CA2196200A1 - Novel compounds - Google Patents

Abstract

A soluble protein having IL4 and/or IL13 antagonist or partial antagonist activity comprises an IL4 mutant or variant fused to at least one human immunoglobulin constant domain or fragment thereof.

Description

W096/04388 21 9 6 2 0 0 , ~"~ ~n~6 .

NOVEL COMPOUNDS
The present invention relates to antagonists of human interleukin 4 (IL4) and/or human interleukin 13 (IL13) for the treaument of condiuions resulting from ~m~l~Qir~hi~- actions of IL4 and/or IL13 such as certain IgE mediated allergic diseases, S T cell mediated d~ condiuons and h.c,yy.uyl;dtc immune responses to infecuous agents.
Tnt~rll . ' are secreted peptide mediators of the immune response. Each of the known hl.cll.,..kills has many effects on the d~,~.,lvyll~ lL, activation, y~ulirc~ iu"
and ~' '' of cells of the immune system. IL4 has a IJh~Diulogi~,al role in10 such functions, but can also contribute to the p - I~UO ~ -:, of disease. In particular Il,4L is associated with the pathway of B l~ yLu~"y tc dc ~ ~,luy~ that leads to the generation of IgE antibodies that are the hallmark of allergic diseases such as extrinsic asthma, rhinitis, allergic cu~ LiviLis~ atopic dermatitis and a~ yll~lQudD.
IL4 can also act as a general growth and dirrc.c..LhlLiu.. factor for T Iyll.yh~ ~., that may contribute to tissue damage in certain A ~ l l. ~ . ~ " 1. 1~ conditions such as insulin dependent diabetes, multiple sclerosis and .h ' arthritis and in graft rejection.
IL4 can also suppress the generation of cell-mediated responses required for thecontrol of infectious disease. Antagonism of the effect of IL4 on T or B ly , ' can therefore be expected to have beneficial effects on such diseases. IL13 has been recently identified and shares similarity in many of the biological properties of IL4 (Minty, A. et al (1993), Nature 362, 248-250) including some aspect(s) of receptor structure/function (Aversa, G. et al (1993), J. Exp. Med. 178, 2213-~l8).
Human IL4 consists of a single pol~y~,yLidc chain of 129 amino acids with 2 possible N-~ly~,uD~l~Liul~ sites and 6 cysteines involved in 3 disulphide bridges (Le, H.V. en aL, (1988), J. Biol. Chem. 263, 10817-10823). The amino acid sequence ofIL4 and the positions of these disulphide bridges are known (Carr, C. et al., (1991) Ri-r I .1. ~.1y 30, 1515-1523).

HIS-LYS-CYS-ASP-ILE-THR-LEU-GLN-GLU-ILE-ILE-LYS--THR-LEU-ASN-SER-LEU-THR-GLU-GLN-LYS-THR-LEU-CYS-THR-GLU-LEU-THR-VAL-THR-ASP-ILE-PHE-ALA-ALA-SER-LYS-ASN-THR-THR-GLU-LYS-GLU-THR-PHE-50 = ~ ' 60 CYS-ARG-ALA-ALA-THR-VAL-LEU-ARG-GLN-PHE-TYR-SER-HIS-HIS-GLU-LYS-~SP-THR-ARG-CYS-LEU-GLY-ALA-THR-ALA-GLN-GLN-PHE-HIS- M G-_ I

WO 96/043R8 2 1 9 6 2 (~ 0 ~ = r~~ n~6 ~IIS-LYS-GLN-LEU-ILE-ARG-P~E-LEU-LYS-MG-LEU-ASP-ARG-ASN-LEU-llO = :~ 12Q
GLN-SER-THR-LEU-GLU-ASN-PEE-LEU-GLU-MG-LEU-LYS-T}iR-ILE-MET-12g The disulphide bridges are between residues 3 and 127, 24 and o5, and 46 and 99 The molecular weight of L4 varies with the extent of ~ ,U~yl~liull from 15KDa(no glyl,uaylclliul.) to 60KDa or more ~L~ ,u~' I IL4).
The DNA sequence for human IL4 has also been described by Yokota, T.
et. al., P.N.A.S. 1986 83 5894-5898.
WO 93/10235 describes certain mutants of IL4 which are L4 antagonists or partial ~n~ae~nicrc EP-A-0 464 533 discloses fusion proteins comprising various portions of the 20 constant region of imm~ glnhnlin molecules together with another human protein or part thereof.
The present invention provides a soluble protein having IL4 and/or L13 antagonist or partial antagonist activity, comprising an L4 mutant or variant fused to least one human; . ".., .. ~,1. ,1,. ,I;, . constant domain or fragment thereof.The term "mutant or variant" ~ ., any molecule such as a truncated or other derivative of the IL4 protein which retains the ability to antagonise IL4 and/or IL13 following intemal ~,I.,.;. ;~l. ~l;.". to a human. Such other derivatives can bepreparedbytheaddition,deletion"~ 8~.~ orr ~ ne~m~ntofaminoacidsor bychemical ,.. 1;1;. ~ thereof.
DNA polymers which encode mutants or variants of L4 may be prepared by site-directed " . ~ of the cDNA which codes for IL4 by ~un~ Liull~ll methods such as those described by G. Winter et al in Nature 1982, 299, 756-758 or by Zoller and Smith 1982; Nucl. Acids Res., 10, 6487-6500, or deletion m.l..,e,n. cic such as described by Chan and Smith in Nucl. Acids Res., 1984, 12, 2407-2419 or by G.
Winter es al in Biochem. Soc. Trans., 1984; 12, 224-225 or pul~ ,laa~ chain reaction such as described by Mikaelian and Sergeant in Nucleic Acids Research, 1992, 20, 376.
As used herein, "having L4 and/or IL13 antagonist or partial antagonist activity" means that, in the assay described by Spits es al (J. T, . ~ r 139, 1142 (1987)), L4-stimulated T cell proliferation is inhibited in a dose-dependent manner.
Suitable L4 mutants are dlsclosed in WO 93/10235, wherein at least one amino acid, naturally occuring in wild type IL4 at any one of positions 120 to 128 wo 96/04388 2 1 q 6 2 0 0 F ~, 1 /~1 ~., . ~6 inclusive, is replaced by a different natural amino acid. In particular, the tyrosine naturally occurring at position 124 may be replaced by a different natural amino acid, such as glycine or, more preferably, aspartic acid.
The ;."..,~ g~ 8i-- may be of any subclass (1gG, IgM, lgA, IgE), but is 5 preferably IgG, such as IgG I, IgG3 or IgG4. The said constant domain(s~ or fragment thereof may be derived from the heavy or light chain or both. The invention ~ u~ mutations in the ~0 L ' component which climinate " 8. ;,~ properties of the native ;".. ~.. gl.. b 1;l~, such as Fc receptor binding and/or introduce desirable properties such as stability. For example, Angal S., King 10 D.J., Bodmer M.W., Turner A., Lawson A.D.G., Roberts G., Pedley B. and Adair R., Molecular l,..l" ,.~ o~ vol30pplO5-108, 1993, describe an IgG4 molecule where residue 241 (Kabat I ' g) is altered from serine to proline. This change increases the serum half-life of the IgG4 molecule. Canfield S.M. and Morrison S.L., Journal of F . l Medicine vol l73pp 1483- 1491, describe the alteration of 15 residue 248 (Kabat numbering) from leucine to glutamate in IgG3 and from glutamate to leucine in mouse IgG2b. S~hctit~ rm of leucine for glutamate in theformer decreases the affinity of the O ' ' molecule concerned for the Fcy RI receptor, and ,..1,~1; n ;.... of glutamate for leucine in the latter increases the affinity. EP0307434 discloses various mutations including an L to E mutation at 20 residue 248 (Kabat numbering) in IgG.
The constant domain(s) or fragment thereof is preferably the whole or a substantial part of the constant region of the heavy chain of human IgG, most preferably IgG4. In one aspect the IgG component consists of the CH2 and CH3 domains and the hinge region of IgGl including cysteine residues, g to 25 inter-heavy chain disulphide bonding, for example residues 11 and 14 of the IgGl hinge region (Frangione B. and Milstein C., Nature vol216pp939-941, 1967).
Preferably the IgGI component consists of amino acids Cu~ lJunl~ g to residues 1-4 and 6-15 of the hinge, 1-110 of CH2 and 1-107 of CH3 of IgGl described by Ellison J., Berson B. and Hood L. E., Nucleic Acids Research vollO, pp4071-4079, 1982.
30 Residue 5 of the hinge is changed from cysteine in the published IgGl sequence to alanine by alteration of TGT to GCC in the nucleotide sequence. In another aspect the IgG component is derived from IgG4, comprising the CH2 and CH3 domains and the hinge region including cysteine residues . . .", . ;l .. " I . .g to inter-heavy chain disulphide bonding, for example residues 8 and 11 of the IgG4 hinge region (Pinck J~R. and Milstein C., Nature vol216pp941-942, 1967). Preferably the IgG4 componentconsistsofaminoacids.,ullc~.ull-li-lgtoresidues 1-120fthehinge, 1-110 of CH2 and I - 107 of CH3 of IgG4 described by Ellison J., Buxbaum J. and Hood L., DNA vollppl l-18, 1981. In one example of a suitable mutation in IgG4, residue 10 .. . . . . . . .. _ _ .. .. _ ... .. . ... . .. ... . ... _ _ _ wo 96104388 2 1 9 6 2 0 0 r ~ ~

of the hinge (residue 241, Kabat numbering) is altered from serine (S) in the wild type to proline (P) and residue 5 of CH2 (residue 248, Kabat numbering) is altered from leucine (L) in the wild type to glutamate (E).
Fusion of the IL4 mutant or variant to the Ig constant domain or fragment is 5 by C-terminus of one component to N-terminus of the other. Preferably the IL4 mutant or variant is fused via its C-terminus to the N-terminus of the Ig constant domain or fragment.
In a preferred aspect, the amino acid sequence of the fusion protein of the invention is ..,~ .,...~ by SEQ ID No:4, SEQ ID No:7 or SEQ ID No: 10.
In a further aspect, the invention provides a process for preparing a compound according to the invention which process comprises expressing DNA encoding said compound in a lC ' host cell and recovering the product.
The DNA polymer comprising a nucleotide sequence that encodes the compound also forms part of the invention.
In a preferred aspect the DNA polymer comprises or consists of the sequence of SEQ ID No:3, SEQ ID No:6 or SEQ ID No:9.
The process of the invention may be performed by ~ v~l~Liollal l~ ' techniques such as described in Maniatis e~. ai., Molecular Cloning - A Laboratory Manual; Cold Spring Harbor, 1982 and DNA Cloning vols I, ll and Ill (D.M. Glover20 ed., IRL Press Ltd).
In particular, the process may comprise the steps of:
i) preparing a replicable expression vector capable, in a host cell, of expressing a DNA polymer comprising a nucleotide sequence that encodes said compound;
ii) n A..~rl~ a host cell with said vector;
25 iiu) culturing said ~ rul UI~ host cell under conditions permitting expression of said DNA polymer to produce said compound; and iv) recovering said compound.

The invention also provides a process for preparing the DNA polymer by the 30 , ' of ~ )IUl ~ ' mono-, di- or oligomeric nucleotide units.
The ~ lLi~nl may be carried out chemically, cll~,yllld~ lly~ or by a ~..,,,,i.;.,Al...,~ofthetwomethods,invilroorinvivoas~ lu~ Lc~ Thus,theDNA
polymer may be prepared by the enzymatic ligation Of ~ r DNA fragments, by l~ llv~ ional methods such as those described by D. M. Roberts et al in Bi~h~,lll;aL y 1985, 24, 5090-5098.
The DNA fragments may be obtained by digestion of DNA containing the required sequences of nucleotides with appropriate restriction enzymes, by chemical Wog6/043s8 2 i ~200 r~"-~

synthesis, by enzymaic pol~u~ Liu,~ on DNA or RNA templates, or by a "",1~ ;nl. of these methods.
Digestion with resrriction enzymes may be performed in an appropriate buffer at a ~ UIC of 20~-70~C, generally in a volume of 50LLI or less with O.l-lO,LLg S DNA.
Enzymatic poly..,~,.i,~Liu.l of DNA may be carried out in virro using a DNA
Auul~ aG such as DNA ~ul~ aG I (Klenow fragment) in an appropriate buffer containing the nucleoside t. r' , ' dATP, dCTP, dGTP and dTTP as required at a r. ~ 'n~r of 10~-37~C, generally in a volume of 501l1 or less.
Enzymaic ligation of DNA fragments may be carried out using a DNA ligase such as T4 DNA ligase in an appropriate buffer at a t 1l~ r of 4~C to ambient, generally in a volume of SO,L1I or less.
The chemical synthesis of the DNA polymer or fragments may be carried out by COIlv~,nLLull~l pllu~ u; ~IrA~ phosphite or p~ ; chemistry, using solid lS phase techniques such as those desctibed in 'Chemical and Enzymatic Synthesis of Gene Fragments - A Laboratory Manual' (ed. H.G. Gassen and A. Lang), Verlag Chemie, Weinheim (1982),or in other scientific ~u~ in~, for example M.J. Gait, H.W.D. Matthes, M. Singh, B.S. Sproat, and R.C. Titmas, Nucleic Acids Research, 1982, 10. 6243; B.S. Sproat and W. Bannwarth, Tetrahedron Letters, 1983, 24, 5771;
M.D. Matteucci and M.H Caruthers, Tetrahedron Letters, 1980,21, 719; M.D.
Matteucci and M.H. Caruthers, Journal of the American Chemical Society, 1981, 103, 3185; S.P. Adams er al., Journal of the American Chemical Society,1983, 105, 661;
N.D. Sinha, J. Biernat, J. Mr~ '- and H. Koester, Nucleic Acids Research, 1984, 12, 4539; and H.W.D. Matthes et aL EMBO Joumal, 1984, 3, 801. Preferably an automated DNA synthesizer is employed.
The DNA polymer is preferably prepared by ligating two or more DNA
molecules which together comprise a DNA sequence encoding the cotnpound. A
particular process in accordance with the invention comprises ligaing a ftrst DNA
molecule encoding a said IL4 mutant or variant and a second DNA molecule 30 encoding a said i".,." ~ nb~ lin domain or fragment thereof.
The DNA molecules may be obtained by the digestion with suitable restricion enzymes of vectors carrying the required coding sequences or by use of pul~ aG
chain reacion technology The precise structure of the DNA molecules and the way in which they are obtained depends upon the structure of the desired product. The design of a suitable strategy for the CO.-~LI u~,Liun of the DNA molecule coding for the compound is a routine matter for the skilled worker in the art.

wo 96/04388 :2 1 9 6 2 0 0 ~ n~6 The expression of the DNA polymer encoding the compound in a IC_ ' ~
host cell may be carried out by means of a replicable expression vcctor capable, in the host cell, of expressing the DNA polymer. The expression vector is novel and also forms part of the invention The replicable expression vector may be prepared in accordance with the invention, by cleaving a vector compatible with the host cell to provide a linear DNA
segment having an intact replicon, and combining said linear segment with one ormore DNA molecules which, together with said linear segment, encode the compoùnd~ under ligating conditions.
The ligation of the linear segment and more than one DNA molecule may be carried ûut ! ' ~!/ or sequentially as desired.
Thus, the DNA polymer may be preformed or formed during the CU~IDLIU~ UII
of the vector, as desircd.
The choice of vector will be determined in part by the host cell, which may be ~lukalyuLiC, such as E. coli, or eukaryotic, such as mouse C127, mouse myeloma, chincse hamster ovary or Hela cells, fungi e.g. filsm~nt~uc fungi or unicellular yeast or an insect cell such as Drosophila. The host cell may also be a transgenic animal.
Suitable vectors include plasmids, l. -- .s .;ulll.AL,. ~ cosmids and Ic~ . viruses derived from, for example, l,c,~,uluvh..D~,D, vaccinia or Semliki Forest virus.
The ~ J~aliull of the replicable expression vector may be carried out cu.. ~ . iu~ ally with a~ r ' enzymes for restriction, pol~ iDaLiull and ligation of the DNA, by procedures described in, for example, Maniatis ~ ~., cited above.Pol~ iDa~ion and ligation may be performed as described above for the ~Jlc~aLiu~of the DNA polymer. Digestion with restriction enzymes may be performed in an a~ ul buffer at a t~ aLulc of 20~-70~C, generally in a volume of 50~LI or less with 0.1-lO~g DNA.
The lc~ ,...l,;~ - l host cell is prepared, in accordance with the invention, by n A ~rl ~ lg a host cell with a replicable expression vector of the invention under nAI~r~ l;llg conditions. Suitable LlallDrullllhlg conditions are uu~ iullai and are 30 described in, for example, Maniatis e~ aL cited above, or "DNA Cloning" Vol. lI, D.M. Glover ed., IRL Press Ltd, 1985.
The choice of L~.,..Drullu...g conditions is ~tl~rmin~d by the host celL Thus, abacteriai host such as E. co~i may be trcared with a solurion of CaC12 (Cohen er al, Proc. Nat. Acad. Sci., Ig73, 69, 2110) or with a solution comprising a mixrure of 35 RbCI, MnC12, potassium acetate and glycerol, and then with 3-[N-~uulyiluli~O]-propane-sulphonic acid, RbCI and glycerol. MRrnmsliRn cells in culture may be LauDrullll~d by calcium Co-l)lcui~ dliul- of the vector DNA onto the cells.

wo 96/04388 2 ~ 9 6 2 0 0 r~

The invention also extends ro a host cell n A~ I'r ~ .- ~ I with a replicable expression vector of the invention.
Culturing the ~ ru..ll~,d host cell under conditions permitting expression of the DNA polymer is carried OUI ~uu~ Liundlly, as described in, for example, 5 Maniatis er al and "DNA Cloning" cited above. Thus, preferably the cell is supplied with nutrienl and cultured at a [~ U.c below 45~C.
Tite expression product is recovered by uu..v.,.~iiu..AI methods according to the .
host cell. Thus, where the host cell is bacterial. such as E. coll it may be Iysed physically, chemically or ~ .ylll_ii.,lly and the protein product isolated from the 10 resulting Iysate. If the product is to be secreted from the bacterial cell it may be recovered from the P . ;~ space or the nutrient medium. Where the host ceil is 1;AI1, the product may generally be isolated from the nutrient medium.
The DNA polymer may be assembled into vectors dcsigned for isolation of stable u,- ~r.. fl mAmmAli~n cell lines expressing the product; e.g. bovine papillomavirus vectors or amplified vectors in chinese hamster ovary cells (DNA
cloning Vol.II D.M. Glover ed. IRL Press 1985; Kaufman, R.J. ~ ~1., Molecular and Cellular Biology 5, 1750- 1759, 1985; Pavlakis G.N. and Hamer, D.H., I~, ' of the National Academy of Sciences (USA) 80, 397-401, 1983; Goeddel, D.V. et al., European Patent Application No. 0093619, 1983).
f'nmro~lnfi~ of the present invention have IL4 and/or IL13 anugonist activity and are therefore of potential use in the treatment of conditions resulting from" ".1. ~: Ai-lf actions of IL4 andlor IL13 such as IgE mediated allergic diseases and T
cell mediated conditions or chronic microbial infection.
The invention therefore further provides a pl,~ u~
comprising a compound of the invention and a 1~l - ~" -- ~ .I;. Ally accepuble carrier.
In use the compound will normally be employed in the form of a " ~ cnmroci~inn in association with a human 1~l - ~ ~ .1 - .,... i~ Al carrier, diluent andlor excipient, although the exact form of the ~ " will depend on the mode of A.' The compound may, for example, be employed in the 3û form of aerosol or 1.. ~ solution for inhalation or sterile solutions for parenteralAllll~ n,.l;r"~
The dosage ranges for a~ ;n.l of the f- -l.,l-u l~ of the present invention are those to produce the desired effect on the IL4 and/or IL13 mediated condition, for example whereby IgE antibody mediated symptoms are reduced or 35 IJlUt;,l~ iUII ofthe -- ~ .;,."""".~diseaseishaltedorreversed. Thedosagewill generally vary with age, extent or severity of the medical condition and r.. ,. u . A;, ..1;, ~ if any. The unit dosage can vary from less than Img to 300mg, but wo 96/04388 ~ P Y I l~ o. 6 2l 9~200 typically will be in the region of I to 20mg per dose, in one or more doses, such as one lo six doses per day, such that the daily dosage is in the range 0.02-40mg/lcg.
n~ suitable for injection may be in the form of solutions, or emulsions, or dry powders which are dissolved or suspended in a 5 suitable vehicle prior to use.
Fluid unit dosage fomms are prepared utilising the compound and a pyrogen-free sterile vehicle. The compound, depending on the vehicle and used, can be either dissolved or suspended in the vehicle. Solutions may be used for all forms of parenteral ' and are p~u Ih,ul~uly used for10 h~ v~ infection. In preparing solutions the compound can be dissolved in the vehicle, the solution being made isotonic if necessary by addition of sodium chloride and sterilised by filtration through a sterile filter using aseptic techniques before filling into suitable sterile vials or ampoules and sealing. Alternatively, if solution stability is adequate, the solution in its sealed containers may be sterilised by uLvcl~Y;--g. Adv~u-~g~,~/u~ly additives such as buffering, sol~hiiicine stabilising, ,L/II.,~>CI V.lliV~ or h =- .. ;. ;.1.1, suspending or clllul ,;f~;llg agents and/or local anaesthetic ~ agents may be dissolved in the vehicle.
Dry powders which are dissolved or suspended in a suitable vehicle prior to use may be prepared by filling pre-sterilised drug substance and other ingredients into 20 a sterile container using aseptic technique in a sterile area. Alternatively the drug and other ingredients may be dissolved in an aqueous vehicle, the solution is sterilised by filtration and distributed into suitable containers using aseptic technique in a sterile area. The product is then freeze dried and the containers are sealed asepically. Parenteral ~ suitable for ;~ ..h~ ."- v ~c or 25 intr~iPrm~l injection, are prepared in snhct~nti~lly the same manner, except that the sterile compound is suspended in the sterile vehicle, instead of being dissolved and ~r.. ;1;~ .. cannot be ..1 ~..,..I.li~' - d by filtration. The compound may be isolated in a sterile state or alternatively it may be sterilised after isolation, e.g. by gamma irradiation. Adv~u,~ ,u,l v, a suspending agent for example pc,l v v h~yll~ llidoae is 30 included in the ~ '1'0~;1;'~ to facilitate uniform riicrrihllticm of the compound.
t'.." ,l..:,~:l;-,n~ suitable for a~ ;.... via the respiratory trdct include aerosols, nl-bnlic~hll- solutions or microfine powders for ~ In the latter case, particle size of less than 50 microns, especially less than 10 microns, ispreferred. Such cr~ may be made up in a uullv.,~lliondl manner and 35 employed in U~l..; .- 1;ll~l with u~llv...ni~/nd~ 3~ t;l.~ devices.
In a further aspect there is provided a method of treating conditions resulting from ~ ;,, hl. actions of lL4 and/or IL13 which comprises ~ e to the sufferer an effective amount of a compound of the invention.

wo 96/04388 2 1 9 6 2 G O p~l/rJ 3 The invention further provides a compound of the invention for use as an active therapeutic substance, in particular for use in treating conditions resulting from ".,.1. :.~IJI~ actionsofllAandlorIL13.
The invention also provides the use of a compound of the invention in the t 5 ~ul~r<l~.ulci of a ,~.l;. ~, for treating conditions resulting from ulld~,~ualJle actions of IL4 and/or IL13.
No lm~Yre(~tPd ~ g~ effects are expected when ~ 1 ' of the invention are ad...;..;s~"ed in accordance with the present invention.
The following Examples illustrate the invention.

Example I IL4.Y124D/lgGl fusion protein The ~,VII~L~UUI,il./U of an IL4.Y124D/IgGI chimeric cDNA, the expression of the ~,u~ o..ding protein in a .,.~".". ~l;_ expression system and its activity are 15 described.

1. C~ ', ' of DNA coding for fusion protein (a) Construction of IL4.Y124D coding region A variant of the human IL4 gene, which has been described (Kruse, N, Tony, H-P and Sebald, W. EMBO Joumal 11.: 3237 [1992]) in which residue 124 in the protein has been mutated from tyrosine in the wild type to aspartic acid, was produced by PCR . ., ~ cic of the human IL4 cDNA (purchased from British R;-,j~ ), The llA.Y124D cDNA was inserted into the expression vector pTR312, using the Hindlll and Bglll sites, (M J Browne, J E Carey, C G Chapman, A
W R Tyrrell, C Entwisle, G M P Lawrence, B Reavy, l Dodd, A Esmail & J H
Robinson. Journal of Biological Chemistry 2~: 1599, [1988]) to form the plasmid pDB906 To amplify the IL4.Y124D molecule and add convenient restriction sites at each end for 5llh~ ning, a PCR reaction was performed using 20ng of the pDB906 plasmid as the substrate. PCR primers were designed to include restriction enzyme sites, flanked by 10-15 nucleotide base pairs to "anchor" the primers at each end. The primer sequences were as follows:

1) 5' CGA ACC ACT GAA TTC CGC ATT GCA GAG ATA 3' (includes an EcoRI restriction site, GAATTC) 2) 5' CAC AAA GAT CCT TAG GTA CCG CTC GAA CAC m GA 3' (includes a Kpnl restriction site, GGTACC) wo 96l04388 . ~ n~6 2176200 ~ ~ ~
Primers were used at a final cu ~~ f .~ .1;.." of 5ng/~11, and dNTPs were added at a final ~ .... of 0.2mM in a total reaction volume of lOO,ul. 31 cycles of PCR were performed. Cycles consisted of a .' step of 1 minute at 94~C, anannealing step of I minute 30 seconds at 50~C, and an elongarion step of I minute 30 S seconds at 72~C. On cycle l f~ was extended to S minutes and on the final cycle elongation was extended to 7 minutes. 2.5 units of the Taq pul~ c; enzyme from Advanced F ' ' O were used in the PCR reaction. A PCR product of 587bp was produced. This was purified using the Promega "Magic PCR cleanup" kit,and then digested with EcoRI and KpnI in react buffer 4 (all resttiction enzymes were obtained from GibcoBRL.), to generate 'sticky ends'. After 4 hours 30 minutes at 37~
C, the reaction was heated to 70~C for 10 minutes and then ethanol ~
Analysis of the resulting DNA by agarose gel c,lc~ showed the presence ofthree bands of a~/.u~ lately 570bp, 463bp and lOObp . The 570bp fragment represents the full-length IL4.Y124D variant of II.4 and was present because the15 digest was im~t)mrl~t~ The two smaller fragments were produced due to the prcsence of an EcoRI site within the IL4.Y124D cDNA. The 570bp band was purified by the Geneclean IM procedure, and ligated into Bluescript KS+ ~M which was prepared bydigestion with EcoRI and KpnI followed by Geneclean TM A Bluescript KS+/IL4.Y124D .c ' was thus generated. Large amounts of this 20 . ~ , I DNA were produced using the Promega "Magic Maxiprep" method.
The IL4.Y124D insert was excised from the Bluescript .c~ using SmaI and KpnI. 20~g IC~'I~. .1.' - -- ~ DNA was incubated with 25 units SmaI in react buffer 4, at 30~C overnight. 25 units of KpnI were then added to the digest, which was incubated at 37~C for S hours. The resulting fragment of ~ u~ f~ 580bp was purified by 25 Geneclean ~M to generate an IL4.Y 124D/Smal/Kpnl fragment.

(b) Cou~llu.,~iu.. of IgGl coding region The COSFcI,ink vector (Table 1~ contains hurnan IgGI cDNA encoding amino acids 1-4 and 6-15 of the hinge, 1-110 of CH2 and 1-108 of CH3 described by Ellison J., Berson B. and Hood L. E., Nucleic Acids Research vollO, pp4071-4079,1982. Residue 5 of the hinge is changed from cysteine in the published IgGl sequence to alanine by alteration of TGT to GCC in the nucleotide sequence. Thiswas cloned from the human IgG plasma cell leukemia ARH-77 ~American Type Tissue Collection), using RT-PCR and fully sequenced to confirm identity with the published sequence [patent application publication WO 92/00985]
The co.l ,u u~, UUII of COSFc began with a pUC18 vector containing the human IgGl cDNA above lpucl8-Fc)l which was digested with KpnI and SacII, deleting the CHl, hinge and part of CH2. The deleted region was replaced with a PCR

. , .

Wo 96/04388 2 1 9 6 2 ~ ~) r~ q ~n~

amplified fragment containing the hinge-CH2 region as follows. Using the following PCR primers:

5' TCG AGC TCG GTA CCG AGC CCA AAT CGG CCG ACA AAA CTC ACA
C3' and S' GTA CTG CTC CTC CCG CGG CTT TGT CTT G 3' A DNA fragment containing the hinge-CH2 region was amplified from 10 pUC18-Fc, digested with KpnI and SacII, gel purified and cloned into the KpnVSacII
digested pUC18-Fc vector. The Cys, which occurs at position 230 (Kabat mlmh~ing Kabat et al., "Sequences of Proteins of Immunological Interest, 5th Edition, US
Department of Health and Human Services, NIH Publication No. 91-3242 (1991~) of the IgG1 heavy chain, was altered to an Ala through a TGT to GCC - ' in 15 the nucleotide sequence. An altered DNA sequence in one of the PCR primers introduced a unique Kpnl site at the 5' end of the hinge. The resulting plasmid was called pUC18Fcmod, and the juncrions and PCR amplifed region were sequenced for ..... ~. " -~;
The entire hinge-CH2-CH3 insert in pUC18-Fcmod was removed im a single DNA fragment with Kpnl and XbaI, gel purified, and ligated into SFcRlCos4 cut with Kpnl and Xbal to create COSFc.
SFcRlCos4 is a derivative of pST4DHFR (Deen, K, McDougal, JS, Inacker, R, Folena-Wasserman, G, Arthos, J, Rosenberg, J, Maddon, PJ, Axel, R, and Sweet,RW. Nature 331: 82 [1988] ) and contains the soluble Fc receptor type I (sFcR1) inserted between the l;yLu~ luv ;- u~ (CMV) promoter and bovine growth hormone (BGH) pul.y~d.,llyLIliu~l regions, and also contains the diL.yLu~uL~ redllctase (DHFR) cDNA inserted between the ~-globin promoter and SV40 pol~ade.,.~L,.iu regions, an SV40 origin of replication, and an ampicillin resistance gene for growth in bacteria. Cutting the vector with KpnI and Xbal removes the sFcRI coding region, so that the COSFc vector contains the hinge-CH2-CH3 region inserted between the CMV promoter and BGH polyA regions.
The COSFcLink vector was made from COSFc by inserring an nlignn~ entiA.- linker at the unique EcoRI site of the vector, which recreates this EcoRI site, and also introduces BstEII, PstI and EcoRV cloning sites. The 35 nli~ ol;.l. ~ used were:
J

5' AATTCGGTTACCTGCAGATATCAAGCT 3' 3' GCCAATGGACGTCTATAGTTCGATTAA 5' wo96/043s8 2 i 9 620~I r~ 6 The junction was sequenced to confit~n oricniation in the vector. The sizc of the final vector is 6.37 kb.

(c) Construction of DNA coding for fusion protein.
To insen the IL4.Y124D cDNA, the COSFcLink vector was prepared by digesting with EcoRV and Kpnl as follows: 5~g DNA was incubated with 15 units EcoRV in react 2 at 37~C for 5 hours, followed by ethanol ~ The resulring DNA was digested with Kpnl in react 4 at 37~C for 3 hours, and ethanol~ ;~.~l. The IL4.Yl24D/SmaVKpnI and the COSFcLinklEcoRV/KpnI
fragments were ligated together to form plasmid pDB951, which encodes the IL4.Y124DlIgG1 fusion protein. The ligation was achieved using an Amersham DNA ligation kit, product code RPN 1507, the reactions being incubated at 16~C
overnight. The ligation reaction products were ~ r ~ . J into Promega 3M109 competent cells (high efficiency) and plated onto Luria Broth agar containing ampicillin at 5011g/ml. T ~ul ~ were cultured in Luria Broth (containing arnpicillin at 5011g/ml) and DNA prepared using Promega "Magic Minipreps".
Production of an IL4.Y124D/COSFcLink ~ '11 DNA was verified by restriction digests and DNA ~ nring The complete IL4.Y124D sequence and the junctions with the COSFcLink DNA were confirmed by DNA sequencing (Table 2).
The coding sequence of the .c l. IL4.Y124D/lgG1 DNA is shown in Table 3 and the amino acid sequence of the fusion protein is shown in Table 4. The IL4.Y124D/COSFcLink IC~ I DNA was prepared and purified using caesium chloride gradients and the DNA used to transiently transfect HeLa cells.

2. ~ of the fusion protein HeLa cells were grown in MEMc~ medium (Gibco) with 10% foetal calf serum and 1 ~o glutamine. For the assay, I x lo6 HeLa cells were seeded in I Smls F~PMI-1640 medium with 10% newborn calf serum, 1% glutamine ("seeding medium"), in a 75cm2 flask, four days prior to u~ re~,tiw~ On the day prior to rr~ l a further 12.5mls seeding medium was added to each flask. On the day Of uA~rr~ the medium was changed to 15mls of "l,A,.~rec~ medium" (MEM
medium with Earle's salts containing lû% newbom calf serum and 1% non essential amino acids), at time zero. At time +3 hours, 2511g of the _~Iu~ c DNA in 0.125M CaC12, lx HBS (BPES buffered saline) was added to the cells. At time +7 hours, the cells were subjected to a glycerol shock (15%v/v) and then left to incubate overnight in 12.5mls seeding medium containing SmM sodium butyrate. The next day the cells were washed with PBS (Dulbecco's phosphate buffered saline) and Wo 96104388 r~ A3036 ~ 21 962[~0 12.5mls ~hatvest medium" (RPMI-1640 with 2% of a 7.5% stock sodium b;.,~bu...lt~, solution) was added. After a further 24 hour incubauon, the s~ were removed, centrifuged at lOOOrpm for 5 minutes to remove cell debris and stored at either 4~C or -20~C.
3. Biological Activity For assay of . for IL4 antagonist activity: using the method described in Spits et al., JN., ~ ~olo~y 139, 1142 (1987), human peripheral blood 1~ 1 ' n"~ ;v~ were incubated for three days with IJ.. Y, ' v a T cell 10 mitogen, to upregulate the IL4 receptor. The resultant blast cells were then stimulated for a further three days with IL4. I'rul;r~ .L;u.. was measured by the hl~ul~JulaLiull of 3H thymidine.
The IL4.Y124D/lgGl chimera inhibited 3H thymidine hl~ullJulaiiuu by human peripheral blood T lyllll~Luvy~ stimulated with 133pM IL4 in a dose lS dependent manner.

Example 2 IL4.Y124D/lgG4 fusion protein 20 1. Cl ~ of DNA coding for fusion protein PCR was performed to amplify the IL4.Y124D coding region and introduce a silent nucleotide s ~ i.... at the 3' end which creates a Xhol site. As substrate for the PCR reaction 20ng of linearised pDB951 plasmid (Example l.l(c)) was used. The r~ ul ;~ lr primers used were as follows:
1) S' CAC AAG TGC GAT ATC ACC TTA CAG GAG ATC 3' (includes att EcoRV restriction site, GATATC) 2) S' CTC GGT ACC GCT CGA GCA CTT TGA GTC TTT 3' 30 (includes a Xhol restriction site, CTCGAG).

A second PCR reaction was perfommed to amplify the hinge-CH2-CH3 fragment of the human IgG4 heavy chain. The substrate for this was a synthetic human IgG4 heavy chain cDNA, the sequence of which is described in Table S, and is 35 based on the Genbank sequence GB:HUMIGCD2 (Ellison J., Buxbaum J. and Hood LE.,DNA 1:11-18, 1981). Numeroussilent~ ;..; weremadetothepublished nucleotide sequence. The gene was assembled by combining two O.SKb synthetic DNA fragments. Each O.SKb fragment was made by annealing a series of WO 96/04388 I ~,1 1~. . _ '03~'~6 21 96~00 u.~,~la~Jhlg r~ ul;~, and then filling in the gaps by PCR. The two 0.5Kb fragments were joined at the Sacll site and inserted into the pCR2 vector. A l.ûKb ApaI-Bglll fragment containing the entire constant region was isolated and ligated into an expression vector, pCD, cont~uning a humanized IL4 specific variable region.
This construct was used as the PCR substrate to amplify the hinge-CH2-CH3 regionof IgG4.
The ,-' ~ ' ' primers used for A~ " of the IgG4 hinge-CH2-CH3 region were as follows:

1) 5' GGT GGA CAA CTC GAG CGA GTC CAA ATA TGG 3' (includes a XhoI restriction site, CTCGAG) 2) 5' TTA CGT AGA TCT AGA CTA CAC TCA TTT ACC 3' (includes an XbaI site, TCTAGA).
The conditions for both PCR reactions were as described for the derivation of pDB951. Briefly, primers were used at 5ng/111, and dNTPs at a final , ~ of 0.2mM in a total reaction volume of 100~LI. 2.5 Units of Taq pol~ enzyme from Advanced Bi : ' ' ,, were used and 31 cycles of PCR
performed. Cycles consisted of a ~ step of 1 minute at 94~C, an annealrng step of 1 minute 30 seconds at 50~C, and an elongation step of 1 minute 30 seconds at 72~C On cycle 1 .1. . A~ - was extended to 5 minutes and on the final cycle elongation was extended to 7 minutes.
PCR products of a~ ly 700bp (hinge-CH2-CH3 of IgCi4) and 400bp (IL4.Y124D) were obtained and purified using the Promega "Magic PCR
cleanup" kit. The purified PCR reactions were then digested with the following enzymes to create "sticky ends": XhoI and XbaI for IgG4 and EcoRV and XhoI for IL4.Yl24D. The digests were incubated at 37~C for 3 hours and then ethanol r '. " ~ The resulting DNAs were analysed by gel el~uu~Lul~ and gave sizes of a~ 'y 690bp (hinge-CH2-CH3 of IgG4) and 370bp (IL4.Y124D).
A vector was prepared into which to ligate the hinge-CH2-CH3 of IgG4 and IL4.Y124D PCR fragments by digesting pDB951 (IL4.Y124D in COSFcLink) with EcoRV and XbaI to remove most of the IL4.Y124D/IgGl fusion molecule. The only part remaining is a~lJluAhlla~,'y 75bp at the 5' end of IL4, which is not present in the IL4.Y124D EcoRV/XhoI fragment produced by PCR Amplifi~-Atin;A. S Lg of pDB951 DNA was digested in a total volume of 30111 using react 2 buffer (GibcoBRL). The resulting 5.8Kb DNA fragment was purified using the Geneclean TM procedure~

Wo96/04388 21 9 62 00 r~ l 7~.. r The three fragrnents described (IL4.Y124D EcoRV/XhoI, hinge-CH2-CH3 of IgG4 XhoVXbaI and the 5.8Kb fragment resulting from EcoRV/XbaI
digestion of pDB951) were ligated together to form plasmid pDB952, which encodesthe IL4.Y124D/lgG4 fusion protein. The ligation was ca{ried out using a DNA
ligation kit from Amersham (product code RPN 1507), incubating the reactions at 16~
C overnight. The ligation reacion products were r ~ into Promega JM 109 competent cells (high efficiency) and plated onto Lulia Broth agar containing ..
ampicillin at 5011g/ml. T c~ were cultured in Luria Broth (containing ampicillin at 50~g/ml) and DNA prepared using Promega "Magic Minipreps".
Production of an IL4.Y124D/IgG4 l~ ' DNA was verified by resttiction digests, and the complete IL4.Y124D and hinge-CH2-CH3 IgG4 regions were verified by DNA s~qu~n. ing Table 6 desclibes the sequence of the coding region only of the IL4.Y124D/IgG4 fusion molecule, and Table 7 contains the arnino acidsequence of the fusion protein. The IL4.Y124D/IgG4 l~_ ' DNA was prepared and purif ed using caesium chloride gradients and the DNA used to transiently transfect HeLa cells.

2. F, . ofthe fusion protein HeLa cells were grown in MEMa medium (Gibco) with 10% foetal calf serum and 1 ~o glutamine. For the assay, 1 x 106 HeLa cells were seeded in l5mlsRPMI-1640 medium with 10% newbom calf serum, 19~o glutamine ("seeding medium"), in a 75cm2 flask, four days prior to ~ rr~ On the day prior to " A,.~rr~ ~;.... a further 12.5mls seeding medium was added to each flask. On the day of n....-rr~ l;."" the medium was changed to 15mls of "~ rc~,i medium" (MEM
25 medium with Earle's salts containing 10% newbom calf serum and 1% non essentdal amino acids), at time zero. At time +3 hours, 2511g of the ~y~lu~!flat~ DNA in 0.125M CaC12, lx HBS (HEPES buffered saline) was added to the cells. At time +7 hours, the cells were subjected to a glycerol shock (151Yov/v) and then left to incubate overnight in 12.5mls seeding medium containing SmM sodium butyrate. The next 30 day the cells were washed with PBS (Dulbecco's phosphate buffered saline) and125mls "harvest medium" (RPMI-1640 with 2% of a 7.5% stock sodium b;~AulJù~l~t~
solution) was added. After a further 24 hour incubaion, the ~u~.. were removed, c~n~ifi~ at 1000rpm for 5 minutes to remove cell debris and stored at either 4~C or -20~C.
~ ~ =
3. Biological Activity For assay Of ~ 'l" , ~A IA 1 1 for IL4 antagonist activity: using the method described in Spits et al., J. T" ,. " ,~ y 139, 1142 (1987), human peripheral blood Iyll~ o~ were incubated for three days with ~ ; ;., a T cell WO ~6/04388 2 1 9 6 2 ~ ~ T ~ ~ n~6 mitogen, to upregulate the L4 receptor. The re5ultant blast cells were thenstimulated for a further three days with IL4. Proliferation was measured by the hl~,ulyulaLiOll of 3H thymidine.
The IL4.Y124D/lgG4 chimera inhibited 3H thymidine hl~ul~ulaLioll by 5 human peripheral blood T Iyllll,Lu~. ~, il.b stimulated with 133pM IL4 in a dose dependent manner.

Example 3 IL4.Y124D/lgG4 PE fusion protein 1. C~ ~ of DNA coding for fusion protein PCR is performed to amplify the L4.Y124D coding region and introduce a silent nucleotide, l ,~l; n ~ ." at the 3' end which creates a Xhol site as described in Example 2.
A second PCR reaction is performed to amplify the hinge-CH2-CH3 fragment of the human IgG4 heavy chain PE variant. In IgG4 PE, residue 10 of thehinge (residue 241, Kabat ' 7) is altered from serine (S) in the wild type to proline (P) and residue 5 of CH2 (residue 248, Kabat m~rnh.o-ing) is altered from leucine (L) in the wild type to glutamate (E). Angal S., King D.J., Bodmer M.W.,Turner A., Lawson A.D.G., Roberts G., Pedley B. and Adair R., Molecular T ' ~y vol30pplO5- 108, 1993, describe an IgG4 molecule where residue 241 (Kabat ' g) is altered from serine to proline. This change increases the serum half-life of the IgG4 molecule.
The IgG4 PE variant was created using PCR ." ~ on the synthetic human IgG4 heavy chain cDNA described in Table 5, and was then ligated into the pCD expression vector. It was this plasmid which was used as the substrate for the PCR reaction amplifying the hinge-CH2-CH3 fragment of IgG4 PE. The sequence of the IgG4 PE variant is described in Table 8. The residues of the IgG4 nucleotidesequence which were altered to make the PE variant are as follows:
referring to Table 8:
residue 322 has been altered to "C" in the PE variant from "T" in the wild type;
residue 333 has been altered to "G" in the PE variant from "A" in the wild type; and residues 343-344 have been altered to "GA" in the PE variant from "CT"
in the wild type.
Oli,, .1~ ' primers are used fûr .,~ , of the IgG4 PE variant hinge-CH2-CH3 region as described for the derivation of pDB952.

.

wo 96/04388 2 l q 6 2 0 0 r~ 6 PCR products of a~ uAhlld~ly 700bp (hinge-CH2-CH3 of IgG4 PE
mutant) and 400bp (IL4.Yi24D) are obtained and purified using the Promega "MagicPCR cleanup" kit. The purified PCR reactions are then digested with the following enzymes to create "sticky ends": Xhol and XbaI for IgG4 PE and EcoRV and Xhol for IL4 Y124D. The digests are incubated at 37~C for 3 hours and then ethanol ylc , ' The resulting DNAs are of sizes of ~ 690bp (hinge-CH2-CH3 of IgG4 PE) and 370bp (IL4.Y124D).
To obtain larger amounts of the IgG4 PE variant hinge-CH2-CH3 fragmcnt and the IL4.Y124D fragment, the purified and digested PCR products are ligated into Bluescript KS+TM which is prepared by digestion with either Xhol and Xbal for the hinge-CH2-CH3 of IgG4 PE fragment or EcoRV and Xhol for the IL4.Y124D fragment, followed by GenecleanTM. A Bluescript KS+/hinge-CH2-CH3 of IgG4 PE ~c~..,.,l,;, - l and a Bluescript KS+/IL4.Y124D .c~ .,..l.;., --.l are thus generated. Large amounts of these DNAs are produced using the Promega "Magic 15 Maxiprep" mcthod. The IgG4 PE hinge-CH2-CH3 fragment is excised from the Bluescript . c~ ~ ....l ... - - - ~ using Xhol and Xbal. The resulting fragment of a~ 690bp is purified by GenecleanTM to generate large amounts of the IgG4 PE hinge-CH2-CH3 XhoVXbal fragment. The IL4.Y124D fragment is excised from the Bluescript . ' ~ using EcoRV and Xhol and the resulting fragment of 20 a~ ' ly 370bp is purified by GenecleanTM.
A vector is prepared into which to ligate the hinge-CH2-CH3 of IgG4 PE
and IL4.Y124D fragments by digesting pDB951 with EcoRV and Xbal as desctibed for the derivation of pDB952.
The three fragments described (IL4.Y124D EcoRV/Xhol, hinge-CH2-25 CII3 of IgG4 PE variant XhoVXbal and the 5.8Kb fragment resulting fromEcoRV/Xbal digesion of pDB951) are ligated together to form plasmid pDB953 using a DNA ligation kit from Amersham (product code RPN 1507), incubatmg the reactions at 16~C overnight. The ligation reaction products are n ",l~r..~ into Promega JM109 competent cells (high efficiency) and plated onto Luria Broth agar30 containing ampicillin at 5011g/ml. Tla~ rullll~ are cultured in Luria Broth (containing ampicillin at 50~1g/ml) and DNA prepared using Promega "Magic Minipreps". Production of an IL4.Y124D/lgG4 PE variant ,c~ .., ..1.; ..- ..l DNA is verified by restriction digests, and the complete IL4.Y124D and hinge-CH2-CH3 IgG4 PE variant regions are verified by DNA seq~ n~ ing Table 9 describes the sequence of the coding region only of the IL4.Y124D/lgG4 PE fusion molecule, andTable 10 contains the amino acid sequence of the fusion protein. The IL4.Y124D/IgG4 PE ,,, ...,.l.;,.~. l DNA is prepared and purified using caesium chloride gradients and the DNA used to transiently transfect HeLa cells.

wo 76/04388 2 1 9 ~ 2 1~ 0 r ~ ~ . 0~6 2. F . . of the fusion protein HeLa cells were grown in MEMc~ medium (Gibco) with 10% foetal calf serum and 1% glutamine. For the assay, I x 106 HeLa cells were seeded in l5mls RPMI-1640 medium with 10% newbom calf serum, 1% glutamine ("seeding medium"),ina75cm2flask,fourdayspriortonA~r~liv~ Onthedaypriorto nA~r~ , a further 12.5mls seeding medium was added to each flask. On the day of l " r_~ n . ,. . the medium was changed to 15mls of j A medium" (MEM
medium with Earle's salts containing 10% newbom calf serum and 1% non essential amino acids), at time zero. At ime +3 hours, 25~1g of the ~ v~lflaa, DNA in 0.125M CaC12, lx HBS (HEPES buffered saline) was added to the cells. At time +7 hours, the cells were subjected to a glycerol shock (15%v/v) and then left to incubate overnight in 12.5mls seeding medium containing SmM sodium butyrate. The next day the cells were washed with PBS (Dulbecco's phosphate buffered saline) and 12.5mls "harvest medium" (RPMI-1640 with 2~o of a 7.5% stock sodium bi.,_L
solution) was added. After a further 24 hour incubation, the ~ were removed, ~A~n~rlfilgetl at 1000rpm for 5 minutes to remove cell debris and stored at either 4~C or -20~C

3. Biological Activity For assay of su~,. for IL4 antagonist activity: using the method described in Spits et al., J. Imm~ gy 1~, 1142 (1987), human peripheral blood 25 ly . ' y;~,S were incubated for three days with ~I,y~ . Arl ,n; ;,a T cell mitogen, to upregulate the L4 receptor. The resultant blast cells were then stimulated for a further three days with IL4. F~vl;rclaliull was measured by theill~,Vl~lVl~L~iVII of 3H thymidine.
The L4.Y124D/lgG4 PE chimera inhibited 3H thymidine il~uvllJvl~Lion by human peripheral blood T lylll~Lvuyt~,s slimulated with 133pM IL4 in a dose dependent manner.

Example 4. ~ ' Expression vector containing DNA coding for IL4.Yl24D/lgG4 PE.
~ =
of DNA
The pCDN vector (Aiyar, N., Baker, E., Wu, H-L., Nambi, P., Edwards, R.M., Trill, J.J., Ellis, C., Bergsma, D. Molecular and Cellular Bio.,L,...i~L y 131:75-86, 1994) contains the CMV promoter, a polylinker cloning region, and the BGH polyadu,lylaLi wo 96104388 2 1 9 6 2 0 0 1 11~1 1A-t,A~A~6 region. This vector also contains a bacterial neomycin ~ , ," r~ gene (NEO)insened between the ~-globin promoter and SV40 polyadenylation region for GeneticinTM
selection, the DHFR selec~ion cassette inserted between the ~-globin promoter and BGH
l,olyd.,.ly._L.u,. region for Ill~,JlU~ ;Ad~C (MTX) A ~ i; r; ~ 1 C an ampicillin resistance gene 5 for growth in bacteria, and a SV40 origin of replication.
To insert the IL4.Y124D/IgG4 PE cDNA, the pCDN vector was prepared by digesting with Ndel and BstXI as follows: 1511g of DNA was incubated with 30 units of BstX1 in react 2 (Gibco-BRL) at 55~C for 1 hour, and ethanol ~ , ' The resultingDNA was digested with Ndel in react 2 at 37~C for 1 hour, and ethanol ~ . ' The IL4.Y124D/lgG4 PE fragment was prepared from pDB953 (Example 3.1) by digesting with BstX1 and Ndel as follows: 15,ug of DNA was incubated with 30 units of BstX1 in react 2 at 55~C for 1 hour, and ethanol ~.c , ' The resulting DNA was digested with Ndel inreact 2 at 37~C for 1 hour, and ethanol ~
The IL4.Y124D/IgG4 PE Ndel/BstXI and pCDN Ndel/BstXI fragments were ligated together to form the plasmid pCDN-lL4.Y124D/lgG4 PE. The ligation was achieved using 2 units of T4 DNA Ligase (Gibco BRL) with T4 DNA Ligase buffer. The reacrions were incubated at 16~C overnight. The ligation reaction products were j r ' intoGibco-BRL DHSa competent cells (! ' ' _ efficiency) and plated onto Ltuia Broth agar containing 75 ug/ml ampicillin. T ' were cultured in Luria Broth (containing ampicillin at 50 ug/ml) and DNA prepared by alkaline Iysis. Production of a pCDN-IL4.Y124D/lgG4 PE DNA was confrmed by restiiction digests. The complete seciuence of dhe IC~ l' a IL4.Y124D/lgG4 PE DNA was confirmed by s ~ ~r - g The pCDN-lL4.Y124D/lgG4 PE -c~ / DNA was prepared and purified using Qiagen columns and dhe DNA was used to rransiendy infect COS cells and elc.,uu~u.~ into CHO cells to create stable clones.
2. Expression of the Fusion Protein a) Transient Expression in COS
COS-I cells were grown in DMEM medium with 10% fetal bovine serum. For the l ". . . ~rr~ l ;. .", cells were seeded at 2 X 105 cells into a 35mm tissue culture dish 24 hours prior. A solution containing l~lg of DNA inlOOul of DMEM widhout serum is added to a solution containing 61al of LlPOFECTAMlNE Reagent (Gibco-BRL) in lOO,tLI of DMEMwidhout serum, gently swirled and incubated at room t~ ,ldlUlc for 45 minutes. The cells are washed once widh serum free DMEM. 0.8ml of serum free DMEM is added to the DNA-LIPOFECTAMlNE SOLUTION, mixed gently and the diluted solution is overlayed on dhe cells. The cells are incubated at 31~C for S hours. then Iml of DMEM containing 20% fetal bovine serum is added. The cells are assayed 48-72 hours later to determine expression levels.

wo 96/0438s ~l9~200 b) Ele~lrl . I into CHO cells CHO cells, ACC-098 ~a suspension cell line derived from CHO DG-44, Urlaub, G., Kas, E., Carothers, A.M. and Chasin, L.A. Cell, 33. 405-412, 1983) were grown inserum free growth medium WO g2/05246. l5~1g of the pCDN-lL4.Y124D/lgG4 PE
plasmid was digested using 30 units of Notl at 37~C for 3 hours to linearize theplasmid, and IJI~ . ' with ethanol. The resulting DNA was ~, .1.. 1. ~I in 50ul of I X TE (lOmM Tris, pH 8.0, I mM EDTA). The DNA was cl~.~,hu~Julat~l into I X
107 ACC-098 cells, using a Bio Rad Gene Pulser set at 380V and 2511Fd. The cellswere ~ u~ J~,J into growth medium at 2.5 X 104 cells/ml, and 200111 of the cell suspension was plated into each well of a 96 well plate. 48 hours later the medium was switched to growth medium containing 40ûlagiml G418 (Geneticin). Twenty one days post selection, c ( . ~ I medium from the colonies which arose were screened by Elisa assay. The highest expressing colonies were transferred to 24 well plates in order to be scaled up.

W096104388 21 9 62 0~ n~6 .

Table 1. DNA sequence of COSFcLink vector, 6367bp SEQ ID No:1 r.ArrTcrArrrATrrr.rArATrrrrr.ATrrATccETrrArrTArrArTAGTTATTAATAG 60 S TAATcAATTAcGGGGTcATTAGTTrATAr~rrrATATATGGA~ ArATAArTT 120 AcGGTAAA~ blll~ArrrrrrAArrA~ ATTrArrTrAATAATG 180 AcGTATGTTcrrATArTAArr~rrAATArrr~ArTTTrrLTTrArrTrAATGr~rTr~r~ArTAT 240 TTArrrTAAArTGcccAcTTr~rrAr~TArATcAAGTrTATrATATGrrAAr~TArr~rrrcrT 300 ATTEAcGTcAATr~Arr~rTAAAT~LL~LLl~TTATrrrrAr~TArATrArrTTATGG 360 0 EACTTT ~TAcTTrrrAr.TArATrTArr.TATTAr.TcATcGcTATTAccATr.rTrATr,rrr. 420 TTTTr~GrAr~TArATrAAl~ TArrçrTTTGAcTcAcGGGGATTTccAAGTcTc 480 rArrrrATTrArrTcAATrrrA~ lArrAAAATrAArrr~r~ArTTTccA-AAA- 540 TrTCrTAArAA~ ATTrArrrAAATçr.rrrrTArrrrTr.TArrr.Tr.r.rArr,Tc 600 TATATAAr~rArArrTrr~rTArr~Tr~AArrrTrArATcr~rrTrrArArGrrATrr~AATTcGG 660 lS TTAccTr~rAr~ATATrAArrTAATTrr~r~TArrr~ArrrrAAATrr~rrrrArAAAArTcAcAc 720 ATrrcrArrrTrrcrAGrArrTrAAll~L~ ArrrTrA~ LLl~llLLLLLL 780 AAAArrrAAr~GAcAcccTcATGATcTrrrrrArrrrTr~Ar~çTrArAll~ .l.A 840 CGTr.ArrrArr.AArArrrTrArrTrAArTTCAACTr.rTArrTrr.Arr,frr.TGGAGGTGCA 900 TAATrrrAAr~ArAAArrrrrr~rrAr~rAr~rArTArAArAr~rArr~TA~ l~AGcGT 960 20 rrTrA~ ArrArr~ArTrrrTr~AATrrrAAr~rArTArAArTGrAArr~TrTccAA 1020 rAAArrrrTrrrArrcrrrATrrArAAAArrATcTrrAAAr~rrAAArrGrArrrrrr~ArA 1080 AccAcAGGTGTAcALLLl~ ATcrrrr~rATrArrTrArrAArAArrArrTcAGccT 1140 r~A~ ~AAGGcTTrTATrrrArrrArAll~ ArTrrr~ArArrAATGG 1200 rrArrrrrArAArAArTArAArArrA~ ArTccGAL~Ll~L~ l 1260 25 rrTrTArAr.rAAr.rTCACCGTrrArAAr.ArrArrTrrrArrArrriAAl~ ATG 1320 cTccGTGATGrATrAr~firTrTr~rArAArrlrTArArr~r~r~ D~ LLll~ ,L 1380 GGGTAAATGAGTGTAGTcTAGAGcTcGcTGATcAGccTcGALl~l~LLllLlAGTTGccA 1440 GCCA'l~ L~ LLLLll~ .ArrrTrr.AArrTrrrArTrrrAr 1500 l~l~L~ lAATDAAATrArr~AAATTr~rATcGcATTGTcTrAr~TAr~iTGTrATTcTAT 1560 30 L~ ArrArArrAArrrrr~rr.~TTçGrAArArAATArrArrrA 1620 TGrTr~rGrAl~ l~lATr~rAArrA~ .ArGrGr,r~ATCTCCCGATC 1680 CccA~Llll~LLl~l~ATTTcTTATTTGcATAATrAr~AAAAAAAr~iAAAATTAATTTTA 1740 AcAccAATTrAr~TAr~TTrATTGAGcAAAl~L~ll~llAAAAArrATGrTTTArArArAr~T 1800 ~ll~llll~lArArAT-AArr~ArAAArATTATTrArAr~Gr~ArTArrrArArrTrAr~ArTccT 1860 35 AArrrArTr.ArTrÇrArArrATTCTArrrArAAATAl~lllll~A'll Arrr.AArCcTGAT 1920 TrrGTArArrrArArrTTrrTAArrrrrAATcTGcTrArArArrATArArArrrrArrAr 1980 rrArr~firArAr~rATATAArr~TrAr~rTArr~ATcA~l~LlLLl~AcAlll~Lll~l~AcAT 2040 A~ L-L-AECTTGEATAGCTTGGACAGCTrArGGrTGrrA~ AAArTT 2100 GACGGCAATCCTAGCGTGAAGGCTGGTAGGATTTTAl~ ATrATGGTTCGAC 2160 cATTGAAcTr~rAll~ AAAATATGGGGATTr~GrAAr~AArrr~Ar~irrTAr 2220 ~ llArr~AArrArTTcAAGTAcTTccAAAEAATr~ArrArAArrTcTTcAG 2280 Trr~AArr~TAAArArAlTcTGGTGATTATGGrTArrALAA~ Lll~l~LATTccTGAGA 2340 AGAATcGAccTTTAAArr~ArArAATTAATATArTTcTrAr~TAr~ArAArTrAAArAArrAr 2400 rArrArrAfirTcAL~ AAAArTTTGEATGATGccTTAAGAcTTATTGAAcAAc 2460 CGEAATTrGrAArTAAAr~TAGAcATGGTTTGEATAGTrrr~ArrrAl~ l-lllACCAGG 2520 AArrrATr~AATrAArrArGrrArrTTAGALl~lll~l~AcAAGGATcATGcAGGAATTTG 2580 AAArTr~ArA~ l~LLAGAAATTGATTTGGrrAAATATAAArTTcTcrrAr~AATArc 2640 cA~L~l~l~l~ll~Ar~r~Trrlrr~ArrAAAAArrrATrAArTATAArTTTGAAGTcTAcG 2700 ArAArAAArArTAArArr~AAr~ATGcTTTcAA~ AAArrTATGcA 2760 TTTTTATAArArrATrrTArrTTGAA5 TTGTTTATTGcAGcTTATAATGGTTAcAAATAA 2820 Ar~rAATAr~rATrArAAATTTrArAAATAAArrATTTTTTTcAcTGcATTcTAGTTGTGGT 2880 TTGTCCAAACTCATCAATGTATCTTATCA~ AArrATAr~rTTATCTGTGGGC 2940 GATrrrAArrArrTGGAl~ lArTEATTTAr~AArrrATTTGccccc 3000 W 096/04388 2 l 9 6 2 0 0 r~ 1/~l . m~A~G

TGAblvbbbblll~bl~ArrArTAA~ lb~ AAArr~Ar~rAATrrAr~AAAr~AAAArr 3060 ATArD~Ar.TATAAr.rTGCCATGTAATAATrr.AAr.AArATAArr.TTGTATGAATTAGATTT 3120 AcATAcTTrTr~AATTr~AAArTAAArArrTTTAAATTrTTAAATATATAArArATTTcATA 3180 TGAAAGTATTTTArATAArTAArTrAr~ATArATAr~AAAArAAbr~rTAATGATAGGTGTcc 3240 cTAAAAGTTcATTTATTAATTcTAcAAATGATr~Ar~rTr~GrrATcA-AAATTccAGcTcAAT 3300 TcTTCAAcGAATTAr.AAArAr.rAATrTrrAAArTrlTrTrr.AATAArAAAAAArrTAr~:A 3360 TAr~rA~AAArTrTTrTrAArr~ATAAAAr~AA~ bb-l~bAATcAccATGccTGAccTAA 3420 AGcTrTArTArArArrAATTr~TrATAAAAlrTGrATGGTAcTr~ATATAr~AAArrr~ArAAr~ 3480 TAGAccAATr~r.AATArAArcrArArArrTATG~TcAcTTGATcTTrAArAArAr~ArcTAA 3540 0 AArrATcrArTr~rAA~ r~ArArrATTTTcAA~AAA~l~r~l~ b~ArAArTr~r~TGGTT 3600 ATrATrr~Ar~AAr~AATGTGAATTGATrrATTrrAAlbl~blll~lArTAAr~r~TrAAATrTAA 3660 GTGGATrAAr~AArTrrArATAAAArrAr-Ar~ArArTr~AAArTTATArArrArAA~rTr~r~r~ 3720 GA-A~AAGccTrr~AAr~ATATr~r~rArAr~rr~AAAAATTrrTr~AATAr~AArAr~rAATGGcTTG 3780 TGcTr~T~ Tr~r~Ar~AATTr~ArAAATr~r~r~ArrTrATGAA-AcTrrAAArrTATcGGATc-A 3840 TTrrTcrAAAAlArrrTrrTrArTArTTrTrr~AATArrTrAr~Ar~Gcrr~Al~ 3900 ccTrTGrATAAATAAA~AAA~TTAr~TrAr~rrArrrATr~r~rr~rr~r~Ar~AATr~r-G-rr~r~AArTr7 3960 rr~rr~r~Ar~TTAr~r~GGrGrr~ATGGGcGGAGTTAr~r~rr~rr~r~r~ArTAll~ ArTAATTG 4020 AGATGCATGCTTTGCATA~ bl~_lb-bbbAGCCTGGGGACTTTCCACACCTGGTT 4080 r~rTr~ArTAATTr~Ar~ATGrATr~rTTTGrATA~ Ar~crTrr~r~r~ArTTT 4140 20 rrArArrrTAArTGAcAcAcATTccAcAGAATTAATTcccGATcccGTrr~ArrTcr~Ar~Ar~ 4200 CTTrr7rr~TAATrLTr~r~TrATAl~' 11.1 I L~ . l l.Ab ATTr.TTATrrGrTrArADTTrr 4260 ArArAArATArr.ArrrGrAArrATAAArTrTAAAi.l I I ,,r,l.l. 1 1.1 1 1 AATrArTrAr.rTA 4320 ACTCACATTAAll~b~ Al 1~.~ 1 r (.l ~ I 1' ( r~r.Trrr.rAAA~ ~ l~l~blb-bl_A _ 4380 r~rTGrATTAATrAATrrr~rrAA~ Ar~A~ l~blAll~bb~bLlbll~ 4440 ~ (,~ ,. .,. I~ACTGAr~ .r711'r.1 ~ r ~ Ar~rGrTATcAGc 4500 TrArTr~ADr~r~rr~r~TAATArr~rTTaTrrArAr~lATrAr~rr~r~ATA~rr~rAr~r~AAAr~AArAT 4560 GTr~Ar~rAAAAr~r~rrArrAAAAr~GrrArrAArcrTAAAAAr~ l~l~b~blllll 4620 ccATAbbbl~b~ b-AcGAGcATc~ AATcGAcGcTcAAGTrArArr~Trrçrr 4680 AAArrrrArAr.rArTATAAArATArrA~.(.( 'r.,,, ~ I r I r I (,r.AAI.~ 1 1 r I ~ r~ i b 4740 30 lr-~lb~ .A~ r.r I I Arrr~ATA~ AAr~rrT 4800 ~bblll~ATGcTrArGrTrTArrTATrTrA~ Ar~ ll~bblbr-~A 4860 ~ (ArrAA(((~ *rrrrr~A~ llATrrr~rTAArTA 4920 TcGTcTTrAr~TrrAArrrr~r~TAArArArr~ArTTATrGrrArTrr~rAr~rAr~rrArTGr~TD~ 4980 c~GGATTAr~rArAr~rrAr~r~TATr~TA~ ((ArAr~Ar~TTrTTrAAr~ l~b~blAA 5040 cTArGGrTArArTAr.AArr.ArAr.TATTTGGTAlblb~ b~l~ ".( ,,.AArrrArTTArcTT . 5loo rr.r.AAAAAr.ArTTGGTAGCTCTTGATrrr.rrAAArAAArrArCGrTr~GTA~ lL 5160 llll~llll~rAAr~rArrArATTArrrrrArAAAAAAArr~ATrTrAArAAr~ATccTTTGAT 5220 cTTTTcTA~bbbb~ Arr-rTrAr~Trr~AArrAAAArTcAcGTTAAGGGATTTTGGTcAT 5280 GAGATTATrAAAAAr~r~ATcTTcAccTAGATccTTTTAA~ATTAA~AATGAAGTTTTAAATc 5340 AATrTAAAr~TATATATGAGTAAA~ll~bl~l~AcAGTTAcc-AATGcTTAATrAr~Tr~Ar7r~r 5400 AccTATcTcAGcGATcTGTcTATTTcGTTrATrrATArTTrrrTr~A~ ~bl~l~lA 5460 r~ATAArTArr~ATArr~r~r~Ar~r~GrTTAccAl~ll~l~rrrrrAr~TrrTrrAATrATArrGrr~Ar~A 5520 ccrArrrTrArrGrrTccAGATTTATrArrAATAAArrArrrAr~rrrr~AArr~rrrr~ArrG 5580 cAGAAbl~bl~r~ AAcTTTAl~br-~l~TccAGTcTATTA-A~l~lll~ AArr 5640 TAr~Ar~TAArTAr~TTcGccAGTTAATAGTTTGcGcAAr-~L~ ATTr~rTArArr~rAT 5700 bbl4blblL~bbl4bl~blll~4LATGGcTTcATTrA~ AACGATCAAG 5760 GcGAGTTAcATGATrrrrrATrTTGTr~rAAAAAArrr~rTTA4((~ AT 5820 cGTTr~TrAr~AArTAA(~ll~bb-b~AGTGTTATcAcTcATGGTTATr~r~rAr~rArTGrATAA 5880 TTcTcTTAcTGTcATGccATccGTAAGA~4~~ 4AcTrr~Tr~Ar~TArTcAAccAA 5940 GTcATTcTrAr~AATAr~Tr~TATçrGçrr~ArrrA(~ (4ll4b~r-bb~bl(AATArrr~r~A 6000 TAATArr~ r(A(ATArrAr~AArTTTAAAAr~TrrTrATrATTrrAAAA~ l~bbb 6060 GcGAAAAcTcTcAAGGATcTTA~r-b~l4ll4AGATccAGTTcGATrTAArcrArTcGTGc 6120 ArrrAArTr~ATcTTrArrATrTTTT~rTTTcA~b~blll~l4r~4l(~ArrAAAAArAr~r 6180 AAGGcAl~AATrrrçrAAAAAArrrAATAAr~rrrr~ArArr~rAAATr~TTrAATArTcATArT ~ 6240 WO 96/04388 21 9 6200 r~ J ~036 .

~ llL,l AATATTATTGAAGCATTTATcAGGGTTATTGTCTrATr.ArrrrATArAr 6300 ATTTGAATGTATTTAr~AAAAATAAArAAATA~ [ArATTTr-rrrrAAAAr~T 6360 Table 2. DNA sequence of encoded Y124D-lgGI fusion molecule in COSFcLink vector, 6926bp SEQ ID No:2 ..
0 GAcGTcGAcGGATcGGGAGATcGGGGATcGATrrr~Trr~Arr~TArr~ArTAr~TTATT M TAG 60 TAATC M TTArr-r~GTrATTAGTTrATAr~rrrATATATGGA~L~ llAcATAAcTT 120 ACGGTAAA~ lG~ ArrrCrrAArrA((~ ATTGACGTC M TAATG 180 AcGTATr~TTcrrATAr~TAArrrrAATAr~r~r~ArTTTccATTGAcGTcAATGGGTGGAcTAT 240 TTArrr~TAAArTr~rrrArTTr~r~rAr~TArATcM GTGTATcATATr~rrAArTArr~rrrrrT 300 15 ATTGACGTCAATr~ArrrTAAA~ TTATrrrrArTArATGACCTTATGG 360 GAcTTTccTAcTTGGrAr-TArATcTAcGTATTAGTcATcGcTATTAccATGGTGATGcGG 420 TTTTr~rAr~TArATraAlv(~ -ATAr~rr~r~TTTrArTrArr~r~r~r~ATTTccAAGTcTc 480 CAccccATTGAcGTcAATGGGA~ (ArrAAAATrAArr~r~ArTTTccAAAA 540 T5TrrTAArAA(~L~ll~AcGcA M Trr-r~rGr~TArrrrTGTAcGGTGGGAGGTc 600 20 TATATAArrAr~Ar~rTr~r~r~TArr~TGAAccGTcAGATcGccTr~r~Ar~Arr~rrATcGAATTcGG 660TTArrTGrAr~ATr~r~r~rTGcAGGAATTccGcATTrrAr~Ar~ATAATTGTATTTAAr~TGccTA 720 GcTrr~ATArAATAAArr~rrATTTGAccATTcAccAcA~ (ArrTrrAArrTTAc 780 CTGCCATGGGTCTCACCTCCCAA~l~ l~lAGCATGTGCCG 840 GcAAcTTTGTrrArrr~ArArAAr~TGcGATATcAccTTArAr~Ar~ATrATcAA M cTTTGA 900 25 AcAGccTrArAr~Ar~rAr~AArArTrTGTGcAccGAGTTr~ArrrTAArAr~ArATcTTTGcTG 960 ccTrrAAr~AArArAArTrArAArrAAArrTTcTGcAGGGcTrrr~A(ll~ GT 1020 TrTArArrrArrATr~Ar~AAr~ArA(l~l~l~bl~AcTrrArArrAr~TTccAcA 1080 rrrArAArrArrTGATccGATTccTGAAAcGGcTcrArArraar~ 1140 GcTTGAAll~ AArr~AArrrAArrAr~Ar~TArrTTGGAAAAcTTcTTGGAAA 1200 30 rrrTAAArArrjATrATr.Ar.ArArlAArArTCi~AAGTGTTrrArrrrTArCr.Arrrr~aT 1260 rr~rrrrArAAAArTrArArATrrrrArrrTrrrrArrArrTr~AA(l~ b(~ Arrr~T 1320 cA~ AAAArrrAAr~ArArrrTrATGATcTrrcrr~ArrrrTGAGG 1380 TcAcAI~l~l~l~AcGTrArrrArr~AAr~ArrrTrArrTrAAr~TTrAArTr~TArr~ 1440 TGGACGGCGTGGAGGTGCATAATr.rrAArArAAArrrrrr,rrAr.r.ArrAr.TArAArAr.rA 150035 rr.TA~ ~GcGTccTcA~ (ArrAr~rArTGGcTGAATr~rAAr~ArT 1560 AcAAGTGcAAGGTcTrrAArAAAr~rrrTcrrAr~rcrrrATrr~ArAAAArrATcTccAAAG 1620 rrAAArrrrArrrrrrArAArrArArrjTr~TArA(~ Trrrrr~r~ATrArcTGA 1680 rrAAr~AArrAr~rTrAr~rcTGA~l~l~l~AAar-r~rTTrTATrrrAr~r-r~ArATcGccG 1740 TGGAGTrr.rAr.ArrAATr7-rrArrrrrAr.AArAArTArAAr.ArrA((,1~.~b~ 1800 AcTrrrAl ~ ArDr~rAArrTrArrrTrr~Ar~r~rArrTGGcAGc 1860 Ar~rrAA(~ Al~L~l~TGcATGAGGcTcTrrArAArrArTArArr~rArA 1920 AGA~ AAATGAGTGTAGTrTAr~ArrTrr~rTGATcAGccTcGA 1980 ~ ll~lAGTTGCCAGCCAl~ ACCC 2040 TGGAAGGTrrrarTrrrA~ AATAAAATGAGGAAATTGcATcGcATTGTc 2100 45 TGAGTAGGTGTcATTcTAll~ll~bb~ Ar~rArArrAAr~rr~r~Ar-r~ATT 2160 rrr~AArArAATArrArrrATrrTrrrr-Al~ llATrr~AArrA~ 2220 rArrrrrrATcTrrrrATcrrrAl~c~ ATTTcTTATTTGcATAATGAGAAA 2280 AAAArrAAAATTAATTTTAArArrAATTcAGTAGTTGATTGAGcAAAI~ll~AAAA 2340 AGGATGcTTTAr~ArArA~l~ll~l~l~ArArATAArr~ArAAArATTATTcAGAGGGAGT 2400 50 ArcrAr~ArrTr~Ar~ArTrrTAArrrArTGAGTr~r-rArArrATTcTAr-rr~Ar~AAATATGcTT 2460 GTrATrArrr~AAr-crTrATTccGTAGAGccAcAccTTrrTAAr~rrrrA~TcTGcTcAcAc 2520 W 096l04388 2 l 9 6200 .~ 6 Arr-ATAr~Ar~ArrrrArr.ArrrAr~rr~rArAGrATATAAr~r~TrArrTArr~ATcAGTTGcTcc 2580 TCACAlL~ ~CATAbll~ll~bbAGCTTGGATAGCTTGGACAGCTCAGGGCT 2640 GcGA~ AAArTTrArr7rrAATrrTAr~rrTr.AAr.GrTGGTAGGATTTTATcccc 2700 GcTGccATcATGGTTcGAccATTGAAcTGcAL~bl~bbcbl~ 'AAAATATGGGGATT 2760 S r.GrAAr~AArrr~Ar.ArrTA~bL~b~bl~ Arr~AArrAr.TTcAAGTAcTTccA~AGA 2820 ATr.ArrArAArrTrTTrAr.Trr.AArr.TAAArAr~AATcTGGTGATTATrr.rTAr~r.iAAArr ~2880 l~bll~L~ATTrrTrArAArAATcGAccTTTiAAr7r.ArAr~AATTAATATAGTTcTcAGT 2940 AGAGAAcTrAAAr~AArrArrArrArrAr~rTcAllll~ll~ AAAArTTTGGATGATGcc 3000 TTAAGAcTTATTr~AArAArcGrAATTr.GrAArTAAAr.TAr~ArATGGTTTGGATAGTcGGA 3060 0 GGcAbl~ ArrAr~AAr~r-rATGAATrAArrArGrrArrTTAGAbl~lll~l~cA 3120 AGGATcATGcAGGAaTTTr.AAAGTrArA~ Ll~AGAAATTGATTTr~rr.AAATAT 3180 AaAcTTcTrcrAr~AATArcrAl~.(b~ llll.Ar~rTrrAr~r~Ar~r~AAAAAr~r7rATcAAG 3240 TATAAGTTTGAAGTrTArr~Ar~AAr~AAAr~ArTAArAr7r~AAr~ATr7rTTTcAAbil~l~L~l 3300 ccccTrrTAAAr~rTATGrATTTTTATAAr~ArrATGcTAGcTTGAAcTTGTTTATTGcAGc 3360 lS TTATAATr~r~TTArAAATAAAr~rAATAr~rATcAcAAATTTrArAAATAAAr7rATTTTTTTc 3420 ACTGCATTCTAbll~lb~ AAACTCATCAATGTATCTTATrATr~TCTGGATCAA 3480 cGATAGcTTAl~~ bb~bATGrrAArrArrTGGAl~l~ll~bl~ (lArTr~AT 3540 TTLr~AAr~rrAll~ A(~ I (.(71.1~ ArrArTAA(~ AAArr~A 3600 GcA-A-TrrAr~AAArAAAArrATArAAAr~TATAAr~rTr~rrATGTAATAATr~r~AAr~AAr~ATAA 3660 20 GGTTGTATGAATTAGATTTAcATAcTTcTGAATTr~AAArTAAArArrTTTAAATTcTTAA 3720 ATATATAArArATTTcATATGAAAGTATTTTArATAAr~TAArTrArATArATAr~AAAArA 3780 AAGCTAATGATAbbl~ lAAAAr-TTCATTTATTAATTCTACAAATGATGAGCTGGCC 3840 ATCA~A~ATTCCAGCTCAATTCTTCAACGAATTArAAAr~ArrAATCTGCAAACTCATCTGG 3900 AATAArAAAAAArrTAr~r~ATLrrAAAAArTcTTcTrAAr-r~ATAAAAr~AA((~ ~bA 3960 ATcAccATrrrTr~ArrTAAArrTrTArTArAr~Ar~rAATTGTrATAD~ArTr7rATGGTAc 4020 Tr~ATATAr~AAArrr~ArAAr~TAr~ArrAATr7r~AATArAArcrArArArcTATGGTcAcTTGA 4080 TcTTrAArAAr~Ar~Ar~cTAAAArrATccAcTrr~AAAAAAr~ArAr~rATTTTcAAcAAATGGT 4140 r~rTr~r~rArAAll~bl~b~TcATrc~r~r~AATrTGAATTGATccATTcc-AATcTccTT 4200 rTArTAAr~TcAAATcTAAGTGGATcAAGGAAcTccArATAAAArrAr~ArArArTGAA-Ac 4260 TTATAr~Ar~r~Ar~AAAr~Tçr~r~:AAAAr~rrTrrAAr~ATATr~rr-rArArr~r~r~AAAAATTccTGA 4320 ATAr~AArArrAA~lbb~L~l~l~l~AGATcGAGAATTGAc-A~AATGGGAccTcATGAAAc 4380 Trr~AAr.rTATcGçATcAATTccTrrAAAAAAr.rrTcrTrArTArTTrTGrAATAr.rTrA 4440 r.Ar~r.rCrA~.I.~ (.(.( ( '1( i~(7~( l~ 1l~( ATAAATAAAAAAAATTAr~TrAr.crATGcATGGGG 4sO0 cGGAçAATr-GrrrrAArTr~rrrrAr7TTAr.r.rrrrr~r.ATçrr7rrrArTTAr.c.r~r.rrrr.Ar 4560 35 TAl~bll~(ll.~rTAATTGAGATGcATGcTTTGcATA~ .Ar-rrTrr. 4620 GGACTTTCCACAb~l~bll~l~CTAATTGAGATGCATGCTTTGCATAb~ 4680 TGGGGAGccTGGGGAcTTTcrArArrrTAArTr.ArArArATTccAcAGAATTAATTcccG 4740 ATCCCGTCGACCTCGAGAb~ b~bl~ATCATGGTCATAb~ ~AATT 4800 r.TTATcrGrTcAcAATTrrArArAArATArrAr.rrrr.AAr.rATAAAr.Tr.TAAAr~rrTGGG 4860 GTGrrTAATr.ArTGAGcTAAcTcAcATTAAll~cbJl~b~l~l~bb~l~l~GT 4920 rrr7~AAAr(~ l;((Ar~rTçrATTAATr.AATrrr~rrAA(~ .ArAr.r7rrr~TT 4980 TGCGTAll~bb~bbl~l~b~ll~bl~bbl~ACTGAbl~bbl~bb~l~bbl~bl~bb~ 5040 Tr.rr,l:rr.Ar.rr.rTATCAGCTCACTrAAArr.rrr.TAATArrrTTATrrArAr.AATrAr.rr.r ' 5100 ATAArr~rArrAAAr.AArATr.TrArrAAAAr~rcrAr.rAAAAr.rrrAr~r.AArrrTAAAAAr~ 5160 ~b~bll~bl~b~blllll~bATAGbbl~ll-ll(ll(ll-ArrArrATcAcAAAAATcGAc 5220 GcTcAAGTcAGAGGTr~rr~AAArcrrArArr~ArTATAAArATArrA~ lb 5280 GAAbbl ~.CLl~,bl(.7bb~ .1cb l~ A( ( ( 117( I (.( ' ~ Arrr.r~ATA( ( ~ b~ 53 40 (-/\A(~ b~.:b~,lll~,l~AATGCTrArGrTrTArrTATCTCAGTTCGG ~ 5~00 TGTAGbl~:bll~(,( 11 ( /~A(.( I(~bb(:L~ l Arr.AAI ( I ~ Ar.CCrrArrGrT 5460 S0 GcGccTTATcrrrTAArTATcGTcTTGAGTcrAArcrrr~TAAr~ArArr~ArTTATcGccAc 5520 Tr.r.rAr,rAr.rrArTrGTAArArr.ATTAr.rArArrr.ArrTATr.TA,.,,".,., ,.~ , ArAr.T 5580 TCTTGAAbl~,bll~'-( ( 1 AArTArrrrTArArTArAArrArAr~TATTTGGTATcTGcGcTc 5640 TGcTGAAGccAGTTAccTTrrr.AAAAAr.Ar~TTGGTAGcTcTTGATrrr7r~rAAArAAArrA 5700 crr,rTçr,TA~., (.(.'~blllllll~7lll'.( f'.Ar,rAr,rAr.ATTArr.rr.rAr.AAAAAAAr.r.AT 576(~

, W 096~4388 2 1 9 6 2 ~ ~ r~

rTrAAr~AAr~ATccTTTGATcTTTTcTA~:bbbb~ cGcTcAGTGr-AArr~AAAArTcAc sa20 GTTAAGGGATTTTGGTcATGAGATTATrAAAAArrATcTTcAccTAGATccTTTTAAATT 5880 A MM ATGAAGTTTTAAATcAATrTAAArTATATATGAGTAAA~llvbL~l~cAGTTAcc 5940 AATGcTTAATcAGTrArr~rArrTATcTcAGcGATcTGTcTATTTcGTTcATccATAGTTG 6000 ccTrAl,ll " ~ ArATAArTArr~ATArrr~rAr~rcTTAccAL~l~b~b~GTG 6060 cTGrAATrATArrr,rrArArrrArrrTCACCGGCTCCAGATTTATrArrAATAAArrAr.C 6120 rAr.rrr,rAAr.rr.rrr.Ar,rrrArAAl.,~bl~ ~A~AcTTTAllrbr~ ATccAGTcTA 6180 TTAAll~Lll.''' ~ AAr~rTAr~Ar~TAAr~TAr~TTcGccAGTTAATAGTTTGcGcAAcGTTG 6240 TTGCCATTGrTArAr~GrAT~ lbl~b~l~bL~ blATGGCTTCATTCAGCT 6300 0 ~ llAArr~ATrAAr~r~cr~ArTTAcATGATcccccATGTTrTr~rAAAAAArrr~r~TTA 6360 b~TcGTTGTrArAAr~TAA(~ b~b~AGTGTTATcAcTcATGG 6420 TTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGAl~lll~ ~ 6480 cTGGTr~ArTArTrAArrAAr~TcATTrTr~Ar~AATArTGTATGrrrrrArrr~Ar~TTGcTcTT 6540 b~ .,b~,~ AATArr.rr.ATAATArrrCrrrArATArrArAArTTTAMAGTGCTCATCA 6600 TTGGA M A~ AAAArTcTcAAGGATcTTA~ Ar~ATrrAr~TT 6660 crATr,TAArrrArTcGTGrArrrAArTrArCTTCAGCATCTTTTACTTTCACCAGCGTTT 6720 CTGGGTrArrLAAAArAr~AArrrAAAATGrrr.rAA~AAArrrAATAAr~jr,~rr.ArArrr.A 6780 AATGTTGAATACTCATA~l~ll~lllll AATATTATTGAAGCATTTATCAGGGTTATT 6840 GTcTcATrArrrrATArATATTTGM TGTATTTArAAAAATAAArAAATAl~[~ ll~cb~ 6900 GCACATTTrrrrrA AA ArTGccAccT 6926 Table3. D N A sequence of rL4.Yl24D~gGIfusion moleculecrvdingregion,1164bp 25 SEQ ID No:3 ATGGGTcTcAccTrrrAA(~ .l~L~l~l~ll~ll.(Il,(lArrAIl.l~b~AAC 60 TTTrTrrArr~r~ArArAAr-TGcGATATcAccTTArAr~rArATcATcAAAAcTTTGAAcAGc 120 cTrArArAr~rArAArArTcTGTGcAccGAGTTr~ArrGTAArArArAl~lll~~ 180 AArAArArAArTrAr~AAr~r~AAArrTTrTrrArr~GrTGcGAcl~l~l~b~GTTcTAc 240 30 AGccAccATr~Ar~AAr~r~ArA~ ArTrrArAr~rAr~TTrrArAr~rrAr 300 AAGcAGcTGATccGATTccTGAAAcGGcTrr~ArArr~AA((l~l~bbb~bl~b~bbb~ll~ 360 AAll~l~l~l~l(~AAr~r~AArrrAArrArArTArrTTGGAAAAcTTcTTr~rAAArGrTA 420 AAGAcGATcATrAr~ArAr~AAAr~ArTcAAAGTGTTrr;Ar~rrrTArrr~Ar~rrrAAATcGGcc 480 GACM AACTCACACATGCCCACCGTr.rrrArrArCTGM ~ ArrrTcAGTc 540 35 ll~ (AAAArcrAArrArArrrTcATGATcTrrrrrArrrrTGAGGTcAcA 600 l~c(~ b~cGTrArrrArrAArArrrTrArrTrAArTTrAArTrrTArrTrrAr 660 GGCGTrrLrr~Tr~rATAATrrrAAr~ArAAAr~rcr~rrGrArrAr~rAr~TArAArArrArrTAr 720 ll Ar~rr~TrrTrA( ( (.1~ ,.117( ArrArr.ArTr.rrTGAATGrrAArr.ArTArAAr. 780 TGcAAGGTcTrr;ArAAArrccTrrrArrrrrrATrrArAAAArrATcTrrAAArrrAAA 840 40 5GrrAr.rrcrr.ArAArrArArrTGTACA~l,,~:(:(((ATrrrrr~rATGAGcTGAccAAG 900 AAccAGGTrAr~rrTrAi~lv~ ~AAGGcTTcTATrrrArrrArA~ Ar 960 Trrr~ArAr-rAA~ (A(-(((~(~Ar~AArAArTAriArArrA((~l(l~blbbl~bAcTcc 1020 GA~bb~ ~lllArAr~rAArrTrArrrTr~r~ArAArAr~rArr~TrrrAr~rArr-rr 1080 AA~bl~ll~l~lb~l~bl~TGCATGAGGCTCTr.rArAArrArTArArrrArAArArr 1140 ~l~l~ lAAATGA 1164 Table4.Sequenceofencoded LL4.YlZ4D~gGlfosion prolein,387aa SEQ ID No:4 1 MGLTSQLLPP LFFLLACAGN FVHGHKCDIT T.QF.TTKTT.NC T.TFQKTT.rTF
~ 51 LTVTDIFAAS K~ K~l~ RAATVLRQFY ~ KvI~L GATAQQFHRH

-~5-W 096/04388 2~962~ r~

101 KQLIRFLKRL nRNTMr~TAr.T, NSCPVKEANQ STLENFLERL KTI~REKDSK
151 rccr~TT~p~cA DKTHTCPPCP APELLGGPSV FLFPPKPKDT LMISRTPEVT
201 ~VVV~V~h~ r~VKI lV~ GVEVHNAKTK r~lN~ll R W SVLTVLH

301 NQVSLTCLVK GFYPSDIAVE W~NW~NN YKTTPPVLDS DGSFFLYSKL
351 TvDKKsRnQQG NVFSCSVMHE ALHNHYTQKS LSLSPGK~

Table 5. DNA sequence of synthetic IgG4 cDNA. 1006bp SEQ ID No:5 GcTTrrArrAArççrrrAlI_rl.ll I 1~ 17~ Ar~ArrArrTrrrAr 60 ArrArA(~ 7~7~AArr~ArTArTTrc-rrr~AArrr~r~Tr~Arr~r~TGTcG 120 Tr~r~AArTrA~ ArrA~ ArA~ ~LlAcAGTccTcA 180 15 GGAcTcTAcTrrrTrArrAr~rrTGrTr~A~ AGcAGcTTrrrrArr-AArArr 240 TArArrTGrAArr.TAr.ATrArAAr.rrrAçrAArArrAArrTrrArAArArArTTGAGTCC 300 AaATAl~l~TGrrrATrATr~rrrAr~rArrTGAA~ 7~ ArrATcAGTc 360 AAArrrAArr~ArArTrTcATGATcTrcrrr~ArrrrTr~Ar~r~TcAcG 420 ~ ArrTrArrrArrAArArrrrrArrTccAGTTrAArTr~r~TArr~Tr~r~AT = 480 20 rrrrTrrAr7rTGcATAATçrrAArArAAArrrçrrrrArrArrArTTrAArArrlrrTAr 540 rrçTrr-TrA(~ (ArrArrArTrrrTrAArr~rAArrArTArAAr 600 Tr~rAArrTrTrrAArllA~ l~TcGATrrAr~AAAArrATrTcrAAAr~rrAAA 660rrrrArrrrrrArArrrArAr7çTGTAcA~L~ u~ TrcrAr-rAr7r~Ar~ATGAccAAG 720 AArrArrTrArrrTrA((~ AAArçrTTrTArrrrArrrArAl~ Ar 780 25 TrGr~ArAr~rAATrr~r~rArrrrr~Ar~ALrAArTArAAr~ArrA(~ LcTcc 840 rAcrrA,.,," ,,~,,.IArAr.rArçrTAACCGTr.rArAAr.ArrArr,TrrrAçrArrrr soo AAl~l~ll~l~A~ ~Tc~rATr~Ar~rcTcTr~rArAArrArTArirArAr~AArAr~r 960~l~l~l~l~l~l~(~lAAATr~ArTr~TAr~TrTArATcTAcGTATG .,1006 Table 6. DNA sequence of IL4.Y124D/Ig~i4 fusion moiecule coding region, 1149bp SEQ ID No:6 ATGGGTCTCACCTCCCAA~l~l . " ,,,~ .(,Ar.r~,,.,,,"~ AAr 60 TTTrTrrArr~r~ArArAArTçcr~ATATcAccTTArAr~rAr~ATrATrAAAArTTTGAAcAGc 120 cTrArArAçrArAArArTcTrTrrArrr~rTTrArrrTAArDrArA~ 180 AArAArArAArTr~rnnrrnAnrrTTrTçrAr~rrTçrrA~ ArTTrTAr 240 AGccAccATr~Ar~AAr~r~AlA(~ ArTr~rArAr~rAr~TTcrArAr~rrAr 300 AAçrAr~rTr~ATccGATTrrTrAAArçrrTrr~ArA~rAA~ ~ll~ 360 40 AAll~~ ".".AAr.r.AArrrAArrAr.ArTArrTTGGAAAAcTTrTTçr.AAArçrTA 420 AAGAcGATcATrnr~rArnAAr~ArTcAAAGTçrTrr~Arrr~ArTrrAAATAl~l~c~A 480 TGcccATrATr~rrrArrArrTGA~LlLl~ll~ ArrATrA~ A 540 AAArrrAnr,r.ArArTCTCATGATcTrrrrrArrrrTrAr.rTrA~ ~Ac 600 GTr~Ar~crAr~rAAr~Arrrrr~Ar~r~TccAGTTc-AAcTGGTAcGTGGATçrcr~Tr~r~Ac~rTçrAT 660 45 AATçrrAArArAAArrrçrrrrArr~Ar~rAr~TTrAArAr~rArrTAl~ llArrGTc ................ ..720 rTrA~ ArrArr~ArTGGcTr~AArrr~rAAr~Ar~TArAArTrrAArr~TrTcrAAr 780 AaAb~ c~l~ATcGATrrArAAAArrATrTrrAAArrrAAArrrrArrrrrrArAr~ 840 rrArArr.TçTArArr,l~ c ~ TrrrArrArrArATrArr~ArAArrAr~rTcAGccTG 900 A~lJ~l~ AAAr~çrTTcTArrfrAr~rr~ArA~ ArTr~çrAr~Ar~rAATGGG 960 50 rAçrrrr~Ar~AArAArTArAAr~ArrA~ ArTccGAcGGATccTTcTTc 1020 rTrTArAr.rAr.ÇrTAArrr.TrrArAArArrArrTrr.rArrArrr~AAi~:I'L~_l L~ RLTGC ~ 1080 TccGTGATGcATGAGGcTcTrrArAArrArTArArArArAArA(~ 1140 GGTAAATGA . _ 1149 WO 96/04388 2 1 9 6 ~ O ~ n~6 Table 7. Sequence of encoded IL4.Y124D/lgG4 fusion protein, 382aa SEQ ID No:7 1 ~G1TSQLLPP LFFLLACAGN FVHGHKCDIT T.Q~TTT~TT.NC T~TT~QT~TT~rTT~
51 LTVTDIFAAS h~ KLI~L_ hAATVLRQFY ~ ~-r'l_L GATAQQFHRH
101 KQLIRFLRRL n~NT.MrT.ArT. NSCPVKEANQ STLENFLERL K~ ~K~K
151 ~ L~K~b~r CPSCPAPEFL GGPSVFLFPP KPKDTLMISR lrL~l~VVV~
0 201 v uL~Lvub NMYvDGVEVH NARTKPREEQ ~L LrLVV~V LTVLHQDMLN
251 b~Lr~L-~y~ ~GLPSSIEKT ISKAKGQPRE PQVYTLPPSQ LLrllr~UV~L
301 TCLVKGFYPS DIAVEMESNG U~L~Y~llr PVLDSDGSFF LYSRLTVDKS
351 h~ bNV~C SVMHEALHNH YTQKSLSLSL GK~

Table 8. DNA sequence of IgG4 PE vaTiant, 984bp SEQ ID ~o:8 rrTAr.TArrAArrr,rrrAl('~.lL,ll~,L L_L L-lL~L~L-bcL L_1LJL_1l'~ Arr~ArrArrTccGAG 60 Ar~rArg~" ~ L,L,L,L_lL,u lL,L,l~AArrArTArTTrrrrrAArrrrTrArr.r.TrTrr 120 TGGAAcTrA~ o~ ;ArrA~ L~LAcAL-L-ll~L- ~bbl~lL~ ACAGTCCTCA 180 GGAcTcTAcTcccTcAGcAGcGTGGTGAL-L-bl~ ArrArrTTrrirrArrAprArr 240 TArArrTrrAArrTArATrArAAr.rrrArrAArArrAArrTrrArP~r~r'rTTGAGTCC 300 A-AATAL~ ATGcccAccATrrrrArrgrrTGAaTT~ r~rr~ArrATcAGTc 860 l~ lAAAArrrAArr~ArArTcTcATGATcTrcrr~r~Arrrr-TGAGGTcAcG 420 ~ ArrTrArrrArrpArArrrrrArrTccAGTTcAAcTrr7TArr~Tr~r~AT 480 rGcrTrrAr~TrrATAATGrrAArArAAArrrrrr,rirArrArrArTTrAArArrArr~TAr 540 LL~lL~lL~L~llArcrTrrTrA~ (ArrArrArTGGcTçAArrr~rAAr~r~ArTArAAr~ 600 TGcAAGGTcTcrAArAAA(~7r~ L-~blL-aTcgATrrArAAAArrATcTrrAAAr~rrAAA 660 rr.r.rArrrCrr.ArArrrArArrTGTACAu LlL~L-L-L-L-L-ATrcrArrAr~r~ArATGAccAAG 720 AAccAGGTcAGccTGAL-L-l~L-L-lL~L~lL~AAAGGcTTrTArrrrAr-rr~ArA~ Ar 780 Tr7r~Ar-ArrAATrr~r-rAr~rrrr~Ar~AArAArTArp~r~rrA~ ArTrc 840 GACGGalL,~,lL~.L~ IArArrArrrTAArrrTrrArAArArrArrTrrrArrArGrr goo AAl4lL~llL-lL-AIL~L-lLL-blL~ATGcATr~Ar~rrTcTrrArAArrArTArArArAr~AArAr~r 960 '_lL,lL~_'_lL,lL,lL,lL~'~blAAATGA 984 Table 9. DNA sequence of IL4.Y124D/lgG4 PE fusion molecule coding region, 1149bp 40 SEQ ID No:9 ATGGGTcTcAccTrrrAAl IMI ~l~UIL~,L~Dl-~--C~ Ar~rAll-~ bb~AAc 60 TTTGTrrArrr~ArArAAr-TGcGATATcAccTTArAr~r~Ar~ATcATcAAAAcTTTGAAcAGc 120 cTrDrDrprrArAAr~ArTcTGTGcAccGAGTTGAccGTAArA~ArA~ll~bl~bl~u 180 AAr~AArArAArTrArAAr~r~AAArcTTrTGrA~ l~bAbll.ll7~ b~Ar~TTcTAc 240 45 AGCcAccATrAr~AAr~r~ArA~ bbl ~ubAcTGrArAr~rArTTrrArAr~(;rAr 300 AAr~rAr~rTrATccGATTcrTr~AAArr~r~rTrr~ArAr~rAA~ ~bbb~bl~ 'b ~(~; l l~ 360 AA~ll~l~l~l~ll~AAr~r~pAr~rrAArrAr~Ar~TArr~TTGGAAAAcTTcTTrr~AAArrrTA 420 AAGAcGATcATrArAr-Ar-AAAr~ArTcAAAGTGcTcGAGcGAGTccA-A~ATAlbbl~u~A 480 TGcccAccATr~rrrArr~rrTrAATTTr~Ar~r~r~rr-rArrATcAbl~ll~l~ll~A 540 AAArcrAAr~r~ArArTcTcATGATcTrrr~r~ArrrrTGAGGTcA~bl~bl~bl~blvbAc 600 GTrAr-rrArrAArArrrrr~Ar~rTccAGTTcAAcTGGTAcGTGGATGGcGTGGAGGTGcAT 660 AATrrrpAr~ArAAAr--rrr-rr-r~r~Ar;r~ArrAr~TTrAArAr~rArrTA~lbl~L~bl~AGcGTc 720 W 096l04388 21 9 6 2 0 0 . ~l/~L~_.'03n~6 cTcAL~ LL-l~7(ArrArrArTGGcTrAArrr~rAAGrAGTArAar~TrrAAr~r~TcTccAAc 780 AA~hLrL-L-lL-L-LJ~ aTc~ATrr~rAAAArrATcTrrAAArrrAAA~rrrArrrrrrArAr 840 CcAcAGGTrTarA~ .[1111ATrrr~rrAr~r~r7~TGACra~r~ArrArr~TCAGCCTG 900 Acrl~L-L-ll~ AAArr~rTTrTArr-rrAr~cr~ArA~ Ar~Tr~r~r~Ar~ArrAATGGG 960 rArrrGr.Ar.AArAArTArAArArrA~ L~ L~L~AcTrrrArr7r~TccTTcTTc 1020 cTrTArArrArrrTAArrr,TrrArAAr.ArrAr.r,TrrrArr.Ar.r.rrAAU.,~ L~TGC 1080 Trrr.Tr.ATrrATr.Ar.rrTrTrrArAArrArTArArArar~ar.A~ LL_LLlL71~1Ll~ 1140 r,r.TAaATr.A _ _ _ _ _ ~ 1143 .-Table 10. Sequence of encoded IL4.Y124D/lgG4 PE variant fusion protein, 382aa SEQ ID No:10 1 MGLTSQLLPP LFFLLACAGN FVHGHKCDIT T.QT.'TTT~TT.NC T~TT~QT~TT~rTT~
51 LTVTDIFAAS AL~llr.~lrL RAATVLRQFY ~rL~AulrLL_L GATAQQFHRH

151 L5~L~KIL,~ CPPCPAPEFE GGPSVFLFPP KPKDTLMISR l~LVI~VVVU
201 v~uLu~Lvut N..IVUL~VLVtL NAKTKPREEQ ~N~lIhVV~V LTVLHQDWLN
251 Lr~I~L ~V~N KGLPSSIEKT ISKAKGQPRE PQVYTLPPSQ ~Lr~lANuv~L
301 TCLVKGFYPS DIAVEWESNG U~NNr~ll~ PVLDSDGSFF LYSP~LTVDKS
351 h..~L~NVt SL- SVMHEALHNH YTQKSLSLSL GK~

Claims (19)

1. A soluble protein having IL4 and/or IL13 antagonist or partial antagonist activity, comprising an IL4 mutant or variant fused to least one human immunoglobulin constant domain or fragment thereof.

2. A compound according to claim 1, wherein at least one amino acid, naturally occuring in wild type IL4 at any one of positions 120 to 128 inclusive, is replaced by a different natural amino acid.

3. A compound according to claim 2, wherein the tyrosine naturally occurring at position 124 is replaced by a different natural amino acid.

4. A compound according to claim 3, wherein the tyrosine naturally occurring at position 124 is replaced by aspartic acid.

5. A compound according to any one of the preceding claims, wherein the immunoglobulin is of the IgG subclass

6. A compound according to claim 5, wherein the constant domain(s) or fragment thereof is the whole or a substantial part of the constant region of the heavy chain of human IgG.

7. A compound according to claim 5, wherein the constant domain(s) or fragment thereof is the whole or a substantial part of the constant region of the heavy chain of human IgG4.

8. A compound according to claim 1, having the amino acid sequence represented by SEQ ID No:4, SEQ ID No:7 or SEQ ID No:10.

9. A process for preparing a compound according to any one of the preceding claims, which process comprises expressing DNA encoding said compound in a recombinant host cell and recovering the product.

10. A process according to claim 9, which comprises:
i) preparing a replicable expression vector capable, in a host cell, of expressing a DNA polymer comprising a nucleotide sequence that encodes said compound;
ii) transforming a host cell with said vector, iii) culturing said transformed host cell under conditions permitting expression of said DNA polymer to produce said compound; and iv) recovering said compound.

11. A DNA polymer comprising a nucleotide sequence that encodes a compound according to any one of claims 1 to 8.

12. A DNA polymer according to claim 11, which comprises or consists of the sequence of SEQ ID No:3, SEQ ID No:6 or SEQ ID No:9.

13. A replicable expression vector comprising a DNA polymer according to claim 11.

14. A host cell transformed with a replicable expression vector according to claim 13.

15 A pharmaceutical composition comprising a compound according to any one of claims 1 to 8 and a pharmaceutically acceptable carrier.

16. A method of treating conditions resulting from undesirable actions of IL4 and/or IL13 which comprises administering to the sufferer an effective amount of a compound according to claim 1.

17. A compound according to any one of claims 1 to 8. for use in therapy.

18. A compound according to any one of claims 1 to 8, for use in the treatment of conditions resulting from undesirable actions of IL4 and/or IL13.

19. Use of a compound according to any one of claims 1 to 8 in the manufacture of a medicament for use in the treatment of conditions resulting from undesirable actions of IL4 and/or IL13.