect regulated replication in the absence of a target Gene. In this situation forei<~n aerie expression is not the 35 object. Instead. regulating viral replication is sought. Such a system may be useful. for example, where regulated viral replication will confer viral resistance to the transgenic plant.
;;
WO 00:17365 PCT/US99/21989 More preferably, replication of RNA virus can be transactivated by either a site-specific excision of a Transcriptional Stop tiagment from the amplicon that allows normal transcription required for viral replication (Figure 3). For example, the Transcriptional Stop fragment can be placed between the promoter and viral cDNA. within the viral cDN~~. or between the viral cDNA and the 3' polyadenvlation signal. Since there is limited space between the TAT.A box and the transcription start site. overlapping part of the lox sequence with the TATA
box is preferred along with use of a deleted site-specific sequence. such as lox Dl 17 ~Abremski et ai.. J. .~lol. Biol. (1988) 202:59-66]. Alternatively, the 10 replicon can be activated by site-specific inversion between two inverted site-specific sites to result in a functional amplicon (Figure 2). These two site-specific sites can be anywhere in the amplicon as long as they do not interfere with replication following inversion. For example, one site-specific sequence can be in the ~' non-coding transcribed sequence of the GFP or GUS gene and the other in I s an inverted orientation between the enhancer and TATA box of the 3~S
promoter (Figure ?).
When replicating repIicons contain sequences homologous to chromosomal genes. the homologous gene has been reported to be silenced [Ruiz et al., (1998) Plant Cell, Vol. 19, pp 937-946]. When the promoter in the 20 amplicon is expressed constitutively and strongly (such as the 35S
promoter), ultimately replication can be silenced. Such silencing has been reported to confer resistance to infection by the virus. Homology-dependent virus resistance has been shown to be due to homology-dependent post-transciptional gene silencing [see Mueller et. al. ( 1995) The Plant Journal 7:1001-1013]. Thus. a conditional transactivation of an inactive amplicon is expected to confer resistance to infection by homologous viruses. Since such gene silencing has been reported to be dependent on mR~\'.A threshold, v~hen gene silencing is not desired, the promoters in the amplicon (Figures 2 and 3) should preferably be a weak promoter such as the minimal 3~S promot~:: to reduce the risk of their beine silenced durin<~
30 replicon replication.
Inactive repiicons may also contain a target genes) that will replicate and be expressed at an enhanced level when the replicon is transactivated to replicate.
The coding sequence in these target genes arc operabiy-linked to regulatory sequences that are of viral andior plant origin. One or more introns may be also be present in the cassette. Other sequences (including those encoding transit .
peptides. secreton~ leader sequences. or introns) may also be present in the proreplicon and replicon as desired. How to obtain and use these sequences is well-known to those skilled in the art. The target gene can encode a polypeptide - _ _ _ _ _ CA 02339595 2001-02-05 29- i 1-2000 US 009921989 of interest (for e~ca:mple, an enzyme), or a functional RNA, whose sequence results ' in antisense inhibition or co-suppression. The nucleotide sedueaces of this '.
invention may be synthetic, naturally-derived, or combinations thereof.
Depending upon the nature of the nucleotide sequence of interest, it may be desirable to synthesize the sequence with plant-preferred codons. i Target genes can encode functional RNAs or foreign proteins. Foreign proteins will typically encode non-viral proteins and proteins the: may be foreign i to plant hosts. Such foreign proteins will include, for example, enzymes for a primary or secondary metabolism in plants, proteins that confer disease or herbicide resistance, commercially useful non-plant enzyrncs, and proteins with desired properties useful in animal feed or human food. Additionally, foreign proteins encoded by the target genes will include seed storage proteins with improved nutritional properties, such as the high-sulftx 10 kD corn seed protein or ' high-sulfur zero proteins.
Regulated e.cpression of the viral replication proteins) is possible by ' placing the coding sequence of the replication protein under the control of promoters that are tissue-specific, developmental-specific, or inducible.
Several tissue-specific regulated genes and/or promoters bane been ' reported in pleats. These iz~cludc genes encoding the seed storage proteins (such ' as napin, cruciferin, .beta.-conglyclnin, and phaseolin), zain or oil body proteins (such as oleosin), or gems involved in fancy acid biosynthesis (including icy l i carrier protein, steazoyl-ACP desaturasc, and fatty acid desaturases (fad 2-1 )), and other genes exgressod during embryo development (such as $ce4, see, for example. EP 255378 and ~ridl et al,, Seed Science Research (1991) 1:209-219).
Particularly useful for seed-specific e:rpression is the pea vicilin promoter [Czako ct sl., ~LIoL Gen. Genet. (I992), 235(1}, 33-40]. Other useful prouroters for .
expression in mature loaves are those that are switched on at the onset of senescence, such as the SAG promoter from Arabidopsis [Gin et al., Inhibition of !
leaf senescence by autoregulated production of cytokinin, Science (Washington, D.C.) (1995), 270 (5244), 1986-8;.
A class of fruit-specific promoters expressed at or during anthesis through fruit developraent, at least until the beginning of ripening, is discussod in LT.S. 4,943,614. cDNA clones that are preferentially expressed in cotton fiber have been isolated [John et al_, Gcnc expression in cotton (Gossypium hirsuturn L.) fiber: cloning of the mRNAs, Proc. Natl Aced. Sci. U.S.A. (1992), 89 (13), 5769-73~. eDNA clones from tomato displaying differential expression during fivit development have been isolated and characterized [Mansson et al., Mol.
Gen.
Genet. ( 1985) AMENDED SHEET
_, _ -- --. _ . . , _ , CA 02339595 2001-02-05 200:35b-361; Slater et ai., Plant Mol Biol. (1985) 5:137-147]. The promoter for polygalacturonase gene is active in fruit ripening. The polygalacturonase gene is described in U.S. Patent No. 4,53S,050 (issued August 13,1985), U.S. Patent No. 4,769,051 (issued September 6, 1988), U.S. Patent No. 4,801,590 (issued January 31, I9$9) and U.S. Patent No. 5,147,065 (issued April 21, 1992).
Mature plastid mRNA for psbA (one of the components of photosystem II) reaches its highest level late in fiuit development, in contrast to plastid mRNAS
for other campcnents of photosystem I and I! which decline to nondetectable levels in ebromoplasts aver the onset of ripening [Piechulla et al., Plant Mol. Btol.
(I98~ 7:367-376J. Recently, cDNA clones representing genes apparently invol~cd is tomato pollen [McCornrzick et al., Tomato Biotechnology (1987) Alan R Liss, Inc., New York) and pistil (Gasser et al., Plant Celt (1989), 1: I S-24]
interactions have also txen isolated and characterized.
Other e.~camples of tissue-specific promoters include those that direct expression in leaf cells following damage to the leaf (far example, from chewing insects), in tubers (for example, patatin gene promoter), and in fiber cells (an example of a developmentally-regulated fiber cell protein is E6 [John et al., Gene expression in cotton (Gossypiurr~ hirsutum L. ) fiber, cloning of the mRNAs, Proc.
Natl. Acad Scz. U.,~~I. (1992), 89(13), 5769-73]). The E6 gene is most active in fber, although low levels of transcripts are found in leaf, ovule and flower.
The tissue-specificity of soma "tissue-specific" promott~rs may not be absolute and ~y~ be tested by one skilled in the art usiag the diphtheria toxin sequence. One can also achieve tissue-specific expression with "leaky"
expression by a combination of different tissue-specific promoter3 (Beals et al., (1997) Plam Cell, vol 9, 1527-1545). Other tissue-specific promoters can be isolated by one skilled in the art (see U.S. 5,589,379). Several inductble promoters ("gene svdtches") have been zeported. Many are described in the review by Gates [Current ppinion in Biotechnology,1996, vol. 7, 168-172; Gatz, C. Chemical control of gene expression, .4nnu. Rev. Plant Physiol. Plant Mo1 BfoL (I9971, 48, 89-108]. These include tetracycline repressor system, Lac repressor system, copper-inducible systems, salicylate-inducible systems (such as the PRIa system), giucocorticoid- [Aoyama T. et al., h=HPlant Journal (1997) vo111:C>OS-G12] and ecdysome-inducibIe systems. Also, included arc the benzene sulphonamide- (U.S. 5,364,780) and alcohol- (WO 97106269 and 'WO 97106268) 3S inducible systems and gl~atathivnc S-transferase promoters. Other studies have focused on genes inducibly regulated in zespvnsc to environmental stress or stimuli such as increased salinity, drought, pathogen, and wounding. [Graham et AMENDED SHEET
al.. J. Biol. Chem. ( 19851 260:6>j~-660; Graham et al.. .l. Biol. Chcm. ( 1985) 260:6561-654] [Smith et al.. Plarrta ( 1986) 168:94-100]. Accumulation of a metallocarboxypeptidase-inhibitor protein has been reported in leaves of wounded potato plants (Graham et al.. Biochem Biopln:s Res C'omnr ( 1981 ) 101:1164-1170].
Other plant genes have been reported to be induced methyl jasmonate.
elicitors.
heat-shock. anerobic stress. or herbicide safeners. -Regulated expression of the chimeric transacting viral replication protein can be further regulated by other genetic strategies. For example, Cre-mediated gene activation as described by Odell et al. [(1990) A~ol. Gerz Genet.
10 113:369-278]. Thus. a DNA fragment containing 3' regulatory sequence bound by lox sites between the promoter and the replication protein coding sequence that blocks the expression of a chimeric replication gene from the promoter can be removed by Cre-mediated excision and result in the expression of the traps-acting replication gene. In this case. the chimeric Cre gene. the chimeric traps-acting 15 replication gene. or both can be under the control of tissue- and developmental-specific or inducible promoters. An alternate genetic strategy is the use of tRNA
suppressor gene. For example, the regulated expression of a tRNA suppressor gene can conditionally control expression of a traps-acting replication protein coding sequence containing an appropriate termination codon as described by 20 Ulmasov et al. [(1997) Plant Molecular Biology, vol 35, pp 417-424]. Again.
either the chimeric tRNA suppressor gene, the chimeric transacting replication gene. or both can be under the control of tissue- and developmental-specific or inducible promoters.
One skilled in the art recognizes that the expression level and regulation of 2~ a transgene in a plant can vary significantly from line to line. Thus. one has to test several lines to find one with the desired expression level and regulation.
Once a line is identified with the desired regulation specificity of a chimeric Cre transgene, it can be crossed with lines carrying different inactive replicons or inactive transeene for activation.
30 A variety of techniques are available and knomm to those skilled in the an for introduction of constructs into a plant cell host. These techniques include transformation with DNA employin, A. tumefacien.s or ,~. rhizogenes as the transforming anent. electroporation. particle acceleration. etc. [See fer example.
EP ?9~9s9 and EP 168:41 ]. It is particularly preferred to use the binar< type 3~ vectors of Ti and Ri plasmids of:lgrobacterium sPp. Ti-derived vectors transfornl a wide variety of higher plants. including monocotyledonous and dicotv ledonous plants. such as soybean. cotton. rape. tobacco. and rice [Pacciotti et al.
(1985) BiolTechnolo~a 3:241. Bvrne et al. (1987) Plant Cell. Tissue acrd Organ Culture ;9 8:3; Sukhapinda et al. ( 1987) Plant ;tlol. Biol. 8:209-216: Lorz et al. ( 1985) nTol.
Gen. Genet. 199:178: Potrvkus ( 1985) A~lol. Gen. Genet. I 99:183; Park et al..
,I Plant Biol. ( 1990, 38(4 ~. 365-7I : Hiei et al.. Plant J. ( 1994). 6:271-282]. The use of T-DNA to transforni plant cells has received extensive study and is amply described (EP 1?0~16: I-loekema. ln: The Binary Plant t%ector System. Offsec-drukl:erij Kanters B.V.: Alblasserdam ( 1985), Chapter V, Knauf, et al..
Genetic -Analvsis of Host Range Expression by Agrobacteritrm In: Molecular Genetics of the Bacteria-Plant Interaction. Puhler, A. ed., Springer-Verlag, New York.
1983.
p. 245: and An, et al.. EMBO J. ( 1985) 4:277-284]. For introduction into plants, the chimeric genes of the invention can be inserted into binary vectors as described in the examples.
Other transformation methods are available to those skilled in the art, such as direct uptake of foreign DNA constructs [see EP 295959]. techniques of electroporation [see Fromm et al. ( 1986) Nature (London) 319:791 J or high-1 ~ velocity ballistic bombardment with metal panicles coated with the nucleic acid constructs [see Kline et al. ( 1987) Nature (London) 327:70, and see U.S.
Patent No. 4,945,050). Once transformed, the cells can be regenerated by those skilled in the art. Of particular relevance are the recently described methods to transform foreign genes into commercially important crops, such as rapeseed [see De Block 20 et al. ( 1989) Plant Pllvsiol. 91:694-701 ], sunflower [Everett et al. ( 1987) BiolTechnology~ 5:1201 ], soybean [McCabe et al. (1988) BiolTechnology 6:923;
Hinchee et al. ( 1988) BiolTechnology 6:915; Chee et al. ( 1989) Plant Physiol.
91:1212-1218; Christou et al. (1989) Proc. ~Vatl. Acad. Sci US9 86:7500-7504;
EP 301749]. rice [Hiei et al.. Plant J. (1994). 6:271-282]. and corn [Gordon-Kamm et al. (1990) Plant Cell 2:603-618: Fromm et al. (1990) Biotechnolog,-8:833-839].
Transeenic plant cells are then placed in an appropriate selective medium for selection of trans~~enic cells which are then grown to callus. Shoots are grown from callus and plantlets generated from the shoot by erowin~ in rooting medium.
30 The various constructs normally will be joined to a marker for selection in plant cells. Conveniently, the marker may be resistance to a biocide (particularly an antibiotic such as kanamycin. 6418, bleomycin. hygromycin. chloramphenicol.
herbicide. or the like). The particular marker used will allow for selection of transformed cells as compared to cells lacking the DNA which has been 35 introduced. Components of DNA constructs including transcription cassettes of this invention may be prepared from sequences which are native (endogenous) or foreign (exogenous) to the host. By "foreign ' it is meant that the sequence is not found in the wild-type host into which the construct is introduced.
Heterologous constructs will contain at least one region which is not native to the gene from which the transcription-initiation-region is derived.
To confirm the presence of the transgenes in transgenic cells and plants. a Southern blot analysis can be performed using methods known to those skilled in the art. Replicons can be detected and quantitated by Southern blot, since they can be readily distinguished from proreplicon sequences by the use of appropriate -restriction enzymes. Expression products of the transgenes can be detected in any of a variety of ways, depending upon the nature of the product. and include Western blot and enzyme assay. One particularly useful way to quantitate protein expression and to detect replication in different plant tissues is to use a reporter gene, such as GUS. Once transgenic plants have been obtained, they may be aro~~n to produce plant tissues or parts having the desired phenotype. The plant tissue or plant pans. may be han~ested. and/or the seed collected. The seed may serve as a source for crowing additional plants with tissues or parts having the I ~ desired characteristics.
The present viral expression system has been used to demonstrate that (i) soybean and corn seed tissue will support geminivirus replication; (ii) Cre can mediate site-specific recombination in transgenic inactive replicons and inactive transgenes and that this recombination leads to high foreign protein expression andlor host gene silencing, and (iii) that the expression system will effect expression of foreign genes in tobacco.
EXAMPLES
The present invention is further defined in the following Examples. These Examples. while indicating preferred embodiments of the invention. are given by 2> way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention. and without departin<~ from the spirit and scope thereof. can make various changes and modifications of the invention to adapt it to various usages and conditions.
GENERAL MIETHODS
30 Standard recombinant DNA and molecular cloning techniques used in the Examples are well known in the art and are described by Sambrook. J.. Fritsch, E.
F. and Maniatis. T . ,~Tolecular Cloning: A Laboratory ?hfanual; Cold Spring Harbor Laboratow Press: Cold Spring Harbor. ( 1989) (Maniatis) and by T. J.
Silhaw. i~T. L. B;nnan. and L. «'. Enquist_ Experiments with Gene Fusions.
Cold Spring Harbor Laboratory, Cold Spring Harbor. N.~'. 11984) and by Ausubel. F.
I\~1. et al.. Current Protocols in A~folecular Biolo~~v. pub. by Greene Publishing Assoc. and Wilev-Interscience ( 1987).
:1 t~ ~ . ~ ~:. L 'J 'J V T . ! L~ _ !e. 1 W . ~. .. . J n . - ,.
i 29- i 1-2000 US 009921989 I
Restriction enzyme digesrions, phosphorylations, legations and transformations ' - were done as desczibed in Sambrook, J. et al., .tuPra. l2esCriction enzymes were v obtained from Nevsr England Biolabs (Boston, MA), GIBCOBRL (Gaithersburg, MD), or Pmmega (Madison, WI). Taq polymerise was obtained from Perkin ' Elmer (Branchburg, NJ). Growth media was obtained from GIBCO~B,RL ' (Gaithersburg, MD). . i the Agrobacterium tumefacie~s strain LBA4404 was obtained from br. R. Schilperoot, Leiden [Hoekema et al. Nature 303:179-I80, (1983)].
Transformation Protocols Bivlistic transformations were done essentially as described in U.S. Patent No. 4,945,050. Briefly, gold particles ( I mm in diameter) are coated with DNA
using the following technique. Ten ug of plasmid DNAs are added to 50 mL of a suspension of gold particles (60 mg per mL). Calcium chloride (50 uL of a 2.5 M
solution) and spezmidine free base (20 mL of a 1.0 M solution) are added to the particles. The suspension is vortexed dewing the addition of these solutions.
A$er 10 min, the tubes are briefly centrifuged (5 sec at 15,000 rpm} and the supernatant removed. The particles are resuspended in 200 mL of absolute ethanol, centrifuged again and the supernatant removed. The ethanol rinse is performed ' again and the particles resuspcnded in a #'unal volume of 30 uL of ethanol. An ' aliquot (S mL) ofthe I3NA-coated gold particles can be placed in tho center of a a flying disc (Bio-Red Labs, 86I Ridgeview Dr, Medina, OI-~. The particles are then accelerated into the corn tissue with a PDS-I OOOIHe (Bio-Itad Labs, 861 ;
Ridgevicw hr., Medina, OITj, using a helium pressure of 1000 psi, a gap distance of 0.5 cm arid a flying distance of 1.0 cm.
Where Agrobacterium transformations were done the proceedure was accomplished esscrniall~~ as described Park et al., J. Plant 8iot_ (1995), 38(4}, 365-71.
Construction of Floxed ACMV and TGMV Monomers pMf3~35 wan made by cloning Xba I fragment from 35SCabb:Ata (Arab ALS) into Xba I sits of pTZl8It.
Tpuetion of the wild-t~.~,e Lvx P site between the Xho I and Sac I aitcs of ~
SS
Two tandem (i.e., directly repeated) wild-type lox P sites were introduced between the Xho I and Sac I sites in tht 5' transcribed, but untranslated, region of ' 3~S promoter:GUS:3'nos chimeric reporter gene such that the two lox P sites were ' separated by an Eco RI site. For this, a Xho I-Eco RI adaptor A jmadc by ana~ealing primer pairs GV 48 (SEQ ID No: l ) and GV 49 (SE(~ ID
AMENDED SHEET
No:2)] and an Eco RI-Sac 1 adaptor B [made by annealing primer pairs GV 50 (SEQ ID No:3') and GV S1 (SEQ ID No:4)] were co-Iigated into Xho I and Sac I
digested plasmid carrying the 3~S promoter:GUS:3'nos chimeric reporter gene.
[SEQ ID No:1 ] ~'-TCG AGA TAA CTT CGT ATA ATG TAT GCT ATA
s CGAAGT TAT G-3' (GV48 ) [SEQ ID No:2] s'-A.AT TC:'~ TAA CTT CGT ATA GCA TAC ATT ATA CGA -AGT TAT C-3' (GV48) [SEQ ID No:3] 5'-AAT TCT ATA ACT TCG TAT AAT GTA TGC TAT ACG
AAG TTA TGA GCT-3' (GV50) 10 [SEQ ID No:4] 5'-CAT AAC TTC GTA TAG CAT ACA TTA TAC GA.A GTT
AT.A G-3' (GV51) The resulting plasmid was designated pGV686 and the introduced lox sites were confirmed by sequence analysis. Subsequently. the poly A signal region from nopaline svnthase (3' nos) [Genbanl: Accession Nos. J01541 V00087] was 1 ~ replaced by that tiom octopine synthase (3' ocs) (Genbank Accession Nos. V00088 and J01820] to yield plasmid pGV690.
Insertion of TGMV and ACMV monomer between the lox sites in pGV690:
A single copy of a modified ACMV (in which most of the coat protein gene is deleted) was isolated as a Mfe I fragment from plasmid pGV~96 20 (WO 99/22003) and cloned into the EcoR I site of pGV690 to yield pGV691, such --that the viral origin is adjacent to the 35S promoter.
The ability of Cre to transactivate both GUS expression and viral replication was first tested by co-bombardment of floxed viral genomes, pGV691, with plasmid pNY102 containing 3~S:Cre chimeric gene into leaves of Nicotiana 25 tabacum var.l'anthi and 1~'. benthamiana. as well as bombarding leaves of,Yanthi plants stably transformed with 3~S:Cre gene. Gus activity and replicon replication were detected only in the presence of Cre, providing evidence that Gus is a good reporter for excision. that geminivirus replication can tolerate at least one lox site, and that the expression of Cre from a chromosomally integrated 30 chimeric Cre gene can transactivate viral replication. When pGV691, pG~'~96d (a ACMV proreplicon with a mutant replication protein described in PCT Int.
Appl WO 99122003), and-pNY102 were co-bombarded, traps replication of proreplicon from pG~'~96d as well as cis replication of replicon from pGV691 was observed.
3~ The Pvu II site in pGV69l was convened into Xma I using IvTEB 1048 Sma I linker and then the Xma I-H3 fragment was cloned into pSK (Stratagene.
11011 North Torrey Pines Road La Jolla. CA 92037). Xma I-Hind III to yield pGV696. pGV699 was made by cloning a Pst I fragment from pGV697 4~
Silencing suppressor gen;.s may be of plant. non-plant. or viral origin.
Examples include. but are not limited to HC-Pro, PI-HC-Pro, and 2b proteins. Other examples include one or more genes in TGMV-B genome.
30 "Homologous to" refers to the similarity between the nucleotide sequence of two nucleic acid molecules or between the amino acid sequences of two protein molecules. Estimates of such homology are provided by either DNA-DNA or DNA-RNA hybridization under conditions of stringency as is well understood by those skilled in the art [as described in Hames and Higgins (eds.) Nucleic Acid 3~ Hybridisation. IRL Press. Oxford. U.K.] or by the comparison of sequence .
similarity between two nucleic acids or proteins.
"Amplicori ' refers to a chimeric gene in which the cDNA of a RNA virus is operationally-linked to plant regulatory sequences such that the primary transcript is the 'plus suand of RNA virus.
"Binary viral expression system" describes the expression system s comprised of two elements. at least one of which is chomosomally integrated.
The first element is an inactive replicon that may contains a target gene whose _ expression is desired in a plant or plant cell. The second element is comprised of a regulated promoter operably-linked to a transactivating gene. The first element may be a proreplicon or may be an inactive replicon. The inactive replicon or proreplicon and a chimeric transactivating gene, functioning together, will effect replicon replication and expression of a target gene in a plant in a regulated manner. Both elements of the system may be chromosomally-integrated and may be inherited independently. Stimulating the regulated promoter driving the transactivating gene releases the replicon from the chromosome and its subsequent 1 ~ episomal replication. The release can be physical excision of the replicon from the chromosome involving site-specific recombination. a replicative release from a master chromosomal copy of a proreplicon in the presence of the replication protein. or transcriptional release from a master chromosomal copy of an amplicon.
?0 "Binary transgenic viral replication system'-"-refers to a replication system comprised of two chomosomally integrated elements. The first element may be a proreplicon or may be an inactive replicon which lacks a target gene encoding a foreign protein. The second element is comprised of a regulated promoter operably-linked to a site-specific recombinase gene. The inactive repiicon and a 2~ chimeric site-specific recombinase gene. functioning together. will effect replicon replication in a plant in a regulated manner. Such a system is useful where replication of the virus is desired in a regulated manner but where no foreign gene expression is sought. For example. the regulated expression of virus may be useful in conferring resistance to a plant to viral infection.
30 "Transgene activation system" refers to the expression system comprised of an inactive transgene and a chimeric site-specific recombinase gene, functioning together. to effect transgene expression in a regulated manner.
The specifictv of the recombination will be determined by the specificity of regulated promoters as well as the use of wildtyp or mutant site-specific sequences.
Both 3~ elements of the system can be chromosomaily-integrated and inherited independently. Such site specific sequences are well hrtov,n in the art. see for example the Cre-Lox system (Sauer. B.. U.S. 4.959.317) as well as the FLP/FRT
WO 00117365 PCT/1;S99/21989 site-specific recombination system (Lyznik et al., iV.lfClL'lC ~l cids Res. ( I 993 ).
21 (4). 969-7~).
''Target gene" refers to a gene on the replicon that expresses the desired target coding sequence. functional RMA. or protein. The target gene is not essential for replicon replication. ~'~dditionallv. target genes may compri:~e natiu:
non-viral genes inserted into a non-native organism. or chimeric genes and v~ill be_ under the control of suitable regulatory sequences. Thus. the regulatory sequences in the target gene may come from any source. includinb the virus. Target genes may include coding sequences that are either heterologous or homologot s to the I 0 genes of a particular plant to be transformed. However, target genes do not include native viral genes. Typical target genes included but are not limited to genes encoding a structural protein, a seed storage protein, a protein that conveys herbicide resistance, and a protein that conveys insect resistance. Proteins encoded by target genes are known as ''foreign proteins". The expression of a 1 ~ target gene in a plant will typically produce an altered plant trait.
The term "altered plant trait'' means any phenotypic or genotypic chan~~e in a transgenic plant relative to the wildtype or non-transgenic plant host.
"Transcription Stop Fragment" refers to nucleotide sequences that contain one or more regulatory signals. such as polyadenylation signal sequences, capable 20 of terminating transcription. Examples include the 3' non-regulatory regions of genes encoding nopaline synthase and the small subunit of ribulose bisphosphate carboxylase.
"Translation Stop Fragment' refers to nucleotide sequences that contain one or more regulatory signals. such as one or more termination colons in all ?~ three frames, capable o: terminating translation. Insertion of translation stop fragment adjacent to or near the initiation colon at the ~' end of the coding sequence will result in no translation or improper translation. Excision of the translation stop fragment by site-specific recombination will leaves a site-specific sequence in the coding sequence that does not interfere with proper translation 30 using the initiation colon.
"Blocking fragment" refers to a DNA fragment that is flanked by site-specific sequences that can block the transcription and/or the proper translation of a coding sequence resultin'; in an inactive transgene. When the blocking fragment contains polvadenylation signal sequences and other sequences encoding 3~ regulatory signals capable of terminating transcription it can block the transcription of a coding sequence when placed in the 5' non-translated region, i.e.. between the transcription start site and the ORF. When inserted in the coding sequence a blocking fragment can block proper translation bv_ disrupting its open reading frame. DNA rearrangement by site-specific recombination can restore transcription and!or proper translatability. For example. excision of the blocking fragment by site-specific recombination leaves behind a site-specific sequence that allov~~s transcription and/or proper translatability. A Transcription or Translational Stop Fragment «-ill be considered a blocking fragment.
The terms "in ci.s~" and "in craps°' refer to the presence of DNA
elements.
such as the viral origin of replication and the replication proteins) gene. on the same DNA molecule or different DNA molecules. respectively.
The terms "cis-acting sequence' and ''cis-acting element'' refer to DNA or R~IA sequence. whose function require them to be on the same molecule. An example of a ci.s-acting sequence on the replicon is the viral replication origin.
The terms "~rans-acting sequence' and "traps-acting element'' refer to DNA or RNA sequences. whose function does not require them to be on the same molecule. Examples of traps-acting sequence is the replication gene IACI or I ~ in ACMV or TGMV geminiviruses, respectively). that can function in replication without being on the replicon.
"Cis-acting viral sequences" refers to viral sequences necessary for viral replication (such as the replication origin) and in cis orientation.
"Transactivating gene" refers to a gene encoding a transactivating protein.
It can encode a viral replication proteins) or a site-specific replicase. It can be a natural gene, for example. a viral replication gene, or a chimeric gene. for example, when plant regulatory sequences are operably-linked to the open reading frame of a site-specific recombinase or a viral replication protein.
''Transactivating genes" may be chromosomally integrated or transiently ?s expressed.
"Episome'~ and "replicon" refer to a DNA or RNA virus or a vector that undergoes episomal replication in plant cells. It contains cis-acting viral sequences, such as the replication origin, necessary for replication. It may or may not contain traps-acting viral sequences necessary for replication, such as the viral 30 replication genes lfor example. the ACI and AL1 genes in ACMV and TGM~' geminiviruses. respectively). It may or may not contain a target gene for expression in the host plant.
"Inactive replicon~~ refers to a replication-defective replicon that contains cis-acting viral s:aue!~ces. such as the replication origin, necessary for replication 3 > but is defective in replication because it lacks either a functional viral gene necessary for replication and!or the ability to be released from the chromosom°
due to its DNA arrangement involving site-specific recombination sequences.
Consequently. an inactive replicon can replicate episomally only when it is ~i provided with the essential replication protein in traps, as in the case of geminivirus proreplicon. or when its non-functional replication gene is rendered functional by site-specific recombination with or without release of the active replicon DN.A from the chromosome. "Activation of replicon replication' refers to the process in which an inactive replicon is rendered active for episomai replication. _ "FIoxed replicon'' refers to a replicon flanked by tandemly (i.e., directly, repeated) site-specific sequences. The replicon can be a full length copy of a DNA virus or RNA virus amplicon. The replicon is excised as LNA following site-specific recombination.
"Episomal replication' and "replicon replication'' refer to replication of DNA or, RNA viruses or virus-derived replicons that are not chromosomally-integrated. It requires the presence of viral replication proteins) essential for replication, is independent of chromosomal replication, and results in the I ~ production of multiple copies of virus or replicons per host genome copy.
"Autonomous" or ''cis'' replication refers to replication of a replicon that contains all cis- and traps-acting sequences (such as the replication gene) required for replication.
"Replication origin" refers to a cis-acting replication sequence essential for viral or episomal replication.
"Proreplicon" refers to an inactive replicon that is comprised of cis-acting viral sequences required for replication, and flanking sequences that enable the release of the replicon from it. It is integrated into a bacterial plasmid or host plant chromosome and may contain a target gene. Proreplicon lacks a gene 2~ encoding a replication protein essential for replication. Therefore. it is unable to undergo episomal replication in the absence of the replication protein. Its replication requires both release from the integration and the presence of the essential replication gene ijr traps. The release from integration can be triggered in different ways. For example, the proreplicon can be present as a partial or 30 complete tandem duplication. such that a full-length replicon sequence is flanked by virus sequences and such that the duplicated viral sequence includes the viral replication origin. Thus. in this case, the proreplicon serves as a master copy from which replicons can be excised by replicational release in the presence of replication proteins) [Bisaro, David. Recombination in geminiviruses:
3~ Mechanisms for maintaining genome size and generating genomic diversity.
Homologous Recomb. Gene Silencing Plants (1.994), 219-70. Editor(s):
Paszkowski, Jerzy. Publisher: Kluwer. Dordrecht. Germany]. Alternatively, the proreplicon can be excised by site-specific recombination between sequences flanking it in the presence of an appropriate site-specific recombinase (as described in site-specific recombination systems. such as Cre-lox and FLP/FRT
systems. Odell et al. Use of site-specific recombination systems in plants.
Homologous Recomb. Gene Silencing Plants (1994). 219-70. Editor(sl:
Paszkowski. Jerzy. Publisher: hluwer, Dordrecht. Germanyj. In the case of RNA virus proreplicons. the amplicon sequences flanking the inactive replicon, -which include regulatory sequences. allow generation of the replicon as R~IA
transcripts that can replicate in traps in the presence of replication protein. These regulatory sequences can be for constitutive or regulated expression.
10 "Viral replication protein" and "replicase" refer to the viral protein essential for viral replication. It can be provided in tran.s to the replicon to support its replication. Examples include viral replication proteins encoded by ACl and ALl genes in ACMV and TGMV geminiviruses. respectively. Some viruses have only one replication protein: others may have more than one.
1 ~ "Replication gene" refers to a gene encoding a viral replication protein.
In addition to the ORF of the replication protein, the replication gene may also contain other overlapping or non-overlapping ORF(s) as are found in viral sequences in nature. While not essential for replication. these additional ORFs may enhance replication and/or viral DNA accumulation. Examples of such 20 additional ORFs are AC3 and AL3 in ACMV and TGMV geminiviruses, respectively.
"Chimeric traps-acting replication gene" refers either to a replication gene in which the coding sequence of a replication protein is under the control of a regulated plant promoter other than that in the native viral replication gene or a modified native viral replication gene. for example. in which a site-specific sequence(sl is inserted in the s' transcribed but untranslated region. Such chimeric genes aiso include insertion of the known sites of replication protein binding between the promoter and the transcription start site that attenuate transcription of viral replication protein gene.
s0 "Chromosomally-integrated" refers to the integration of a foreign gene or DNA construct into the host DNA by covalent bonds. ~~'here genes are not "chomosomally integrated" they may be "transiently expressed". Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but is function independently. either as part of an autonomously replicating plasmid or expression cassette for example. or as part of another biolo<~icai system such as a virus.
"Production tissue' refers to mature, harvestable tissue consisting of non-dividing, terminally-differentiated cells. It excludes young, growing tissue consisting of germline. meristematic. and not-fully-differentiated cells.
''Germiine cell." refer to cells that are destined to be gametes and whose genetic material is heritable.
''T'rans-activatiou~ refers to switching on of gene expression or replicon -replication by the expression of another (regulatory) gene in tran.s.
"Transformation" refers to the transfer of a foreign gene into the genome of a host organism. Examples of methods of plant transfoartation include 10 Agrobacterium-mediated transformation (De Blaere et al. (1987) Meth.
Enrymol.
143:?77j and particle-accelerated or "gene gun" transformation technology (Klein et al. ( 1987) Nature (London) 327:70-73; U.S. Patent No. 4,94,050). The terms ''transformed". "transformant" and "transgenic" refer to plants or calli that have been through the transformation process and contain a foreign gene integrated into 1 ~ their chromosome. The term "untransformed" refers to normal plants that have not been through the transformation process.
"Transiently transformed" refers to cells in which transgenes and- foreign DNA have been introduced (for example. by such methods as a~robacterium-mediated transformation or biolistic bombardment), but not selected for stable 20 maintenance.
"Stably transformed'' refers to cells that have been selected and regenerated on a selection media followin; transformation.
"Transient expression" refers to expression in cells in which virus or transgene is introduced by viral infection or by such methods as agrobacterium-25 mediated transformation. electroporation. or biolistic bombardment. but not selected for its stable maintenance.
"Genetically stabl;: ' and "heritable'' refer to chromosomallv-integrated genetic elements that are stably maintained in the plant and stably inherited by progeny through successive generations.
30 ''Primaw transformant'' and "TO generation" refer to transgenic plants that are of the same genetic generation as the tissue which was initially transformed (i.e.. not having gone through meiosis and fertilization since transformation).
"Secondan~ transformants" and the ''T1, T?. T3, etc. generations'' refer to transgenic plants derived from primar~~ transformants through one or more meiotic 3~ and fertilization cycles. They may be derived by self fertilization of primary or secondary transformants or crosses of primary or secondary transformants with other transformed or untransformed plants.
-,-1 WO 00/17365 PC'TIUS99/21989 "Wild-type~~ refers to the normal gene. virus, or organism found in nature without anv knov~m mutation.
"Genome" refers to the complete genetic material of an organism.
The term "dimes ~ when used in reference to the eeminivirus B ~enome refers to at least one partial or complete tandem copy of the B genome. As used herein 'dimes' therefore refers to partial or complete tandem dimes of a -geminivirus genome. such that a single replicon is flanked by cis-acting viral sequences. including the replication origin. necessary for viral replication.
'these geminivirus dimers can serve as master copies from which replicons can be i 0 excised by replicative release in the presence of the replication protein in traps (Bisaro. David. Recombination in geminiviruses: Mechanisms for maintaining genome size and generating genomic diversity. Homologous Recomb. Gene Silencing Plants (19941. 219-70. Editor(sj: Paszkowski. Jerzy. Publisher:
Kluwer. Dordrecht. Germany).
1 s "TopCross~ high oil corn seed method" refers to a commercial method of making hybrid corn seeds in the field, as described. for example. in U.S.
Patent No. 5.704,160.
The invention provides a two-component, expression system in transgenic plants. Both components are chromosomally-integrated and. thus, stably 20 maintained by themselves.
In one embodiment of the invention. one component is an inactive replicon carrying site-specific sequences) that is unable to replicate by itself. The second component is a chimeric site-specific recombinase gene in which the coding sequence of a site-specific recombinase is operably-linked to a regulated promoter. Expressing the recombinase under appropriate stimulus will result in recombination between the cognate wild-type or mutant site-specific sequences in or around the inactive replicon which will activate release of the replicon ancL' replicon replication.
In yet another embodiment of the invention, one component is an inactive 30 transgene cam~ing site-specific sequences) and the second component is a chimeric transactivating gene in which the coding sequence of a site-specific recombinase is operable-linked to a regulated promoter. Expressing the recombinase under appropriate stimulus will result in recombination between the cognate vwild-teoe or mutant site-specific sequences in or around the inacti~
a transgene vwhich will activate transgene expression, without involvin~~ viral replication.
Thus. repiicon replication and/or transgene expression can be targeted to specific plant cells by controlling the expression of replication proteini s) or recombinase to those cells. Plants will be most sensitive to cellular toxicity andior the detrimental effect of replicon replication and/or the expression of the transgene or replication gene in early stages of plant growth and differentiation that involve cell division and differentiation. 'Thus. controlling such expression entirely or largely to non-dividing. terminally-differentiated cells will reduce the detrimental effect of replicon replication on plant growth and development. Examples of such terminally-differentiated cells are those in production tissue and include, but are Ilot limited to, the storage cells of seed and root tissues and mature leaf cells.
This invention provides for a regulated. tr ~nsgenic expression system.
10 Since the components of this system are stably transformed, this invention solves the problem of episomal instability through cell divisions, since episomes are unstable in the absence of selection. When recombination between site-specific sequences in an inactive replicon or inactive transgene activates its replication or transgene expression, respectively, the system will be heritable unless the site-1 > specific recombination involves DNA excision in eern~ line cells.
The replicon will. be cell-autonomous. if the necessary viral movement proteins) are not expressed in the cell. This is the case using only DNA A of geminiviruses or in using PVX with a mutation in a movement protein. The replicon will spread cell-to-cell systemically, if the necessary viral movement 20 proteins) are also expressed in the cell.
Transgenic plants with different constructs will be selected and regenerated into plants in tissue culture by methods known to one skilled in the art and referred to above. The ability of a transactivating chimeric site-specific recombinase gene to activate an inactive replicon in plant chromosome into ?s replication via site-specific recombination will be tested following one of the follow~in~ methods:
infecting the transgenic plants carrying the inactive repiicon with viruses carrying the Cre gene, crossinc plants where one parent contains the correctly regulated s0 chimeric Cre gene and the other the inactive replicon.
3. making two agrobacterium strains containing binary vectors with different plant selectable markers, one containing a chimeric Cre gene under the control of an appropriately regulated promoter and the other the inactive replicon.
The two components can be introduced into plants together by co-transformation 3 ~ or by sequential transformations.
Replication in transgenic plant tissue will be monitored by reporter gene expression or analysis of viral nucleic acids by Southern blot in the case of DNA
viruses and by Northern blot in the case of RNA viruses.
~6 WO 00/17365 PCT/US99/2i989 Site-specific Recombination for Conditional Expression of Transeenes Use of developmentally-regulated or chemically-induced promoters for conditional transgene expression is usually limited either by their insufficient strength in the 'fully-on~ stage or. more often. by their basal non-specific (i.e..'leaky- expression) in the 'off stage, depending on the application.
One can increase both the level and specificity of conditional expression -by putting the coding sequence of the gene of interest under the control of a strong constitutive or regulated promoter for expression in the production tissue in such a manner that the gene is transcriptionally inactive unless it undergoes a site-10 specific recombination through the conditional expression of the cognate site-specific recombinase. Thus. conditional expression of the gene of interest is now dependent on the conditional expression of the recombinase. In this manner, determinants for high-level expression and for specificity are separated and one can then focus on the basal non-specific (i.e.. 'leaky) expression of recombinase.
1 ~ Since the levels of the recombinase enzyme required are not expected to be high, several 'specific promoters can be used that may otherwise be too weak to express the gene of interest. Furthermore, since site-specific recombination depends on a threshold level of the recombinase. there may be a tolerance for leaky transcription that results in sub-threshold levels of recombinase.
20 Furthermore, increased 'tissue-selectivity' to available regulated promoters is provided by decreasing the efficiency of wild-type Cre-mediated recombination, raising the threshold of recombinase required by using either a mutant site for site-specific recombination and/or a mutant recombinase that are not proficient in recombination. Such mutants are well known. at least for the Cre-lox system.
25 The applicants have shown that when using safener-inducible Cre expression to activate the expression of a transgene (35S:luciferase j. the use of a mutant lox sit:
(1ox72) and a wild type lox P site in Cre-mediated activation of the transgene reduces the basal activity of the promoter compared to using both wild type lox P
sites.
s0 The non-specificity of recombinase expression can be further reduced (i.e..
its expression specificity further increased) by other post-transcriptional approaches including: -1. using a chimeric recombinase gene that is poorly translated (such as having a non-ideal context sequence around the initiation codor 3~ followine Itozak's rule or having additional short ORFs in the ~' untranslated region as in yeast GCN4 mRNA, or having 3' UTR
sequences that makes mRNA unstable as described by Pamela Green -"
(Department of Biochemistry. Michigan State University. East Lansing. MI 4$824-131?, U.S.A.) '_'. using a mutant recombinase that has less cellular stability (i.e..
shorter half life). Such mutants could be made by adding PEST sequences ~Sekhar Et al...lnl. Receptnn SignG~l Tran.scxuctinn Res. 18 (2-3), I 13-13? (1998)]. _ Once a system is developed in a given crop. it can be easily adapted for conditional expression of a variety of target trait genes with or without involvement of replicon.
Furthermore, replicon replication is expected to achieve high-level expression of target genes through gene amplification that is heritable. In addition, high-level transcription from these vectors may be used for gene silencing by antisense inhibition or co-suppression.
The invention further encompasses novel recombinant virus constructs I ~ including transfer vectors and methods for making them and using them.
Vvhen used to transform a plant cell the vectors provide a transgenic plant capable of regulated, high-level expression though gene amplification. This regulated expression could be in response to a particular stimulus, such as the development stage, wounding of the plant (for example, by insect attack or pathogen). an environmental stress (such as heat or high salinityj, or chemicals that induce specific promoters. Plants in which particular tissues and/or plant parts have a new or altered phenotype may be produced by the subject method.
The constructs include vectors. expression cassettes and binary plasmids depending upon the intended use of a particular construct. Two basic DIvTA
2~ constructs are required which may be combined in a variety of ways for transforming a plant cell and obtaining a transgenic plant. For agrobacterium-mediated transformation. the inactive replicon and chimeric replication gene may be combined in one binary plasmid or the two may be introduced into a cell on separate binary plasmids by either co-transformation or sequential transformations. Alternatively, the two constructs may be combined by crossing two transgenic lines containing one or the other construct.
The termination region used in the target gene in the inactive replicon as well as in the chimeric replication protein gene will be chosen primarily for convenience, since the termination regions appear to be relatively interchangeable.
3~ The termination region which is used may be native with the transcriptional initiation region. may be native with the DNA sequence of interest. or may be derived from another source. The termination region may be naturally occurring, or wholly or partially synthetic. Convenient termination regions are available ?8 from the Ti-plasmid of ~l. rumefaciens. such as the octopine synthase and nopaline svnthase termination regions or from the genes for [3-phaseolin. the chemically inducible lant gene. pIN (Hershey et al.. Isolation and characterization of cDNA
clones for RNA species induced by substituted benzenesulfonamides in corn.
Plant ~Lfol. Biol. ( 19911. 17(4 i. 679-90; U.S. Patent No. 5.364.780).
The Constructs: -In one aspect of the invention. a novel system of transaetivatin~T replication of plant viruses is developed using a site-specific recombination system. The system has the advantage of better tolerating non-specific basal expression {i.e., leakiness) of 'regulated" promoters and provides a more stringent control of transactivation. Furthermore. when a properly regulated site-specific recombination is developed. it can be applied generically to the activation of inactive replicons of different viruses as well as for transactivating expression of trans~enes without replicon. The non-specific expression (i.e.. ieakiness) of some available regulated promoters expressing a site-specific recombinase (such as Cre recombinase) will be more readily tolerated by the plants since the recombinase has to reach a threshold level before it can effect recombination [(Araki et al..
Targeted integration of DNA using mutant lox sites in embryonic stem cells.
Nucelic ,Acids Res. 25:868-872 (1997)]). The 'specificity' of the promoters can be further increased by increasing the threshold level of the recombinase required by using either known mutant recombinase proteins, as described for Cre [Abremski, K., et al.. Properties of a mutant Cre protein that alters the topological linkage of recombination products. J. AToI. Biol. 202:59-66 ( 19881: Wierzbicki et al.. A
mutational analysis of the bacteriophage P 1 recombinase Cre.. J a~lol. Bio?.
195:785-94 ( 1987) and/or mutant site-specific sequences. such as lox P sites [Albert et al.. Site-specific integration of DNA into wild-type and mutant lox sizes placed in the plant genome. Plant J. 7:659-59 (1995)], that render recombination less proficient than its wild-type site-specific recomination system and, thus.
requires a higher level of the recombinase.
In this system. the inactive replicon construct contains wild-type or mutant site-specific sequences within or flanking the replicon. Recombination between the site-specific recognition sequences makes the replicon active and activates replicon replication. When the site-specific sequences are directly oriented (i.e..
are in tandeml. site-specific recombination will result in excision of the D\.~, between the site-specific sequences (Figures 1 and ~). When they are in an inverted orientation {i.e.. in head-to-head or tail-to-tail orientation). site-specific recombination will result in inversion of the DNA between the site-specific sequences (Figure ?).
'_' 9 In another embodiment (Figure 1 ), the inactive replicon construct comprises a single copy of the replicon (either a geminivirus replicon or RIvTA
virus ampliconl flanked by tandem site-specific sequences and integrated in the chromosome. In this integrated state the replicon is inactive and unable to replicate. Site-specific recombination will excise the single copy of the replicon containing a single site-specific sequence that is capable of replication.
When the replicon is inserted between the site-specific sequences at a site that is between the transcription start site and the open reading frame (i.e., in the S' transcribed but untranslated region of the repli~~ation gene), the replication gene is non-functional 10_ and the site-specific recombination also reconstitutes the functional replication gene (Figure ?). When the RNA amplicon is inserted between the promoter and its transcription start site, the RNA replicon is not transcribed and the site-specific recombination excises the amplicon from the chromosome as well as reconstitutes a functional aamplicon. In either case, site-specific recombination removes the 1 ~ replicon from the chromosome. which is preferable when avoiding virus-induced gene silencing. When the replicon is flanked by two tandem lox sites, it is refered to as a 'lloxed replicon'. The floxed replicon may be integrated within a reporter gene such that it serves as a Transcription Stop Fragment and blocks proper transcription of the reporter gene. Site-specific recombination will excise the 20 replicon and reconstitite a functional reporter gene. Such reporter gene will be useful in developing screening plants for a properly regulated Cre-lox activation system. It is preferable that a Transcription Stop Fragment is inserted near the floxed amplicon to prevent inadvertant transcription of the replication gene from sequences adjacent to the floxed amplicons, such as the context plant DNA in transgenic plants. However, it is not required that the insertion of the floxed replicon in a gene or a Transcription Stop Fragment be inserted, as long as the replication gene is not ey.essed in its integrated state. Inactivating the replication gene in the inactive replicon is important when its expression is detrimental to plant d:velopment.
30 As has been noted. gene silencing is an important obstacle in plant transgene expression and the present expression and replication systems may be modified to address this problem. Recently, pathogenicity determinants Pl-HC-Pro and HC-Pro polypeptides of Tobacco Etch Virus and 2b protein of Cucumber Mosaic t% irus were shown to suppress gene silencing in plants of 3 ~ transgenes and/or RNA virus genes [Anandalakshmi, R., Pruss. G. J., Ge, X..
Marathe, Pv., Mallory. A. C.. Smith, T. H.. Vance. V, B.: A viral suppressor of gene silencing in plants. Proc. Natl. Acad. Sci. G'. S. M. 9:13079-13084 ( 1998):
Brigneti, G.. Voinnet. O.. Li. W.-X., Ji. L.-H.. Ding. S.-W.. Baulcombe. D.
C.:
Viral pathogenicity determinants are suppressers oftransgene silencing in Nicotiana hetTrhamiana. EATBO J. 17:6739-6746 ( 1998); Carrington. J. C., Whitham. S. A.: Viral invasion and host defense: strategies and counter-strategies. Ctrrr Opin. Plant Biol. 1:336-341 ( 1998): Vance, V. B.. Pruss. G.
J..
Carrington. J.. Martin, L.. Dawson. W. O.: Potyvirus booster sequence and helper component proteinase for enhancing expression of a foreign or endogenous gene -product in plants. PCT lnt. Appl. WO 9844097 (1998)]. However, constitutive expression of such silencing suppressers in transgenic plants will be detrimental to plants, since it will constitutively suppress gene silencing. a fundamental plant 10 process. This detrimental effect is especially strong in conjunction with viral vectors. since the above silencing suppressers also increase viral pathogenicity. In fact, plants infected with Potato Virus X containing HC-Pro showed severe symptoms. necrosis and stunting, while those infected with 2b protein became highly necrogenic and died in 3 weeks [Brigneti. G.. Voinnet. O.. Li, W.-X., Ji.
1~ L.-H.. Ding. S.-W.. Baulcombe. D. C.: Viral pathogenicitv determinants are suppressers of transgene silencing in Nicotiana benthamiana EATBO J.
17:6739-6746 (1998)]. Therefore. localized and/or regulated expression of these silencing suppressers in production tissue of transgenic crops will be critically important for their practical application in increasing viral vector replication 20 and/or for higher level gene expression, especially foreign protein production.
Applicant has observed that TGMV-B genome can also suppress virus-induced gene silencing. For example. when leaves of transgenic tobacco plants transformed with T-DNA containing floxed TGMV genome A in which the coat protein ORF was replaced with GUS ORF were co-bombarded with 3~S:Cre gene '_'> and a dimer of TGMV-B aenome show sianificantlv higher expression of the GUS than those transformed with 3~S:Cre gene alone. Furthermore, co-bombardment of wild type Nicotiana benthamiana with PVX-GFP and TGMV-B
resulted in longer persistence of GFP activity than when bombarded with PVC-GFP along. The applicant has discovered that infection of wild type 30 Nicotiana benthamiana plant with TGMV carrying GFP resulted in GFP
expression that did not fade or silence for at least 2 months. This infection was achieved by biolistic co-bombardment of two plasmids, collectively referred here to as 'TGMV-GFP dimers~. one containine a partial dimer of TGMV-A-GFP. in which the coat protein ORF is replaced with that of briehter (mutant) form of GFP. and one containin~~ a partial dimer of wild type TGMV-B. Furthermore. the applicant has discovered that TGivIV-GFP expression was similarly persistent in plants that were silenced for PVX-GFP expression. For this. transgenic .fir. berrthamiar7a plant. desienated 714B-LL 1. containing an inactive RNA
virus WO 00!17365 PCT/US99/21989 PVX-GFP ampiicon was used. These transgenic plants do not express any GFP
because the inactive form of PVX-GFP is unable to replicate unless it undergoes Cre-lox mediated site-specific recombination. When line 714B-LL1 is bombarded with 3~S:Cre gene. it results in activation of PVX-GFP replication and GFP
expression that is silenced in about ? weeks. When such a silenced 714B-LL1 plant was infected with 'TGMV-GFP dimers'. GFP expression from TGMV-GFP. -which is distinguishable from that in PVX-GFP by its brighter fluorescence, persisted as long as in untransformed control. Moreover. when line 714B LL-1 was co-bombarded wit'i 35S:Cre and 'TGMV-GFP dimers', GFP expression from TGMV-GFP persisted as long as in untransformed control and beyond the time GFP from PVX-GFP was silenced. Since, the expression of a foreign gene in TGMV in the presence of TGMV-B is persistent and not silenced with time, TGMV-B may be used to enhance high level expression by suppressing silencing of transgenes present in viral vectors. It is anticipated that ail geminiviruses have 1 ~ such silencing suppressor activity, whether with monopartite or bipartite genome.
It is likely that this persistent expression of foreign gene in grminivirus results is derived from the geminivirus movement. The silencing suppressor activity of geminivirus genome B can be used in different ways. TGMV-B genome can be transformed into the host plant chromosome by one skilled in the art and 20 combined with the cognate proreplicon or floxed genome-A. For example, TGMV-B genome can be present in its entirety as a partial dimer in the chromosome or its replication and expression may also be under the controlled activation by site-specific recombination. When present as a diner, it may suppress silencing with or without its replication. For the former.
replication may ?> be transactivated directly by the expression of the replication proteins under the control of a regulated promoter or indirectly by the activation of an inactive genome A via site-specific recombination. As an alternative to using the entire genome B. one could identify the silencing suppressor gene in genome B and use it to enhance foreign gene expression. Since TGMV-B has only two large ORFs.
~0 BL1 and BRl. which encode viral movement proteins, one skilled in the art can readily identify v~rhich ORF(s) is a silencing suppressor. For example leaves may be co-bombarded with 3~S:Cre and TGMV-B diner with mutant BR1 (or PVX:BL1 chimeric gene) or 3~S:Cre and TGMV-B diner with mutant BLl (or PVX:BRI chimeric gene) and the relative expression of GtJS expression measured. The identified silencing suppressor gene may then be used for enhancing transgene expression.
Regulated expression of silencing suppresser genes can be achieved by putting them under the control of appropriately regulated promoters or.
preferably.
3'' by regulated activation by site-specifc recombination. Thus. in one embodiment of the invention chimeric silencing suppressers genes will be Cre-activated.
However. it would be most desirable to have the activation of both viral expression system and silencing suppresser gene expression under a common control ensuring simultaneous viral replication and suppression of gene silencing for high level viral replication and for producing high levels of foreign proteins. -Thus. in another embodiment of this invention. conditional viral replication system will incorporate a conditional expression of a silencing suppresser gene.
For example referring to Figure 1. element A could be a plant promoter, such as 35S promoter. element B could be an inactive RNA virus-derived amplicon that also serves as a transcriptional and/or translational Stop fragment of element C.
and element C is the ORF of silencing suppresser gene, such PI-HC-Pro. HC-Pro.
or the 2b protein (as described above) and 3' untranslated region. Regulated site-specific recombination will activate at the same time the excision and replication 1 ~ of the RNA viral replicon and expression of the silencing suppresser Gene under the control of the promoter in element A. Similarly. referring to Figure 1, element A could be a plant promoter. such as 35S promoter. element B could be an inactive geminivirus-derived replicon that also serves as a transcriptional and/or translational Stop fragment of element C. and element C is the ORF of silencing suppresser gene from TGMV-B genome~nd 3' untranslated region. Regulated site-specific recombination will activate at the same time the excision and replication of the geminivirus viral replicon and expression of the geminivirus silencing suppresser gene under the control of the promoter in element A.
Alternatively. the silencing suppresser gene can be expressed as a target '?i ~Tene on an inactive replicon. For example. inactive PVX amplicons with lox sites as described above (Figures 2 and 3l will contain in addition of the target gene of interest a silencing suppresser gene under the control of viral promoter. The target gene of interest and silencing suppresser gene in the virus replicon could be present either as tandem genes under the control of duplicated viral CP
promoter or as a N- or C-terminal protein fusion with the target protein, as described by jAnandalakshmi. R.. Pruss. G. J., Ge,1.. Marathe, R., Mallory. A. C., Smith.
T. H.. Vance. V. B.: A viral suppressor of gene silencing in plants. Proc.
.~~atl.
.-lcad. Sci. L'. S. A. 9:13079-13084 (1998)]. In transgenic plants. such virus-based vectors may or may not be capable of systemic spread. For example. in geminivirus-based replicons the coat protein ORF mar' be replaced by that of a silencing suppresser gene. Insert size limitation in replicons can be circumvented by having 2 replicons. one carrying the silencing suppresser gene and the other target Gene of interest.
In another embodiment, the transcription of an essential replication gene(s;i of a replicon is blocked by a Transcription Stop Fragment flanked by tandem site-specific sites and site-specific recombination excises the Transcription Stop Fragment leaving behind a single site-specific sequence that allows transcription of the previously blocked gene and subsequent repiicon release and replication.
For example. in TGMV and ACMV viruses, the Transcription Stop Fragment _ flanked by tandem site-specific sites may be inserted in the ~' transcribed but untranslated region of the replication gene, AC 1 (for example. at the Mfe I
site) in a viral dimer. For RNA virus amplicons, the lox site is inserted between the 10. TATA box of the promoter and the transcription start site (Figure 3).
In another embodiment, a region in or around a replicon is inverted by site-specific sequences to disrupt the replicon genome or the RNA virus amplicon.
The inverted region can be entirely within the replicon ~enome resulting in disruption of the viral genome. Site-specific recombination restores the 1 ~ organization of the replicon, including amplicon (except for the residual site-specific sequence(s)) that allows replication. Alternatively, the inversion can be in part of the replicon and/or a plant regulatory sequence of an amplicon that disrupts proper transcription of essential replication gene(s). Site-specific recombination restores proper transcription that allows replicon release and replication. __ 20 The site-specific sequences and their cognate recombinase enzymes can be from any natural site-specific recombination systems. Well-known examples include Cre-lox, FLP/FRT, R/RS, Gin/gix systems. These are described in Odell et al., Use of site-specific recombination systems in plants. Homologous Recomb.
Gene Silencing Plants ( 1994), 219-70. Editor(s): Paszkowski. Jerzv.
Publisher:
?5 Kluwer. Dordreeht. Germany).
In one embodiment of the invention (Figure 4), the basic inactive replicon construct is the proreplicon. which. in the case of a geminivirus replicon, is preferably present as a partial or complete tandem dimer in T-DNA, such that a single replicon is flanked by cis-acting viral sequences necessary for viral 30 replication. including the replication origin. These geminivirus dimers can serve as master copy from which replicons can be excised by replicative release (Bisaro.
David. Recombination in geminiviruses: Mechanisms for maintaining genome size and venerating genomic diversity. Homologous Recomb. Gene Silencing , Plants ( 1994). ? 19-70. Editor(s): Paszkowski, Jerzv. Publisher: Kluwer, 3~ Dordrecht. Germany] in the presence of the replication protein in traps.
The.
preferable source of proreplicon sequences is from a geminivirus (such as ACMV
and TGMV) in which the essential replication gene (for example, AC 1 ) is rendered non-functional by mutation (addition. rearrangement. or a partial or complete deletion of nucleotide sequences). The mutation can be in the non-coding sequence. such as the promoter, and/or it can be in the coding sequence of the replication protein so as to result either in one or more altered amino acids in the replication protein or in a frame shift. Preferentially. the mutation is a s frameshift mutation at or close to the initiation codon of the replication protein so that not even a truncated replication protein is made. 1\-lore preferably. the entire -replication tene is deleted from the proreplicon such that there is no homolog5-between the transactivating replication gene and the replicon in order to prevent virus-induced homology-based silencing of the transactivating replication gene 10 during replicon replication. In addition, the proreplicon preferentially has most or all of the coat protein gene deleted and replaced by a restriction site for cloning target gene.
In this embodiment the other basic construct is a chimeric traps-actine replication gene consisting of a regulated plant promoter operable-linked to the 1 ~ codin~l sequence of a replication protein. For ACMV and TGMV
geminiviruses.
the replication proteins are encoded by the AC1 and AL1 ORFs, respectively.
Preferably, AC2 and AC3 ORFs are included with the ACl ORF in ACMV and AL? and AL3 ORFs are included with the ALl ORF in TGMV.
In the case of RNA virus proreplicons. the amplicon sequences flanking 20 the inactive replicon, which include regulatory sequences, allow generation of the replicon as RNA transcripts that can replicate in traps in the presence of replication protein. These regulatory sequences can be for constitutive or regulated expression. Preferably, the promoter used in these amplicons will be a weak promoter in order to minimize virus-induced gene silencing [Ruiz et al..
23 (199F1 Plant Cell. ~'ol 19. pp 937-946]. Also included are the replication proteins of single-stranded RNA viruses (such as the RNA-dependent RNA polymerases) when they can support viral replication in traps (for example. Brome Mosaic Virus (BMV)).
Site-specific recombination can reconstitute a functional viral replicase 30 gene and transactivate the cis replication of the replicon. which in turn can provide the replication protein in ~rans for the replication of the proreplicon.
The skilled person appreciates that the instant expression systems (involving inactive replicon) may be used to effect regulated replication in the absence of a target Gene. In this situation forei<~n aerie expression is not the 35 object. Instead. regulating viral replication is sought. Such a system may be useful. for example, where regulated viral replication will confer viral resistance to the transgenic plant.
;;
WO 00:17365 PCT/US99/21989 More preferably, replication of RNA virus can be transactivated by either a site-specific excision of a Transcriptional Stop tiagment from the amplicon that allows normal transcription required for viral replication (Figure 3). For example, the Transcriptional Stop fragment can be placed between the promoter and viral cDNA. within the viral cDN~~. or between the viral cDNA and the 3' polyadenvlation signal. Since there is limited space between the TAT.A box and the transcription start site. overlapping part of the lox sequence with the TATA
box is preferred along with use of a deleted site-specific sequence. such as lox Dl 17 ~Abremski et ai.. J. .~lol. Biol. (1988) 202:59-66]. Alternatively, the 10 replicon can be activated by site-specific inversion between two inverted site-specific sites to result in a functional amplicon (Figure 2). These two site-specific sites can be anywhere in the amplicon as long as they do not interfere with replication following inversion. For example, one site-specific sequence can be in the ~' non-coding transcribed sequence of the GFP or GUS gene and the other in I s an inverted orientation between the enhancer and TATA box of the 3~S
promoter (Figure ?).
When replicating repIicons contain sequences homologous to chromosomal genes. the homologous gene has been reported to be silenced [Ruiz et al., (1998) Plant Cell, Vol. 19, pp 937-946]. When the promoter in the 20 amplicon is expressed constitutively and strongly (such as the 35S
promoter), ultimately replication can be silenced. Such silencing has been reported to confer resistance to infection by the virus. Homology-dependent virus resistance has been shown to be due to homology-dependent post-transciptional gene silencing [see Mueller et. al. ( 1995) The Plant Journal 7:1001-1013]. Thus. a conditional transactivation of an inactive amplicon is expected to confer resistance to infection by homologous viruses. Since such gene silencing has been reported to be dependent on mR~\'.A threshold, v~hen gene silencing is not desired, the promoters in the amplicon (Figures 2 and 3) should preferably be a weak promoter such as the minimal 3~S promot~:: to reduce the risk of their beine silenced durin<~
30 replicon replication.
Inactive repiicons may also contain a target genes) that will replicate and be expressed at an enhanced level when the replicon is transactivated to replicate.
The coding sequence in these target genes arc operabiy-linked to regulatory sequences that are of viral andior plant origin. One or more introns may be also be present in the cassette. Other sequences (including those encoding transit .
peptides. secreton~ leader sequences. or introns) may also be present in the proreplicon and replicon as desired. How to obtain and use these sequences is well-known to those skilled in the art. The target gene can encode a polypeptide - _ _ _ _ _ CA 02339595 2001-02-05 29- i 1-2000 US 009921989 of interest (for e~ca:mple, an enzyme), or a functional RNA, whose sequence results ' in antisense inhibition or co-suppression. The nucleotide sedueaces of this '.
invention may be synthetic, naturally-derived, or combinations thereof.
Depending upon the nature of the nucleotide sequence of interest, it may be desirable to synthesize the sequence with plant-preferred codons. i Target genes can encode functional RNAs or foreign proteins. Foreign proteins will typically encode non-viral proteins and proteins the: may be foreign i to plant hosts. Such foreign proteins will include, for example, enzymes for a primary or secondary metabolism in plants, proteins that confer disease or herbicide resistance, commercially useful non-plant enzyrncs, and proteins with desired properties useful in animal feed or human food. Additionally, foreign proteins encoded by the target genes will include seed storage proteins with improved nutritional properties, such as the high-sulftx 10 kD corn seed protein or ' high-sulfur zero proteins.
Regulated e.cpression of the viral replication proteins) is possible by ' placing the coding sequence of the replication protein under the control of promoters that are tissue-specific, developmental-specific, or inducible.
Several tissue-specific regulated genes and/or promoters bane been ' reported in pleats. These iz~cludc genes encoding the seed storage proteins (such ' as napin, cruciferin, .beta.-conglyclnin, and phaseolin), zain or oil body proteins (such as oleosin), or gems involved in fancy acid biosynthesis (including icy l i carrier protein, steazoyl-ACP desaturasc, and fatty acid desaturases (fad 2-1 )), and other genes exgressod during embryo development (such as $ce4, see, for example. EP 255378 and ~ridl et al,, Seed Science Research (1991) 1:209-219).
Particularly useful for seed-specific e:rpression is the pea vicilin promoter [Czako ct sl., ~LIoL Gen. Genet. (I992), 235(1}, 33-40]. Other useful prouroters for .
expression in mature loaves are those that are switched on at the onset of senescence, such as the SAG promoter from Arabidopsis [Gin et al., Inhibition of !
leaf senescence by autoregulated production of cytokinin, Science (Washington, D.C.) (1995), 270 (5244), 1986-8;.
A class of fruit-specific promoters expressed at or during anthesis through fruit developraent, at least until the beginning of ripening, is discussod in LT.S. 4,943,614. cDNA clones that are preferentially expressed in cotton fiber have been isolated [John et al_, Gcnc expression in cotton (Gossypium hirsuturn L.) fiber: cloning of the mRNAs, Proc. Natl Aced. Sci. U.S.A. (1992), 89 (13), 5769-73~. eDNA clones from tomato displaying differential expression during fivit development have been isolated and characterized [Mansson et al., Mol.
Gen.
Genet. ( 1985) AMENDED SHEET
_, _ -- --. _ . . , _ , CA 02339595 2001-02-05 200:35b-361; Slater et ai., Plant Mol Biol. (1985) 5:137-147]. The promoter for polygalacturonase gene is active in fruit ripening. The polygalacturonase gene is described in U.S. Patent No. 4,53S,050 (issued August 13,1985), U.S. Patent No. 4,769,051 (issued September 6, 1988), U.S. Patent No. 4,801,590 (issued January 31, I9$9) and U.S. Patent No. 5,147,065 (issued April 21, 1992).
Mature plastid mRNA for psbA (one of the components of photosystem II) reaches its highest level late in fiuit development, in contrast to plastid mRNAS
for other campcnents of photosystem I and I! which decline to nondetectable levels in ebromoplasts aver the onset of ripening [Piechulla et al., Plant Mol. Btol.
(I98~ 7:367-376J. Recently, cDNA clones representing genes apparently invol~cd is tomato pollen [McCornrzick et al., Tomato Biotechnology (1987) Alan R Liss, Inc., New York) and pistil (Gasser et al., Plant Celt (1989), 1: I S-24]
interactions have also txen isolated and characterized.
Other e.~camples of tissue-specific promoters include those that direct expression in leaf cells following damage to the leaf (far example, from chewing insects), in tubers (for example, patatin gene promoter), and in fiber cells (an example of a developmentally-regulated fiber cell protein is E6 [John et al., Gene expression in cotton (Gossypiurr~ hirsutum L. ) fiber, cloning of the mRNAs, Proc.
Natl. Acad Scz. U.,~~I. (1992), 89(13), 5769-73]). The E6 gene is most active in fber, although low levels of transcripts are found in leaf, ovule and flower.
The tissue-specificity of soma "tissue-specific" promott~rs may not be absolute and ~y~ be tested by one skilled in the art usiag the diphtheria toxin sequence. One can also achieve tissue-specific expression with "leaky"
expression by a combination of different tissue-specific promoter3 (Beals et al., (1997) Plam Cell, vol 9, 1527-1545). Other tissue-specific promoters can be isolated by one skilled in the art (see U.S. 5,589,379). Several inductble promoters ("gene svdtches") have been zeported. Many are described in the review by Gates [Current ppinion in Biotechnology,1996, vol. 7, 168-172; Gatz, C. Chemical control of gene expression, .4nnu. Rev. Plant Physiol. Plant Mo1 BfoL (I9971, 48, 89-108]. These include tetracycline repressor system, Lac repressor system, copper-inducible systems, salicylate-inducible systems (such as the PRIa system), giucocorticoid- [Aoyama T. et al., h=HPlant Journal (1997) vo111:C>OS-G12] and ecdysome-inducibIe systems. Also, included arc the benzene sulphonamide- (U.S. 5,364,780) and alcohol- (WO 97106269 and 'WO 97106268) 3S inducible systems and gl~atathivnc S-transferase promoters. Other studies have focused on genes inducibly regulated in zespvnsc to environmental stress or stimuli such as increased salinity, drought, pathogen, and wounding. [Graham et AMENDED SHEET
al.. J. Biol. Chem. ( 19851 260:6>j~-660; Graham et al.. .l. Biol. Chcm. ( 1985) 260:6561-654] [Smith et al.. Plarrta ( 1986) 168:94-100]. Accumulation of a metallocarboxypeptidase-inhibitor protein has been reported in leaves of wounded potato plants (Graham et al.. Biochem Biopln:s Res C'omnr ( 1981 ) 101:1164-1170].
Other plant genes have been reported to be induced methyl jasmonate.
elicitors.
heat-shock. anerobic stress. or herbicide safeners. -Regulated expression of the chimeric transacting viral replication protein can be further regulated by other genetic strategies. For example, Cre-mediated gene activation as described by Odell et al. [(1990) A~ol. Gerz Genet.
10 113:369-278]. Thus. a DNA fragment containing 3' regulatory sequence bound by lox sites between the promoter and the replication protein coding sequence that blocks the expression of a chimeric replication gene from the promoter can be removed by Cre-mediated excision and result in the expression of the traps-acting replication gene. In this case. the chimeric Cre gene. the chimeric traps-acting 15 replication gene. or both can be under the control of tissue- and developmental-specific or inducible promoters. An alternate genetic strategy is the use of tRNA
suppressor gene. For example, the regulated expression of a tRNA suppressor gene can conditionally control expression of a traps-acting replication protein coding sequence containing an appropriate termination codon as described by 20 Ulmasov et al. [(1997) Plant Molecular Biology, vol 35, pp 417-424]. Again.
either the chimeric tRNA suppressor gene, the chimeric transacting replication gene. or both can be under the control of tissue- and developmental-specific or inducible promoters.
One skilled in the art recognizes that the expression level and regulation of 2~ a transgene in a plant can vary significantly from line to line. Thus. one has to test several lines to find one with the desired expression level and regulation.
Once a line is identified with the desired regulation specificity of a chimeric Cre transgene, it can be crossed with lines carrying different inactive replicons or inactive transeene for activation.
30 A variety of techniques are available and knomm to those skilled in the an for introduction of constructs into a plant cell host. These techniques include transformation with DNA employin, A. tumefacien.s or ,~. rhizogenes as the transforming anent. electroporation. particle acceleration. etc. [See fer example.
EP ?9~9s9 and EP 168:41 ]. It is particularly preferred to use the binar< type 3~ vectors of Ti and Ri plasmids of:lgrobacterium sPp. Ti-derived vectors transfornl a wide variety of higher plants. including monocotyledonous and dicotv ledonous plants. such as soybean. cotton. rape. tobacco. and rice [Pacciotti et al.
(1985) BiolTechnolo~a 3:241. Bvrne et al. (1987) Plant Cell. Tissue acrd Organ Culture ;9 8:3; Sukhapinda et al. ( 1987) Plant ;tlol. Biol. 8:209-216: Lorz et al. ( 1985) nTol.
Gen. Genet. 199:178: Potrvkus ( 1985) A~lol. Gen. Genet. I 99:183; Park et al..
,I Plant Biol. ( 1990, 38(4 ~. 365-7I : Hiei et al.. Plant J. ( 1994). 6:271-282]. The use of T-DNA to transforni plant cells has received extensive study and is amply described (EP 1?0~16: I-loekema. ln: The Binary Plant t%ector System. Offsec-drukl:erij Kanters B.V.: Alblasserdam ( 1985), Chapter V, Knauf, et al..
Genetic -Analvsis of Host Range Expression by Agrobacteritrm In: Molecular Genetics of the Bacteria-Plant Interaction. Puhler, A. ed., Springer-Verlag, New York.
1983.
p. 245: and An, et al.. EMBO J. ( 1985) 4:277-284]. For introduction into plants, the chimeric genes of the invention can be inserted into binary vectors as described in the examples.
Other transformation methods are available to those skilled in the art, such as direct uptake of foreign DNA constructs [see EP 295959]. techniques of electroporation [see Fromm et al. ( 1986) Nature (London) 319:791 J or high-1 ~ velocity ballistic bombardment with metal panicles coated with the nucleic acid constructs [see Kline et al. ( 1987) Nature (London) 327:70, and see U.S.
Patent No. 4,945,050). Once transformed, the cells can be regenerated by those skilled in the art. Of particular relevance are the recently described methods to transform foreign genes into commercially important crops, such as rapeseed [see De Block 20 et al. ( 1989) Plant Pllvsiol. 91:694-701 ], sunflower [Everett et al. ( 1987) BiolTechnology~ 5:1201 ], soybean [McCabe et al. (1988) BiolTechnology 6:923;
Hinchee et al. ( 1988) BiolTechnology 6:915; Chee et al. ( 1989) Plant Physiol.
91:1212-1218; Christou et al. (1989) Proc. ~Vatl. Acad. Sci US9 86:7500-7504;
EP 301749]. rice [Hiei et al.. Plant J. (1994). 6:271-282]. and corn [Gordon-Kamm et al. (1990) Plant Cell 2:603-618: Fromm et al. (1990) Biotechnolog,-8:833-839].
Transeenic plant cells are then placed in an appropriate selective medium for selection of trans~~enic cells which are then grown to callus. Shoots are grown from callus and plantlets generated from the shoot by erowin~ in rooting medium.
30 The various constructs normally will be joined to a marker for selection in plant cells. Conveniently, the marker may be resistance to a biocide (particularly an antibiotic such as kanamycin. 6418, bleomycin. hygromycin. chloramphenicol.
herbicide. or the like). The particular marker used will allow for selection of transformed cells as compared to cells lacking the DNA which has been 35 introduced. Components of DNA constructs including transcription cassettes of this invention may be prepared from sequences which are native (endogenous) or foreign (exogenous) to the host. By "foreign ' it is meant that the sequence is not found in the wild-type host into which the construct is introduced.
Heterologous constructs will contain at least one region which is not native to the gene from which the transcription-initiation-region is derived.
To confirm the presence of the transgenes in transgenic cells and plants. a Southern blot analysis can be performed using methods known to those skilled in the art. Replicons can be detected and quantitated by Southern blot, since they can be readily distinguished from proreplicon sequences by the use of appropriate -restriction enzymes. Expression products of the transgenes can be detected in any of a variety of ways, depending upon the nature of the product. and include Western blot and enzyme assay. One particularly useful way to quantitate protein expression and to detect replication in different plant tissues is to use a reporter gene, such as GUS. Once transgenic plants have been obtained, they may be aro~~n to produce plant tissues or parts having the desired phenotype. The plant tissue or plant pans. may be han~ested. and/or the seed collected. The seed may serve as a source for crowing additional plants with tissues or parts having the I ~ desired characteristics.
The present viral expression system has been used to demonstrate that (i) soybean and corn seed tissue will support geminivirus replication; (ii) Cre can mediate site-specific recombination in transgenic inactive replicons and inactive transgenes and that this recombination leads to high foreign protein expression andlor host gene silencing, and (iii) that the expression system will effect expression of foreign genes in tobacco.
EXAMPLES
The present invention is further defined in the following Examples. These Examples. while indicating preferred embodiments of the invention. are given by 2> way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention. and without departin<~ from the spirit and scope thereof. can make various changes and modifications of the invention to adapt it to various usages and conditions.
GENERAL MIETHODS
30 Standard recombinant DNA and molecular cloning techniques used in the Examples are well known in the art and are described by Sambrook. J.. Fritsch, E.
F. and Maniatis. T . ,~Tolecular Cloning: A Laboratory ?hfanual; Cold Spring Harbor Laboratow Press: Cold Spring Harbor. ( 1989) (Maniatis) and by T. J.
Silhaw. i~T. L. B;nnan. and L. «'. Enquist_ Experiments with Gene Fusions.
Cold Spring Harbor Laboratory, Cold Spring Harbor. N.~'. 11984) and by Ausubel. F.
I\~1. et al.. Current Protocols in A~folecular Biolo~~v. pub. by Greene Publishing Assoc. and Wilev-Interscience ( 1987).
:1 t~ ~ . ~ ~:. L 'J 'J V T . ! L~ _ !e. 1 W . ~. .. . J n . - ,.
i 29- i 1-2000 US 009921989 I
Restriction enzyme digesrions, phosphorylations, legations and transformations ' - were done as desczibed in Sambrook, J. et al., .tuPra. l2esCriction enzymes were v obtained from Nevsr England Biolabs (Boston, MA), GIBCOBRL (Gaithersburg, MD), or Pmmega (Madison, WI). Taq polymerise was obtained from Perkin ' Elmer (Branchburg, NJ). Growth media was obtained from GIBCO~B,RL ' (Gaithersburg, MD). . i the Agrobacterium tumefacie~s strain LBA4404 was obtained from br. R. Schilperoot, Leiden [Hoekema et al. Nature 303:179-I80, (1983)].
Transformation Protocols Bivlistic transformations were done essentially as described in U.S. Patent No. 4,945,050. Briefly, gold particles ( I mm in diameter) are coated with DNA
using the following technique. Ten ug of plasmid DNAs are added to 50 mL of a suspension of gold particles (60 mg per mL). Calcium chloride (50 uL of a 2.5 M
solution) and spezmidine free base (20 mL of a 1.0 M solution) are added to the particles. The suspension is vortexed dewing the addition of these solutions.
A$er 10 min, the tubes are briefly centrifuged (5 sec at 15,000 rpm} and the supernatant removed. The particles are resuspended in 200 mL of absolute ethanol, centrifuged again and the supernatant removed. The ethanol rinse is performed ' again and the particles resuspcnded in a #'unal volume of 30 uL of ethanol. An ' aliquot (S mL) ofthe I3NA-coated gold particles can be placed in tho center of a a flying disc (Bio-Red Labs, 86I Ridgeview Dr, Medina, OI-~. The particles are then accelerated into the corn tissue with a PDS-I OOOIHe (Bio-Itad Labs, 861 ;
Ridgevicw hr., Medina, OITj, using a helium pressure of 1000 psi, a gap distance of 0.5 cm arid a flying distance of 1.0 cm.
Where Agrobacterium transformations were done the proceedure was accomplished esscrniall~~ as described Park et al., J. Plant 8iot_ (1995), 38(4}, 365-71.
Construction of Floxed ACMV and TGMV Monomers pMf3~35 wan made by cloning Xba I fragment from 35SCabb:Ata (Arab ALS) into Xba I sits of pTZl8It.
Tpuetion of the wild-t~.~,e Lvx P site between the Xho I and Sac I aitcs of ~
SS
Two tandem (i.e., directly repeated) wild-type lox P sites were introduced between the Xho I and Sac I sites in tht 5' transcribed, but untranslated, region of ' 3~S promoter:GUS:3'nos chimeric reporter gene such that the two lox P sites were ' separated by an Eco RI site. For this, a Xho I-Eco RI adaptor A jmadc by ana~ealing primer pairs GV 48 (SEQ ID No: l ) and GV 49 (SE(~ ID
AMENDED SHEET
No:2)] and an Eco RI-Sac 1 adaptor B [made by annealing primer pairs GV 50 (SEQ ID No:3') and GV S1 (SEQ ID No:4)] were co-Iigated into Xho I and Sac I
digested plasmid carrying the 3~S promoter:GUS:3'nos chimeric reporter gene.
[SEQ ID No:1 ] ~'-TCG AGA TAA CTT CGT ATA ATG TAT GCT ATA
s CGAAGT TAT G-3' (GV48 ) [SEQ ID No:2] s'-A.AT TC:'~ TAA CTT CGT ATA GCA TAC ATT ATA CGA -AGT TAT C-3' (GV48) [SEQ ID No:3] 5'-AAT TCT ATA ACT TCG TAT AAT GTA TGC TAT ACG
AAG TTA TGA GCT-3' (GV50) 10 [SEQ ID No:4] 5'-CAT AAC TTC GTA TAG CAT ACA TTA TAC GA.A GTT
AT.A G-3' (GV51) The resulting plasmid was designated pGV686 and the introduced lox sites were confirmed by sequence analysis. Subsequently. the poly A signal region from nopaline svnthase (3' nos) [Genbanl: Accession Nos. J01541 V00087] was 1 ~ replaced by that tiom octopine synthase (3' ocs) (Genbank Accession Nos. V00088 and J01820] to yield plasmid pGV690.
Insertion of TGMV and ACMV monomer between the lox sites in pGV690:
A single copy of a modified ACMV (in which most of the coat protein gene is deleted) was isolated as a Mfe I fragment from plasmid pGV~96 20 (WO 99/22003) and cloned into the EcoR I site of pGV690 to yield pGV691, such --that the viral origin is adjacent to the 35S promoter.
The ability of Cre to transactivate both GUS expression and viral replication was first tested by co-bombardment of floxed viral genomes, pGV691, with plasmid pNY102 containing 3~S:Cre chimeric gene into leaves of Nicotiana 25 tabacum var.l'anthi and 1~'. benthamiana. as well as bombarding leaves of,Yanthi plants stably transformed with 3~S:Cre gene. Gus activity and replicon replication were detected only in the presence of Cre, providing evidence that Gus is a good reporter for excision. that geminivirus replication can tolerate at least one lox site, and that the expression of Cre from a chromosomally integrated 30 chimeric Cre gene can transactivate viral replication. When pGV691, pG~'~96d (a ACMV proreplicon with a mutant replication protein described in PCT Int.
Appl WO 99122003), and-pNY102 were co-bombarded, traps replication of proreplicon from pG~'~96d as well as cis replication of replicon from pGV691 was observed.
3~ The Pvu II site in pGV69l was convened into Xma I using IvTEB 1048 Sma I linker and then the Xma I-H3 fragment was cloned into pSK (Stratagene.
11011 North Torrey Pines Road La Jolla. CA 92037). Xma I-Hind III to yield pGV696. pGV699 was made by cloning a Pst I fragment from pGV697 4~
containing a Transcriptional Stop fragment consisting of tandem 3' untranslated regions of small subunit of ribulose-1.5-bisphosphate carboxylase and nopaline synthase genes into the Pst I site of pGV696 in the desired orientation to prevent inadvertant transcription of the viral replicase <~ene Lw a plant promoter within T-DivlA or adjacent to its insertion site. The 1ma I-Hind III fragment from pGV699 was cloned into pBE673. a binary vector for bar selection (described in -PCT Int. Appl WO 99/22003) to yield pBE704. To make a binary vector containing both floxed ACMV vector and a dimer of a replication-defective mutant of ACMV, the Sac I-Xma I fragment of pGV596d containing the mutant ACMV dimer was cloned into Sac I-Xma I pBE673 binary vector to make pBE69~. Next the Xma I-H3 fragment of pGV699 was cloned into pBE695 to form pBE70~. pBE704 and pBE705 constructs were introduced into A! benthamiana and ~'~' tabacum through agrobacterium-mediated transformation as described above either alone or in the presence of ACMV proreplicon 1 ~ pGV~96d. Bombardment of transgenic plants with Cre showed activation of GUS
expression and replication of ACMV replicon was obsen~ed in both 704 and 705 transformants. In addition, replication of the mutant ACMV replicon was observed in 70~ transformants co~rming the data from transient analysis.
Results indicated that replication of excised replicon was significantly higher in the absence than the presence of the proreplicon.
The GUS ORF in pGV690 was replaced with one carrying the Luc ORF
from pSP-luc+ vector from Promega (2800 Woods Hollow Road Madison. «'I
53711 ) using Nco I-Xba 1 to make pGV716. A single copy full-length genome of TGMV was isolated as a 2.6 kb Mfe I fragment from plasmid pTAl.3 (N.
2~ Robertson. North Carolina State university) was cloned into the Eco RI site between Lox P sites of pGV716 to result in 'floxed' TGMV replicons in plasmid pGV731. such that the viral origin is adjacent to the 3~S promoter. The coat protein gene in pGV731 was replaced with the GUS ORF from pGV671 (PCT Int.
Appl. ~%0 99/22003) using NdeI/Sall to yield pGV733. Bgl II to Hind III
fragment of pGV733 was cloned into Bam HI/Hind III cut pBE673 to yield pBE733, a bar binary vector.
A binary vector pBE736 was made that was identical to that in pBE733 except that one of the lox sites was changed fiom wild type P to mutant lox 7?
[Albert et al.. Plarzt J 7:649-59 (1995)]. The floxed replicons with mutant log 3~ sites was introduced into a binary vector and the modified binan~ vectors were introduced into agrobacterium tumefaciens and transformed into plants by agrobacterium-mediated transformation. Progeny of the plants were collected and will be crossed with lines containing correctly-reeulated Cre gene.
WO 00/I736~ PCT/US99/21989 The binary vectors pBE733 and pBE736 were transformed into atTrobacterium and introduced into tobacco ( ~'icotiana tabacum var. Xanthi) and Nicotiana benthamiana leaf discs by agrobacterium-mediated transformation (usin, ?~ mls of the agro~ culture at OD A600 of I .0). After 3 days on MS
media s the disks were incubated for 6 weeks on shooting medium (MS media supplemented with 1 mg%ml claforan 1 ug/ml BAP, 0.1 ug/ml NAA) containing 10 -and 6 uglml PPT (Sigma Chemical Co.. 6050 Spruce St., St. Louis, MO 63103) for tobacco and benthamiana. respectively. BE733 transformants were confirmed for transgene by Southern analysis and analysed for replication by Southern and for GUS expression upon bombardment of a plasmid pNY102 containing 35S:Cre gene.
Transgenic tobacco and N. benthamiana containing the floxed TGMV
from pBE733 were obtained. Bombardment of transgenic leaf or plant with PVX:Cre and 35S:Cre gave distinct GUS staining expected for replication. TI
1 ~ progeny seedlings of :~benthamiana line 733# 23, was infected with PVX-Cre.
This resulted in GUS expression in infected leaves that persisted for upto 2~
days with no apparent silencing. These results confirmed that the inactive replicon was heritable and capable of being activated by Cre-mediated excision.
Inactive PVX-GFP and PVX-GUS Amplicons with-Lox Sites Plasmids pVX201, pTXS-GFP, and TXGC3S.vec were obtained from Dr. D. Baulcombe (The Sainsbury Laboratory, John Irines Centre. Norwich Research Park. Norwich Research Park, NR4 7UH, UK). pVX201 contains a clone of 35S:P~'XcDNA: 3'nos l'PVX amplicon'), pTXS-GFP contains T7 '?5 promoter:PVX-GFP construct. and TXGC3S.vec contains T7 promoter:P~'X-GFP
construct. The GFP and GL'S ORFs were cloned behind the PVX coat protein promoter.
pGV680. containing PVX-GFP ('PVX-GFP amplicon'), was made by replacing the Sac I-:Ayr II fragment of pVX201 amplicon with that from pTXS-GFP containing the GFP ORF. pGV681. containing the PVX-GUS
('PVX-GFP ampiicon~), was made by replacing the Sac I-Avr II fragment of - pVX?01 amplicon with that of TXGC3S.vec containing the GUS ORF. A
frameshift mutation in the open reading frame of the viral RNA-dependent RIV.A
polvmerase of pG~'E80 and pC~V681 yielded plasmids pGV682 and pG~'68~.
3> respectively. This mutation was made by restricting pGV680 and pGV681 DNA
with Arc I. filling-in. and reli~~ation.
Detached leaves of lVicotiana benthamiana were bombarded with the above plasmids using the biolistic gun. Analysis of leaves 10-14 days after -1;
expression and replication of ACMV replicon was obsen~ed in both 704 and 705 transformants. In addition, replication of the mutant ACMV replicon was observed in 70~ transformants co~rming the data from transient analysis.
Results indicated that replication of excised replicon was significantly higher in the absence than the presence of the proreplicon.
The GUS ORF in pGV690 was replaced with one carrying the Luc ORF
from pSP-luc+ vector from Promega (2800 Woods Hollow Road Madison. «'I
53711 ) using Nco I-Xba 1 to make pGV716. A single copy full-length genome of TGMV was isolated as a 2.6 kb Mfe I fragment from plasmid pTAl.3 (N.
2~ Robertson. North Carolina State university) was cloned into the Eco RI site between Lox P sites of pGV716 to result in 'floxed' TGMV replicons in plasmid pGV731. such that the viral origin is adjacent to the 3~S promoter. The coat protein gene in pGV731 was replaced with the GUS ORF from pGV671 (PCT Int.
Appl. ~%0 99/22003) using NdeI/Sall to yield pGV733. Bgl II to Hind III
fragment of pGV733 was cloned into Bam HI/Hind III cut pBE673 to yield pBE733, a bar binary vector.
A binary vector pBE736 was made that was identical to that in pBE733 except that one of the lox sites was changed fiom wild type P to mutant lox 7?
[Albert et al.. Plarzt J 7:649-59 (1995)]. The floxed replicons with mutant log 3~ sites was introduced into a binary vector and the modified binan~ vectors were introduced into agrobacterium tumefaciens and transformed into plants by agrobacterium-mediated transformation. Progeny of the plants were collected and will be crossed with lines containing correctly-reeulated Cre gene.
WO 00/I736~ PCT/US99/21989 The binary vectors pBE733 and pBE736 were transformed into atTrobacterium and introduced into tobacco ( ~'icotiana tabacum var. Xanthi) and Nicotiana benthamiana leaf discs by agrobacterium-mediated transformation (usin, ?~ mls of the agro~ culture at OD A600 of I .0). After 3 days on MS
media s the disks were incubated for 6 weeks on shooting medium (MS media supplemented with 1 mg%ml claforan 1 ug/ml BAP, 0.1 ug/ml NAA) containing 10 -and 6 uglml PPT (Sigma Chemical Co.. 6050 Spruce St., St. Louis, MO 63103) for tobacco and benthamiana. respectively. BE733 transformants were confirmed for transgene by Southern analysis and analysed for replication by Southern and for GUS expression upon bombardment of a plasmid pNY102 containing 35S:Cre gene.
Transgenic tobacco and N. benthamiana containing the floxed TGMV
from pBE733 were obtained. Bombardment of transgenic leaf or plant with PVX:Cre and 35S:Cre gave distinct GUS staining expected for replication. TI
1 ~ progeny seedlings of :~benthamiana line 733# 23, was infected with PVX-Cre.
This resulted in GUS expression in infected leaves that persisted for upto 2~
days with no apparent silencing. These results confirmed that the inactive replicon was heritable and capable of being activated by Cre-mediated excision.
Inactive PVX-GFP and PVX-GUS Amplicons with-Lox Sites Plasmids pVX201, pTXS-GFP, and TXGC3S.vec were obtained from Dr. D. Baulcombe (The Sainsbury Laboratory, John Irines Centre. Norwich Research Park. Norwich Research Park, NR4 7UH, UK). pVX201 contains a clone of 35S:P~'XcDNA: 3'nos l'PVX amplicon'), pTXS-GFP contains T7 '?5 promoter:PVX-GFP construct. and TXGC3S.vec contains T7 promoter:P~'X-GFP
construct. The GFP and GL'S ORFs were cloned behind the PVX coat protein promoter.
pGV680. containing PVX-GFP ('PVX-GFP amplicon'), was made by replacing the Sac I-:Ayr II fragment of pVX201 amplicon with that from pTXS-GFP containing the GFP ORF. pGV681. containing the PVX-GUS
('PVX-GFP ampiicon~), was made by replacing the Sac I-Avr II fragment of - pVX?01 amplicon with that of TXGC3S.vec containing the GUS ORF. A
frameshift mutation in the open reading frame of the viral RNA-dependent RIV.A
polvmerase of pG~'E80 and pC~V681 yielded plasmids pGV682 and pG~'68~.
3> respectively. This mutation was made by restricting pGV680 and pGV681 DNA
with Arc I. filling-in. and reli~~ation.
Detached leaves of lVicotiana benthamiana were bombarded with the above plasmids using the biolistic gun. Analysis of leaves 10-14 days after -1;
bombardment showed that GFP fluorescence was detected in leaves bombarded with pGV680 but not pGV682 and that GUS staining was detected in leaves bombarded N.~ith pGV681 but not pGV683. 'this confirmed that the reporter gene expression was dependent on a functional viral RNA-directed R'~,~ polvmerase (RdRP) and that reporter ~~enes can be used to detect replication.
When pGV681 was bombarded into cotyledons ca. ~0-100 mg soy°bean zygotic embryos. GUS staining detected replication of the PVX vector 10-14 days post bombardment. This showed that PVX can replicate in seed tissue and in asy diverse plant species as Glycine max and Nicotiana benthamiana.
10. Introduction of Inverted Mutant I ox sites in PVX Am~licons:
A mutant lox site (lox 43) was introduced by PCR into PVX-GFP
amplicon. For this, PCR products I and II were made using pGV681 as the template and PCR primer pairs I [SEQ ID No:S (GV70. upper primer) and SEQ
ID No:6 (GV71, lower primer)] and II [SEQ ID No:7 (GV73, upper primer) and 1 ~ SEQ ID No:8 (G',~72, lower primer)], respectively.
[SEQ ID No:~] 5'-GCG GCA TGC GTC GAC ACA TGG TGG AGC .4CG ACA-S' (GV70) [SEQ ID No:6] 5'-GCC GGG TAC CGA GAC GCG TCA TCC CTT ACG-3' (GV71 ) 20 [SEQ ID No:7] ~'-GTC TCG GTA CCT ATA ATG TAT GCT ATA CGA AGT
TAT ATA AGG AAG TTC ATT TCA-3' (GV73), [SEQ ID No:8] 5'-TGA TCC GCG GGT TTC TTC TCA TGT-3' (GV7?).
PCR product I was digested with Sphl and Asp718 and PCR product II
with Asp718 and Sac II to result in 369 by and 464 by fragments. respectively.
pGV680 plasmid was digested with Sph I and Sac II and the 979? by vector .
fragment was ligated in a 3-way ligation with the two PCR fragments to yield plasmid pGV701 containing mutant lox 43 site between the As-1 element and the TATA box in 3~S promoter of the amplicon.
A mutant lox site (lox 44) was inserted by adaptor ligation in the 30 untranslated region ~' to the GUS ORF in pGV681. For this, pGV681 was digested with Xma I and ligated to an adaptor made by annealing the following two ~ 1-mer primers:
[SEQ ID No:9] ~'- CCG GGA ATG CAT GCT ATA GCA T.AC ATT ATA CGA
AGT TAT TCG AAT TTA AAT -3' 3~ [SEQ ID No:lO] ~'-CCG GAT TTA AAT TCG AAT AAC TTC GTA TAA TGT
ATG CTA TAG CAT GCA TTC -3' Following Swa I digestion of the ligated DNA. the linear DNA was isolated. religated. and traniormed into E. coli to yield plasmid pGV700.
Inserting lox 44 in PVX-GUS amplicon yielded a 31 amino acid-N-terminal extension of the GUS ORF. Mutant lox 4s and lox 44 sites in pG~'70U and pGV701were confirmed by DNA sequence analysis.
PVX-GFP and PVX-GUS amplicons with nvo inverted lox sites were made by combining the above mutant lox sites. Thus. for PVX-GUS. the Avr II-Sac I fragment. containing the GFP ORF. of pGV701was replaced with -that of pGV700. cam~in~ lox 44 and GUS ORF. yielding pGV70?. For PVX-GFP. the 4432 by Age I-Cla I fragment in pGV701 was replaced with the 4476 by Age I-BstB 1 fragment. carrying lox 44, of pGV700, yielding pGV708 I 0 with a 23 amino acid-N-terminal extension of the GFP.
Detached leaves of ~'~'icotiana bentlTamiaraa mere bombarded with plasmids pGV700, pGV701, pGV702. and pGV708 using the biolistic gun. Based on expression of the reporter genes in the leaves 10-14 days after bombardment, replication.was observed in all four cases. although the level of replication was 1 ~ lower in pGV708. These results show that insertion of lox sites in the plant promoter and/or in the intergenic sequence ~' to the reporter genes does not affect replication. The poorer GFP fluorescence in pGV708 may be due to the N-terminal extension on GFP protein.
To obtain a non-functional amplicon, pGV702 and pGV708 were passaged 20 through Cre-expressing bacteria or incubated with purified Cre enzyme (Novagen, Madison WI) to invert the sequence between the inverted iox sites. However, no inversion was detected in either plasrnid. This may be due to poor efficiency of inversion with these mutant lox sites that were the most inefficient in Cre-lox recombination.
25 Introduction of Inverted 'Vild Tvpe I_ox P sites in P~'1 Amplicons:
A wild-type lox P site was cloned as an adaptor into the Cla I site in the intergenic region. ~' to GFP ORF in piasrnid pGV701 followed by Xma I
digestion, isolation of the linear vector and its self ligation to yield piasmid pG~'712. The adaptor was made by annealing primers GV78 (SEQ ID No:l l) 30 and G~'77 (SEQ ID No:l2) [SEQ ID No: l l ] ~'-CGA TAA CTT CGT ATA ATG TAT GCT ATA CGA AGT
TAT CCC GGG-s' (G~'78 j [SEQ ID No: I ~] ~'-CGC CCG GGA TAA CTT CGT .ETA GCA TAC ATT .ATA
CGA AGT TAT-~' (G~'77 s~ The mutant log ~13 site in 3~S promoter in pG~~712 was replaced by a wild-type lox P site as follows. .-~ PC'R product was made on pGV71'' DNA
template using an upper primer GV74 (SEQ ID No: l3) and a lower primer GV72.
(SEQ ID No:8).
t 7 [SEQ ID No:l3] s'- Gt~~I~ GAC GCG TAT AAC TTC GTA TAA TGT-3' (GV74) The PCR product was digested with Mlu I and Sac II, and the resulting product was used to replace the 1\~tlu I-Sac II fragment containing lox 44 in pGV7I? to yield plasmid pGV713. pGV713 contains two inverted wild-type lox P sites. Incubation of pGV713 with Cre recombinase as sujgested by the manufacturer (Novagen. Madison. Vv) inverted of the DNA sequence between the -lox P sites containing the IL'~1A dependent RNA polymerase to yield a non-functional amplicon in plasmid pGV714. Plasmid pGV714 was purified following transformation of E. colt XL1 cells.
10 A wild-type lox P site was cloned as an adaptor into the Cla I site in the intergenic region ~' to GUS ORF in plasmid pGV702. For this plasmid pGV702 was linearized with Xma I, ligated to adaptor annealed from primers GV80 [SEQ
ID N0:14] and GV81 [SEQ ID NO:I S].
[SEQ ID No:l4] ~'-CCG GGG ATA ACT TCG TAT AGC ATA C.AT TAT ACG
I ~ AAG TTA TTC GAA CAT TTA AAT -3' GV80 [SEQ ID No:15] ~'- CCG GAT TTA AAT GTT CG A ATA ACT TCG TAT AAT
GTA TGC TAT ACG AAG TTA TCC -3' GV81 The resulting plasmid, designated pGV702W. was used to construct PVX-GUS with inverted wild-type lox P sites. For this, the Avr II-Sac I
fragment, 20 containing the GFP ORF, of pGV713 was replaced with that of pGV702W, carrying lox P and GUS ORF yielding pGV708W.
The inability of the inverted non-functional arriplicons to replicate without undergoing Cre-mediated inversion to a functional amplicon was confirmed by bombardment of tVicntiana benthamiana leaves. Plasmids pG~'71? and pGV713 replicated and spread in the bombarded leaves. This was clear from the showing that GFP fluoresence was detected 10-14 days after bombardment. However.
plasmid pG~'?14 did not .eplicate unless co-bombarded with plasmid pNY102 that expresses Cre under the control of a 35S promoter. The 3.01 I:B BspEl-Sac fragment containing the inverted, non-functional amplicon from plasmid pGV714 30 was cloned into Xma I (BspEl compatible)-Sac 1 cut pBEb74. a binary vector with bar selection in plants, as described above, to result in pBE714. Plasmid pBE714 was introduced via agrobacterium LBA4404 in wild type Nicotiana benthamiarta plants, as described above. The plants were selected on PPT
30 ug/ml phosphonithricin shooting and then 10 uglml rooting media. 10 3s transformants (714B ~s E-~. E-6. G-1. M-4. M-6. M-7, Q-I. S-4, LL-1. UU-1) were obtained. Southern analyses showed that all were positive for the transgene except for M-7 and Q-I . .All appeared phenotypical)v normal and without any viral symptoms.
PCT/US99/? 1989 The ability of the transfotmants to be transactivated by Cre expression was tested using infection with PVX expressing Cre. Leaves from five positive 714 B
transgenic plants (LL-1. UU-l, E-~. M-4. and S4) were bombarded with the particle gun using 1 u~~ of a plasmid DNA carving chimeric 35S:Cre gene to test for amplicon activation or with gold alone as a control. After ca. ~ days. GFP
expression was noted in leaves of three (LL-1, M-4. and S4) of the five transgenic-plants bombarded with 35S:Cre but not with gold alone control. After ca 12 days.
the GFP expression in the transgenic leaves bombarded with 35S:Cre diminished.
suggesting that silencing might was occuring, as is often seen upon infection of wild type leaves with PVX-GFP. The expression levels, spread, and duration of GFP in Cre-activated leaves were comparable to that of PVX:GFP bombarded directly into wild type lit. benthamiana leaves.
Five out of eight Tl progeny seedlings of 714B transgenic LL-1 showed GFP expression upon bombardment with 3~S:Cre. Similar bombardment of 1 ~ detached leaves from 12 other progeny seedlings showed that 11 were positive for activation. Thus, the inactive virus is heritable and the progeny capable of being Cre-activated. The expression levels, spread, and dtu~ation of GFP in Cre-activated seedlings was slightly variable between the T1 progeny individuals but were generally comparable to that of PVX:GFP bombarded directly into wild type 2U' N. benthamiana seedlings.
714B transgenic lines will be genetically combined with correctly regulated Cre chimeric genes. for example by crossing with transgenic Lines carrying such Cre genes.
?s Excisional Inactive Pvx Amplicons To make a PVX Rl~IA virus replicon flanked by tandem lox sites, two PCR
products were made on pGV680: a 438 by PCR product containing the TATA
box ('minimal promoter') and lox P site using primer pairs GV8~ [SEQ ID
N0:16](with Sph I site)-GV86 [SEQ ID N0:17] (with Not I sites) and a 441 by 30 PCR product containing mutant lox site (IoxDl 17) [Abrenski, K. and Hoess R.
(1980 J. Mol. Biol. 184:211-220] and 5' end of the PVX cDI~iA usinD primer pairs GV87 [SEQ ID N0:18] (with Not I site)-GV88 [SEQ ID N0:19] (with Sac II
site). Then. the two PCR products were digested with Not I, ligated. and used as template for PCR usin~~ primer pairs: GV 10~ [SEQ ID N0:20] and GV88 [SEQ
3 ~ ID NO:19] primers to give the X09 by PCR product. The resultant PCR
product was digested with Sph I and Sac II and the X09 by fragment containing the TAT.A
box ('minimal promoter) followed by tandem wild type and mutant (Dl 17) lox P
sites in front of the amplicon cDNA was isolated and cloned into Sph I-Sac 1I
digested pGV680 to give pGV720. Thus, pGV720 is a PVX-GFP amplicon with minimal 35S promoter and tandem IoxP and loxDl 17 sites between the TATA
box and the transcription start site. pGV720 did not replicate efficiently when bombarded into N. benthamiana. Therefore, is was replaced with the full length promoter, which was isolated as a 438 by PCR product using PCR primers GV85 [SEQ ID N0:16] (with Sph I site) and GV86 [SE ID N0:17] (with Not I site) on _ pGV680 and cloned into Sph I-Not I digested pGV720 to result in pGV740.
Thus, pGV740 is a PVX-GFP amplicon with 35S promoter and tandem loxP and loxDl 17 sites between the TATA box and the transcription start site. pGV740 could replicate when bombarded into N. benthamiana even without a Cre expressing gene, suggesting that the amplicon can have at least 66 by between the TATA box and the 5' end of PVX cDNA.
Although pGV740 may be readily inactivated by the insertion of a Transcriptional STOP fragment in the Not I site as represented in Figure 3 it was decided to make an excisional replicon that physically excises the RNA virus amplicon from the chromosome upon site-specific recombination. For this, the promoter at the end of PVX cDNA was moved by first deleting the promoter by ligating a XmaI/NotI/XmaI adapter (primers GV 157 [SEQ ID N0:21 J and GV I 58 [SEQ ID N0:22]) to the XmaI site of pGV740, followed by Not I digestion and 20 religation. This resulted in pGV760, which is a promoter-less PVX-GFP
amplicon with a mutant lox D117 site upstream of the transcription start site.
Next a yeast 2u-trp fragment was isolated by PCR using primers GV 165 [SEQ ID
N0:23) and GV 166 [SEQ ID N0:24] and cloned by recombination around the Sph I site in Sph I- cut pGV760 by transforming the vector and tareet into yeast.
25 DNA from yeast colonies prototrophic for trp was isolated and transformed into E. coli. Ampicillin-resistant E. coli were confrmed to be the desired yeast-E.
coli shuttle plasmid, pGV774. A 391 by of 35S promoter+lox P site was isolated by PCR using primers GV170 [SEQ ID N0:25] and GV171 [SEQ ID N0:26] on ' pGV740 with an Xma I site at 3' end of the lox P site and cloned by yeast 30 recombination using 20 by overlaps to regions flanking the Nar 1 site in pGV774.
The resultant plasmid, pGV783, is a yeast-E. coli shuttle vector containing a floxed, excisional PVX-GFP ampIicon flanked by tandem WT and lox D 1 I 7 sites.
As an excisonal amplicon is represented by element B with or without elements A
and/or C in Figure 1.
35 Inactive Movement-defective Excsional PVX Amplicom The coat protein gene in excisional PVX-GFP amplicon in pGV783 was deleted by Xho I and Sal I digestion of pGV783 followed by religation to result in a movement-defective amplicon, pGV819. This mutant amplicon was isolated as a Xma I fragment and cloned into the Xma I site of pBFNl9 binary vector to result in pBE8I9. This was introduced into tobacco plants via agrobacterium-mediated transformation.
Inactive Excsional PV's AmQlicon with Dual Reporters for Foreign Protein i Expression To demonstrate that the amplicons can be used to both express a foreign -protein as well as silence an endogenous gene. pGV784 was made. This construct is a yeast-E. coli shuttle vector containing a floxed excisional PVX- CP-GFP-PDS
amplicon with Vv'T and lox D 117 sites. The Avr II/Sac I 3.6 kb band from 10 pGV770 was cloned into the Avr II/Sac I cut pGV783. pGV770 is PVX-GFP-PDS-CP amplicon. It contains a chimera of the GFP ORF (740 bp) followed by a ca. 200 by fragment of partial A'. bentkamiana phytoene desaturase cDNA. It was constructed by two-step PCR. First. the entire GFP ORF was isolated by PCR on plasmid pGV680 using primer pairs GV 162 [SEQ ID N0:27)/GV 163 [SEQ iD
15 N0:28] and a 200 by N. benthamiarza phytoene desaturase sequenced was isolated by PCR using primer pairs GV 133 [SEQ ID N0:29J/GV 109 [SEQ ID N0:30] on plasmid pGV723 that carries a partial N. benthamiana phytoene desaturase eDNA
clone [Ruiz et. al. (1998) Plant Cell 10:937-946], since the 3' 18 by sequence of these primers is specific for the phytoene desaturase sequence, these 18 by 20 sequences can also be used isolating the sequence directly by RT-PCR from mRNA isolated from N. benthamiana leaf, by techniques well known by one skilled in the art. Next, these 2 fragments were ligated by Age I/Xma I sites introducted by the primers and re-amplified by PCR using GV 162 [SEQ ID
I~T0:27] and GV 109 [SEQ ID N0:30]. The entire chimeric GFP-PDS fragment ?5 was digested with Cla I and Xho I and cloned into the Cla I-Sal I sites of pVX201 to result in pGV770. The Avr II/Sac I 3.6 kb band from pGV770 was cloned into the Avr IIISac I cut pGV783 (see below) to result in plasmid pGV784. In this case, the excsional amplicon in pGV784 represents element B without elements A
and C in Figure I. It was isolated as a 8.387 kB Xma I fragment and cloned into 30 Xma I site of pain l 9 binary vector to result in pBE784, which was introduced into tobacco via agrobacterium-mediated transformation.
Primers referred to in the above discussion are given below:
GVB
~'-GAG GCA TGC CCG GGC ABC ATG GTG GAG CAC GAC :~-:' [SEQ ID N0:16~
5'-TAT GCG GCC GCA TAA CTT CGT ATA GCA TAC ATT ATA CG A AGT TAT
ATA GAG GAA GGG T-3' [SEQ 1D N0:17]
W O 00/17365 PCT/US99I2 t 989 TCC TTG ATC CGC GGG TTT CTT CTC ATG T [SEQ ID NO:IB]
~'-TCC TTG ATC CGC GGG TTT CTT CTC ATG T-3' [SEQ ID NO:I9]
5'-CAC GCA TGC ACT ATC CTT CGC AAG ACC C-3' [SEQ ID N0:20]
5'-CCG GGG CGG CCG CAT AC-3' [SEQ ID N0:21 ]
1 ~ ~'-CCG GGT ATG CGG CCG CC-3' [SEQ ID N0:22]
5'-ACC ATG ATT ACG CCA AGC TTA AGA AAA GGA GAG GGC CAA GA-3' [SEQ ID N0:23]--S'-AGT TAT GCG GCC GCC CCG GGC AT.4 TGA TCC AAT ATC AAA GGA-3' [SEQ ID N0:24]
5'-GCG CAG CCT GAA TGG CGA ATG GCG CCC CA.~ AaA TAT C:~~ AG:a T.=~C
A-3' [SEQ ID N0:2~]
~'-AAG GAG AAA ATA CCG CAT CAC CCG GG,A TAA CTT CGT ATA GCA TAC
A-3' [SEQ ID N0:26]
GV 162 (25-mer) 5'-GCC AAT CGA TCA 'rGA GTA AAG GAG .~-3' [SEQ ID N0:27]
3~
GV 163 (35-mer) 5'-GCT AAC CGG TAG ACA TTT ATT TGT ATA GTT CAT CC-3' [SEQ ID
N0:28]
S~
GV 133 (34-merl 5'-GAA GTC GAC CGC GGG CAG ACT AAA CTC ACG AAT A-3' GV 109 (30-mer) ~'-GAA TTC TCG AGC C.AT ATA TGG ACA TTT ATC-3' [SEQ ID N0:30] -Co-Activation Of An Inactive PVX Repiicon And Silencing Suppresser Gene Bv Site-Specific Recombination A silencing suppresser gene will be incorporated into the lox-containin~~
PVX amplicons by two methods. In one method. the ORF of a silencing suppressor will replace the target gene or coat protein ORF in amplicons depicted in Figures 1-3 such that the silencing suppresser is on the replicon. In the second method. the ORF of a silencing suppressor will replace the excsional reporter.
such that it is represented by element C and the floxed amplicon acting as a transcriptional/translational Stop fragment, is represented by element B in Figure 1. In either case. activation of the amplicon will also activate expression of the silencing suppressor gene for overcoming host 's antiviral defense system involving homology dependent silencing and result in higher replication and higher foreign protein production.
Co-Activation Of An Inactive (Inverted PVX Replicon And Silencinc Suppresser Gene By Site-Specific Recombination pG~'71-; is a non-functional PV~i-GFP ampiicon with inverted lox P sites.
?s whose construction is described above. It was used to make coat protein replacement vectors. pGV806 and pGV808. For pGV806. the ORF of the coat protein in pGV714 was replaced with that of silencing suppressor HC-Pro (bases 1057-2433 of tobacco etch virus genome, Gen Bank accession number M15239) or P1-HC-Pro (bases 145-2433 of tobacco etch virus genome, Gen Bank accession number ~.M 52 ~91 isolated from plasmid PtI-009 (American Type Culture Collection. ATCC 45030. This cloning was done by homologous recombination in yeast [Hua, S. B, et al., (1997) Plasmid 38(2):91-6: Oldenburg, K. R.. et al.:
(1997) Nucleic.~lcids Res 25(2):451-2, and Prado. F., et al., (1994) Curr Genct 199 Feb:2~('_'):1 ~0-~j. For this, first a PCR fragment containing the yeast selection marker (trp) and 2 micron yeast origin of replication was made by using PCR primers P? I 6 and P? 17 [SEQ ID Nos: 31 and 32]. The ~' ?~ bases of these primers have homology to either side of the Kas I in the E. toll vector of pGV714.
such that co-transformation of the PCR product into yeast cells alongwith ;;
Kas I-linearized pGV714 resulted in the cloning of the yeast fragment by gap reapir (homologous recombination across the Kas I site in the vector) resulting in an E. coli-yeast shuttle vector, pGV800. Next, PCR products containing HC-Pro or P1-HC-Pro were made bs usin_ PCR primer pairs P?3 ~-P23~ [SEQ ID N0:3s and 3~ respectively] and P234-P?3~ [SEQ ID NO: 34 and 33 respectively).
respectively, on pTL-0059. The 33 5'-terminal bases in P'_'~3 and 30 5'-terminal -bases in P234 are homologous to the coat protein promoter, while 31 5'-terminal bases in 235 are homologous to the 3' UTR of the coat protein ORF.
Co-transformation of HC-Pro or P1-HC-Pro PCR products alongwith Stu I
10 linearized pGV800 resulted in gap repair (homologous recombination across the Stu I site in the coat protein ORF) and replacement of the coat protein coding sequence with that of HC-Pro or P1-HC-Pro to result in pGV806 and pGV808, respectively. These silencing suppressors replace the coat protein ORF in amplicons represented by Figure 2.
1 ~ Primers referred to in the preceding discussion are given below:
P216(46-mer) GCC AAG A-3' [SEQ ID N0:31) The 2~ 5'-terminal bases (underlined) are homologous to pGV714 vector, and 21 20 3'-bases are homologous to the yeast fragment.
P217(47-mer) 5'-GCG CAG CCT GAA TGG CGA ATG GCG CCA TAT GAT CCA ATA
TC.A AAG GA-3' [SEQ ID \0:32J
2~ The 25 5'-terminal bases (underlined) are homologous to pGV714 vector, and '-bases are homoloeou~ to the yeast fraement.
P233 (52 by UP for HCP1:
p'-AAC GGT TAA GTT TCC ATT GAT ACT CGA AAG ATG AGC GAC
30 AAA TC A ATC TCT GA-3" [SEQ ID N0:33) The 33 5'-terminal bases (underlined) are PVX coat protein promoter in pGV800 and 20 3'-bases are homologous to S' terminus of HC-Pro coding sequence.
P234 (50 by UP for P1-HC-Proj:
3> >'-AAC GGT TAA GTT TCC ATT GAT ACT CGA AAG ATG GCA CTG ATC
TTT GGC AC-3" [SEQ ID N0:34) ;4 The 30 5'-terminal bases (underlined) are homologous to PVX coat protein promoter in pGV 800 and 20 3'-bases are homologous to 5' terminus of P 1-HC-Pro coding sequence.
P235 (53 by LP for HCP):
~'-GGG GTA GGC GTC GGT TAT GTA GAC GTA GTT ATC CAA CAT TGT _ AAG TTT TCA TT-3" [SEQ ID N0:35]
The 31 5'-terminal bases (underlined) are homologous to 3'-UTR of PVX coat protein sequence in pGV800 and 22 3'-bases are homologous to 3' terminus of HC-Pro coding sequence.
These modified PVX cDNAs carrying GFP and silencing suppressors without coat protein will be used to transform tobacco plants via agrobacterium-mediated transformation known to one skilled in the art. For example, the amplicon in pGV806 was isolated as a 8.3 kB Bspel and Xma I fragment and 1 ~ cloned into Xma I linearized pBI101. Upon controlled Cre-mediated recombination, co-activation of viral replication without systemic spread and of silencing suppressor .will enhance foreign protein, in this case GFP
production.
Co -Activation Of An Inactive Excisional PVX Renlicon And Silencing Suppresser Gene Bv Site-Specific Recombination The entire region between the lox sites containing the PVX cDNA and the 35S promoter from plasmid pGV783 can be isolated and cloned between lox sites, as element B, with elements A and/or C in Figure 1. For this, the sequence of and around the lox sites before excision will be:
atgATAACTTCGT4TAGCATACATTATACGAAGTTAT fSEO ID N0:361 -inactive PVX amplicon -TAAIvTTAA.ATAACTTCGTATAGCATACATTATACGAAGTTAT SI EOID
N0:37 Q; and after excision it is:
atgATAACTTCGTATAGCATACATTATACGAAGTTATfSEO iD No:3sl Q;
where the lowercase codon is the initiation codon, the underlined sequences are the wild type lox P site flanking the inactive replicon, N is any base, and Q
is the coding sequence of the silencing suppressor, such that it is in-frame to the initiation codon after excision. Thus. the silencing suppresser is not translated unless the blocking fragment is excised to restore its proper reading frame.
The wild t~-pe lox sequence will also be replaced by mutant ones for enhanced conditional specificity while preserving this translational activation by methods kno~~n to one skilled in the art.
CXAMPLE ~
Co-Activation Of An Inactive (Flo~ced) Geminivirus Replicon And Silencing Suppresser Gene Bv Site-Specific Recombination: Suppresser Gene IS Cm The Renlicon .-~ silencin~~ suppresser gene will be incorporated into the iloxed geminivirus vector by two methods. The ORF of a silencing suppresser will - .
replace either the GUS ORF or the luciferase ORF in pGV7 33. In the former case, the silencing suppresser is on the replicon (as an element B with or without elements A and/or C in Figure 1. While in the latter case, it is outside the 10 replicon. as element C alongwith elements A and B in Figure 1, such that element B acts as a transcriptional/translational Stop fragment. An example of translational stop fragment is as described above for PVX. In either case.
activation of the replicon will also activate expression of the silencing suppresser gene for overcoming host 's antiviral defense system involving homology I ~ dependent silencing and result in higher replication and higher foreign protein production.
Flexed Binarv TGMV With GFP Replacing The Coat Protein A coat replacement vector of TGMV was made with GFP. For this a PCR
20 fragment containing the yeast selection marker (trp) and 2 micron yeast origin of replication was made by using PCR primers P216 and P217 [SEQ ID N0:31 and 32] and cloned into the Kas I in the E. coli vector in pCST.A [~~on Arnim.
Albrechit: Stanley. John. I~irology ( 1992), 186( I ), 286-93], obtained from Dr.
John Stanley (John lnnes Center. lvorwich. United Kingdom) by gap reapir (homologous recombination across the Kas I site in the vector, as described previously) resulting in an E. coli-yeast shuttle vector. pGV79 ~. New, a PCR
product containin~~ 796 by GFP ORF was made from plasmid psmGFP [Davis. S.
J. and Vierstra. R. D. ( 1998) Plant Molecular Biolo~t~ 36:21-528] with primers P218 [SEQ ID N0:39] and P219 [SEQ ID NO:~10] and cloned into Hpa I ~ BstB 1 30 cut pGV793 by yeast cloning to result in pGV798. P? 18 is a 49 by primer whose ~' 29 bases is homologous to the coat protein promoter and 3' 18 by has homology to ~' end of GFP ORF (except for 2 by mismatch), while P219 is a 48-mgr. whose ~' 31 bases is homologous to coat protein 3' untranslated region and 3' 18 bases are homologous to the 3' end of GFP ORF. Finally. the Sac I-Nhe I franment coat 3~ protein in pGV6~ 1, a TGMV-A dimer (PCT Int. Appl. WO 99'22003) was replaced with that from pGV798 to make pGV802. a TGMV-A dimer with GFP
replacing the coat protein.
~6 When 1\'. 6enthamiarur was co-bombarded with pGV802 and TGMV-B
dimer (obtained from Dr. D. Robertson. North Carolina State University).
infected tissue expressed GFP that was persistent and did not silence for at least months. To make a floxed TGMV-GFP replicon. a single copy of the replicon will be isolated as a Mfe I partial and cloned into the Eco RI site of pGV690, as described above. The Bam HI- Xho 1 fragment containing GFP ORF of the -resulting plasmid will be used to replace the GUS ORF in pBE733, cut with Bam HI and Xho I. This binary vector will be transformed into plants via agrobacterium-mediated transformation alone or co-transformed with plasmid 10 pBE79s. pBE79~ is a binary vector containin; TGMV-B dimer. 1t was made by the replacing the Sma I to Sal I sequence of pBIB. [Becker. D. (1990) Nucleic Acids Research 15:203] with that of BsrB I to Sal I frafiment of TGMV B dimer.
P218 IITP primer for GFP ORFl~49-merl 1 ~ ~'-A.A.A GTT AT.A TAA AAC GAC ATG CGT TTC GTA GAT CTA AGG
AG.A TAT AAC A- 3' [SEQ ID N0:39]
P219 lLP for GFP ORFI (48-merl 20 5'-AAT TTT ATT AAT TTG TTA TCG AAT CAT AAA TTA TTT GTA TAG' TTC ATC-3' [SEQ ID N0:40]
Transtenic Lines Exnressine Reeulated Chimeric Cre Genes For ciiimeric replicase genes the Cre ORF was isolated as a 1.3 kB
Nco I-Xba I fragment from a 3~S:Cre plasmid and used to replace the Nco I-Xba fragment containing the 10 kD ORF in pGV6~6 and the Nco I-Xba I fragment containing the ACMV replication protein in pGV6~9 to result in plasmids 30 pGV69~ and pG~'69~, respectively. The Hind III fragment from pGV692 containing the \~c:C're gene w-as cloned into the Hind III site of pBinl9 (GEN
BANK ACCESSION U0936~) and pBE673 (described in PCT Int. Appl.
V'O 99;'?200.) to yield binan~ plasmids pBE69? (with plant kanamycin resistance ~_ene~ m:d nBE69~h (with plant phosphothricon resistance ~encl. respectively.
The Bam HI-Bam HI-Asp718 I partial fragment from pGV693 containing the IN:C're <zene cloned into Bam HI-Asp718 I cut pBinl9 and pBE67s to yield binay piasmids pBE693 and pBE693b, respectively. Nicotiarza benthamiana and h'. tabacum var.karuhi were transformed with agrobacterium BA69? and BA693 ~7 containing binary plasmids pBE692 and pBE693. respectively. These transgenic plants will be crossed with those carrying the floxed viruses.
A chimeric II~':Cre gene was modifed to reduce its translationability in order to tolerate leaky Cre transcription. Since. it has been reported that small upstream ORFs usually reduce, or in extreme cases preclude, downstream translation [Kozak, ivl. ( 1996) Mammalian Genome. 7. 563-74], pGV693 was linearized with the unique Nco I site at the initiation codon of the Cre ORF
and ligated an adapter made up of primers P224 [SEQ ID N0:41] and P225 [SEQ ID
N0:42]. This resulted in the addition of 39 by sequence upstream of the 10 translation initiation codon including 21 by ORF 18 by upstream of the translation initiation codon. The modification in the resultant plasmid, pGV787, was confirmed by DNA sequencing. Bam HI fragment from pGV787 was used to replace the corresponding region in pBE673 to yield pBE787 binary vector. This vector was tested in transaenic plants.
15 Primers used in the preceeding discussion are given below:
5'-CAT GCG TGT CGC ATA CTA TTA CTA ATA GGC AGC GAG GAT-3' [SEQ ID N0:41 P22~
20 ~'-CAT GAT CCT CGC TGC CTA TTA GTA ATA GTA TGC GAC ACG-3' (SEQ ID N042]
Screening for Correctly Regulated Cre Expression And Use of Mutant Lox Sites A system was developed to enable the selection of transgenic lines that have correctly regulated Cre expression. The luciferase gene was chosen as a 25 sensitive. non-destructive reporter for Cre-mediated excision. A set of floxed vectors. pC,V751-7~4. that contain the basic cassette ''35S promoter-loa-NPT
II
gene-rbcS 3' terminator-Nos 3' terminator-lox-Luc'' were chosen. Cre expression would excise the 'STOP' fragment containing NPT II gene and the transcriptional terminator sequences benyeen the lox sites, thus. switching on luciferase 30 expression. Thus. the excision of NPT II gene during selection will render the plants sensitive to kanamycin selection. Co-transformation of these bar-resistant binary vectors carrying IN2:Cre (pBE692) or Vc:Cre (pBE693), as described previously, on kanamycin + bar selection plates allowed for the selection of transgenic lines where Cre expression is low enough not to mediate 3 ~ recombination.
Using the above selection method the efficacy of mutant lox sites to improve the 'specificity' of the regulated promoters expressing Cre was tested.
Several mutant lox sites have been published that have been reported to require ~8 more Cre protein to activate the site-specific recombination [Albert et al., Plant J.
When pGV681 was bombarded into cotyledons ca. ~0-100 mg soy°bean zygotic embryos. GUS staining detected replication of the PVX vector 10-14 days post bombardment. This showed that PVX can replicate in seed tissue and in asy diverse plant species as Glycine max and Nicotiana benthamiana.
10. Introduction of Inverted Mutant I ox sites in PVX Am~licons:
A mutant lox site (lox 43) was introduced by PCR into PVX-GFP
amplicon. For this, PCR products I and II were made using pGV681 as the template and PCR primer pairs I [SEQ ID No:S (GV70. upper primer) and SEQ
ID No:6 (GV71, lower primer)] and II [SEQ ID No:7 (GV73, upper primer) and 1 ~ SEQ ID No:8 (G',~72, lower primer)], respectively.
[SEQ ID No:~] 5'-GCG GCA TGC GTC GAC ACA TGG TGG AGC .4CG ACA-S' (GV70) [SEQ ID No:6] 5'-GCC GGG TAC CGA GAC GCG TCA TCC CTT ACG-3' (GV71 ) 20 [SEQ ID No:7] ~'-GTC TCG GTA CCT ATA ATG TAT GCT ATA CGA AGT
TAT ATA AGG AAG TTC ATT TCA-3' (GV73), [SEQ ID No:8] 5'-TGA TCC GCG GGT TTC TTC TCA TGT-3' (GV7?).
PCR product I was digested with Sphl and Asp718 and PCR product II
with Asp718 and Sac II to result in 369 by and 464 by fragments. respectively.
pGV680 plasmid was digested with Sph I and Sac II and the 979? by vector .
fragment was ligated in a 3-way ligation with the two PCR fragments to yield plasmid pGV701 containing mutant lox 43 site between the As-1 element and the TATA box in 3~S promoter of the amplicon.
A mutant lox site (lox 44) was inserted by adaptor ligation in the 30 untranslated region ~' to the GUS ORF in pGV681. For this, pGV681 was digested with Xma I and ligated to an adaptor made by annealing the following two ~ 1-mer primers:
[SEQ ID No:9] ~'- CCG GGA ATG CAT GCT ATA GCA T.AC ATT ATA CGA
AGT TAT TCG AAT TTA AAT -3' 3~ [SEQ ID No:lO] ~'-CCG GAT TTA AAT TCG AAT AAC TTC GTA TAA TGT
ATG CTA TAG CAT GCA TTC -3' Following Swa I digestion of the ligated DNA. the linear DNA was isolated. religated. and traniormed into E. coli to yield plasmid pGV700.
Inserting lox 44 in PVX-GUS amplicon yielded a 31 amino acid-N-terminal extension of the GUS ORF. Mutant lox 4s and lox 44 sites in pG~'70U and pGV701were confirmed by DNA sequence analysis.
PVX-GFP and PVX-GUS amplicons with nvo inverted lox sites were made by combining the above mutant lox sites. Thus. for PVX-GUS. the Avr II-Sac I fragment. containing the GFP ORF. of pGV701was replaced with -that of pGV700. cam~in~ lox 44 and GUS ORF. yielding pGV70?. For PVX-GFP. the 4432 by Age I-Cla I fragment in pGV701 was replaced with the 4476 by Age I-BstB 1 fragment. carrying lox 44, of pGV700, yielding pGV708 I 0 with a 23 amino acid-N-terminal extension of the GFP.
Detached leaves of ~'~'icotiana bentlTamiaraa mere bombarded with plasmids pGV700, pGV701, pGV702. and pGV708 using the biolistic gun. Based on expression of the reporter genes in the leaves 10-14 days after bombardment, replication.was observed in all four cases. although the level of replication was 1 ~ lower in pGV708. These results show that insertion of lox sites in the plant promoter and/or in the intergenic sequence ~' to the reporter genes does not affect replication. The poorer GFP fluorescence in pGV708 may be due to the N-terminal extension on GFP protein.
To obtain a non-functional amplicon, pGV702 and pGV708 were passaged 20 through Cre-expressing bacteria or incubated with purified Cre enzyme (Novagen, Madison WI) to invert the sequence between the inverted iox sites. However, no inversion was detected in either plasrnid. This may be due to poor efficiency of inversion with these mutant lox sites that were the most inefficient in Cre-lox recombination.
25 Introduction of Inverted 'Vild Tvpe I_ox P sites in P~'1 Amplicons:
A wild-type lox P site was cloned as an adaptor into the Cla I site in the intergenic region. ~' to GFP ORF in piasrnid pGV701 followed by Xma I
digestion, isolation of the linear vector and its self ligation to yield piasmid pG~'712. The adaptor was made by annealing primers GV78 (SEQ ID No:l l) 30 and G~'77 (SEQ ID No:l2) [SEQ ID No: l l ] ~'-CGA TAA CTT CGT ATA ATG TAT GCT ATA CGA AGT
TAT CCC GGG-s' (G~'78 j [SEQ ID No: I ~] ~'-CGC CCG GGA TAA CTT CGT .ETA GCA TAC ATT .ATA
CGA AGT TAT-~' (G~'77 s~ The mutant log ~13 site in 3~S promoter in pG~~712 was replaced by a wild-type lox P site as follows. .-~ PC'R product was made on pGV71'' DNA
template using an upper primer GV74 (SEQ ID No: l3) and a lower primer GV72.
(SEQ ID No:8).
t 7 [SEQ ID No:l3] s'- Gt~~I~ GAC GCG TAT AAC TTC GTA TAA TGT-3' (GV74) The PCR product was digested with Mlu I and Sac II, and the resulting product was used to replace the 1\~tlu I-Sac II fragment containing lox 44 in pGV7I? to yield plasmid pGV713. pGV713 contains two inverted wild-type lox P sites. Incubation of pGV713 with Cre recombinase as sujgested by the manufacturer (Novagen. Madison. Vv) inverted of the DNA sequence between the -lox P sites containing the IL'~1A dependent RNA polymerase to yield a non-functional amplicon in plasmid pGV714. Plasmid pGV714 was purified following transformation of E. colt XL1 cells.
10 A wild-type lox P site was cloned as an adaptor into the Cla I site in the intergenic region ~' to GUS ORF in plasmid pGV702. For this plasmid pGV702 was linearized with Xma I, ligated to adaptor annealed from primers GV80 [SEQ
ID N0:14] and GV81 [SEQ ID NO:I S].
[SEQ ID No:l4] ~'-CCG GGG ATA ACT TCG TAT AGC ATA C.AT TAT ACG
I ~ AAG TTA TTC GAA CAT TTA AAT -3' GV80 [SEQ ID No:15] ~'- CCG GAT TTA AAT GTT CG A ATA ACT TCG TAT AAT
GTA TGC TAT ACG AAG TTA TCC -3' GV81 The resulting plasmid, designated pGV702W. was used to construct PVX-GUS with inverted wild-type lox P sites. For this, the Avr II-Sac I
fragment, 20 containing the GFP ORF, of pGV713 was replaced with that of pGV702W, carrying lox P and GUS ORF yielding pGV708W.
The inability of the inverted non-functional arriplicons to replicate without undergoing Cre-mediated inversion to a functional amplicon was confirmed by bombardment of tVicntiana benthamiana leaves. Plasmids pG~'71? and pGV713 replicated and spread in the bombarded leaves. This was clear from the showing that GFP fluoresence was detected 10-14 days after bombardment. However.
plasmid pG~'?14 did not .eplicate unless co-bombarded with plasmid pNY102 that expresses Cre under the control of a 35S promoter. The 3.01 I:B BspEl-Sac fragment containing the inverted, non-functional amplicon from plasmid pGV714 30 was cloned into Xma I (BspEl compatible)-Sac 1 cut pBEb74. a binary vector with bar selection in plants, as described above, to result in pBE714. Plasmid pBE714 was introduced via agrobacterium LBA4404 in wild type Nicotiana benthamiarta plants, as described above. The plants were selected on PPT
30 ug/ml phosphonithricin shooting and then 10 uglml rooting media. 10 3s transformants (714B ~s E-~. E-6. G-1. M-4. M-6. M-7, Q-I. S-4, LL-1. UU-1) were obtained. Southern analyses showed that all were positive for the transgene except for M-7 and Q-I . .All appeared phenotypical)v normal and without any viral symptoms.
PCT/US99/? 1989 The ability of the transfotmants to be transactivated by Cre expression was tested using infection with PVX expressing Cre. Leaves from five positive 714 B
transgenic plants (LL-1. UU-l, E-~. M-4. and S4) were bombarded with the particle gun using 1 u~~ of a plasmid DNA carving chimeric 35S:Cre gene to test for amplicon activation or with gold alone as a control. After ca. ~ days. GFP
expression was noted in leaves of three (LL-1, M-4. and S4) of the five transgenic-plants bombarded with 35S:Cre but not with gold alone control. After ca 12 days.
the GFP expression in the transgenic leaves bombarded with 35S:Cre diminished.
suggesting that silencing might was occuring, as is often seen upon infection of wild type leaves with PVX-GFP. The expression levels, spread, and duration of GFP in Cre-activated leaves were comparable to that of PVX:GFP bombarded directly into wild type lit. benthamiana leaves.
Five out of eight Tl progeny seedlings of 714B transgenic LL-1 showed GFP expression upon bombardment with 3~S:Cre. Similar bombardment of 1 ~ detached leaves from 12 other progeny seedlings showed that 11 were positive for activation. Thus, the inactive virus is heritable and the progeny capable of being Cre-activated. The expression levels, spread, and dtu~ation of GFP in Cre-activated seedlings was slightly variable between the T1 progeny individuals but were generally comparable to that of PVX:GFP bombarded directly into wild type 2U' N. benthamiana seedlings.
714B transgenic lines will be genetically combined with correctly regulated Cre chimeric genes. for example by crossing with transgenic Lines carrying such Cre genes.
?s Excisional Inactive Pvx Amplicons To make a PVX Rl~IA virus replicon flanked by tandem lox sites, two PCR
products were made on pGV680: a 438 by PCR product containing the TATA
box ('minimal promoter') and lox P site using primer pairs GV8~ [SEQ ID
N0:16](with Sph I site)-GV86 [SEQ ID N0:17] (with Not I sites) and a 441 by 30 PCR product containing mutant lox site (IoxDl 17) [Abrenski, K. and Hoess R.
(1980 J. Mol. Biol. 184:211-220] and 5' end of the PVX cDI~iA usinD primer pairs GV87 [SEQ ID N0:18] (with Not I site)-GV88 [SEQ ID N0:19] (with Sac II
site). Then. the two PCR products were digested with Not I, ligated. and used as template for PCR usin~~ primer pairs: GV 10~ [SEQ ID N0:20] and GV88 [SEQ
3 ~ ID NO:19] primers to give the X09 by PCR product. The resultant PCR
product was digested with Sph I and Sac II and the X09 by fragment containing the TAT.A
box ('minimal promoter) followed by tandem wild type and mutant (Dl 17) lox P
sites in front of the amplicon cDNA was isolated and cloned into Sph I-Sac 1I
digested pGV680 to give pGV720. Thus, pGV720 is a PVX-GFP amplicon with minimal 35S promoter and tandem IoxP and loxDl 17 sites between the TATA
box and the transcription start site. pGV720 did not replicate efficiently when bombarded into N. benthamiana. Therefore, is was replaced with the full length promoter, which was isolated as a 438 by PCR product using PCR primers GV85 [SEQ ID N0:16] (with Sph I site) and GV86 [SE ID N0:17] (with Not I site) on _ pGV680 and cloned into Sph I-Not I digested pGV720 to result in pGV740.
Thus, pGV740 is a PVX-GFP amplicon with 35S promoter and tandem loxP and loxDl 17 sites between the TATA box and the transcription start site. pGV740 could replicate when bombarded into N. benthamiana even without a Cre expressing gene, suggesting that the amplicon can have at least 66 by between the TATA box and the 5' end of PVX cDNA.
Although pGV740 may be readily inactivated by the insertion of a Transcriptional STOP fragment in the Not I site as represented in Figure 3 it was decided to make an excisional replicon that physically excises the RNA virus amplicon from the chromosome upon site-specific recombination. For this, the promoter at the end of PVX cDNA was moved by first deleting the promoter by ligating a XmaI/NotI/XmaI adapter (primers GV 157 [SEQ ID N0:21 J and GV I 58 [SEQ ID N0:22]) to the XmaI site of pGV740, followed by Not I digestion and 20 religation. This resulted in pGV760, which is a promoter-less PVX-GFP
amplicon with a mutant lox D117 site upstream of the transcription start site.
Next a yeast 2u-trp fragment was isolated by PCR using primers GV 165 [SEQ ID
N0:23) and GV 166 [SEQ ID N0:24] and cloned by recombination around the Sph I site in Sph I- cut pGV760 by transforming the vector and tareet into yeast.
25 DNA from yeast colonies prototrophic for trp was isolated and transformed into E. coli. Ampicillin-resistant E. coli were confrmed to be the desired yeast-E.
coli shuttle plasmid, pGV774. A 391 by of 35S promoter+lox P site was isolated by PCR using primers GV170 [SEQ ID N0:25] and GV171 [SEQ ID N0:26] on ' pGV740 with an Xma I site at 3' end of the lox P site and cloned by yeast 30 recombination using 20 by overlaps to regions flanking the Nar 1 site in pGV774.
The resultant plasmid, pGV783, is a yeast-E. coli shuttle vector containing a floxed, excisional PVX-GFP ampIicon flanked by tandem WT and lox D 1 I 7 sites.
As an excisonal amplicon is represented by element B with or without elements A
and/or C in Figure 1.
35 Inactive Movement-defective Excsional PVX Amplicom The coat protein gene in excisional PVX-GFP amplicon in pGV783 was deleted by Xho I and Sal I digestion of pGV783 followed by religation to result in a movement-defective amplicon, pGV819. This mutant amplicon was isolated as a Xma I fragment and cloned into the Xma I site of pBFNl9 binary vector to result in pBE8I9. This was introduced into tobacco plants via agrobacterium-mediated transformation.
Inactive Excsional PV's AmQlicon with Dual Reporters for Foreign Protein i Expression To demonstrate that the amplicons can be used to both express a foreign -protein as well as silence an endogenous gene. pGV784 was made. This construct is a yeast-E. coli shuttle vector containing a floxed excisional PVX- CP-GFP-PDS
amplicon with Vv'T and lox D 117 sites. The Avr II/Sac I 3.6 kb band from 10 pGV770 was cloned into the Avr II/Sac I cut pGV783. pGV770 is PVX-GFP-PDS-CP amplicon. It contains a chimera of the GFP ORF (740 bp) followed by a ca. 200 by fragment of partial A'. bentkamiana phytoene desaturase cDNA. It was constructed by two-step PCR. First. the entire GFP ORF was isolated by PCR on plasmid pGV680 using primer pairs GV 162 [SEQ ID N0:27)/GV 163 [SEQ iD
15 N0:28] and a 200 by N. benthamiarza phytoene desaturase sequenced was isolated by PCR using primer pairs GV 133 [SEQ ID N0:29J/GV 109 [SEQ ID N0:30] on plasmid pGV723 that carries a partial N. benthamiana phytoene desaturase eDNA
clone [Ruiz et. al. (1998) Plant Cell 10:937-946], since the 3' 18 by sequence of these primers is specific for the phytoene desaturase sequence, these 18 by 20 sequences can also be used isolating the sequence directly by RT-PCR from mRNA isolated from N. benthamiana leaf, by techniques well known by one skilled in the art. Next, these 2 fragments were ligated by Age I/Xma I sites introducted by the primers and re-amplified by PCR using GV 162 [SEQ ID
I~T0:27] and GV 109 [SEQ ID N0:30]. The entire chimeric GFP-PDS fragment ?5 was digested with Cla I and Xho I and cloned into the Cla I-Sal I sites of pVX201 to result in pGV770. The Avr II/Sac I 3.6 kb band from pGV770 was cloned into the Avr IIISac I cut pGV783 (see below) to result in plasmid pGV784. In this case, the excsional amplicon in pGV784 represents element B without elements A
and C in Figure I. It was isolated as a 8.387 kB Xma I fragment and cloned into 30 Xma I site of pain l 9 binary vector to result in pBE784, which was introduced into tobacco via agrobacterium-mediated transformation.
Primers referred to in the above discussion are given below:
GVB
~'-GAG GCA TGC CCG GGC ABC ATG GTG GAG CAC GAC :~-:' [SEQ ID N0:16~
5'-TAT GCG GCC GCA TAA CTT CGT ATA GCA TAC ATT ATA CG A AGT TAT
ATA GAG GAA GGG T-3' [SEQ 1D N0:17]
W O 00/17365 PCT/US99I2 t 989 TCC TTG ATC CGC GGG TTT CTT CTC ATG T [SEQ ID NO:IB]
~'-TCC TTG ATC CGC GGG TTT CTT CTC ATG T-3' [SEQ ID NO:I9]
5'-CAC GCA TGC ACT ATC CTT CGC AAG ACC C-3' [SEQ ID N0:20]
5'-CCG GGG CGG CCG CAT AC-3' [SEQ ID N0:21 ]
1 ~ ~'-CCG GGT ATG CGG CCG CC-3' [SEQ ID N0:22]
5'-ACC ATG ATT ACG CCA AGC TTA AGA AAA GGA GAG GGC CAA GA-3' [SEQ ID N0:23]--S'-AGT TAT GCG GCC GCC CCG GGC AT.4 TGA TCC AAT ATC AAA GGA-3' [SEQ ID N0:24]
5'-GCG CAG CCT GAA TGG CGA ATG GCG CCC CA.~ AaA TAT C:~~ AG:a T.=~C
A-3' [SEQ ID N0:2~]
~'-AAG GAG AAA ATA CCG CAT CAC CCG GG,A TAA CTT CGT ATA GCA TAC
A-3' [SEQ ID N0:26]
GV 162 (25-mer) 5'-GCC AAT CGA TCA 'rGA GTA AAG GAG .~-3' [SEQ ID N0:27]
3~
GV 163 (35-mer) 5'-GCT AAC CGG TAG ACA TTT ATT TGT ATA GTT CAT CC-3' [SEQ ID
N0:28]
S~
GV 133 (34-merl 5'-GAA GTC GAC CGC GGG CAG ACT AAA CTC ACG AAT A-3' GV 109 (30-mer) ~'-GAA TTC TCG AGC C.AT ATA TGG ACA TTT ATC-3' [SEQ ID N0:30] -Co-Activation Of An Inactive PVX Repiicon And Silencing Suppresser Gene Bv Site-Specific Recombination A silencing suppresser gene will be incorporated into the lox-containin~~
PVX amplicons by two methods. In one method. the ORF of a silencing suppressor will replace the target gene or coat protein ORF in amplicons depicted in Figures 1-3 such that the silencing suppresser is on the replicon. In the second method. the ORF of a silencing suppressor will replace the excsional reporter.
such that it is represented by element C and the floxed amplicon acting as a transcriptional/translational Stop fragment, is represented by element B in Figure 1. In either case. activation of the amplicon will also activate expression of the silencing suppressor gene for overcoming host 's antiviral defense system involving homology dependent silencing and result in higher replication and higher foreign protein production.
Co-Activation Of An Inactive (Inverted PVX Replicon And Silencinc Suppresser Gene By Site-Specific Recombination pG~'71-; is a non-functional PV~i-GFP ampiicon with inverted lox P sites.
?s whose construction is described above. It was used to make coat protein replacement vectors. pGV806 and pGV808. For pGV806. the ORF of the coat protein in pGV714 was replaced with that of silencing suppressor HC-Pro (bases 1057-2433 of tobacco etch virus genome, Gen Bank accession number M15239) or P1-HC-Pro (bases 145-2433 of tobacco etch virus genome, Gen Bank accession number ~.M 52 ~91 isolated from plasmid PtI-009 (American Type Culture Collection. ATCC 45030. This cloning was done by homologous recombination in yeast [Hua, S. B, et al., (1997) Plasmid 38(2):91-6: Oldenburg, K. R.. et al.:
(1997) Nucleic.~lcids Res 25(2):451-2, and Prado. F., et al., (1994) Curr Genct 199 Feb:2~('_'):1 ~0-~j. For this, first a PCR fragment containing the yeast selection marker (trp) and 2 micron yeast origin of replication was made by using PCR primers P? I 6 and P? 17 [SEQ ID Nos: 31 and 32]. The ~' ?~ bases of these primers have homology to either side of the Kas I in the E. toll vector of pGV714.
such that co-transformation of the PCR product into yeast cells alongwith ;;
Kas I-linearized pGV714 resulted in the cloning of the yeast fragment by gap reapir (homologous recombination across the Kas I site in the vector) resulting in an E. coli-yeast shuttle vector, pGV800. Next, PCR products containing HC-Pro or P1-HC-Pro were made bs usin_ PCR primer pairs P?3 ~-P23~ [SEQ ID N0:3s and 3~ respectively] and P234-P?3~ [SEQ ID NO: 34 and 33 respectively).
respectively, on pTL-0059. The 33 5'-terminal bases in P'_'~3 and 30 5'-terminal -bases in P234 are homologous to the coat protein promoter, while 31 5'-terminal bases in 235 are homologous to the 3' UTR of the coat protein ORF.
Co-transformation of HC-Pro or P1-HC-Pro PCR products alongwith Stu I
10 linearized pGV800 resulted in gap repair (homologous recombination across the Stu I site in the coat protein ORF) and replacement of the coat protein coding sequence with that of HC-Pro or P1-HC-Pro to result in pGV806 and pGV808, respectively. These silencing suppressors replace the coat protein ORF in amplicons represented by Figure 2.
1 ~ Primers referred to in the preceding discussion are given below:
P216(46-mer) GCC AAG A-3' [SEQ ID N0:31) The 2~ 5'-terminal bases (underlined) are homologous to pGV714 vector, and 21 20 3'-bases are homologous to the yeast fragment.
P217(47-mer) 5'-GCG CAG CCT GAA TGG CGA ATG GCG CCA TAT GAT CCA ATA
TC.A AAG GA-3' [SEQ ID \0:32J
2~ The 25 5'-terminal bases (underlined) are homologous to pGV714 vector, and '-bases are homoloeou~ to the yeast fraement.
P233 (52 by UP for HCP1:
p'-AAC GGT TAA GTT TCC ATT GAT ACT CGA AAG ATG AGC GAC
30 AAA TC A ATC TCT GA-3" [SEQ ID N0:33) The 33 5'-terminal bases (underlined) are PVX coat protein promoter in pGV800 and 20 3'-bases are homologous to S' terminus of HC-Pro coding sequence.
P234 (50 by UP for P1-HC-Proj:
3> >'-AAC GGT TAA GTT TCC ATT GAT ACT CGA AAG ATG GCA CTG ATC
TTT GGC AC-3" [SEQ ID N0:34) ;4 The 30 5'-terminal bases (underlined) are homologous to PVX coat protein promoter in pGV 800 and 20 3'-bases are homologous to 5' terminus of P 1-HC-Pro coding sequence.
P235 (53 by LP for HCP):
~'-GGG GTA GGC GTC GGT TAT GTA GAC GTA GTT ATC CAA CAT TGT _ AAG TTT TCA TT-3" [SEQ ID N0:35]
The 31 5'-terminal bases (underlined) are homologous to 3'-UTR of PVX coat protein sequence in pGV800 and 22 3'-bases are homologous to 3' terminus of HC-Pro coding sequence.
These modified PVX cDNAs carrying GFP and silencing suppressors without coat protein will be used to transform tobacco plants via agrobacterium-mediated transformation known to one skilled in the art. For example, the amplicon in pGV806 was isolated as a 8.3 kB Bspel and Xma I fragment and 1 ~ cloned into Xma I linearized pBI101. Upon controlled Cre-mediated recombination, co-activation of viral replication without systemic spread and of silencing suppressor .will enhance foreign protein, in this case GFP
production.
Co -Activation Of An Inactive Excisional PVX Renlicon And Silencing Suppresser Gene Bv Site-Specific Recombination The entire region between the lox sites containing the PVX cDNA and the 35S promoter from plasmid pGV783 can be isolated and cloned between lox sites, as element B, with elements A and/or C in Figure 1. For this, the sequence of and around the lox sites before excision will be:
atgATAACTTCGT4TAGCATACATTATACGAAGTTAT fSEO ID N0:361 -inactive PVX amplicon -TAAIvTTAA.ATAACTTCGTATAGCATACATTATACGAAGTTAT SI EOID
N0:37 Q; and after excision it is:
atgATAACTTCGTATAGCATACATTATACGAAGTTATfSEO iD No:3sl Q;
where the lowercase codon is the initiation codon, the underlined sequences are the wild type lox P site flanking the inactive replicon, N is any base, and Q
is the coding sequence of the silencing suppressor, such that it is in-frame to the initiation codon after excision. Thus. the silencing suppresser is not translated unless the blocking fragment is excised to restore its proper reading frame.
The wild t~-pe lox sequence will also be replaced by mutant ones for enhanced conditional specificity while preserving this translational activation by methods kno~~n to one skilled in the art.
CXAMPLE ~
Co-Activation Of An Inactive (Flo~ced) Geminivirus Replicon And Silencing Suppresser Gene Bv Site-Specific Recombination: Suppresser Gene IS Cm The Renlicon .-~ silencin~~ suppresser gene will be incorporated into the iloxed geminivirus vector by two methods. The ORF of a silencing suppresser will - .
replace either the GUS ORF or the luciferase ORF in pGV7 33. In the former case, the silencing suppresser is on the replicon (as an element B with or without elements A and/or C in Figure 1. While in the latter case, it is outside the 10 replicon. as element C alongwith elements A and B in Figure 1, such that element B acts as a transcriptional/translational Stop fragment. An example of translational stop fragment is as described above for PVX. In either case.
activation of the replicon will also activate expression of the silencing suppresser gene for overcoming host 's antiviral defense system involving homology I ~ dependent silencing and result in higher replication and higher foreign protein production.
Flexed Binarv TGMV With GFP Replacing The Coat Protein A coat replacement vector of TGMV was made with GFP. For this a PCR
20 fragment containing the yeast selection marker (trp) and 2 micron yeast origin of replication was made by using PCR primers P216 and P217 [SEQ ID N0:31 and 32] and cloned into the Kas I in the E. coli vector in pCST.A [~~on Arnim.
Albrechit: Stanley. John. I~irology ( 1992), 186( I ), 286-93], obtained from Dr.
John Stanley (John lnnes Center. lvorwich. United Kingdom) by gap reapir (homologous recombination across the Kas I site in the vector, as described previously) resulting in an E. coli-yeast shuttle vector. pGV79 ~. New, a PCR
product containin~~ 796 by GFP ORF was made from plasmid psmGFP [Davis. S.
J. and Vierstra. R. D. ( 1998) Plant Molecular Biolo~t~ 36:21-528] with primers P218 [SEQ ID N0:39] and P219 [SEQ ID NO:~10] and cloned into Hpa I ~ BstB 1 30 cut pGV793 by yeast cloning to result in pGV798. P? 18 is a 49 by primer whose ~' 29 bases is homologous to the coat protein promoter and 3' 18 by has homology to ~' end of GFP ORF (except for 2 by mismatch), while P219 is a 48-mgr. whose ~' 31 bases is homologous to coat protein 3' untranslated region and 3' 18 bases are homologous to the 3' end of GFP ORF. Finally. the Sac I-Nhe I franment coat 3~ protein in pGV6~ 1, a TGMV-A dimer (PCT Int. Appl. WO 99'22003) was replaced with that from pGV798 to make pGV802. a TGMV-A dimer with GFP
replacing the coat protein.
~6 When 1\'. 6enthamiarur was co-bombarded with pGV802 and TGMV-B
dimer (obtained from Dr. D. Robertson. North Carolina State University).
infected tissue expressed GFP that was persistent and did not silence for at least months. To make a floxed TGMV-GFP replicon. a single copy of the replicon will be isolated as a Mfe I partial and cloned into the Eco RI site of pGV690, as described above. The Bam HI- Xho 1 fragment containing GFP ORF of the -resulting plasmid will be used to replace the GUS ORF in pBE733, cut with Bam HI and Xho I. This binary vector will be transformed into plants via agrobacterium-mediated transformation alone or co-transformed with plasmid 10 pBE79s. pBE79~ is a binary vector containin; TGMV-B dimer. 1t was made by the replacing the Sma I to Sal I sequence of pBIB. [Becker. D. (1990) Nucleic Acids Research 15:203] with that of BsrB I to Sal I frafiment of TGMV B dimer.
P218 IITP primer for GFP ORFl~49-merl 1 ~ ~'-A.A.A GTT AT.A TAA AAC GAC ATG CGT TTC GTA GAT CTA AGG
AG.A TAT AAC A- 3' [SEQ ID N0:39]
P219 lLP for GFP ORFI (48-merl 20 5'-AAT TTT ATT AAT TTG TTA TCG AAT CAT AAA TTA TTT GTA TAG' TTC ATC-3' [SEQ ID N0:40]
Transtenic Lines Exnressine Reeulated Chimeric Cre Genes For ciiimeric replicase genes the Cre ORF was isolated as a 1.3 kB
Nco I-Xba I fragment from a 3~S:Cre plasmid and used to replace the Nco I-Xba fragment containing the 10 kD ORF in pGV6~6 and the Nco I-Xba I fragment containing the ACMV replication protein in pGV6~9 to result in plasmids 30 pGV69~ and pG~'69~, respectively. The Hind III fragment from pGV692 containing the \~c:C're gene w-as cloned into the Hind III site of pBinl9 (GEN
BANK ACCESSION U0936~) and pBE673 (described in PCT Int. Appl.
V'O 99;'?200.) to yield binan~ plasmids pBE69? (with plant kanamycin resistance ~_ene~ m:d nBE69~h (with plant phosphothricon resistance ~encl. respectively.
The Bam HI-Bam HI-Asp718 I partial fragment from pGV693 containing the IN:C're <zene cloned into Bam HI-Asp718 I cut pBinl9 and pBE67s to yield binay piasmids pBE693 and pBE693b, respectively. Nicotiarza benthamiana and h'. tabacum var.karuhi were transformed with agrobacterium BA69? and BA693 ~7 containing binary plasmids pBE692 and pBE693. respectively. These transgenic plants will be crossed with those carrying the floxed viruses.
A chimeric II~':Cre gene was modifed to reduce its translationability in order to tolerate leaky Cre transcription. Since. it has been reported that small upstream ORFs usually reduce, or in extreme cases preclude, downstream translation [Kozak, ivl. ( 1996) Mammalian Genome. 7. 563-74], pGV693 was linearized with the unique Nco I site at the initiation codon of the Cre ORF
and ligated an adapter made up of primers P224 [SEQ ID N0:41] and P225 [SEQ ID
N0:42]. This resulted in the addition of 39 by sequence upstream of the 10 translation initiation codon including 21 by ORF 18 by upstream of the translation initiation codon. The modification in the resultant plasmid, pGV787, was confirmed by DNA sequencing. Bam HI fragment from pGV787 was used to replace the corresponding region in pBE673 to yield pBE787 binary vector. This vector was tested in transaenic plants.
15 Primers used in the preceeding discussion are given below:
5'-CAT GCG TGT CGC ATA CTA TTA CTA ATA GGC AGC GAG GAT-3' [SEQ ID N0:41 P22~
20 ~'-CAT GAT CCT CGC TGC CTA TTA GTA ATA GTA TGC GAC ACG-3' (SEQ ID N042]
Screening for Correctly Regulated Cre Expression And Use of Mutant Lox Sites A system was developed to enable the selection of transgenic lines that have correctly regulated Cre expression. The luciferase gene was chosen as a 25 sensitive. non-destructive reporter for Cre-mediated excision. A set of floxed vectors. pC,V751-7~4. that contain the basic cassette ''35S promoter-loa-NPT
II
gene-rbcS 3' terminator-Nos 3' terminator-lox-Luc'' were chosen. Cre expression would excise the 'STOP' fragment containing NPT II gene and the transcriptional terminator sequences benyeen the lox sites, thus. switching on luciferase 30 expression. Thus. the excision of NPT II gene during selection will render the plants sensitive to kanamycin selection. Co-transformation of these bar-resistant binary vectors carrying IN2:Cre (pBE692) or Vc:Cre (pBE693), as described previously, on kanamycin + bar selection plates allowed for the selection of transgenic lines where Cre expression is low enough not to mediate 3 ~ recombination.
Using the above selection method the efficacy of mutant lox sites to improve the 'specificity' of the regulated promoters expressing Cre was tested.
Several mutant lox sites have been published that have been reported to require ~8 more Cre protein to activate the site-specific recombination [Albert et al., Plant J.
7:649-59 (1995)j. For example. the in vitro efficiency of mutant sites. lox 72. lox 78, and lox 65 sites were reported to be 12.5%. 5°ro. and 2.5°,%, respectively°, relative to wild type iox P. Plasmids pGV751. pGV752. pGV753, and pGV754 contain one wild type lox site and a second lox site that is wild type lox P, lox 65, log 72. and lox 7S. respectively. in the above cassette. pGV751 and pGV75?
were -selected for initial testing in transeenic plants. The floxed constructs were introduced in binary vectors (referred below with pBE prefix) and transformed into tobacco (~~'. tabacum. co. .~'antiiil plants via a~robacterium-mediated leaf disc transformation with pBE751 .(kan) + pBE693b (bar), pBE751 (kan) + pBE692b (bar), pBE753 (kan) + pBE693b (bar). and pBE753 (kan) + pBE692b (bar).
For safener induction leaf discs of primary transfortnants were flooded for 30 min in 30 ppm of freshly made 2-CBSU [Hershey. H. P. and Stoner. T. D.
( 1991 ) Plant A~olecular Biolo~~ 17:679-690j and then placed on solid plain MS
medium for 1-2 days before assay. Whole seedling or leaf discs to be tested were sprayed with 5 mM beetle luciferin and then kept in dark for 5 min before ima~in~~
for luciferase expression under a cool CCD camera.
Results of 7s 1/693bar and 7531693bar cotransformation:
Expression of luciferase was detected by a cool CCD camera from untreated and safener-treated independent transgenic lines transformed with IN:Cre in the presence of floxed construct pBE751 (with wild type lox P site) or pBE753 (with mutant log 7?). Table 1 shows that relative to wild type lox P
mutant lox 72 reduces the number of lines that show luciferase in leaf discs at zero time point. Lines that showed safener inducibility with no background were selected for further analysis. Leaf discs from these plants were incubated for days with or without safener treatment. Table ? shows that Iuciferase expression. a reporter of excision. is higher in lines co-transformed with pBE751 than with pBE753.
;9 ~r,aBLE I
Luciferase expression in leaf discs with or without treatment with safener I independent ~ 2-CBSU and transeenic plants no treatmentwounding treatment ?~ i and 693bar ' 1 ~;
i ~b . + foxed? _ l0a - +
lla - -16a . + foxed?
?I _ +
26c - +
?9a + +foxed?
I 30 _ +
l + + foxed?
+ foxed?
3; + + foxed?
34 + + foxed?
35 + + foxed?
37 - +
753 and 693bar I 1 b - ~ _ ' I ~b _ +/-i 6a ; - +%-1?a ~ _ _ I ~Id -17a - -18c - +
_'la - _ I '?'~ - +
2~a - +
24b - -?6a - -t ?9b - -30 - +/_ I 3'? - +i-Relative iuciferase e:cpression in leaf discs with or without treatment with safener after 2 davs wounding 2-CBSU and wounding control 1 187 218 (W) * control 126 ~ 283 ~ -~' ;
75l 1 5.663 4.895 75110 j 1.156 5.522 751 21 1.286 16.500 751 26 1,898 6,990 751 30 2.595 ~ 58.01 ~
751 37 8,450 I 72.091 733 4 829 ~ 921 753 6 , 247 671 753 14 ~ 495 4.408 753 18 ~ 905 8,598 753 22 ~ 241 1,274 753 23 ~ 405 3,843 753 30 542 1,117 753 32 1~9 *Control 2 is a transgenic plant with 751/693bar. However, iuciferase in this transgenic plant is not induced either by wounding or safener-treatment.
SEQUEI~ICE LISTING
<110> ~. I. du Pant de Nemours and Company <120> Binary 4'irai Expression System in Plants <13C> CL-11~~-..
<140>
<141>
rlSC; b0/1C' <151> 1°°9-CG-23 <16C> ._ <170> Microsoft Office °7 <210> i <211> 40 <212> DNA
<21.i. f':rt~fl.alC ~ ~CQ~tlv.':~~
<GL~>
<223> Description cf Artificial Sequence: Primer <40C>
tcgagataac ttcgtataat gtatgctata cgaagttatg 40 <210> 2 <211? 4C
<212> DNA
<2i3> Artificial Sequen-ae <220>
<223> Description of Artificial Sequence: Primer <400> 2 aattcataac ttcgtatoac atacattata cgaagttatc 4C
~~210> _ <211> 45 <212> DNA
21?> Artifici~~~ Sequence <22C>
<223> Descriptiar: cf Artificial Sequence: Primer <4CC>
aattctataa cttcotataa tgtatgctat acgaagttat gagct 45 <210> 4 <211>
<212> DNA
<213> Artificial Sequence <220>
<2~~> ~escrvpti~r. c_ .._:i~icia~~ Sequence: Primer <900> 4 cataacttca tataccat:a attatacgaa gttatag 37 <210> 5 <211> 33 <212> DNA
<213> Artificial Seauence <220>
<223> Description of Artificial Sequence:Frimer <400> 5 gcggcatgcg tcgacacatg gtggagcacg aca 33 <210> E -<211> 30 <2i2> Di <213> Artificia'_ Seauence <220>
<223> Description of Artificial Sequence:Primer <400> 6 gccgggtacc gaaacgc~tc atcccttacg 30 <210> 7 <211> 54 <212> DNA
<21~~ ..rtificial Seauence <220>
<223> Description of Artificial Sequence:Primer <400> 7 gtctcggtac ctataatgta tgctatacga agttatataaggaagttcat 54 ttca <210> 8 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:Primer <qOn:.
tgatccgcgg gtttcttctc atgt 24 ~1~%
<211> 51 <21~> DNA
<213> Art-ifici~', Sequence <220>
<223> Description: c~ Artificial Sequence:Primer <40C>
ccgggaatgc atgctatagc atacattata cgaagttattcgaatttaaa 51 t <210> 10 <211> 51 <212> DNA
<213> Artificial Seauence <220:>
<223> Description cf Artificial Sequence:Primer <400> 10 ccggatttaa attcgaataa cttcgtataa tgtatgctatagcatgcatt 5,:
c <21G> 11 <211> 92 <212> DNA
<213> Artificia~.~ Seauence <220>
<223> Descri~t_on cf Artificial Secuence:_rimer <400> 1 cgataacttc gtatdatctd tactatacga agttatcccggg 42_ <210> 12 <211>
<212> DNA
<213> Artificv~'_ Sequence <220>
<223> Description. of Artificial Sequence:Primer <40G> 12 cgcccgggat aacttcgtdt dgcatacatt atacgaagttat 42 <21C> _.~
<211> L'7 '~21L> CjVA
<213> Artificial Seauence <22C>
<223> Description of Artificial Sequence:Primer <400> 13 gatgacgcgt dtaacttcgt ataatgt 27 <21G> 14 <211> 5y <212> DNA
<213> Artificia'_ Seauence <220>
<223> Descriptie~ or ~rt,_ficial Sequence:rime_-<4GG> 19 CC:.'IGGat~.= '_.~;~Ctdtd'7 C2~a.~uttcL dCGddGttdi~CGddCd.'t2t 57 :.acs :21 ~> i~
<211>
<212> DNA
<213> Artificial Seauence <220>
<223> Descri~tic.~ cf frtificial Seauence:Primer <400> 13 ccggatttda dtgttcgaat aacttcgtat aatgtatgctatacgaactt 54 atcc <210> to <211> 39 <212'- DNA
<213> Artificia~~ Sequence <220>
<223> Description of Artificial Sequence:?Timer <400> 16 _ gaggcatgcc cgggcaacat ggtggagcac gaca 39 <210> i7 <211> 58 <212> DNA
<213% Artificial Seauence <220>
<223~ Descripticn ,~_ Artificial Sequence: Primer -<4G
tGtgcggccg cataacttcg tatagcatac attatacgaa attatataga ggaagggt 5~' <210> lE
<211> 28 <212> DNA
<213> Artificial Sequence <220%
<223> Description of Artificial Sequence: Primer <900> lc~
tccttgatcc g~gggttt=t tctcatgt 28 <210> l <211> 28 <212> DNA
<213> Artificial Seauence <220>
<223> Descrinticn of Artificial Seauence: Primer <400> i_~
tccttgatcc gcgggtttct tctcatgt 28 <210> 20 <211> 28 <212% DNA
<213'> .._ _vficia~ Seauence <220>
<22~,: D?scri~tio-: __ ..r t_=icial Sequence: _rimer <y:,~ - ..,.
cacgca:gc~ ctatcctt _ caagaccc <210> ~_ <211>
< 212 %' Dr:
<213% !rt=F',C~c_ Seqllence <220>
<223.'w Descri~ticn of Artificial Seauence: Primer <900> 2'_ ccggggcggc cacat~~ 17 <210> ~_ <211> '_',' <212> DN:S
<213> ::rt_ficiai Sequence <220>
<223> Description of ArtificialSequence:Primer <900> 22 ccgggtatgc ggccgcc 17 <210> 23 <211> 91 <212> DNA
<:213: Artificial Sequ ence _ <220>
<223> Descripticn o: ArtificialSequence:Primer <90C> 23 accatgatta cgccaagctt aagaaaaggagagggccaaga 41 <210> 29 <211> y?
<212> DNA
<213> Artificial Sequence <220>
<223~ Description of ArtificialSequence:primer <900> 29 agttatgcgg ccgccccggg catatgatccaatatcaaagga 42 <210> 25 <211> 90 <2i2> DLIA
<213> Artificia'_ Sequence <220>
<223> Description of ArtificialSequence:Primer <400> 25 gcgcagcctg aatggcgaat ggcgccccaaaaatatcaaagataca 96 <210> 26 <211; 46 <212> DNA
<213; .._tificia': Sea uence <22Ci <223> Descript:~o:; cl ArtificialSequence:Frimer <400> 26 aaggagaaaa taccwca~c;: cccgggataacttcgtatagcataca 96 <21C >
<211> G5 <2i2> DNA
<213> Artificial Seq uence <220>
<223> Description of ArtificialSeauence:Primer <400> 27 gccaatcgat catgagtoaa ggaga 25 <210> 28 <211> 35 <212= DNA
<213> Artificial Seauence <220>
<223> Description of Artificial Sequence:Primer <400> 28 gctaaccggt agaca-_tta~ ttgtatagtt catcc 3=
<210> 2 -<211> J4 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:Primer <400> 29 gaagtcgacc gcgggcaqac taaactcacg aata 34 <210> 30 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:Primer <400> 30 gaattctcga gccatatatg gacatttatc 30 <210> 31 <211> 96 <212> CNA
<213> Artifvcia~ Sequence <220>
<223> Description of Artificial Sequence:Primer <400> 3 tgcgtaagga gaaaataccu catcaaagaa aaggagagggccaaga 46 <210>
<21' 4'7 <212;> Dt7A
<213> !.rtificia'~ ..equencE
<220>
<223> Descriction ef Artificial Sequence:Primer <900> ??
gcgcagccta aatgGcgaat agcgccatat gatccaatatcaaagga 4~
<210> 33 <211> 53 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 33 aacggttaaa tttccattga tactcgaaag atgagcgaca aatcaatctc 53 tga <210> ~4 <211> 50 <212> DNA
<213> Artificial Sequence <220>
<223.' Gescriptio:: of Art=ficial Sequence:Primer <900> 39 aacggttaaa tttccattga tactcgaaag atggcactgatctttggcac 5~
<210> 35 ~21~ > 53 <212-'- DNA
<G1:',% rrtificia~ Seauence <220>
<223> Description of Artificial Sequence:Primer <400> 35 ggggtaggcg tcggttatgt agacgtagtt atccaacattgtaagttttc 53 att <210> 36 <211~ 3 <212> Dt~A
<213> Artificial Sequence <22C>
<223> Description of Artificial Sequence:Primer <40C> Jo atgataactt catatagcat acattatacg aagttat 37 <210> 37 <21:: ._ <212> DNA
<213> Artificial Sequence <220>
<223> Descri~___.. cf Arti~_c~ai Seauence:Primer <900> _.
L.GaI_auGGG:~ C. _ _ J W _G .~~'tu:.~.-.. ~.d~~QaV'..tG:
u.._.
<21i _ <212=> DIVA
<213> Artificial Sequence <220>
<22~ _.__ __ __~.. _~ Art~.__~ia_ Sequence:Pri:r.e_ <400== _,.
atgotaactt cgtatagcat acattatacg aagttat 37 <2iG>
<e <2i3F:r~ific;~l Seaue.~.ce <220>
<223= Description of Artificial Seauence:Primer <900> 39 aaagttatat aaaacgacat gcgtttcgtagatctaaggagatataaca 99 <210> 90 <211> 98 <212> DNA
<213> Artificial Sequ ence <220>
<223> Descriptio~: cf ArtificialSequence:Primer _ <4C0> 90 aattttatta atttgttatc gaatcataaattatttgtatagttcatc 98 <210> 91 <211> 39 <212> DNA
<2I3> Artificial Seq uence <220>
<223> Description of ArtificialSequence:Primer <400> 41 catgcgtgtc gcatactatt actaataggcagcgaggat 39 <210> 42 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Description of ArtificialSequence:Primer <400> 42 catgatcctc gctgcctatt agtaatagtatgcgacacg 39
were -selected for initial testing in transeenic plants. The floxed constructs were introduced in binary vectors (referred below with pBE prefix) and transformed into tobacco (~~'. tabacum. co. .~'antiiil plants via a~robacterium-mediated leaf disc transformation with pBE751 .(kan) + pBE693b (bar), pBE751 (kan) + pBE692b (bar), pBE753 (kan) + pBE693b (bar). and pBE753 (kan) + pBE692b (bar).
For safener induction leaf discs of primary transfortnants were flooded for 30 min in 30 ppm of freshly made 2-CBSU [Hershey. H. P. and Stoner. T. D.
( 1991 ) Plant A~olecular Biolo~~ 17:679-690j and then placed on solid plain MS
medium for 1-2 days before assay. Whole seedling or leaf discs to be tested were sprayed with 5 mM beetle luciferin and then kept in dark for 5 min before ima~in~~
for luciferase expression under a cool CCD camera.
Results of 7s 1/693bar and 7531693bar cotransformation:
Expression of luciferase was detected by a cool CCD camera from untreated and safener-treated independent transgenic lines transformed with IN:Cre in the presence of floxed construct pBE751 (with wild type lox P site) or pBE753 (with mutant log 7?). Table 1 shows that relative to wild type lox P
mutant lox 72 reduces the number of lines that show luciferase in leaf discs at zero time point. Lines that showed safener inducibility with no background were selected for further analysis. Leaf discs from these plants were incubated for days with or without safener treatment. Table ? shows that Iuciferase expression. a reporter of excision. is higher in lines co-transformed with pBE751 than with pBE753.
;9 ~r,aBLE I
Luciferase expression in leaf discs with or without treatment with safener I independent ~ 2-CBSU and transeenic plants no treatmentwounding treatment ?~ i and 693bar ' 1 ~;
i ~b . + foxed? _ l0a - +
lla - -16a . + foxed?
?I _ +
26c - +
?9a + +foxed?
I 30 _ +
l + + foxed?
+ foxed?
3; + + foxed?
34 + + foxed?
35 + + foxed?
37 - +
753 and 693bar I 1 b - ~ _ ' I ~b _ +/-i 6a ; - +%-1?a ~ _ _ I ~Id -17a - -18c - +
_'la - _ I '?'~ - +
2~a - +
24b - -?6a - -t ?9b - -30 - +/_ I 3'? - +i-Relative iuciferase e:cpression in leaf discs with or without treatment with safener after 2 davs wounding 2-CBSU and wounding control 1 187 218 (W) * control 126 ~ 283 ~ -~' ;
75l 1 5.663 4.895 75110 j 1.156 5.522 751 21 1.286 16.500 751 26 1,898 6,990 751 30 2.595 ~ 58.01 ~
751 37 8,450 I 72.091 733 4 829 ~ 921 753 6 , 247 671 753 14 ~ 495 4.408 753 18 ~ 905 8,598 753 22 ~ 241 1,274 753 23 ~ 405 3,843 753 30 542 1,117 753 32 1~9 *Control 2 is a transgenic plant with 751/693bar. However, iuciferase in this transgenic plant is not induced either by wounding or safener-treatment.
SEQUEI~ICE LISTING
<110> ~. I. du Pant de Nemours and Company <120> Binary 4'irai Expression System in Plants <13C> CL-11~~-..
<140>
<141>
rlSC; b0/1C' <151> 1°°9-CG-23 <16C> ._ <170> Microsoft Office °7 <210> i <211> 40 <212> DNA
<21.i. f':rt~fl.alC ~ ~CQ~tlv.':~~
<GL~>
<223> Description cf Artificial Sequence: Primer <40C>
tcgagataac ttcgtataat gtatgctata cgaagttatg 40 <210> 2 <211? 4C
<212> DNA
<2i3> Artificial Sequen-ae <220>
<223> Description of Artificial Sequence: Primer <400> 2 aattcataac ttcgtatoac atacattata cgaagttatc 4C
~~210> _ <211> 45 <212> DNA
21?> Artifici~~~ Sequence <22C>
<223> Descriptiar: cf Artificial Sequence: Primer <4CC>
aattctataa cttcotataa tgtatgctat acgaagttat gagct 45 <210> 4 <211>
<212> DNA
<213> Artificial Sequence <220>
<2~~> ~escrvpti~r. c_ .._:i~icia~~ Sequence: Primer <900> 4 cataacttca tataccat:a attatacgaa gttatag 37 <210> 5 <211> 33 <212> DNA
<213> Artificial Seauence <220>
<223> Description of Artificial Sequence:Frimer <400> 5 gcggcatgcg tcgacacatg gtggagcacg aca 33 <210> E -<211> 30 <2i2> Di <213> Artificia'_ Seauence <220>
<223> Description of Artificial Sequence:Primer <400> 6 gccgggtacc gaaacgc~tc atcccttacg 30 <210> 7 <211> 54 <212> DNA
<21~~ ..rtificial Seauence <220>
<223> Description of Artificial Sequence:Primer <400> 7 gtctcggtac ctataatgta tgctatacga agttatataaggaagttcat 54 ttca <210> 8 <211> 29 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:Primer <qOn:.
tgatccgcgg gtttcttctc atgt 24 ~1~%
<211> 51 <21~> DNA
<213> Art-ifici~', Sequence <220>
<223> Description: c~ Artificial Sequence:Primer <40C>
ccgggaatgc atgctatagc atacattata cgaagttattcgaatttaaa 51 t <210> 10 <211> 51 <212> DNA
<213> Artificial Seauence <220:>
<223> Description cf Artificial Sequence:Primer <400> 10 ccggatttaa attcgaataa cttcgtataa tgtatgctatagcatgcatt 5,:
c <21G> 11 <211> 92 <212> DNA
<213> Artificia~.~ Seauence <220>
<223> Descri~t_on cf Artificial Secuence:_rimer <400> 1 cgataacttc gtatdatctd tactatacga agttatcccggg 42_ <210> 12 <211>
<212> DNA
<213> Artificv~'_ Sequence <220>
<223> Description. of Artificial Sequence:Primer <40G> 12 cgcccgggat aacttcgtdt dgcatacatt atacgaagttat 42 <21C> _.~
<211> L'7 '~21L> CjVA
<213> Artificial Seauence <22C>
<223> Description of Artificial Sequence:Primer <400> 13 gatgacgcgt dtaacttcgt ataatgt 27 <21G> 14 <211> 5y <212> DNA
<213> Artificia'_ Seauence <220>
<223> Descriptie~ or ~rt,_ficial Sequence:rime_-<4GG> 19 CC:.'IGGat~.= '_.~;~Ctdtd'7 C2~a.~uttcL dCGddGttdi~CGddCd.'t2t 57 :.acs :21 ~> i~
<211>
<212> DNA
<213> Artificial Seauence <220>
<223> Descri~tic.~ cf frtificial Seauence:Primer <400> 13 ccggatttda dtgttcgaat aacttcgtat aatgtatgctatacgaactt 54 atcc <210> to <211> 39 <212'- DNA
<213> Artificia~~ Sequence <220>
<223> Description of Artificial Sequence:?Timer <400> 16 _ gaggcatgcc cgggcaacat ggtggagcac gaca 39 <210> i7 <211> 58 <212> DNA
<213% Artificial Seauence <220>
<223~ Descripticn ,~_ Artificial Sequence: Primer -<4G
tGtgcggccg cataacttcg tatagcatac attatacgaa attatataga ggaagggt 5~' <210> lE
<211> 28 <212> DNA
<213> Artificial Sequence <220%
<223> Description of Artificial Sequence: Primer <900> lc~
tccttgatcc g~gggttt=t tctcatgt 28 <210> l <211> 28 <212> DNA
<213> Artificial Seauence <220>
<223> Descrinticn of Artificial Seauence: Primer <400> i_~
tccttgatcc gcgggtttct tctcatgt 28 <210> 20 <211> 28 <212% DNA
<213'> .._ _vficia~ Seauence <220>
<22~,: D?scri~tio-: __ ..r t_=icial Sequence: _rimer <y:,~ - ..,.
cacgca:gc~ ctatcctt _ caagaccc <210> ~_ <211>
< 212 %' Dr:
<213% !rt=F',C~c_ Seqllence <220>
<223.'w Descri~ticn of Artificial Seauence: Primer <900> 2'_ ccggggcggc cacat~~ 17 <210> ~_ <211> '_',' <212> DN:S
<213> ::rt_ficiai Sequence <220>
<223> Description of ArtificialSequence:Primer <900> 22 ccgggtatgc ggccgcc 17 <210> 23 <211> 91 <212> DNA
<:213: Artificial Sequ ence _ <220>
<223> Descripticn o: ArtificialSequence:Primer <90C> 23 accatgatta cgccaagctt aagaaaaggagagggccaaga 41 <210> 29 <211> y?
<212> DNA
<213> Artificial Sequence <220>
<223~ Description of ArtificialSequence:primer <900> 29 agttatgcgg ccgccccggg catatgatccaatatcaaagga 42 <210> 25 <211> 90 <2i2> DLIA
<213> Artificia'_ Sequence <220>
<223> Description of ArtificialSequence:Primer <400> 25 gcgcagcctg aatggcgaat ggcgccccaaaaatatcaaagataca 96 <210> 26 <211; 46 <212> DNA
<213; .._tificia': Sea uence <22Ci <223> Descript:~o:; cl ArtificialSequence:Frimer <400> 26 aaggagaaaa taccwca~c;: cccgggataacttcgtatagcataca 96 <21C >
<211> G5 <2i2> DNA
<213> Artificial Seq uence <220>
<223> Description of ArtificialSeauence:Primer <400> 27 gccaatcgat catgagtoaa ggaga 25 <210> 28 <211> 35 <212= DNA
<213> Artificial Seauence <220>
<223> Description of Artificial Sequence:Primer <400> 28 gctaaccggt agaca-_tta~ ttgtatagtt catcc 3=
<210> 2 -<211> J4 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:Primer <400> 29 gaagtcgacc gcgggcaqac taaactcacg aata 34 <210> 30 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence:Primer <400> 30 gaattctcga gccatatatg gacatttatc 30 <210> 31 <211> 96 <212> CNA
<213> Artifvcia~ Sequence <220>
<223> Description of Artificial Sequence:Primer <400> 3 tgcgtaagga gaaaataccu catcaaagaa aaggagagggccaaga 46 <210>
<21' 4'7 <212;> Dt7A
<213> !.rtificia'~ ..equencE
<220>
<223> Descriction ef Artificial Sequence:Primer <900> ??
gcgcagccta aatgGcgaat agcgccatat gatccaatatcaaagga 4~
<210> 33 <211> 53 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: Primer <400> 33 aacggttaaa tttccattga tactcgaaag atgagcgaca aatcaatctc 53 tga <210> ~4 <211> 50 <212> DNA
<213> Artificial Sequence <220>
<223.' Gescriptio:: of Art=ficial Sequence:Primer <900> 39 aacggttaaa tttccattga tactcgaaag atggcactgatctttggcac 5~
<210> 35 ~21~ > 53 <212-'- DNA
<G1:',% rrtificia~ Seauence <220>
<223> Description of Artificial Sequence:Primer <400> 35 ggggtaggcg tcggttatgt agacgtagtt atccaacattgtaagttttc 53 att <210> 36 <211~ 3 <212> Dt~A
<213> Artificial Sequence <22C>
<223> Description of Artificial Sequence:Primer <40C> Jo atgataactt catatagcat acattatacg aagttat 37 <210> 37 <21:: ._ <212> DNA
<213> Artificial Sequence <220>
<223> Descri~___.. cf Arti~_c~ai Seauence:Primer <900> _.
L.GaI_auGGG:~ C. _ _ J W _G .~~'tu:.~.-.. ~.d~~QaV'..tG:
u.._.
<21i _ <212=> DIVA
<213> Artificial Sequence <220>
<22~ _.__ __ __~.. _~ Art~.__~ia_ Sequence:Pri:r.e_ <400== _,.
atgotaactt cgtatagcat acattatacg aagttat 37 <2iG>
<e <2i3F:r~ific;~l Seaue.~.ce <220>
<223= Description of Artificial Seauence:Primer <900> 39 aaagttatat aaaacgacat gcgtttcgtagatctaaggagatataaca 99 <210> 90 <211> 98 <212> DNA
<213> Artificial Sequ ence <220>
<223> Descriptio~: cf ArtificialSequence:Primer _ <4C0> 90 aattttatta atttgttatc gaatcataaattatttgtatagttcatc 98 <210> 91 <211> 39 <212> DNA
<2I3> Artificial Seq uence <220>
<223> Description of ArtificialSequence:Primer <400> 41 catgcgtgtc gcatactatt actaataggcagcgaggat 39 <210> 42 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Description of ArtificialSequence:Primer <400> 42 catgatcctc gctgcctatt agtaatagtatgcgacacg 39
Claims (41)
1. A binary transgenic viral expression system comprising:
(i) a chromosomally-integrated inactive replicon comprising:
a) cis-acting viral elements required for viral replication;
b) a target gene comprising at least one suitable regulatory sequence; and c) site-specific sequences responsive to a site-specific recombinase; and (ii) a chromosomally-integrated chimeric transactivating gene comprising a regulated plant promoter operably-linked to a site-specific recombinase coding sequence;
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination, activation of replicon replication, and increased expression of the target gene.
(i) a chromosomally-integrated inactive replicon comprising:
a) cis-acting viral elements required for viral replication;
b) a target gene comprising at least one suitable regulatory sequence; and c) site-specific sequences responsive to a site-specific recombinase; and (ii) a chromosomally-integrated chimeric transactivating gene comprising a regulated plant promoter operably-linked to a site-specific recombinase coding sequence;
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination, activation of replicon replication, and increased expression of the target gene.
2. The vital expression system of Claim 1 wherein the site-specific sequences responsive to the recombinase are lox sequences and the site-specific recombinase coding sequence encodes for the Cre protein.
3. The transgenic viral expression system of Claim 1 wherein the inactive replicon is derived from viruses selected from the group consisting of geminiviruses and single-stranded RNA viruses.
4. The transgenic viral expression system of Claim 3 wherein the geminvirus is selected from the group consisting of Tomato golden mosaic virus (TGMV) and African Cassava Mosaic Virus (ACMV)
5. The transgenic viral expression system of Claim 3 wherein the single-stranded RNA viruses is a potato virus X.
6. The viral expression system of Claim 1 wherein the regulated plant promoter is selected from the group consisting of tissue-specific promoters, inducible promoters, and development stage-specific promoters.
7. The viral expression system of Claim 6 wherein the regulated promoter is derived from genes selected from the group consisting of genes derived from a safener-inducible system, genes derived from the tetracycline-inducible system, genes derived from salicylate-inducible systems, genes derived from alcohol-inducible systems, genus derived from glucocorticoid-inducible system, gene derived from pathogen-inducible systems, and gene derived from ecdysome-inducible systems.
8. The viral expression system of Claim 1 wherein the target gene encodes a protein selected from the group consisting of an enzyme, a structural protein, a seed storage protein, a protein that conveys herbicide resistance, and a protein that conveys insect resistance.
9. The viral expression system of Claim 1 wherein the target gene encodes an RNA whose expression results in homology-dependent gene silencing of a transgene or endogenous gene.
10. The viral expression system of Claim 1 wherein the at least one suitable regulatory sequence linked to the target gene is selected from the group consisting of constitutive plant promoters, plant tissue-specific promoters, plant development-specific promoters, inducible plant promoters and viral promoters.
11. The viral expression system of Claim 10 wherein the at least one suitable regulatory sequence is selected from the group consisting of a viral coat protein promoter, the nopaline synthase promoter, the phaseolin promoter, and the cauliflower mosaic virus promoter.
12. The viral expression system of Claim 1 wherein the inactive replicon optionally contains a DNA fragment encoding a transit peptide.
13. A method of altering the levels of a protein encoded by a target gene in a plant comprising:
(i) transforming a plant with the viral expression system of Claim 1; and (ii) growing the transformed plant seed under conditions wherein the protein is expressed.
(i) transforming a plant with the viral expression system of Claim 1; and (ii) growing the transformed plant seed under conditions wherein the protein is expressed.
14. The method of Claim 13 wherein the target gene is in sense orientation and the level of the expressed protein is increased.
15. The method of Claim 13 wherein the site-specific sequences responsive to the recombinase are mutant lox sequences that are inefficient for Cre-lox recombination and the site-specific recombinase coding sequence encodes for the Cre protein.
16. A method of altering the levels of a protein encoded by a target gene in a plant comprising:
(i) transforming a first plant with a inactive replicon to form a first primary transformant, the inactive replicon comprising:
a) cis-acting viral elements required for viral replication:
b) a target gene comprising at least one suitable regulatory sequence; and c) site-specific sequences responsive to a site-specific recombinase.
iii) transforming a second plant with a chimeric transactivating gene to form a second primary transformant comprising a regulated plant promoter operable-linked to a transactivating site-specific recombinase coding sequence:
(iii) growing the first and second primary transformants wherein progeny from both seeds are obtained: and (iv) crossing the progeny of the first and second transformants wherein the target gene is expressed.
(i) transforming a first plant with a inactive replicon to form a first primary transformant, the inactive replicon comprising:
a) cis-acting viral elements required for viral replication:
b) a target gene comprising at least one suitable regulatory sequence; and c) site-specific sequences responsive to a site-specific recombinase.
iii) transforming a second plant with a chimeric transactivating gene to form a second primary transformant comprising a regulated plant promoter operable-linked to a transactivating site-specific recombinase coding sequence:
(iii) growing the first and second primary transformants wherein progeny from both seeds are obtained: and (iv) crossing the progeny of the first and second transformants wherein the target gene is expressed.
17. The binary transgenic expression system of Claim 1 wherein the chromosomally-integrated inactive replicon is inserted into a reporter gene sequence such that when the replicon is excised the reporter gene is activated.
18. The binary transgenic expression system of Claim 1 wherein a Transcription Stop Fragment is inserted in the inactive replicon.
19. A binary transgenic viral expression system comprising:
(i) a chromosomally-integrated inactive replicon comprising:
a) cis-acting viral elements required for viral replication:
b) a target gene comprising at least one suitable regulatory sequence; and c) site-specific sequences responsive to a site-specific recombinase; and (ii) a transiently-expressed chimeric transactivating gene comprising a plant or viral promoter operably-linked to a site-specific recombinase coding sequence;
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination, activation of replicon replication, and increased expression of the target gene.
(i) a chromosomally-integrated inactive replicon comprising:
a) cis-acting viral elements required for viral replication:
b) a target gene comprising at least one suitable regulatory sequence; and c) site-specific sequences responsive to a site-specific recombinase; and (ii) a transiently-expressed chimeric transactivating gene comprising a plant or viral promoter operably-linked to a site-specific recombinase coding sequence;
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination, activation of replicon replication, and increased expression of the target gene.
20. A method of altering the levels of a protein encoded by a target gene in a plant comprising:
(i) transforming a plant with a inactive replicon the inactive replicon comprising:
a) cis-acting viral elements required for viral replication:
b) a target gene comprising at least one suitable regulatory sequence; and c) site-specific sequences responsive to a site-specific recombinase;
(ii) infecting the transformant with a virus containing a chimeric transactivating gene comprising a regulated plant promoter operable-linked to a transactivating site-specific recombinase coding sequence:
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination, activation of replicon replication, and increased expression of the target gene.
(i) transforming a plant with a inactive replicon the inactive replicon comprising:
a) cis-acting viral elements required for viral replication:
b) a target gene comprising at least one suitable regulatory sequence; and c) site-specific sequences responsive to a site-specific recombinase;
(ii) infecting the transformant with a virus containing a chimeric transactivating gene comprising a regulated plant promoter operable-linked to a transactivating site-specific recombinase coding sequence:
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination, activation of replicon replication, and increased expression of the target gene.
21. A binary transgenic expression system comprising an inactive transgene and a chimeric transacrivating gene, the inactive transgene comprising:
(i) cis-acting transcription regulatory elements inoperably-linked to the coding sequence or functional RNA, and (ii) site-specific sequences responsive to a site specific recombinase;
the chimeric transactivating gent comprising a regulated plant promoter operably-linked to a transactivating site-specific recombinase coding sequence, wherein expression of the chimeric transactivating gave in cells containing the inactive transgene results in an operable linkage of cis-acting transcription regulatory elements to the coding sequence or functional RNA through the site-specific recombination and increased expression of the target gene.
(i) cis-acting transcription regulatory elements inoperably-linked to the coding sequence or functional RNA, and (ii) site-specific sequences responsive to a site specific recombinase;
the chimeric transactivating gent comprising a regulated plant promoter operably-linked to a transactivating site-specific recombinase coding sequence, wherein expression of the chimeric transactivating gave in cells containing the inactive transgene results in an operable linkage of cis-acting transcription regulatory elements to the coding sequence or functional RNA through the site-specific recombination and increased expression of the target gene.
22. The binary transgenic expression system of Claim 21 wherein the site-specific sequences responsive to the recombinase are lox sequences.
23. The viral expression system of Claim 21 wherein the lox seqeunces are mutant lox sequencese that are inefficient for Cre-lox recombination.
24. A binary transgenic viral replication system comprising:
(i) a chromosomally-integrated inactive replicon comprising cis-acting viral elements required for viral replication and site-specific sequences responsive to a site-specific recombinase; and (ii) a chimeric transactivating gene, comprising a regulated plant promoter operably-linked to a situ-specific recombinase coding sequence;
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination and activation of replicon replication.
(i) a chromosomally-integrated inactive replicon comprising cis-acting viral elements required for viral replication and site-specific sequences responsive to a site-specific recombinase; and (ii) a chimeric transactivating gene, comprising a regulated plant promoter operably-linked to a situ-specific recombinase coding sequence;
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination and activation of replicon replication.
25. The transgenic viral replication system of Claim 24 wherein the site-specific sequences responsive to the recombinase are lox sequences.
26. The transgenic viral replication system of Claim 24 wherein the inactive replicon is derived from viruses selected from the group consisting of geminiviruses and single-stranded RNA viruses.
27. The transgenic viral replication system of Clam 26 wherein the geminvirus is selected from the group consisting of Tomato golden mosaic virus (TGMV) and African Cassava Mosaic Virus (ACMV)
28. The transgenic viral replication system of Claim 26 wherein the single-stranded RNA viruses is a potato virus X.
29. The viral replication system of Claim 24 wherein the regulated plant promoter is selected from the group consisting of tissue-specific promoters, inducible promoters, and development stage-specific promoters.
30. The viral replication system of Claim 29 wherein the regulated promoter is derived from genes selected from the group consisting of genes derived from a safener-inducible system, genes derived from the tetracycline-inducible system, genes derived from salicylate-inducible systems, genes derived from alcohol-inducible systems, genes derived from glucocorticoid-inducible system, gene dived from pathogen-inducible systems, and gene derived from ecdysome-inducible systems.
31. A binary transgene expression system of Claim 21, wherein, the inactive transgene is a silencing suppresser gene.
32. A binary transgenic expression system comprising:
(i) a chromosomally integrated blocking fragment bounded by site-specific sequences responsive to a site-specific recombinase; and (ii) a chromosomally integrated inactive silencing suppresser transgene;
wherein expression of a site specific recombinase results in site-specific recombination that activates the silencing suppresser gene.
(i) a chromosomally integrated blocking fragment bounded by site-specific sequences responsive to a site-specific recombinase; and (ii) a chromosomally integrated inactive silencing suppresser transgene;
wherein expression of a site specific recombinase results in site-specific recombination that activates the silencing suppresser gene.
33. The binary transgenic viral expression system of Claim 32 wherein the blacking fragment is an inactive replicon comprising:
(i) a target gene comprising at least one suitable regulatory sequence; and (ii) site-specific sequences responsive to a site-specific recombinase;
wherein expression of the site specific recombinase results in the site-specific recombination, and activation of both the replicon and the silencing suppresser gene, and the increased expression of the target gene.
(i) a target gene comprising at least one suitable regulatory sequence; and (ii) site-specific sequences responsive to a site-specific recombinase;
wherein expression of the site specific recombinase results in the site-specific recombination, and activation of both the replicon and the silencing suppresser gene, and the increased expression of the target gene.
34. The binary transgenic viral expression system of Claim 32 wherein the blocking fragment is an inactive replicon comprising site-specific sequences responsive to a site-specific recombinase, wherein expression of the site specific recombinase results in the site-specific recombination, and activation of both the replicon and the silencing suppresser gene.
35. The binary ttansgenic viral expression system of Claim 32 wherein the silencing suppresser gene is selected from the group consisting of genes encoding p1 helper component-proteinase (P1-HC-Pro), helper component-proteinase (HC-Pro), and cucumoviral 2b protein.
36. The binary transgenic viral expression system of Claim 32 wherein the silencing suppresser gene is selected from the group consisting of genes encoding BL1 or BR1 geminivirus movement proteins.
37. A transgenic viral expression system comprising:
(i) a chromosomally-integrated geminivirus proreplicon comprising:
a) cis-acting viral elements required for viral replication;
b) a target gene comprising at least one suitable regulatory sequence: and c) flanking sequences that enable the excision of the elements of a) and b).
wherein the proreplicon lacks a functional replication gene for episomal replication:
(ii) a chromosomally-integrated chimeric mans-acting replication gene comprising a regulated plant promoter operably-linked to a geminieirus viral replication protein coding sequence:
and (iii) a dimer of the geminivirus B genome:
wherein expression of the traps-acting replication gene in cells containing the proreplicon results in the replication of the proreplicon and the B-genome.
and increased expression of the target gene.
(i) a chromosomally-integrated geminivirus proreplicon comprising:
a) cis-acting viral elements required for viral replication;
b) a target gene comprising at least one suitable regulatory sequence: and c) flanking sequences that enable the excision of the elements of a) and b).
wherein the proreplicon lacks a functional replication gene for episomal replication:
(ii) a chromosomally-integrated chimeric mans-acting replication gene comprising a regulated plant promoter operably-linked to a geminieirus viral replication protein coding sequence:
and (iii) a dimer of the geminivirus B genome:
wherein expression of the traps-acting replication gene in cells containing the proreplicon results in the replication of the proreplicon and the B-genome.
and increased expression of the target gene.
38. A method of altering the levels of a protein encoded by a target gene in a plant comprising:
(i) transforming a plant with the viral expression system of Claim 37: and (ii) growing the transformed plant seed under conditions wherein the protein is expressed.
(i) transforming a plant with the viral expression system of Claim 37: and (ii) growing the transformed plant seed under conditions wherein the protein is expressed.
39. A transgenic geminivirus expression system comprising:
(i) a chromosomally-integrated inactive replicon comprising:
a) cis-acting viral elements required for viral replication:
b) a target gene comprising at least one suitable regulatory sequence: and c) site-specific sequences responsive to a site-specific recombinase:
(ii) a chromosomally-integrated chimeric transactivating gene comprising a regulated plant promoter operable-linked to a site-specific recombinase coding sequence:
(iii) a dimer of a geminivirus B genome:
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination, activation of replicon and B-genome replication and increased expression of the target gene.
(i) a chromosomally-integrated inactive replicon comprising:
a) cis-acting viral elements required for viral replication:
b) a target gene comprising at least one suitable regulatory sequence: and c) site-specific sequences responsive to a site-specific recombinase:
(ii) a chromosomally-integrated chimeric transactivating gene comprising a regulated plant promoter operable-linked to a site-specific recombinase coding sequence:
(iii) a dimer of a geminivirus B genome:
wherein expression of the chimeric transactivating gene in cells containing the inactive replicon results in the site-specific recombination, activation of replicon and B-genome replication and increased expression of the target gene.
40. method of altering the levels of a protein encoded by a target gene in a plant comprising:
(i) transforming a plant with the viral expression system of Claim 39; and (ii) growing the transformed plant seed under conditions wherein the protein is expressed.
(i) transforming a plant with the viral expression system of Claim 39; and (ii) growing the transformed plant seed under conditions wherein the protein is expressed.
41. A method of increasing vial resistance in a plant comprising:
(i) transforming a first plant with a inactive replicon to form a first primary transformant. the inactive replicon comprising:
a) cis-acting viral elements required for viral replication;
b) viral sequences homologous to the infecting virus capable of conferring homology-dependent resistance:
c) site-specific sequences responsive to a site-specific recombinase;
(ii) transforming a second plant with a chimeric transactivating gene to form a second primary transformant comprising a regulated plant promoter operably-linked to a transactivating site-specific recombinase coding sequence;
(iii) growing the first and second primary transformants wherein progeny from both seeds are obtained: and (iv) crossing the progeny of the first and second transformants wherein the viral sequences homologous to the infecting virus are expressed. conveying viral resistance to the plant.
(i) transforming a first plant with a inactive replicon to form a first primary transformant. the inactive replicon comprising:
a) cis-acting viral elements required for viral replication;
b) viral sequences homologous to the infecting virus capable of conferring homology-dependent resistance:
c) site-specific sequences responsive to a site-specific recombinase;
(ii) transforming a second plant with a chimeric transactivating gene to form a second primary transformant comprising a regulated plant promoter operably-linked to a transactivating site-specific recombinase coding sequence;
(iii) growing the first and second primary transformants wherein progeny from both seeds are obtained: and (iv) crossing the progeny of the first and second transformants wherein the viral sequences homologous to the infecting virus are expressed. conveying viral resistance to the plant.
Applications Claiming Priority (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10155898P | 1998-09-23 | 1998-09-23 | |
US60/101,558 | 1998-09-23 | ||
US13008699P | 1999-04-20 | 1999-04-20 | |
US69/130,086 | 1999-04-20 | ||
US15025599P | 1999-08-23 | 1999-08-23 | |
US60/150,255 | 1999-08-23 | ||
PCT/US1999/021989 WO2000017365A2 (en) | 1998-09-23 | 1999-09-22 | Binary viral expression system in plants |
Publications (1)
Publication Number | Publication Date |
---|---|
CA2339595A1 true CA2339595A1 (en) | 2000-03-30 |
Family
ID=27379204
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002339595A Abandoned CA2339595A1 (en) | 1998-09-23 | 1999-09-22 | Binary viral expression system in plants |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1115870A2 (en) |
CA (1) | CA2339595A1 (en) |
HU (1) | HUP0104697A3 (en) |
NZ (1) | NZ510594A (en) |
WO (1) | WO2000017365A2 (en) |
Families Citing this family (30)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6632980B1 (en) * | 1997-10-24 | 2003-10-14 | E. I. Du Pont De Nemours And Company | Binary viral expression system in plants |
AU4393901A (en) | 2000-03-28 | 2001-10-08 | Univ Queensland | A construct capable of release in closed circular form from larger nucleotide sequence permitting site specific expression and/or developmentally regulated expression of selected genetic sequences |
AU2001243939B2 (en) * | 2000-03-28 | 2006-06-15 | Queensland University Of Technology | A construct capable of release in closed circular form from a larger nucleotide sequence permitting site specific expression and/or developmentally regulated expression of selected genetic sequences |
US7468475B2 (en) | 2000-06-16 | 2008-12-23 | Schmuelling Thomas | Method for modifying plant morphology, biochemistry and physiology |
DE10049587A1 (en) | 2000-10-06 | 2002-05-02 | Icon Genetics Ag | Vector system for plants |
US7560622B2 (en) | 2000-10-06 | 2009-07-14 | Pioneer Hi-Bred International, Inc. | Methods and compositions relating to the generation of partially transgenic organisms |
DE10061150A1 (en) | 2000-12-08 | 2002-06-13 | Icon Genetics Ag | Methods and vectors for the production of transgenic plants |
DE10102389A1 (en) | 2001-01-19 | 2002-08-01 | Icon Genetics Ag | Methods and vectors for plastid transformation of higher plants |
DE10109354A1 (en) * | 2001-02-27 | 2002-09-05 | Icon Genetics Ag | Recombinant viral switch systems |
DE10114209A1 (en) | 2001-03-23 | 2002-12-05 | Icon Genetics Ag | Site-directed transformation using amplification vectors |
DE10115507A1 (en) | 2001-03-29 | 2002-10-10 | Icon Genetics Ag | Method for coding information in nucleic acids of a genetically modified organism |
DE10121283B4 (en) * | 2001-04-30 | 2011-08-11 | Icon Genetics GmbH, 80333 | Methods and vectors for amplification or expression of desired nucleic acid sequences in plants |
DE10132780A1 (en) | 2001-07-06 | 2003-01-16 | Icon Genetics Ag | Plastid gene expression via autonomously replicating vectors |
DE10143237A1 (en) | 2001-09-04 | 2003-03-20 | Icon Genetics Ag | Manufacture of artificial internal ribosomal entry point elements (Ires elements) |
DE10143238A1 (en) | 2001-09-04 | 2003-03-20 | Icon Genetics Ag | Identification of eukaryotic internal ribosome entry sites (IRES) elements |
US7238854B2 (en) | 2002-04-11 | 2007-07-03 | E. I. Du Pont De Nemours And Company | Method of controlling site-specific recombination |
US7267979B2 (en) | 2002-07-01 | 2007-09-11 | Pioneer Hi-Bred International, Inc. | Method of controlling gene silencing using site specific recombination |
US9187761B2 (en) | 2006-09-25 | 2015-11-17 | Thomas Schmulling | Transcriptional repressors of cytokinin signaling and their use |
ATE550350T1 (en) | 2009-07-10 | 2012-04-15 | Univ Berlin Freie | ROCK2 AND ROCK3, TWO NEW GAIN-OF-FUNCTION VARIANTS OF THE CYTOKIN RECEPTORS AHK2 AND AHK3 |
EP2418283A1 (en) | 2010-08-07 | 2012-02-15 | Nomad Bioscience GmbH | Process of transfecting plants |
EP2584042A1 (en) | 2011-10-17 | 2013-04-24 | Nomad Bioscience GmbH | Production, storage and use of cell wall-degrading enzymes |
EP2647715A1 (en) | 2012-04-03 | 2013-10-09 | Nomad Bioscience GmbH | Agrobacterium for transient transfection of whole plants |
EP3097783B1 (en) | 2015-05-26 | 2019-11-13 | Nomad Bioscience GmbH | Colicin m for the control of ehec |
EP3372091A1 (en) | 2017-03-07 | 2018-09-12 | Nomad Bioscience GmbH | Method of reducing contamination of an object with clostridium |
EP3378485A1 (en) | 2017-03-24 | 2018-09-26 | Nomad Bioscience GmbH | Bacteriocins for control of salmonella enterica |
EP3752185A1 (en) | 2018-02-15 | 2020-12-23 | Icon Genetics GmbH | Immunogenic composition and vaccine for generating an immune response to norovirus |
CA3133030A1 (en) | 2019-03-12 | 2020-09-17 | Icon Genetics Gmbh | Norovirus-like particles with improved stability |
BR112021024197A2 (en) | 2019-06-06 | 2022-04-26 | Nomad Bioscience Gmbh | Klebicins for the control of klebsiella |
AU2021308848A1 (en) | 2020-07-16 | 2023-03-09 | Nomad Bioscience Gmbh | Products for oral consumption with reduced sugar content |
EP4248987A1 (en) | 2022-03-21 | 2023-09-27 | Nomad Bioscience GmbH | Chimeric bacteriocins and method for the control of pseudomonas |
Family Cites Families (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0221044B1 (en) * | 1985-10-25 | 1992-09-02 | Monsanto Company | Novel plant vectors |
NL9001711A (en) * | 1989-10-03 | 1991-05-01 | Clovis Matton N V | GENETIC MANIPULATIONS WITH RECOMBINANT DNA INCLUDING SEQUENCES DERIVED FROM RNA VIRUS. |
CA2156720A1 (en) * | 1993-02-26 | 1994-09-01 | Jean C. Kridl | Geminivirus-based gene expression system |
GB9405768D0 (en) * | 1994-03-23 | 1994-05-11 | Univ Leicester | Viral replicon |
GB9626858D0 (en) * | 1996-12-24 | 1997-02-12 | Gatsby Plant Science Innovatio | Transcriptional regulation in plants |
GB9703146D0 (en) * | 1997-02-14 | 1997-04-02 | Innes John Centre Innov Ltd | Methods and means for gene silencing in transgenic plants |
ATE454459T1 (en) * | 1997-11-18 | 2010-01-15 | Pioneer Hi Bred Int | MOBILIZATION OF A VIRAL GENOME FROM T-DNA THROUGH SITE-SPECIFIC RECOMBINATION SYSTEMS |
-
1999
- 1999-09-22 NZ NZ510594A patent/NZ510594A/en unknown
- 1999-09-22 EP EP99969445A patent/EP1115870A2/en not_active Withdrawn
- 1999-09-22 CA CA002339595A patent/CA2339595A1/en not_active Abandoned
- 1999-09-22 WO PCT/US1999/021989 patent/WO2000017365A2/en not_active Application Discontinuation
- 1999-09-22 HU HU0104697A patent/HUP0104697A3/en unknown
Also Published As
Publication number | Publication date |
---|---|
HUP0104697A2 (en) | 2002-03-28 |
HUP0104697A3 (en) | 2003-12-29 |
WO2000017365A2 (en) | 2000-03-30 |
WO2000017365A8 (en) | 2000-10-12 |
EP1115870A2 (en) | 2001-07-18 |
WO2000017365A3 (en) | 2000-08-24 |
NZ510594A (en) | 2002-09-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6632980B1 (en) | Binary viral expression system in plants | |
CA2339595A1 (en) | Binary viral expression system in plants | |
US6077992A (en) | Binary viral expression system in plants | |
ES2267175T3 (en) | PROCEDURE AND MEANS FOR GENETIC LOCK IN TRANSGENIC PLANTS. | |
AU731330B2 (en) | Binary viral expression system in plants | |
JP2000515748A (en) | Methods for reducing transgene expression variability in plant cells | |
JP2004536573A (en) | Recombinant viral switch for regulating gene expression in plants | |
WO2000056895A1 (en) | COTTON LEAF CURL VIRUS (CLCuV) PROMOTER AND ITS USE | |
KR100477413B1 (en) | Improved integration of exogenous DNA delivered to eukaryotic cells | |
MXPA03011302A (en) | Processes and vectors for producing transgenic plants. | |
US7238854B2 (en) | Method of controlling site-specific recombination | |
AU2010211450B2 (en) | Plant transformation using DNA minicircles | |
US7267979B2 (en) | Method of controlling gene silencing using site specific recombination | |
Lebedev et al. | Transgenic pear clonal rootstocks resistant to herbicide" Basta" | |
JP4797141B2 (en) | Constructs that can be released in a closed circle from larger nucleotide sequences that allow site-specific and / or developmentally regulated expression of selected gene sequences | |
MXPA01002374A (en) | Binary viral expression system in plants | |
AU1441000A (en) | Binary viral expression system in plants | |
Lee | New Binary Ti Vectors with Co-directional Replicons for Agrobacterium Tumefaciens-mediated Transformation of Higher Plants | |
WO2011031370A1 (en) | Enhancement of reproductive heat tolerance in plants | |
MXPA00003537A (en) | Binary viral expression system in plants | |
Hegedus | 10 pORE Modular Vectors for Plant Transformation | |
MXPA99007512A (en) | Methods and means for gene silencing in transgenic plants | |
AU2001243939A1 (en) | A construct capable of release in closed circular form from a larger nucleotide sequence permitting site specific expression and/or developmentally regulated expression of selected genetic sequences |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FZDE | Discontinued |