CA2116107A1 - Targeted delivery of poly-or oligonucleotides to cells - Google Patents

Abstract

Molecular complexes for targeting oligonucleotides, such as antisense oligonucleotides or ribozymes, to a specific cell to block expression of a gene or genes in the cell are described. The single-stranded poly- or oligonucleotide is complexed to a conjugate of a cell-specific binding agent and a poly- or oligonucleotide-binding agent. The cell-specific binding agent is specific for a cellular surface structure which mediates internalization of the complex. An example is the asialoglycoprotein receptor of hepatocytes. The poly- or oligodeoxy-nucleotide-binding agent is a compound such as a polycationic protein which stably complexes the oligonucleotide under extracellular conditions and releases it under intracellular conditions so that it can hybridize with the target RNA. The molecular complex is stable and soluble in physiological fluids and can be used to selectively introduce antisense oligonucleotides, ribozymes or other signal-stranded oligonucleotides into a cell to inhibit expression of a gene within the cell. The oligonucleotide can be directed against cellular genes (e.g., cellular oncogenes) or genes of noncellular origin (e.g., viral oncogenes, genes of an infecting pathogen).

Description

WO93~04701 PCT/US92~07339 21l~l07 .
TARGETED DELIVERY OF POLY- OR
Ol.IÇQNUCLEOTIDES TO CELLS

.
~: .
: .:
: Background of~the Invention Antisense~oligonucleotides hoid great promise as : means of specifically inhibiting unwanted gene expression in cells~.~ Improvements in the delivery of '~
;O5~ oligonucIeotides~to~cells will enhance :~
effectiveness.~ Naked antisense oligonucleotides can ~
.be~taken up by:cel:ls~non-specifically and at low ,' e~ficiency. 'Some methods:have been e~plored to ~:
~ ~ , increase:uptake;.,~emaitre ~ al. covalently coupled lO~an~oligonucleotide~to~polylysine and demonstrated ,,, ; inhibition~of~v~iral gene express,ion at several fold "~
lower~than~DNA~concentrations compared to mixtures of polylysine and~anti~sense DNA (Lemai~re, M. ~ al.
Proc.~ N~tl.~Acad.~Sci.:US~ 84::~48-652). Although :L5 s:pecifîc antivira~l effects were shown, specific :.. , delivery~was-not~demonstrated.

:: : : :
:~ :: :: :

:: ~.

W~93/04701 P~T/US9~/07339 2 l l 6 l ~7 -2-Summary of the Invention This invention pertains to a soluble, targetable molecular complex for targeting poly- or oligonucleo-tides to a specific cell to inhibit the expression of 05 a gene or genes. The molecular complex comprises a single-stranded poly- or oligonucleotide which hybridizes to an RNA transcript of the gene, : complexed to a:carrier which is a conjugate of a ~.
~ ~ cell-specific binding agent and a poly- or : : lO oligon~cleotide-binding agent. The complex is .:
administered in~:a~pharmaceutically acceptable : solution in an~amount;sufficient to hybridize to and : : inhibit the fùnction of the RNA transcript. ~
~: The poly- or oligonucleotide can be DNA or RNA. .
15 For antisense~applications, an antisense oligodeoxy-nucleotide;~can~be~us~ed which hybridizes to and inhibits the~unct;ion of an RNA. The targeted RNA is t~ypically~a messenger RNA. The oligonucleotide can :al~so be an~RNA~which has catalytic activity (a 20:~ribozyme). The~target for an~isense or ribozyme~
medi~ated inhibition~can be a gene or gen~s of ~`
ce1~1ular origin~:~(e.~g:., a cellular oncogene) or of noncellular~or~igin`~(e:.g., a viral oncogene or the genes~ of an~infecting:~pathogen such as a virus). ~-~

:

:: ~ :~ ::
~ ~ , W093/0470l PCT/VS92/0733 21 1 ~
The cell-specific binding agent is specific for a cellular surface structure, typically a receptor, which mediates internalization of bound ligands by endocytosis, such as the asialoglycoprotein receptor 05 of hepatocytes. The cell-specific binding agent can be a natural or synthetic ligand (for e~ample, a protein, polypeptide, glycoprotein, carbohydrate, etc.) or it can be an antibody, or an analogue thereof, which specifically binds a cellular surface 10 structure which then mediates int~rnalization of the bound comple~. The poly- or oligonucleotide-binding component o the conjugate is a compound such as a polycation which stably comple~es the single-stxanded pol~- or oligonucl~otide under e~tracellular 15 conditions and releases it under intracellular conditions so that it can function within the cell.
The complex of the genP and the carrier can be us2d in vitr~ or in v vo to selectively deliver poly-or oligonucleotides to target cells. The comple~ is -~
-~ 20 stable and soluble in physiological fluids. It can be~administeLed in y~y~ where it is selectively taken up by the target cell via the surface-structure- -mediated endocytotic pathway. The incorporated poly-or oligonucleotide hybridizes with its ~omplementary -~
25 RNA, thereby inhibiting function of the RNA and expression of the target gene or genes.

8rief De~cription of the Fiaures Figure 1 shows the uptake of comple~ed antisense DNA by HepG2 and SK Hepl cells.
Figure 2 shows the effect of comple~ed antisense D~A on hepatitis B virus surface antigen .
concentration in culture medium.
Figure 3 shows Southern blots of DNA extracted from medium and cel-ls after 24 hrs of exposure to 35 antisense DNA.

W093/0470l PCT~US92/07339 --4-- !

Detailed DescriRtion of the Invention A soluble, targetable molecular comple~ is used to selectively deliver a single-stranded poly- or oligonucleotide to a target cell or tissue in vivo to 05 specifically inhibit gene expression. The molecular complex comprises the oligonucleotide to be delivered complexed to a carrier made up of a binding agent specific for the target cell and a DNA-binding agent. The complex is selectively taken up by the ~;
10 target cell and the oligonucleotide hybridizes to the RNA transcript which inhibits expression of the targeted gene(s).
., The poly- or oligonucleotide is a single-stranded molecule which hybridizes to a specific RNA
15 under intracellular conditions. The degree of comp}ementarity required for appropriately specific hybridization to the target RNA sequence under intra-cell~ular conditions càn be determined empirically.
In~a~preferred~ embodiment, the oligonucle~tide ;Z0~ is an antisènse~oligodeo~ynucleotide. The antisense oligodeoxynuc~leotide~can be a normal oligodeoxy-nucleotide or~an~analogue of an oligodeoxynucleotide ; (e.g., phosphorothioate oligonucleotides, in which one~ of the pho~sphate oxygens is replaced by a sulfur ;;25~ atom)~suffici~ent~ly stable to reach the tarqet in efective concentrations. See e.g.~ Stein, C.A. and Cohen, J.S. (1988~)~Cancer Rese~rch 48:2659-2668.
Antisense oligodeoxynucleotides can be prepared by standard synthétic procedures.
The antisense oli~onucleotides can be designed t~ operate by different mechanisms of gene inhibition. Gener~a~lly, these mechanisms involve the hybridization of~the oligonucleotide to a specific WO93/~47~1 PCT/US92/0733 RNA sequence, typically a messenger RNA. The targeted se~uence can be located in the coding region of the RNA or it can be a signal sequence required for processing or translation of the RNA. The 05 targeted sequence can be a sequence normally found in an organism or a sequence found in a p~thogenic organism but not in its host. Alternatively, the oligonucleotide may form a triple helix DNA
structure, inhibiting transcription of the mRNA
10 sequence.
, .
~ ~ In other embodiments, the oligonucleotide can be . .
an~RNA molecule~which has catalytic activity, i.e., a ribozyme. Ri~bozymes are advantageous because they ~-specifically cleave and, thus, destroy the targeted 15 RNA sequence. Ribozymes are described in U.S. Patent No . 4~, 9 8 7, 0 71~
The carri~er component of the comple~ is a conjugate~o~ a cell-specific binding ag~nt and an ::
oligonucleotide-binding agent. The cell- specific 20 ~binding agent specifically binds a cellular surface structure which~mediates its internalization by, f~r ~
e~ample,~the~process;of endocytosis. The surface st~ructure can be a protein, polypeptide, carbohydrate,~lipid~or combination thereof. It is typ~ically a surface receptor which mediates endo-cytosis of a ligand.; Thus, the binding~ agent can be a natural or~synthetic ligand which binds the ` receptor. Th~e ligand can be a protein, polypeptide, ; ~ carbohydrate,~ lipid or a combination thereof which 30 has functional groups that are exposed sufficiently to be recognized by the cell surface structure. It can also~be~a component of a biological organism such as a virus, cells (e.g., mammalian, bacterial, protozoan~ or artificial carriers such as liposomes.

.
,' :

W~93~047~1 PCT/US92/07339 The binding agent can also be an antibody, or an analogue of an antibody such as a single chain antibody, which binds the cell surface structure.
Ligands useful in forming the carrier will vary 05 according to the particular cell to be targeted. For targeting hepatocytes, glycoproteins having e~posed terminal carbohydrate groups such as asialoglyco- -protein (galactose-terminal) can be used, although other ligands such as polypeptide hormones may also 10 be employed. E~amples of asialoglycoproteins include ` asialoorosomucoid, asialofetuin and desialylated vesicular stomatitis virus. Such ligands can be formed by chemic~al or~enzymatic desialylation of glycoproteins that possess terminal sialic acid and 15 penultimate galactose~residues. Alternatively, asialoglycoprotein~ligands can be formed by coupling galactose terminal carbohydrates such as lactose or arabinogalactan;~to non-ga~lactose bearin~ proteins by reductive~lacto;samination.
~ ~ For targetin~ ~he molecular complex to other cell su~rface receptors, other types of ligands can be used~,~ such~as mannose for macrophages (lymphoma), mannose-6-phosph~ate glycoproteins for fibroblasts fibrosarcoma)~ intr~insic factor-vitamin B12 for 25~enterocytes~ and ~insulin for fat cells~ Alternative-ly, the~cell-specific binding agent can be a receptor or receptor-l~ike~molecule, such as an antibody which ; binds a ligand ~(e.g., antigen~ on the cell surface.
Such antibodi`es can be produced by standard 30 procedures~.
.

' WO93/04701 P~T/US92/07339 2116io7 The po}y- or oligonucleotide-binding agent complexes the oligonucleotide to be delivered.
Complegation with the oligonucleotide must be sufficiently stable in vivo to prevent significant 05 uncoupling of the oligonucleotide extracellularly prior to internalization by the target cell.
However, the complex is cleavable under appropriate conditions within the cell so that the oligonucleo-tide is released in functional, hybridizable form. .:
10 For e~ample, the comple~ can be labile in the acidicand enzyme rich environment of lysosomes. A non-covalent bond based on electrostatic attraction between the binding agent and the oligonucleotide proyides e~tracellular stability and is releasable 15 under intracellular conditions.
: ~Preferred poly- or oligonucleotide-binding :.
agents~are polycations that bind the negatively : char~ed nucleic~acid strands. These positively charged materials can bind noncovalently with the 20 poly- or oligonucleotide to form a soluble, targetable molecular complex which is stable : :e~tracellularly~but which releases the poly- or oligonucleotide~as a functional (e.g., hybridizable) molecule intrace~l1ularly. Suitable polycations are 25 polylysine, polyarginine, polyornithine, basi~
; : proteins su~h as histones, avidin, protamines and the ike.~ A preferred polycation is polylysine (e.g., ranging from:3,~800 to 60,000 daltons). Other noncovalent bonds that can be used to releasably link 30 the poly- or oligonucleotide include hydrogen .:~: bonding, hydrophobic bondin~, electrostatic bonding alone or in combination such as, anti~poly- or oligonucleotide antibodies bound to poly- or , ' '' WO93/04701 P~T/US9~/~7339 23L~ ~107 oligonucleotide, and streptavidin or avidin binding to poly- or oligonucleotide containing biotinylated nucleotides~
The carrier can be formed by chemically linking 05 the cell-specific binding agent and the oligonucleo-tide-binding agent. The linkage is typically covalent. A preferred linkage is a peptide bond.
This can be formed with a wat~r soluble carbodiimide ; as described by Jung, G. et al. (1981) Biochem.
10 Biophys. Res. Commun. 101:599-606. An alternative kage is a disulfide~bond.
The linkaqe reaction can be optimized for the , particular cell-specific binding agent and oligonucleotide-binding agent used to form the 15 carrier. Reac~tion conditions can be designed to ;; magimize linkage~formation but to minimize the formation of aggreyates of the carrier components.
The optimal ratio~of cell-specific bindiny a~ent to p~oly- or oli~onucleotide-binding agent can be 20 determined empirical~1y. When polycations are used, the molar ratio of the components will vary with the size of the polycation and the size of the poly- or oligonucleotide;. ~For e~ample, for a conjugate of asi;aloorosomucoid linked to polyl~sine complexed with 25 a~ 21-mer oligonucleotide the ratio can range from 2~
:: : :
to 1:2 by weight~(asialoorosom~coid:oli~onucleotide) can be used. Uncoupled ~omponents and aggre~ates can be separated from the carrier by molecular sieve or ion e~change chromatography. In a preferred embodiment, the conjugate is purified on a high pressure liquid~cation exchange column ~Aquapore~
cation-exchange, Rainin) with stepwise elution with 0.1 M sodium acetate, pH 5.0, 2.5, 2.25 and 2Ø

WOg3/0470l PCT/US92/07339 _g_ 21161~)7 To form the complex, the poly- or oligonucleo-tide and carrier are mixed and incubated under conditions conducive to complexation. For example, the poly- or oligonucleotide and carrier can be mixed at the appropriate ratio in 2 M NaCl and the solution can be diluted to 0.15 M and filtered to provide an administrable composition.
The molecular complex can contain more than one copy of the nucleic acid strand. The amount of poly-- 10 or oligonucleotide, of course, should not e~ceed that required to maintain solubility of the ~esulting ~ compIex. The preferréd weight or molar ratio of ;~ ~ carrier to poly-~or oligonucleotide for the construct employed can be determined by routine e~perimentation Th~ molecular comple~ of this invention can be administered~parenterally. Preferably, it is ;injected intrav~enously. The complex is administered in solution~in~a~physioloqically acceptable vehicle.
The~molecular comple~ of this invention can be 20~ used~to target delivery of a wide range of poly- and oligonucleotide~for specific hybridization usually to an~RNA~ta~rget~ The;~target can also be DN~ by triplex ; formation.~ Duvall-Valentine ~ al. (1992) PNAS
~9:594-508.~ In the former case, depending on the 25 therapeutic ~oa~ the oligonucleotide can be directed against trans~lation of a gene or genes of cellular origi~n (e.g., a~cellular oncogene3 or of noncellular origin ~e.~g.;,~ a~viral oncogene or the genes of an infecting pathogen such as a virus Qr a parasite such - 30 as malaria~, trypanosome, lysteria or mycoplasma~. In the latter ca~ses, the antise~se can be directed against transcription of target genes.

: ~

W O 93/04701 PC~r/US92/07339 2 1 i ~
In one embodiment, the method of this invention can be used to treat hepatitis infection. The complex can be used to deliver an antisense oligo-deoxynucleotide specifically to liver cells to block 05 production of hepatitis virus. One strategy is to take advantage of the fact that, because of its compact nature, the human hepatitis B virus has only -~
one polyadenylation signal (nucleotides 1903-1923).
The signal is common to all hepatitis B viral-derived 10 mRNA and is different from the mammalian signal. As a result, antisense~oligodeo~ynucleotides comple-mentary to this region can block viral protein synthesis. In~a~preferred embodiment, the antisense strand is comple~ed to a carrier comprising a ligand 15 for the hepatic asialoglycoprotein receptor and a po1ycationic;protei~n~such as polylysine to provide a soluble molecular complex`targetable to the liver.
In another embodiment, the method of this invention can ~e used t~ alter the expression of a 20 ge~e of cellular origin. This method may be useful in~the treatment of diseases characterized by abnormal biosynthesis, especially overexpression, of normal or abnormal cellular proteins.
. ~ ~

' .~.

WO93/~701 PCT/US92/07339 2116i~7 This invention is illustrated further by the following e~amples.

Example l M~TERIALS AND METHODS

05 Cells and Cell Culture Human hepatoma, HepG2 2.2.15 cells kindly pro~ided by Dr. George Acs (Mt. Sinai S~hool of Medicine, ~Y) and SK Hepl cells were grown in DME~
and 10% fetal calf serum as described pr~viously (Wu, G.Y. and Wu, C.H. (1987) J. Biol. Chem. 262:4429-4~32).

PrePa at~Qn ~f Tar~etable Antisense DNA
: : A targetable, soluble DNA carrier was prepared : by coupling as:ialoorosomucoid to poly L-lysine 15 ~Sigma) (Mr = 59,000) using 1-ethyl-3 (3-dimethyl-aminopropyl) carbodiimîd~) (Pierce) as described ~::pr2viously (Wu, G.Y. and Wu, C.H. (1987) ~ iol~
- 5h~ 262:4429-4432) e~cept that the conjugate was purified b~ cation exchange chromatography using a ~:
20 high pressure liquid chromatographic system (Rainin) employing an Aquapore C-300 column (Rainin) and :~
stepwise elution with 0.1 M sodium acetate, p~ 5.0, 2.~, 2.25 and 2Ø The second peak eluted from the column, as detected by U.V. absorption at 230 nm, was ~:
25 determined to be the optimal conju~ate form and was used for all subse~uent experimentsO A 21-mer oligodeo~ynucleotide, complementary to a portion of ~;
the human hepatitis B virus (ayw subtype3 ~Hirschman, :`
S.Z. et ~1~ (1980~ Proc. Natl. Açad~ S~i. USA
30 77:5507-5~11) including the polyadenylation signal~ --WOg3/0~7~1 PCT/~92~07339 ~ 1 ~ 6 1 0 7 -12-corresponding to nucleotides 1903-1923 (See SEQUENCE
ID NO. 1 - TTTATAAGGGTCGATGTCCAT) of the viral genome, was synthesized with phosphorothioate linkages on an automated nucleotide synthesizer 05 (Applied Biosystems) ~Matsukura, M. et al. (1987) Proc. Natl. Acad. Sc O USA ~:7705-7710). As a control, a random~21-mer sequence was prepared in an identical fashion. The purity of oligonucleotides was determined by electrophoresis through 15%
10 polyacrylamide gels stained with ethidium bromide.
~ntisense DNA was titrated with conjugate to form a soluble complex using an agarose gel retardation ;~ ~ system as described pre~iously (Wu, G.Y. and Wu, C.H.
(1987) J. Biol. Chem.~262:4429-4432) and a conjugate lS to DNA ratio of 1.6:1 by weight (asialoorosomucoid:
D~A) was selected.

Assay for Re~eptor-Mediated Uptake of Compl~ed ; Anti$ense DNA~
To evaluate uptake of oligonucleotides, 20 antisense DNA was end-labeled with 32p (Sambrook, J.
1989~) Molecular Cloninq - A Laboratory Manual, Cold Spring~Harbor Laboratory, 2nd ed., vol.
2, pg. lI.31). ~DNA alone, or in the form of a complex was~added to medium of HepG2 and SK Hepl 25 cells to make 50 ~M solutions with respect to added antisense DNA.~ Uptake was determined as described previously for asiaIoglycoproteins (Schwartz, A.L. et ~-~1~ (1981) J,_Biol. Chem ~k:8~78-88Bl). In brief, cells were incubated with ligands at 37C and at 30 regular time i;ntervals, d~shes were chilled to 4C, washed with cold 10 mM EDTA-phosphate buffered saline and the cell layers removed and scintillation ..

..

W O 93/0470~ PC~r/US92/~7339 2 ~ 0 7 counted. To determine counts bound to the cell surface, identical sets of cells were incubated at 4C with ligands and, after washing as described above, the cell layers were removed and adherent 05 radioactivity was determined by scintillation counting. Up~ake was calculated as the difference between total cell-associated counts at 37C and counts bound to the cells at 4C for each time point. All points were determined in triplicate and 10 results shown as means ~ SEM expressed as pmole DNA/106 cells.

Antisense DNA and Viral Gene Expression To determine~the effect of antisense DNA on viral gene expression, HepG2 2.2.15 cells were seeded 15 six~ days pre-con~1uence and incubated at 37C in medium containing antisense DNA alone, ~omplesea antisense DNA,:comple~ed random DNA, or medium alone~ All media containing added DNA were initially .
50:~M with respect to DNA. At daily intervals, 50 ~1 20 Of med:ium:was~sampled and assayed for hepatitis B
: : : surface antigen;by:an ELISA (Abbott) method as described by the~manufacturer, modified for qua~ntîtation using serially diluted standard surface antigen~ (CalBiochem~:which produced a lînear response :~
25~withîn the range~ of antîgen levels found in the :~
samples~. Cell number was determined by microscopic countîng cells staîned with trypan blue. All points :
were determined in:trîplicate and the results of four : : e~perîments are shown as means ~ SEM expressed as 30 ~g/ml/106 cells.

W093/04701 2 1 1 6 1 0 ~ PCT/US92/07339 Effect of Antisense DNA on Protein Secretion HepG2 2.2.15 cells were incubated with 50 ~M
comple~ed DNA as described in Figure 2 except that 10 ~Ci [35S]-methionine (Amersham), specific activity 05 1000 Ciimmole, was added to label newly synthesized proteins. Aftex 24 hrs, medium was moved, cells washed with phosphate buffered saline and lysed with 1% sodium dodecyl sulfate which was subsequently removed with triton X-100. Both media and cell 10 Iysates were treated with a specific rabbit anti-surface antigen antibody (DAKO) and precipitated with protein-A sepharose ~Sigma). Precipitates were scintill~ti~n counted and each point assayed in triplicate. Total ceIl protein was determined by 15 colorimetric assay (Bio-Rad). The results of three experiments are shown as means ~ SEM e~pressed as cpm/mg cell protein.
~; In order to assess the effect of comple~ed antisense DNA on total protein synthesis, cells 20 treated with~co~plexed DNA and labeled with ~;
;~ ~35S]-methionine as described above were separated ~-; , ~
from media. Total protein was precipitated with 10%
trichluroacetic acid and counted. The results of triplicate assays of three experiments are shown as 25 means ~ S~M express~ed as cpm~mg cell protein.

Effect of Antisense DNA on Production_of Viral DNA
Cells were incubated wîth 50 ~M antisense DNA
alone, or in the form of complexes. After 24 hrs, medium was removed and HBV DNA, extracted from the 30 medium according to the method of Sells et al.
~Sells, M~A. et~al. (1987) Proc. Natl. Acad. Sci. USA
a~i:l005-1009) and from the cell layer according to WO93/047~1 P~T/US92/07339 2 1 1~
the method of Hirt ~Hirt, B.J. ~1967) Mol. Biol.
26:365-371). Total cell protein was determined by colorimetric assay tBio-Rad3. DNA extracted from equal volumes (40 ml) of medium and from approxi-05 mately equal numbers of cells (107) were applied onan agarose gel. HBV DNA was identified by Southern blot using an EcoRI-BglII fragment of the HBV genome ~ ~ (nucleotide 0 to 1982) as a probe labeled with 32p ; ~ and exposed to x-ray film as described previously 10~ ~Sambrook, J. et al. ~1989) Molecular_Clonina - A
LaboratorY Manùal, Cold Spring Harbor Laboratory, 2nd ed., voI. 2,~pp. 10.14-10.15). Relative quantitation was achieved~by~densitometry and confirmed by -~
scintillation counting of corresponding bands.
The first;obj;ective was to determine whether a single-strand~ed ~NA oligonucleotide could be bound by -~
an~ asialoglycop~rotein-based carrier and whether it could be specific~ally targeted to asialoglycoprotein r~eceptor-bearing cells.
Figure 1 s~ows~uptake of complexed antisense DN~
by~HepG2 and;~SK~Hepl~ce~lls. A targetable, soluble DNA carriér;was prepared by coupling asialooro~o-mucoid to~poly~L-lysine using a water soluble c~arbodiimide~as~described previously (Wu, G.Y. a~d 25~Wu,~ C.H. (1987) J. Biol. Chem. 262:4429-4432) and purified as desc~ribed in Materials and Methods. The conjugate was~complexed to a 21-mer oligodeo~y-nucleotide,~ complementary to a portion of the human hepatitis B~virus~including the polyadenylation 30 signal and labeled~with 32p. DNA alone, or in the form of a complex~was added to medium to make it 50 ~M with respect;to added antisense DNA. Uptake was determined~as described previously for asialo--, ~' W093/04701 2 1 1 6 1 0 7 -16- PCT/USg2/07339 glycoproteins (Schwartz, A.L. et al. ~1981) J. Biol.
Chem. 256:8878-8881). Cells were incubated at 37C
and at regular time intervals, dishes were chilled, washed with 10 mM EDTA-phosphate buffered saline. To 05 determine counts bound to the cell surface, identical sets of cells were also incubated at 4C with ligands and, after washing as described above, the cell layers were removed and radioactivity determined ~y scintillation counting. Uptake was calculated as the 10 difference between cell-associated counts at 37C and ` counts bound to~the cell surface at 4C for each time point. All points were determined in triplicate and ~;~ results shown as means ~ SEM expressed as pmole DNA~106 cells, (o), antisense DNA alone; (~), lS complexed antisense DNA; (~), complexed antisense DNA
plus a 100-fold~mo1ar excess of asialoorosomucoid.
F~igure~l shows;that in SK Hepl rasialoglycoprotein receptor (~ cells3,~ the average uptake of antisense DNA alone wa~s~less~than 0.05 pmole/hr/ million cells 20 over 4 hrs of~exposure. Incubation with DNA in the form~of a complex d~id~not improve the uptake in these cells. Similarl~yr~uptake of antisense DNA alone by HepG2 [asia1~oglycoprotein recep~or (+)] cells was as low as observed~in~receptor ~-) cells over the course 25~of the 4~ hrs.~;However, in the receptor (~) cells, complexed antisense~DNA was taken up nearly linearly at an~average rate 12 times faster than antisense DNA -`
alone throu~h the 4~hrs of incubation. Accumulation ~of complexed~antisense was also 12 times greater than -30 antisense DNA ~alone~after 4 hrs of exposure. The uptake of comp~lexed DNA was virtually completely blocked by administration of a large molar e~cess of free carrier protein, asialoorosomucoid, to compete ' '' :
.

W093/04701 PCT/U~92/~7339 2~i10~
for receptor binding. This confirmed the involvement of asialoglycoprotein receptors in the differential delivery of the antisense DNA.
To determine whether the targeted antisense DNA
05 was functional, effects on hepatitis B viral gene expression were evaluated. Figure 2 shows the effect of complexed ant~isense DNA on hepatitis B virus surface antigen concentration in culture medium.
HepG2 2.2.15 cells were incub~ted at 37C in medium lO containing antisense DNA alone, complexed antisense DNA, complexed random DNA, or medium alone. All ~- ; media containing added D~A were initially 50 ~M with respect to DNA.~At;daily intervals, medium was sampled and assayed for the presence of hepatitis B
15 sur~face antigen by an ELISA (Abbott) method as described by the manufacturer, modified as described ;in Materials~and~ Methods. Cell number was determined by~miGroscopically counting cells stained with trypan ~;
blue. All;~points~were determined in triplicate and O~ the~ results of four~ experiments are shown as means SEM~;e~i~ressed as yg/ml~106 cells.
Figure 2~;shows that in untreated control cells, hep~atitis~;B~v1ra~l~s~urface antigen steadily increased n :concent~ation ~ in t heir media,~rising from 1 25~ g/ml~/106 cells~n the first day to 5.5 ~g/ml/106 ceils by the~seventh day. ~Exposure of cells to antisense DNA;~alone had no significant effect until the 3rd day~at~which time surface antiqen concen-tration was 30%~10wer than ùntreated controls 30 Nevertheless,~surface antigen concentrations in the presence of~antis~ense DNA alone continuea to rise steadily throughout the 7 da~s of exposure. However, treatme~t with c;omplexed antisense DNA resulted in an : ~ :
: : :

80% inhibition after the 1st day and 95% inhibition by the 7th day compared to untreated controls. There was no significant increase in surface antigen concentration after the first 24 hrs. Complexed 05 random DNA of the same size had no effect on antigen concentrations at any time point under identical conditions. -The lack of accumulation of hepatitis B surface antigen in the medium of cells treated with complexed 10 antisense DNA could have been due to a block in protein secretion. To examine this possibility, the synthesis of new surface antigen was measured in the media and cell~layers. Table lA shows that ,~
~ radi,olabeled immuno~recipitable surface antigen in 15 both the medium and cells after treatment with complexed ant~isense DNA for 24 hrs were decreased to an equal extent ~(80%)~ compared to untreated cells.
There was~no~significant intracellular accumulation of newly synthesi~zed antigen that would have been 20 expected i~ a block in protein secretion had occurred.
Table~lB shows that neither comple~ed antisense DNA nor random~DNA~had a significant effect on total newly synthesized~protein in the cell la~er. A
small, 2%, de~rea'se~was detected in newly synthesized 25 secreted protein~ln;cells exposed to comple~ed antisense DNA~.~ This likely reflects,the contribution of the inhib,ition of~viral surface antigen synthesis noted in Table lA~. Th;e data, overall, indicate that the observed inhibition of hepatitis B surface 30 antigen s~nthesis by complexed antisense DNA was specific and could not have been due to a generalized inhibition of total protein synthesis.

' .

. W093/04701 PCT/US92/0733g 21~ ~07 Table lA
Immunoprecipitable Hepatitis B Surface Antigen~

Treatment Cell Layer+ Cell ~edium+
Untr~ated Control 56,100 + 2,321 114,500 ~ 2,442 - 05 Complexed Antisense DNA 10,200 ~ 1,009 15,300 + 890 Comple~ed Random DNA 52,500 + 4,534 122,220 ~ 5,742 :
' Table lB
: ~ Total TCA Precipitable Radioactivity*

Tr~atm nt Cell Layer+ Cell Medium+
10 Untreated Zontrol 184,498 ~ 2,258 712,498 ~ 5,435 Complexed Antisense DNA 188,844 ~ 6,240 684,302 1 9,678 Complexed Random DMA 183,5~1 ~ 5,444 706,240 ~ 7,544 ~ ..
~ after 24 hrs incubatIon ,:
cpm/m~ cell protein :~
5;:~T~A - trichloroacetic acid Finally, in order to determine whether viral eplication was~aff~ected, DNA was extracted from the ~ ~ .
medium and cells layers exposed to oligonucleotides or 24 hrs and :analyzed by Southern blots. Figure 3 20 shows Southern~blots of D~A extracted from medium and cells aftsr 24~ hrs~ exposure to antisense DNA. Cells ::
were incubated as described for Figure 2 with 50 ~M
antisense DNA alone, or in the form of comple~es as ~ described for Figure 2. After 24 hrs, medium was ;~ ; 25 rPmo~ed and DNA, extracted from the medium (Sells, .

:

W093/04701 PC~/US92/0733g 21~ ~107 -20-M.A. et al. (lg87) Proc. Natl. Acad. Sci. USA
84:1~05-1009) and from the cell layer (Hirt, B.J.
(1967) Mol. Biol. 26:365-371). Total cell protein was determined by colorimetric assay ~Bio-Rad). DNA
05 extracted from equal volumes of medium and from approximately equal numbers of cells were applied on an agarose gel, ~BV ~NA was identified by Southern blot using an EcoRI-BglII fragment of the HBV genome as a probe~ labeled~with 32p and exposed to x-ray film 10 (Sambrook, J. et al. tl989) Molecular Cloninq - A
Laboratory Manual, Cold Spring Harbor Laboratory, 2nd ed., vol. 2, pp~. 10.14-10.15). Relative ~uantitation was achieved~by densitometry and confirmed by scintillation counting of corresponding bands, 15 normalized to~equal volume or cell number, for media ;and cell layers~, respectively. Duplicate blots were per~ormed, a representative of which is shown above.
;Lanes~ 1-4, cell~lysates; lanes 5-8, media; lanes 1 and 5,~ untreated; cont~ro1s; lanes 2 and 6, treated with 20;complexed antisense DNA; lanes 3 and 7~ treated with omplexed~r~andom~DNA~and lanes 4 and 8, treated with antisense~DNA~a~lone.~ Expected positions for relaxed circular ~RC)~and single stranded (SS) forms are dicate~d on the~right.
25~ Figure 3~1anes~1 and 5 show that untreated cells produced bands~at positions expected for relaxed ci~rcular and~single-stranded linear viral replicative DNA forms.~Othe~r~ minor bands are present, at 2.3 kb for example,~as described previously for this cell 30 line (Sell~s, M.~A. et al. ~19B7) Proc. Natl. A~ad, Scî.
USA 84:1005-100gj. Lanes 2 and 6 show that treatment of cells with~ complexed antisense DNA decreased the amount of all viral DNA forms in the medium by ~:: :

211~1~7 approximately 80% compared to untreated cells (lanes 1 and 5). Complexed random DNA, lanes 3 and 7, had no detectable effect on the levels of HBV DNA under identical conditions. Antisense DNA alone, lanes 4 05 and 8, decreased HBV DNA by approximately 30% relative to untreated controls. The number of viable cells as determined by trypan blue exclusion was not affected by treatment with any form of DNA (data not shown).
It has been shown previously that many cell-types 10 are capable of taking up free oligonucleotides tLoke, S.~ aI. ~1989) Proc. Natl. Acad. Sci. USA
86:3474-3478). ~ Loke et al. showed that the rates of uptake were inver~sely proportional to the size of the oligonucleotide (Loke, S.L. et al. (1989) Proc. ~atl. -~
15 Acad. Sci~. USA 86:3474-3478). However, in general, the~longer the~DNA sequence, the greater the specificity for~target~mRN~ molecules. These conflicting properties illustrate two common problems ~ , ., ; with the cur~rent~use of antisense oligonucleotides:
20~ inefficient uptake and lack of cell specificity. In order to improve uptakP of antisense oIigonucleotides, emaitre et al.~covalently coupled an oligonucleotide to polylysine (Lemaitre, M. et al. (1987) Proc. Natl.
;Acad.~ Sci.~USA~84:648-652)~and obtained antî-viral z5 ~effects at~severa~l-fold lower concentrations than could be obtaine~d~with free DNA~. However, the delivery wa~s not `cell-specific. Our uptake data indicate that not;~only can transport of oligonucleo-tides into cells be greatly enhanced, but the uptake 30 can also be directed to specific cells mediated by an ~-asialoglycoprotein-based DNA-carrier system.

~ , :

~.
~ .
: ~., W093/04701 P~T/VS92/07339 ~1 ~ 61 ~ 7 -22-Because of the specificity of DNA hybridization with mRNA to form hybrids implicated in antisense-mediated inhibition of translation, antisense oligonucleotides have been used successfully 05 to study normal gene expression in vitro (Bevilaqua, A. ~ al. (1988) Proc. Natl. Acad. Sci. USA
85:831-835~. For similar reasons, antisense oligonucleotides have also been examined previously for anti-viral effects ~(Goodchild, J. et al. (1988) 10 Procg Natl,_A~ad. Sci. U5A 85:5507-S511 and Agrawal, S. et ~1~ (1989)~ Prpc~ Natl. Acad. Sci. USA
~6:7790-7794~. For example, Agrawal et al.
administered infec~ious virus (HIV) together with antisense oligonucleotides in a non-targeted manner to 15 cell media (Agrawal, S. et al. (1989) PrQc. Natl~
ç~d. S~i. USA 6:7790-7794). Specific înhibition of viral replication was demonstrated. Similarly, Lem~itre et ~ studied a model of acute viral infection in which antisense was pre-administered to 20 cells (Lemaitre, M. et al. ~1987) Proc. Na~l. Aca~
ç~ USA 84:648-652) wit~ substantial specific antiviral effects. Our experiments differ from these previous studies in that our cells had a pre-e~i~sting, stable viral infection with viral production 25 maintained by~an;in~egrated viral genome. Our data indicate that~a~l~though a stable infection e~i~ted, d~livery of an~tisense oligonucleotides can ramatically inhibit viral gene expression in a specific manner. However, in vivo, persistent 30 production o~ hepatitis B virus is usually due to the presence of unintegrated viral DNA (Shafritz, D. et al. (1981~ N. Enq. J. Med. 305:1067-1073).
Integration of the viral genome into that of the host 2~ 7 is usually associated with a cessation of production of complete viral particles (Ganem, D. (1982) Rev.
Infect. Dis. 4:1026). Whether targeted antisense delivery can be effective in the presence of an 05 infection generated by unintegrated viral DNA remains to be seen. However, asialoglycoprotein uptake in - hepatitis virus-infected HepG2 cells was found to be not substantially different from non-infected HepG2 -cells (data not~shown), indicating that infection by 10 the virus did not alter the receptor acti~ity in these celIs. This suggests that targeted deliYery of ; antisense oli~gonucleotides may be generally applicable to naturally infected hepatocytes, that are otherwise normal, via asialoglycoprotein receptors.
It should be noted that the oligonucleotides used in this current~ work were linked together by phosphorothioate bonds~. These linkages are less susceptible to;nuclease degradation than normal phosphodiester bonds. However, an antisense 20~ o~ligonucleot~ide~synthesized with phosphodiester linkages was also effective. In addition, a variety of other synthetic strategies ha~e been developed to ;-confer nuclease~resistance to antisense oligonucleo~
tides (Mil~er, P.~S. et al. S1985~ Nucleosides - Nucleotides 6:769-776~). Forms that retain polyanionic character may~a~lso be deliverable by a receptor-mediated carrier~ system to provide enhanced and prolsnged effica~cy in a targeted manner.

.

~: : :

~ : : :

W093/04701 2 1 1 ~ 7 PCT/US92/07339 Uptake of AsOR-Pol~ L-lysine-oliqoDNA CQmplexes in Vivo To determine whether the AsOR-poly-L-lysine-oligoDNA complexes retained their ability to be recosnized by hepatocyte asialoglycoprotein receptors 05 in vivo, rats 200-250 9, were injected intravenously via a tail vein with AsOR-poly-L-lysine-[32P~-oligoDNA
; - alone or together with a 1000-fold molar e~cess of asialoorosomucoid in 0.15 M sterile saline. After 10 min, animals were kl~lled and samples of blood, liver, 10 spleen, lung and kidney were obtained. Tissue samples were weighed,~homogenized~, mixed with aqueous counting ~:
scintillant and counted for 32p radioactivity on a beta-counter. The uptake of radioactivity by each organ was expressed as the mean of the percent of the 15 total injected counts. These data indicate that complexed single-stra~nded (antisense) oligoDNA
sequences can be targeted specifically to the liver by simple intravenous~injection.

Organ Distribution of 32P-(oligonucleotide) DNA
~as;~an AsOR-PL Complex ; %;~iniect~ed --Blood ~ 6.0 Heart 2.1 Lung ~ 4.5 25`Kidney~ ~ 2.7 Spleen 3.7 -Liver 81 ::: : :
:~ ' : ~ :

::: :
::

WO93/04701 P~T/US92/07339 2 11 ~
Competition with 1000-fold Molar Excess Cold AsOR

% iniected -Blood 74.1 Heart 1.5 :
05 Lung 3.2 :~
Kidney 4.1 ;:
Spleen 3 Liver 14.1 : .

Example 2 ~:

:~: 10 M~TERIA~S A~D METHODS

~ .
ASSAYS F~R_D~TERMINING THE EFFECT OF AsOR-PL-~l(I~
PRO~OL~AGEN A~TISENSE DNA ON PROCOLLAGEN BIOSYNTHESIS ~:

~ell Culture and Treatment . ~:
A mouse fibroblast cell line (3T3-AsGR) producing 15~ collagen and stably transfected with the asialoglycoprotein (AsG) receptor genes kina~y : provided by~Dr.:Michael Shia (Massachusetts Institute : of Technology,~Cambridge, MA) was grown in DMEM and 10% FBS. Confluent 35mm dishes of 3T3-AsGR were 20 treated with al(I) antisense DNA alone ~1.3 ~M or 2.7 ~M) or varying concentrations of antisense DNA compleg (1.3 ~M, 1.7 ~M, or 2.7 ~M antisense) for 12-16 hours (overnight) at 37~C in DMEM and 10~ FBS. The medium was removed and replaced with labeling medium 25 containing 5 ~Ci/ml of [3H~-proline, 50 ~g/ml : L-ascorbate and varying concentrations of antisense : DNA or complexes. Cells were incubated for WOg3/~4701 PCT/US92/07339 21i61~7 -26-4 hours at 37C in the labeling medium. Newly -~
synthesized procollagens and other proteins were determined by bacterial collagenase digestion (Peterkofsky, B. and Diegelmann, Biochemistry : 05 10:988-9g~ (1971)).

: Collaaenase Diqestion : The labeling medium was removed and set aside.
.
Buffer containing;protease inhibitors (.5 M-Tris, pH
7.4, .4 mM:NEM, .2 mM PMSF, 2.5 mM EDTA) was added to ;~
` lO the cell layer and~the cell layer was removed and .
pooled with ~he supernatant. The entire mixture was ~ homogénized:us~i:ng a Dounce homogenizer and ice cold : TCA was added:to a final concentration of 15%. TCA
precipitable~proteins:were digested with bacterial :15 collagenase (Form III, Advanced Biofactures, Lynbrook, ; ; NY):at~37C for~2 hours followed by precipitation with TCA-tannic~acid.~; The~collagenase-sensiti~e radioactivity in~the~supe~rnatant was separated by centrifugation:to measure newly synthesized :~
; 20~procollagen~p~r~oduction. The collagenase-resistant : precipitated rad:ioactivity was used to calculate non-collagenous~protein:production. All assays were normalized to~ equ:al numbers of cells~

Pre~aration_of_~araetable Antisense DNA
25~ A ~argetable, soluble DNA carrier was prepared by coupling asialoorosomucoid to poly L-lysine ~Sigma) (Mr ~ 41,000):using 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide) (Pierce) as described previously (Wu, G.Y. and Wu, C.H. (1987) J. Biol.
30 Sh~m~ 262:4429-4432) except that the conjugate was purified by cation exchange chromatography using a : : ~

. .
.

WO9~4701 PCT/US92/07339 -27~ 7 '~

high pressure liquid chromatographic system (Rainin) employing an Aquapore C-300 column ~Rainin) and stepwise elution with 0.1 M sodium acetate, pH 5.0, 2.5, 2.25 and 2Ø The second peak eluted from the 05 column, as detected by U.V. absorption at 230 nm, was determined to be the optimal conjugate form and was - used for all subsequent experiments. A 24-mer oligodeoxynucleotide, complementary to the 5'-region of the pro al procollagen mRNA (See SEQUENCE ID NO. 2 10 - CCGGAGGTCCA~AAAGCTGAACAT) was synthesized with , ~ .
phosphodiester linkages on an automated nucleotide synthesizer ~Applied~;Biosystems) tMatsukura, M. et al. ~`
~; ` (1987) Pr~c. Natl. Acad. Sci. USA 84:7705-7710).
Specifically, this sequence is antisense to the first 15 24 nucleotides of pro ~1 procollagen beginning at the al(I) translation start site and including a portion of the first-intron. The purity of oligonucleotides was de~termined~by~electrophoresis throu~h 15%
polyacrylamide~ ~els stained with ethidium bromide.
20~Anti~sense DNA~was;titrated with conjugate to for~ a s~luble complex~using an agarose gel retardation system~as described previously (Wu, G.Y. and Wu, C.H.
19~87)~ J. Biol.~Chem~ 262:4429-4432~ and a con~ugate to~DNA ratio of 2:1 by weight ;25~(asialoorosomucoid-polylysine (AsOR-PL): DNA) was selected. ~

, ~ , AssaY for RecePtor-Mediated Uptake of Complexed Antisense DNA~
In order to characterize the uptake capacity of the asialoglycoprotein receptors on the 3T3-AsGR
cells, confluent 35mm dishes of 3T3-AsGR cells in DMEM
and 10% FBS wer;e~stripped with phosphate buffered :

: : ~

. .
~:

WO93/04701 ~ ll. 6 ~ 0 7 -28- PCT/US92/07339 saline (PBS~-10 mM EDTA, pH 5.O and incubated with 2 ~g/ml [125I]-AsOR with specific activity of 1 ~ 10~
cpm/~g. Uptake was determined as described previously for asialoglycoproteins ~Schwartz, A.L. et al. (1981) 05 J. Biol. Chem. 256:8878-8881). In brief, cells were incubated with t125I]-AsOR at 37C and at regular time intervals ~0.5, 1, 2, or 4 hours), dishes were chilled ~~
to 4C, washed three times with cold 10 mM ~.
EDTA-phosphate buffered saline and the cell layers 10 solubilized with 0.1 NaOH and gamma counted. This :~ ~ proces~s~ was repeated by incu~ating the 3T3-AsGR cells with~32P]-DNA-AsOR-PL ~1.3 ~M antisense) or 1.3 ~M
~: ~ DNA-~125I3~-AsOR-PL :(specific activity = 0.5 x 106 cpm/
~g) to determine the rate of uptake of antisense 15 complex e~cept that cell layers incubated with 32P-labeled~comp~lex were scintillation counted.
Pa~rallel dishes were incubated with the radiolabeled ligand together: with a 300-fsld weight e~cess of cold ~.
AsOR tQ determine non-specific uptake. To ascertain ;: 20 counts bound~;to~the cell surface, identical sets of cells:were~inc~bated at 4~C with ligands and, after was;hing as desc~ribed above, the cell layers were remov~ed::and adherent radioactivity was determined by scintillation::counting. :Uptake was calculated as the 25~-difference:between total cell-associated counts at 3~7C and counts~bound to the cells àt 4C for each t~ime point.~

:
:~ RNA Extrac.tion:and RNA Dot Blots -~ - : ConfIuent ~10 cm dishes of 3T3-AsGR ~ells in DMEM
~: 30~and 10% FBS~were~incubated overnight at 37C with one or a combination.of the following: (1) al(I) antisense : oligonucleotide ~1.3 ~M or 2.7 ~M) (2) similar :: :
: ~; : ~ :

: ~ : , :

21~61~7 concentrations of antisense complexed with AsOR-PL.
Total cellular mRNA was extracted by the guanidinium thiocyanate method. (Chomczynski, P. and Sacchi, N., Anal. Biochem. 162: 156-159 (1987)). Quantity and 05 quality of the e~tracted RNA were determined by A260/A28o absorbance and ethidium bromide stained formaldehyde gels.
Dot blot studies starting with 20 ~g of total RNA
were serially diluted 2-fold in 20x ~S~ pH 7Ø
10 Samples were heat-denatured in 5Q% formamide, 7%
~ ~ formaldehyde, and lx SSC pH 7.0 ~Sambrook, J., et al.
;~ Molecular Clonina 7.54, 19~9). Samples were applied to nit-rocellulose filters using slot blot apparatus, cross-linked to the~filter by ultraviolet e2posure, 15 and prehybridized for 3 hours at 42C. The cDNA
probes, labeled~with 32p using a random priming m~thod (Sambrook, J., et al. Molecular Cloninq 13.44, tl989)) were rat proal(I) and ~-actin, both linearized with EcoRI, and~a~9OObp piece of rat proa2(I) The 20 nitrocellulose~filtèrs were hybridized with the probes 0.5-1.0 ~ 107 cpm/filter) overnight at 42C, washed, ana e~posed to~film. Quantitation was done ~y scintillation counting of the filters.

N~rthern~lots~~ ;
25~ ~ Total RNA samples ~60 ~g) were heat denatured in 5~ formamide, 2x formaldehyde running buffer, 7%
ormaldehyde at 55C for 15 minutes (Sambrook, J., et al. Molecular Clonina 7.43, (1989)). Samples were run on formaldehyde gels; (1% agarose, 2.2 M formaldehyde) 30 for 4 hours at 100 mvolts on ice. Molecular weight :
' ~ 7 -30-and control RNAs were stained in O.l ammonium acetate and 0.5 ~g/ml ethidium bromide and photographed with a ~
fluorescent ruler. The remaining gel was washed . ~:
; several times with water, the RNA hydrolyzed with 0.5 05 N NaOH for 20 minutes~ and soaked in 20x SSC for 45 minutes. The RNA was transferred onto a -nitrocellulose filter under vacuum for one hour and cross-linked to the filter by exposure to ultraviolet irradiation using a Stratalinker. Conditions for lO prehybridization and hybridization were the same as in the slot blot studies.

RESULTS ~ ~ ~

Characterization of 3T3-AsGR cells Since~the~3T3-AsGR cells do not normally possess 15 asialoglycoprotein~receptors, they were transfected with~the asia109lycoprotein receptor genes and were found~to havé a Kd of 1.5 x lO-9 M, a binding saturation~with~l25I]-AsOR at l.8 ~g/ml, and an uptake~rate of ~125I~-AsOR of l.~ pmolefmillion 2~ cells/hr~. The~number of asialoglycoprotein receptors per cell was~250;,00~0.
The 3T3~-AsGR ce1ls displayed a linear uptake of al~ antisense~DNA-AsOR-PL complex up to 4 hours at a rate~of 18~.2 pmole of DNA/mil~lion cells/hr. In 2s~contrast, the~rate of uptake of labeled al(I) antisense DNA ~alone was 0.15 pmole DNA/million cells/hr. Uptake~of~AsOR in a 300x excess ~y weight competed with the uptake of al ( I) antisense DNA
complex~

:: ~

:`

': ~ ' .~

W O 93/04701 PC~r/US92/0733 21161G'`i' Effect of al(I) antisense DNA complex on collaaen sYnthe s i s al(I) antisense DNA complexes inhibited collagen production by 3T3-AsGR cells. This inhibition was 05 specific for collagen production and was dependent on the concentration of al(I) antisense DNA in the : complex. This result is set forth in the following table.

: ~ ~M collagen noncollagen collagen :~ 10 al(I) proteins proteins production cpm/mi:llion cells (% control~

0 4,330 45,00~ 100 :1.3 3,190 44,500 74 1.7 2,77~ 45,660 64 : lS 2.7: 2,210 40,500 56 :: :

Ef~ect of al~I? antisense DNA com~lex on procolla~en I
mRNA:leveIs ; : : al(I~ antisense DNA complex specifically inhibited mRNA of the al(I) chain. But at a higher :; 20~conCentratiQn (~ 7~M):o antisense D~A comple~, mRNA
of~b~th the al:(I)~ and~a2(I) chain was inhibited. The :; following table;is à~ r~e:sult of the quantitation of ; several dot blot analyses.

: ~M pal(I) ! pa2(I) ~-actin (% control) : 1.3 71 100 102 2.7 65 85 106 :~

2 ~ 32-Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific 05 pFocedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the following claims.

.

.
: : ;

.

~: ~
:

r W ~ 93~4701 PCT/US9~/07339 2 ~ 0 ~

SEQUENCE LISTI~G

~1) GENERAL INFORMATION: ~.
~i) APPLICA~T: Wu, George Y.
Wu, Catherine H.
05 (ii) TITLE OF INVENTION: Targeted Delivery of Poly- or Oligonucleotides to Cells (iii~ NUMBER OF SEQUENCES: 2 (iv) CORRESPON~E~CE ADDRF5S:
(A) ADDR~SSEE: Lahive & Cockfield ; (B) STREET: 60 State Street (C) CITY: 80sto~
(D) STATEs Massachusetts :~ 15 (E) COU~rBY: U.S.A.
~F~ ZIP: 02lOg (v) COMæUTER:READABLE FO~M~
(A) MæDIUM TYPE: Floppy disk :
(B) COMPUTER: IBM PC compatible (C) OPE~ATI~G SYSTEM: PC-DOS~MS-DOS
: ~D) SOFTWARE: ASCII
(vi) CURRENT APPLICATION D~TA:
: (A) APPLI~ATIO~ NUMBER:
: (B) FILING DATE: ~-~C3 CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 07/864,003 (8) FILI~ DATE: 03-APR-1992 (C) APPLICATION:NUMBER: US 07/788,119 (D) FILI~G D~TE: 04-NOV-l99l (E) APPLICATION NUMBER: US 07/755,083 (F) FILI~G DATE: 05-SEP-l991 WO 93/047~111 PCI`/~S92/07339 r~

~2) I~FORMATION FO~ SEQ ID NO~
~i) SEQUE~CE CHARACTERISTICS:
(A) LENGTH: 21 nucleotides (B) TYPE: nucleic acid 05 ~C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii~ MOLECULE TYPE: DNA
(iv) A~TISE~SE: yes ~ix~ FEATURE: Complement to hepatitis B
~irus polyaden~lation site (~i) SEQUENCE DESCRIPTION: SEQ ID NO:1:

TTT~TAAGG~ TCGATGTCCA T 21 : 2)~ OEM~TIO~ FOB S~Q ID ~0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTHs 24 ~ucleotides (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: li~ear ii) MOL~CULE TYPE: DNA
(iv) ANTISE~SE:~yes (i~) FEATURE: Complement to first 24 nucleotides of pro al ; procollagen beginning a~ the altI3 ~ranslation ,.
start site and including a portion of the first intron.
(~i) SEQUE~CE DESRIPTION: SEQ ID NO:2~

~.

':

Claims (38)

Claims

1. A soluble molecular complex for targeting a poly- or oligonucleotide to a specific cell for hybridization to an RNA therein, the complex comprising a single-stranded poly- or oligonucleotide which hybridizes to the RNA
complexed with a carrier comprised of a cell-specific binding agent and a poly- or oligonucleotide-binding agent.

2. A soluble molecular complex of claim 1, wherein the oligonucleotide is an antisense oligodeoxy-nucleotide.

3. A soluble molecular complex of claim 2, wherein the antisense oligodeoxynucleotide hybridizes to cellular or viral RNA or DNA.

4. A soluble molecular complex of claim 3, wherein the antisense oligodeoxynucleotide hybridizes to a hepatitis viral RNA.

5. A soluble molecular complex of claim 4, wherein the antisense oligodeoxynucleotide hybridizes to the hepatitis RNA polyadenylation site.

6. A soluble molecular complex of claim 2, wherein the antisense oligodeoxynucleotide hybridizes to oncogene RNA.

7. A soluble molecular complex of claim 1, wherein the oligonucleotide is a ribozyme.

8. A soluble molecular complex of claim 1, wherein the oligonucleotide-binding agent is a polycation.

9. A soluble molecular complex of claim 8, wherein the polycation is polylysine.

10. A soluble molecular complex of claim 1, wherein the cell-specific binding agent binds a surface receptor of the cell which mediates endocytosis of the complex by the cell.

11. A soluble molecular complex of claim 10, wherein the cell-specific binding agent is a ligand for an asialoglycoprotein receptor and the targeted cell is an hepatocyte.

12. A soluble molecular complex of claim 11, wherein the ligand is an asialoglycoprotein.

13. A pharmaceutical composition, comprising a solution of the molecular complex of claim 1 and physiologically acceptable vehicle.

14. A soluble molecular complex for targeting an antisense oligodeoxynucleotide to an hepatocyte, the complex comprising the antisense oligodeoxy-nucleotide complexed with a carrier comprised of a ligand for the asialoglycoprotein receptor and an oligodeoxynucleotide-binding polycation.

15. A soluble molecular complex of claim 14, wherein the antisense oligodeoxynucleotide hybridizes to a viral RNA transcript.

16. A soluble molecular complex of claim 15, wherein the antisense oligodeoxynucleotide hybridizes to a hepatitis RNA transcript.

17. A soluble molecular complex of claim 16, wherein the antisense oligodeoxynucleotide hybridizes to a hepatitis virus RNA polyadenylation site.

18. A soluble molecular complex of claim 14, wherein the polycation is polylysine.

19. A soluble molecular complex, the complex comprising an antisense oligodeoxynucleotide complimentary to hepatitis RNA polyadenylation site complexed with a carrier comprised of a ligand or the asialoglycoprotein receptor and an oligonucleotide-binding polycation.

20. A soluble molecular complex of claim 19, wherein the polycation is polylysine.

21. A method of delivering an oligonucleotide to a specific cell of an organism to block expression of a gene or genes in the cell, comprising administering to the organism a soluble molecular complex comprising a single-stranded oligonucleotide which hybridizes to an RNA
transcript of the gene or genes, complexed with a carrier comprised of a cell-specific binding agent and an oligonucleotide-binding agent.

22. A method of claim 21, wherein the oligo-nucleotide is an antisense oligodeoxynucleotide.

23. A method of claim 22, wherein the oligodeoxy-nucleotide hybridizes to a viral RNA transcript.

24. A method of claim 23, wherein the oligodeoxy-nucleotide hybridizes to a hepatitis viral RNA
transcript.

25. A method of claim 24, wherein the oligodeoxy-nucleotide hybridizes to a hepatitis viral RNA
polyadenylation site.

26. A method of claim 21, wherein the oligo-nucleotide is a ribozyme which catalyzes the cleavage of the transcript.

27. A method of claim 21, wherein the oligonucleo-tide-binding agent is a polycation.

28. A method of claim 27, wherein the polycation is polylysine.

29. A method of claim 22, wherein the cell-specific binding agent binds a surface receptor of the cell which mediates endocytosis of the complex.

30. A method of claim 29, wherein the cell-specific binding agent is a ligand for an asialoglyco-protein xsceptor and the targeted cell is an hepatocyte.

31. A method of claim 30, wherein the ligand is an asialoglycoprotein.

32. A method of claim 21, wherein the molecular complex is administered intravenously.

33. A method of inhibiting replication of hepatitis virus in infected hepatocytes, comprising injecting a pharmaceutically acceptable solution of an effective amount of a molecular complex comprising an antisense oligodeoxynucleotide which hybridizes to an RNA transcript of a hepatitis DNA sequence necessary for viral replication, complexed with a carrier comprised of a ligand for the asialoglycoprotein receptor and an oligodeoxynucleotide-binding polycation.

34. A method of claim 33, wherein the oligodeoxy-nucleotide is complementary to a hepatitis viral RNA polyadenylation site.

35. A method of claim 33, wherein the polycation is polylysine.

36. A method of claim 33, wherein the molecular complex is administered intravenously.

37. An antisense oligonucleotide which hybridizes to the polyadenylation site of hepatitis virus.

38. An antisense oligodeoxynucleotide having the nucleotide sequence given as SEQUENCE ID NO. 1.