CA2059242C - Coleopteran-active bacillus thuringiensis isolate and a novel gene encoding a coleopteran-active toxin - Google Patents

Abstract

The subject invention concerns a novel microbe and gene encoding a novel toxin protein with activity against insect pests of the order Coleoptera. Pests in the order Coleoptera do heavy damage to crops, e.g., corn. The novel Bacillus thuringiensis microbe of the invention is referred to as B-t. PS50C. The spores or crystals of this microbe, or mutants thereof, are useful to control coleopteran pests in various environments. The novel gene of the invention can be used to transform various hosts wherein the novel toxic protein can be expressed.

Description

1 ~~'~~~~''~' MA53.C1 DESCRIPTION
NOVEL COLEOPTERAN-ACTIVE BACILLUS T~IURINGIENSIS ISOLATE
AND A NOVEL GENE ENCODING A COLEOPTERAN-ACTIVE T'OHI~T
10 Background of the Invention Bacillus thuringiensis (B-t.) produces an insect toxin designated as ~
endotoxin. It is synthesized by the B-t. sporulating cell. The toxin, upon being ingested in its crystalline form by susceptible insect larvae, is transformed into biologically active moieties by the insect gut juice proteases. The primary target is insect cells of the gut epithelium, which are rapidly destroyed:
The reported activity spectrum of Ba. covers insect species within the order Lepidoptera, many of which are major pests in agriculture and forestry.
The activity spectrum also includes the insect order Diptera, which includes mosquitos and black flies. See Couch, T.L. (1980) "Mosquito Pathogenicity of Bacillus thuringiensis var. israelensis;' Developments in Industrial Microbiology 22:61-76;
Beegle, C.C., (1978) "Use of Entomogenous Bacteria in Agroecosystems,"
Developments in Industrial Microbiology 20:97-104. Krieg, et al., Z. ang. Ent.
(1983) 96:500-508, describe a B~t. isolate named Bacillus thurin '~ensis var.
tenebrionis, which is reportedly active against two beetles in the order Coleoptera.
These are the Colorado potato beetle, Leptinotarsa decemlineata, and elastics alni.
In European Patent Application 0 202 739 there is disclosed a novel B~t.
isolate active against Coleoptera. It is known as B. thurin~iensis var. son die~o (B.t.sd.). U.S. Patent No. 4,966,765 discloses the coleopteran-active Bacillus thurin~iensis isolate B~t. PS86B1. European Patent Application 0 337 604 also discloses a novel B~t. isolate active against C.oleoptera. This isolate is B-t. PS43F.

v4 P.~H W~/

2 MA53.C1 Coleopteran-active strains, such as B.t.sd.. B-t. PS86B1, and B~t. PS43F, can be used to control foliar-feeding beetles. The Colorado potato beetle (Lentinotarsa decemlineata), for example, is susceptible to the delta-endotoxin of B.t.sd. and larvae are killed upon ingesting a sufficient dose of spore/crystal preparation on treated foliage.
A number of crops are attacked by flea beetles. These beetles belong to the family Chrysomelidae, the deeemlineata. The adults can cause extensive damage by feeding on the foliage.
Brief Summary of the Invention The subject invention concerns a novel Bacillus thurin '~nsis (B-t.) isolate and a cloned gene therefrom which encodes a novel coleopteran-active protein.
The novel B-t. isolate, known herein as Bacillus thuring;iensis PS50C (B~t.
PS50C), has thus far been shown to be active against the Colorado potato beetle (Leptinotarsa decemlineata). The novel d-endotoxin gene of the invention encodes an =130 kDa protein. The nucleotide sequence of the gene (open reading frame only) is shown in Sequence ID No. 1. The predicted peptide sequence of the toxin is shown in Sequence )D No. 2.
The subject invention also includes mutants of B-t. PS50C which have substantially the same pesticidal properties as B-t. PS50C. Procedures for malting mutants are well )mown in the microbiological art. Ultraviolet light and nitrosoguanidine are used extensively toward this end.
Further, the invention also includes the treatment of substantially intact B-t. PS50C cells, and recombinant cells containing the gene of the invention, to prolong the pesticidal activity when the substantially intact cells are applied to the environment of a target pest. Such treatment can be by chemical or physical means, or a combination of chemical or physical means, so long as the technique does not deleteriously affect the properties of the pesticide, nor diminish the cellular capability in protecting the pesticide. The treated cell acts as a protective coating for the pesticidal toxin. The toxin becomes available to act as such upon ingestion by a target insect.

~3.C1 Brief Description of the Sequences Sequence ID No. l is the nucleotide sequence (open reading frame only) of the novel gene of the invention.
Sequence ID No. Z is the predicted peptide sequence of the toxin.
Brief Description of the Drawings Figure 1 - Photograph of a Standard SDS Polyacrylamide Gel of B~t.
PS50C, B.t.sd.. and B~t. PS86B1.
Figure 2 - Restriction map of pMYC1638.
Deta~ed Disclosure of the Invention The novel Bacillus thu '~~ iensis isolate of the subject invention has the following characteristics in its biologically pure form:
Characteristics of t~3.t. PS50C
Colony morphology--Large colony, dull surface, typical B~t.
Vegetative cell morphology--typical B-t. .
Culture methods--typical for B-t.
Flagellar serotyping--PS50C belongs to serotype 18, kumamotoensis.
Crystal morphology--a sphere.
RFLP analysis--Southern hybridization of total DNA distinguishes B~t.
PSSOC from B.t.sd. and other B.t. isolates.
Alkali-soluble proteins-SDS polyacrylamide gel electrophoresis (SDS-PAGE) shows a 130 kDa doublet protein.
A comparison of the characteristics of B. thurin~iensis PS50C (B-tt.
PS50C) to the characteristics of the known B_t. strains B. thuringiensis var.
san die~o (B.t.sd.), B. thurin 'ensis PS86B1 (NRRL B-18299), and B. thuringiensis var.
kurstaki (HD-1) is shown in Table 1.

Table 1. Comparison of B-t. PSSOC, B-t. PS86B1, B.t.sd., and B-t. HD-1 B-t. PSSOC B.t.sd. B_t. PS86B1 B-t. HD-1 Serovar kumamotoensis morrisoni tolworthi kurstaki Type of inclusionsphere square flat, pointedBipyramid wafer ellipse, plus sm. inclusions Size of alkali-130 kDa 72,000 75,000 130,000 soluble proteinsdoublet 64,000 68,000 68,000 by SDS-PAGE 61,000 Host range Coleoptera Coleoptera Coleoptera Lepidoptera The cultures disclosed in this application have been deposited in the Agricultural Research Service Patent Culture Collection (NRRL), Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, USA.
S
Culture Repository No. Deposit date Bacillus thurin '~ensis NRRL B-18746 January 9, 1991 PSSOC
Escherichia coli NM522 NRRL B-18751 January 11, 1991 [pMYC1638J
The subject cultures have been deposited under conditions that assure that access to the cultures will be available during the pendency of this patent application to one determined by the Commissioner of Patents to be entitled thereto. The deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.

MA53.C1 Further, the subject culture deposits will be stored and made available to the public in accord with the provisions of the Budapest 'Treaty for the Deposit of Microorganisms, i.e., they will be stored with all the care necessary to keep them viable and uncontaminated for a period of at least five years after the mast S recent request for the furnishing of a sample of a deposit, and in any case, for a period of at least thirty (30) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the cultures. The depositor acknowledges the duty to replace the deposits should the depository be unable to furnish a sample when requested, due to the condition of the deposits. All restrictions on the availability to the public of the subject culture deposits will be irrevocably removed upon the granting of a patent disclosing them.
B-t. PSSOC, NRRL B-18746, can be cultured using standard art media and fermentation techniques. Upon completion of the fermentation cycle, the bacteria can be harvested by first separating the B-,t. spores and crystals from the IS fermentation broth by means well known in the art. The recovered B-t.
spares and crystals can be formulated into a wettable powder, liquid concentrate, granules, or other formulations by the addition of surfactants, dispersants, inert carriers and other components to facilitate handling and application for particular target pests.
These formulation and application procedures are all well known in the art.
Plasmid DNA (pMYC1638) containing the toxin gene from B-t. PS50C
can be purified from E. coli NM522(pMYC1638] by standard procedures well known in the art. The toxin gene can be excised from the plasmid DNA by restriction enzyme digestion, as indicated in Figure 2.
Formulated products can be sprayed or applied onto foliage to control phytophagous beetles or caterpillars.
Another approach that can be taken is to incorporate the spores and crystals of BB~t. PSSOC into bait granules containing an attractant and applying these granules to the soil for control of soil-inhabiting Coleoptera.
Formulated B-t. PSSOC can also be applied as a seed-coating ar root treatment or total plant treatment.

6 MA53.C1 The B-t. PSSOC cells can be treated prior to formulation to prolong the pesticidal activity when the cells are applied to the environment of a target pest.
Such treatment can be by chemical or physical means, or by a combination of chemical and/or physical means, so long as the technique does not deleteriously S affect the properties of the pesticide, :nor diminish the cellular capability in protecting the pesticide. Examples of chemical reagents are halogenating agents, particularly halogens of atomic no. 17-80. More particularly, iodine can be used under mild conditions and for sufficient time to achieve the desired results.
Other suitable techniques include treatment with aldehydes, such as formaldehyde and glutaraldehyde; anti-infectives, such as zephiran chloride; alcohols, such as isopropyl and ethanol; various histologic fixatives, such as Bouin's fixative and Helly's fixative (See: Humason, Gretchen. L., Animal Tissue Techniques, W.FI.
Freeman and Company, 1967); or a combination of physical (heat) and chemical agents that prolong the activity of the toxin produced in the cell when the cell is applied to the environment of the target pest(s). Examples of physical means are short wavelength radiation such as gamma-radiation and X-radiation, freezing, UV
irradiation, lyophilization, and the like.
The novel toxin gene of the subject invention was obtained from a navel coleopteran-active B. thurin 'ensis (B-t.) isolate designated B-t. PSSOC. The gene was isolated as disclosed in the Examples.
The toxin gene of the subject invention can be introduced into a wide variety of microbial hosts. Expression of the toxin gene results, directly or indirectly, in the intracellular production and maintenance of the pesticide.
With suitable hosts, e.g., Pseudomonas, the microbes can be applied to the situs of coleopteran insects where they will proliferate and be ingested by the insects. The result is a control of the unwanted insects. Alternatively, the microbe hosting the toxin gene can be treated under conditions that prolong the activity of the toxin produced in the cell. The treated cell then can be applied to the environment of target pest(s). The resulting product retains the toxicity of the B-t. toxin.

r s~
7 MA53.C1 Where the B-t, toxin gene is introduced via a suitable vector into a microbial host, and said host is applied to the environment in a living state, it is essential that certain host microbes be used. Microorganism hosts are selected which are known to occupy the "phytosphere" (phylloplane, phyllosphere, rhizosphere, and/or rhizoplane) of one or more crops of interest. These microorganisms are selected so as to be capable of successfully competing in the particular environment (crop and other insect habitats) with the wild-type microorganisms, provide for stable maintenance and expression of the gene expressing the polypeptide pesticide, and, desirably, provide for improved protection of the pesticide from environmental degradation and inactivation.
A large number of microorganisms are known to inhabit the phylloplane (the surface of the plant leaves) and/or the rhizosphere (the soil surrounding plant roots) of a wide variety of important crops. These microorganisms include bacteria, algae, and fungi. Of particular interest are microorganisms, such as bacteria, e.g., genera Pseudomonas, Erwinia, Serratia, Klebsiella.
Xanthomonas, Streptom~, Rhizobium, lZhodopseudomonas. Methvlophilius, Agrobacterium, Acetobacter, Lactobacillus, Arthrobacter, Azotobacter. Leuconostoc, and Alcali es~nes; fungi, particularly yeast, e.g., genera Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomvces, Rhodotorula, and Aureobasidium. Of particular interest are such phytosphere bacterial species as Pseudomonas syrin age, Pseudomonas fluorescens, Serratia marcescens, Acetobacter linum A~robacterium tumefaciens. IZhodopseudomonas spheroides, Xanthomonas cam ep StTIS, Rhizobium melioti, Alcafi enes entrophus, and Azotobacter vinlandii;
and phytosphere yeast species such as Rhodotorula rubra, R, utinis R, marina, R. aurantiaca, Cryptococcus albidus, C. diffluens, C. laurentii, Saccharomyces rosei, S. pretoriensis, S. cerevisiae, Sporobolomvces roseus, S. odorus, HIuweromvces veronae, and Aureobasidium pollulans. Of particular interest are the pigmented microorganisms.
A wide variety of ways are available for introducing the B~t. gene expressing the toxin into the microorganism host under conditions which allow for ~~i~u'~~~c 8 MA53.C1 stable maintenance and expression of the gene. One can provide for DNA
constructs which include the transcriptional and translational regulatory signals for expression of the toxin gene, the toxin gene under their regulatory control and a DNA sequence homologous with a sequence in the host organism, whereby integration will occur, and/or a replication system which is functional in the host, whereby integration or stable maintenance will occur.
The transcriptional initiation signals will include a promoter and a transcriptional initiation start site. In same instances, it may be desirable to provide for regulative expression of the toxin, where expression of the toxin will only occur after release into the environment. This can be achieved with operators or a region binding to an activator or enhancers, which are capable of induction upon a change in the physical or chemical environment of the microorganisms. For example, a temperature sensitive regulatory region may be employed, where the organisms may be grown up in the laboratory without expression of a toxin, but upon release into the environment, expression would begin. Other techniques may employ a specific nutrient medium in the laboratory, which inhibits the expression of the toxin, where the nutrient medium in the environment would allow for expression of the toxin. Far translational initiation, a n'bosomal binding site and an initiation codon will be present.
Various manipulations may be employed for enhancing the expression of the messenger, particularly by using an active promoter, as well as by employing sequences, which enhance the stability of the messenger RNA. The initiation and translational termination region will involve stop codon(s), a terminator region, and optionally, a polyadenylation signal.
In the direction of transcription, namely in the 5' to 3' direction of the coding or sense sequence, the construct will involve the transcriptional regulatory region, if any, and the promoter, where the regulatory region may be either 5' or 3' of the promoter, the ribosomal binding site, the initiation codon, the structural gene having an open reading frame in phase with the initiation codon, the stop codon(s), the polyadenylation signal sequence, if any, and the terminator region.

~(?~~
9 MA53.C1 This sequence as a double strand may be used by itself far transformation of a microorganism host, but will usually be included with a DNA sequence involving a marker, where the second DNA sequence may be joined to the toxin expression construct during introduction of the DNA into the host.
S By a marker is intended a structural gene which provides for selection of those hosts which have been modified or transformed. The marker will normally provide for selective advantage, for example, providing far biocide resistance, e.g., resistance to antibiotics or heavy metals; complementation, so as to provide prototropy to an auxotro;phic host, or the like. Preferably, complementation is employed, so that the modified host may not only be selected, but may also be competitive in the field. Cne or more markers may be employed in the development of the constructs, as well as for modifying the host. The organisms may be further modified by providing for a competitive advantage against other wild-type microorganisms in the field. For example, genes expressing metal chelating agents, e.g., siderophores, may be introduced into the host along with the structural gene expressing the toxin. In this manner, the enhanced expression of a siderophore may provide for a competitive advantage for the toxin-producing host, so that it may effectively compete with the wild-type microorganisms and stably occupy a niche in the environment.
Where no functional replication system is present, the construct will also include a sequence of at least 50 basepairs (bp), preferably at least about 100 bp, and usually not more than about 1000 by of a sequence homologous with a sequence in the host. In this way, the probability of legitimate recombination is enhanced, so that the gene will be integrated into the host and stably maintained by the host. Desirably, the toxin gene will be in close proximity to the gene providing for complementation as well as the gene providing for the competitive advantage. Therefore, in the event that a toxin gene is lost, the resulting organism will be likely to also lose the complementing gene and/or the gene providing for the competitive advantage, so that it will be unable to compete in the environment with the gene retaining the intact construct.

~'~'~'[ ~v (,~J_ /V9 'r ~iJ l~~l~
MA53.C1 A large number of transcriptional regulatory regions are available from a wide variety of microorganism hosts, such as bacteria, bacteriophage, cyanobacteria, algae, fungi, and 'the like. Various transcriptional regulatory regions include the regions associated with the trp gene, lac gene, gal gene, the lambda left 5 and right promoters, the tac promoter, the naturally-occurring promoters associated with the toxin gene, where functional in the host. See for example, U.S.
Patent Nos. 4,332,898, 4,342,832 and 4,3:16,270. The termination region may be the termination region normally associated with the transcriptional initiation region or a different transcriptional initiation region, so long as the two regions are 10 compatible and functional in the host.
Where stable episomal maintenance or integration is desired, a plasmid will be employed which has a replication system which is functional in the host.
The replication system may 'be derived from the chromosome, an episomal element normally present in the host or a different host, or a replication system from a virus which is stable in the host. A large number of plasmids are available, such as pBR322, pACYC184, RSF1010, pR01614, and the like. See for example, Olson et al., (1982) J. Bacteriol. 150:6069, and Bagdasarian et al., (1982) Gene 16:237, and U.S. Patent Nos. 4,356,270, 4,362,817, and 4,371,625.
The B-t. gene can be introduced between the transcriptional and translational initiation region and the transcriptional and translational termination region, so as to be under the regulatory cantrol of the initiation region.
This construct will be included in a plasmid, which will include at least one replication system, but may include more than one, where one replication system is employed for cloning during the development of the plasmid and the second replication system is necessary for functioning in the ultimate host. In addition, one or more markers may be present, which have been described previously. Where integration is desired, the plasmid will desirably include a sequence homologous with the host genome.
The transformants can be isolated in accordance with conventional ways, usually employing a selection technique, which allows for selection of the desired ~~~...a~v~.° o~Cw 11 MA53.C1 organism as against unmodified organisms or transfernng organisms, when present.
The transformants then can be tested for pesticidal activity.
Suitable host cells, where the pesticide-containing cells will be treated to prolong the activity of the toxin in the cell when the then treated cell is applied S to the environment of target pest(s), may include either prokaryotes or eukaryotes, normally being limited to those cells which do not produce substances toxic to higher organisms, such as mammals. However, organisms which produce substances toxic to higher organisms could be used, where the toxin is unstable or the level of application sufficiently low a:> to avoid any possibility of toxicity to a mammalian host. As hosts, of particular interest will be the prokaryotes and the lower eukaryotes, such as fungi. Illustrative prokaryotes, both Gram-negative and -positive, include Enterobacteriaceae, such as Escherichia. Erwinia, Shigella, Salmonella, and Proteus; Bacillaceae; Rhizobiceae, such as Rhizobium:
Spirillaceae, such as photobacterium, Zymomonas, Serratia. Aeromonas. Vibrio, Desulfovibrio, Spirillum; L.actobacillaceae; Pseudomonadaceae, such as Pseudomonas and Acetobacter; Azotobacteraceae and Nitrobacteraceae. Among eukaryotes are fungi, such as Phycomycetes and Ascomycetes, which includes yeast, such as Saccharomvces and Schizosaccharomyces; and Basidiomycetes yeast, such as Rhodotorula, Aureobasidium, Sporobolomyces, and the like.
Characteristics of particular interest in selecting a host cell for purposes of production include ease of introducing the B-t, gene into the host, availability of expression systems, efficiency of expression, stability of the pesticide in the host, and the presence of auxiliary genetic capabilities. Characteristics of interest for use as a pesticide microcapsule include protective qualities for the pesticide, such as thick cell walls, pigmentation, and intracellular packaging or formation of inclusion bodies; leaf affinity; lack of mammalian toxicity; attractiveness to pests for ingestion; ease of killing and fixing without damage to the toxin; and the like.
Other considerations include ease of formulation and handling, economics, storage stability, and the like.

12 MA53.C1 PIost organisms of particular interest include yeast, such as Rhodotorula sp., Aureobasidium sp., Saccharornvces sp., and Sporobolornyces sp.;
phylloplane organisms such as Pseudomonas sp., Erwinia sp. and Flavobacterium sp.; or such other organisms as Escherichia, Lactobacillus sp., Bacillus sp., Streptomyces sp., and the like. Specific organisms include Pseudomonas ae~nosa, Pseudomonas fluorescens, Saccharom,~ces cerevisiae, Bacillus thurin 'ensis, Escherichia colic Bacillus subtilis, Strentomyces lividans, and the like.
The cell will usually be intact and be substantially in the proliferative form when treated, rather than in a spore form, although in some instances spores may be employed.
Treatment of the recombinant microbial cell can be done as disclosed infra. The treated cells generally will have enhanced structural stability which will enhance resistance to environmental conditions. ~llrhere the pesticide is in a proform, the method of inactivation should be selected so as not to inhibit processing of the proform to the mature form of the pesticide by the target pest pathogen. For example, formaldehyde will crosslink proteins and could inlu'bit processing of the proform of a polypeptide pesticide. The method of inactivation or killing retains at least a substantial portion of the bio-availability or bioactivity of the toxin.
The cellular host containing the B-t. insecticidal gene may be grown in any convenient nutrient medium, where the DNA construct provides a selective advantage, providing for a selective medium so that substantially all or all of the cells retain the B-t, gene. These cells may then be harvested in accordance with conventional ways. Alternatively, the cells can be treated prior to harvesting.
The B-t. cells may be formulated in a variety of ways. They may be employed as wettable powders, granules or dusts, by mixing with various inert materials, such as inorganic minerals (phyllasilicates, carbonates, sulfates, phosphates, and the like) or botanical materials (powdered corncobs, rice hulls, walnut shells, and the like). The formulations may include spreader-sticker adjuvants, stabilizing agents, other pesticidal additives, or surfactants.
Liquid 13 IVIA53.C1 formulations may be aqueous-based or non-aqueous and employed as foams, gels, suspensions, emulsifiable concentrates, or the like. The ingredients may include rheological agents, surfactants, emulsifiers, dispersants, or polymers.
The pesticidal concentration will vary widely depending upon the nature of the particular formulation, particularly whether it is a concentrate or to be used directly. The pesticide will be present in at least 1% by weight and may be 100%
by weight. The dry formulations will have from about 1-95% by weight of the pesticide while the liquid formulations will generally be from about 1-60% by weight of the solids in the liquid phase. The formulations will generally have from about 102 to about 104 cells/mg. These formulations will be administered at about 50 mg (liquid or dry) to 1 kg or more per hectare.
The formulations can be applied to the environment of the coleopteran pest(s), e.g., plants, soil or water, by spraying, dusting, sprinkling, or the like.
Following are examples which illustrate procedures, including the best mode, for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
Example 1 - Culturing B.t PS50C NRRL B-18746 A subculture of B-t. PS50C, NRRL B-18746 can be used to inoculate the following medium, a peptone, glucose, salts medium.
Bacto Peptone 7.5 g/( Glucose 1.0 gIl KHZP04 3.4 g/!
KZHPO4 4.35 g/I
Salt Solution 5.0 m1/1 CaCl2 Solution 5.0 ml/I
Salts Solution (100 ml) llrlgS0~.7H20 2.46 g fit; '~~:~~s~
14 MA53.C1 MnSO~.H20 0.04 g ZnS04.7Hz0 0.28 g FeS04.7H20 0.40 g CaCl2 Solution (100 ml) CaC12.2H20 3.66 g pH 7.2 The salts solution and CaCl2 solution are filter-sterilized and added to the autoclaved and cooked broth at the time of inoculation. ?Masks are incubated at 30 ° C on a rotary shaker at 200 rpm for 64 hr.
The above procedure can be readily scaled up to large fermentors by procedures well known in the art.
The B-t. spores and crystals, obtained in the above fermentation, can be isolated by procedures well known in the art. A frequently-used procedure is to subject the harvested fermentation broth to separation techniques, e.g., centrifugation.
Example 2 - Testing of B.t. PSSOC NRRL B-18746 Spores and C , sr~tals B-t. PS50C, NRRL B-18746 spores and crystals are toxic to the Colorado potato beetle (CPB). The assay for the Colorado potato beetle was conducted as follows:
CPB Biaassav - Early second instar larvae of Lentinotarsa decemlineata are placed on potato leaves which have been dipped in suspensions containing Bacillus thurin 'ensis preparations. The larvae are incubated at 25 ° C
for 4 days, and larval mortality is recorded and analyzed using probit analysis.
Example 3 - Cloning of a Novel Toxin Gene from B t Isolate PSSOC
Total cellular DNA was prepared from Bacillus thurin '~ensis (B-t.) cells grown to an optical density, at 600 nm, of 1Ø The cells were recovered by centrifugation and protoplasts were prepared in TES buffer (30 mM Tris-HC1, 10 mM EDTA, 50 mM NaCI, pH = 8.0) containing 20% sucrose and 50 mg/ml lysozyme. The protoplasts were lysed by addition of SDS to a final concentration of 4%. The cellular material was precipitated overnight at 4°C in 100 mM (final 5 concentration) neutral potassium chloride. The supernate was extracted twice with phenol/chloroform (1:1). rJucleic acids were precipitated with ethanol and DNA
was purified by isopycnic banding on cesium chloride-ethidium bromide gradients.
Total cellular DrTA from B-t. subsp. kumamotoensis (B.t.kum.), isolate PSSOC, was digested with I~indIII and fractionated by electrophoresis on a 0.8%
10 (w/v) agarose-TAE (50 mIvl Tris-HCI, 20 mM NaOAc, 2.5 mM EDTA, pH = 8.0) buffered gel. A Southern blot of the gel was hybridized with a [32P]-radiolabeled oligonucleotide probe. Results showed that the hybridizing fragments of PSSOC
are approximately 12 Kb and 1.7 Kb in size.
A library was constructed from PSSOC total cellular DNA partially 15 digested with Sau3A and size fractionated by gel electrophoresis. The 9-23 Kb region of the gel was excised and the DNA was electroeluted and then concentrated using an Eluvtip-d~ ion exchange column (Schleicher and Schuel, Keene, NH). The isolated Sau3A fragments were ligated into BamHI-digested LambdaGEM-11~ (PROrrfEGA). The packaged phage were plated on E. coli KW251 cells (PROMEGA) at a high titer and screened using the radiolabeled oligonucleotide probe. Hybridizing plaques were purified and rescreened at a lower plaque density. Sinhle isolated, purified plaques that hybridized with the probe were used to infect F- coli KW251 cells in liquid culture for preparation of phage for DNA isolation. I>NA was isolated by standard procedures. Preparative amounts of DNA were dif;ested with XhoI (to release the inserted DNA from lambda sequences) and separated by electrophoresis on a 0.6% agarose-TAE gel.
The large fragments were purified by ion exchange chromatography as above and ligated to XhoI-digested, de,phosphorylated pHTBIueII (an E. co ' - thurin 'ensis shuttle vector comprised of pBluescript s/k [Stratagene] and the replication origin from a resident B-t. plasmicl [D. Lereclus et al. 1989. FEMS Microbiology Letters *Trade-mark 16 MA53.C1 60:211-218]). The ligation mix was introduced by transformation into competent E. coli NM522 cells (ATCC 47000) and plated on LB agar containing ampicillin, isopropyl-(,B)-D-thiogalactoside (IPTG) and 5-bromo-4-chloro-4-indolyl-(~)-D-galactoside (XGAL). White colonies, with putative restriction fragment insertions in the (~)-galactosidase gene of pHTBIueII, were subjected to standard rapid plasmid purification procedures. Plasmids were analyzed by XhoI digestion and agarose gel electrophoresis. The desired plasmid construct, pMYC1638, contains an approximately 12 Kb XhoI insert. A partial restriction map (Figure 2) of the cloned insert indicates that the toxin gene is novel compared to the maps of other toxin genes encoding insecticidal proteins. The nucleotide sequence (open reading frame only) is shown in Sequence >D No. 1. The predicted peptide sequence of the toxin is shown in Sequence 1D No. 2.
Plasmid pMYC1638 was introduced into an acrystalliferous (Cry ) B-t.
host (HD-1 cryB obtained from A. Aronson, Purdue University) by electroporation. Expression of an approximately 130 kDa protein was verified by SDS-PAGE. Broth containing spores and crystals was used for the determination of toxicity to Leptinotarsa decemlineata.
Plasmid pMYC1638 containing the B_t, toxin gene, can be removed from the transformed host microbe by use of standard well-known procedures. For example, E. coli NM522[pMYC1638] NRRL B-18751 can be subjected to cleared lysate isopycnic density gradient procedures, and the like, to recover pMYC1638.
Example 4 - Insertion of Toxin Gene Into Plants The novel gene coding for the novel insecticidal toxin, as disclosed herein, can be inserted into plant cells using the Ti plasmid from A rg obacter tumefaciens. Plant cells can then be caused to regenerate into plants (~ambryski, P., Joos, H., Gentello, C., Leemans, J., Van Montague, M. and Schell, J [1983]
Cell 32:1033-1043). A particularly useful vector in this regard is pEND4K (Klee, H.J., Yanofsky, M.F. and Nester, E.W. [1985] BiofTechnology 3:637-642). This plasmid can replicate both in plant cells and in bacteria and has multiple cloning sites for aC'n~..~.~"'~ ~~c d 17 MA53.C1 passenger genes. The toxin gene, for Pxample, can be inserted into the Baml-II
site of pEND4I~, propagated in E. coli, and transformed into appropriate plant cells.
Example 5 - Cloning of Novel B. thuri~~nsis Gene Into Baculoviruses The novel gene of the invention can be cloned into baculoviruses such as Autographa californica nuclear polyhedrosis virus (AcNPV). Plasmids can be constructed that contain the AcNPV genome cloned into a commercial cloning vector such as pUCB. The AcNPV genome is modified so that the coding region of the polyhedrin gene is removed and a unique cloning site for a passenger gene is placed directly behind the polyhedrin promoter. Examples of such vectors are pGP-B6874, descnbed by Pennock et al. (Pennock, G.D., Shoemaker, C. and Miller, L.K. [1984] Mol. Cell. Biol. 4:399-406), and pAC380, descn'bed by Smith et al. (Smith, G.E., Summers, M.D. and Eraser, M.J. [1983] Mol Cell. Biol.
3:2156-2165). The gene coding for the novel protein toxin of the invention can be modified with BamPII linkers at appropriate regions both upstream and downstream from the coding region and inserted into the passenger site of one of the AcNPV vectors.

e~ ~...~9~~.b tame~9 18 MA53.C1 SEQUENCE LISTTNG
(1) GENERAL INFORMATION:
(i) APPLICANT:
Foncerrada, Luis R

Payne, Jewel M

Sick, August J

(ii) TITLE
OF
INVENTION:
Novel Coleopteran-Active Bacillus th i i i ur nc1 ens s Isolate and a Novel Gene Encoding a Coleoperan-Active Toxin (iiij NUMBER
OF
SEQUENCES:

(iv ) CORRESPONDENCE
ADDRESS:

A ADDRESSEE: Roman Saliwanchik B STREET: 2421 N.W. 41st Street, Ste A-1 C CITY: Gainesville D STATE: FL

E COUNTRY: USA

F ZIP: 32606 (v) COMPUTER
READABLE
FORM:

(A) MEDIUM TYPE: Floppy disk (B COMPUTER: IBM PC compatible ) C OPERATING SYSTEM: PC-DOS/M5-DOS
( ) D SOFTWARE: PatentIn Release #1.0, Version ( #1.25 ) (vi) CURRENT
APPLICATION
DATA:

A APPLICATION NUMBER:

B FILING DATE:
~
~

C CLASSIFICATION:

(viii)ATTORNEY/AGENT
INFORMATION:

(A) NAME:
Saliwanchik, Roman (ix) TELECOMMUNICATION
INFORMATION:

(A) TELEPHONE:

(B) TELEFAX:

(2) INFORMATTON
FOR
SEQ
ID
NO:1:

(i) SEQUENCE
CHARACTERISTICS:

A LENGTH: 3471 base pairs B TYPE: nucleic acid C STRANDEDNESS: double ~
~

D TOPOLOGY: linear (ii) MOLECULE
TYPE:
DNA
(genomic) (iii) HYPOTHETICAL:
NO

(iv) ANTI-SENSE:
NO

(vi) ORIGINAL
SOURCE:

A ORGANISM: Bacillus thuringiensis B STRAIN: kumamotoensia ~
~

C INDIVIDUAL ISOLATE: PS50C

(vii) IMMEDIATE
SOURCE:

(A) LIBRARY:
LAMBDAGEM
(TM) -LIBRARY
OF
LUTS

FONCERRADA

(B) CLONE:

(xi) SEQUENCE
DESCRIPTION:
SEQ
ID
N0:1:

ATAATCAAAA
TGAATATGAA
ATTATAGATG
CGACACCTTC
TACATCTGTA

CTAACAGATA
CCCTTTTGCG
AATGAGCCAA
CAGATGCGTT
ACAAAATATG

ATTATCTGAA
AATGTCTGGG
GGAGAGAATC
CTGAATTATT
TGGAAATCCG

TTAGTTCATC
CACGATTCAA
ACTGGAATTG
GCATTGTTGG
TCGAATACTA

GGGTTCCATT
TGCTAGTCAG
ATAGCTAGTT
TCTATAGTTT
CATTGTTGGT

CGTCAAAGAG
CGTAGATATA
TGGGGAGAAA
TTATGGAACG
AGTGGAAGAA

~1L'fr~.~IvP,~ r...8 R.r ~.. ....~ .~,m ~,s ~KVd 19 MAS3.C1 AAAAAATAGA
AAAATATGTA
AAAGATAAGG

TATTCAGACTATTGTGTAAAGTGGTATAAAATC:GGCTTAGATAAATTGAA AGGTACCACT780 TCTAAAAGTTGGCTGAATTATCATCAGTTCCG7'AGAGAGATGACATTACT GGTATTAGAT840 ~C' a~,~~°~
20 MA53.C1 CACTTGGAAA
TCTTGAATTA

GAGACAGATAGAAGATACATGGCATCGAAACAAGCGGTAGATCGTT.'TATATGCCGATTAT2880 (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
A) LENGTH: 1157 amino acids B)) TYPE: amino acid C STRANDEDNESS: single ~D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: YES
(ivj ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
A ORGANISM: Bacillus thuringiensis B STRAIN: kumamotoensis ~C~ INDIVIDUAL ISOLATE: PS50C
(vii) IMMEDIATE SOURCE:
(A) LIBRARY~ Lambdagem (TM) - 11 LIBRARY OF LUIS
FONCERRADA
(B) CLONE: 50C
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Met Ser Pro Asn Asn Gln Asn Glu Tyr Glu Ile Ile Asp Ala Thr Pro Ser Thr Ser Val Ser Ser Asp Ser Asn Arg Tyr Pro Phe Ala Asn Glu Pro Thr 35p Ala Leu Gln Asn 4e0t Asn Tyr Lys Asp 4yr Leu Lys Met Ser Gly Gly Glu Asn Pro Glu Leu Phe Gly Asn Pro GSlu Thr Phe Ile Ser Ser Ser Thr Ile Gln Thr Gly Ile Gly Ile Val Gly Arg Ile Leu Gly Ala Leu Gly 851 Pro Phe Ala Ser 910n Ile Ala Ser Phe 9yr Ser Phe Ile Val G1y Gln Leu Trp Pro Ser Lys Ser Val Asp Ile TSrp Gly Glu Ile i15 Glu Arg Val Glu i2O Leu Val Asp Gln iys I12 Glu Lys ~~:'.' a~°~~
21 MA53.C1 Tyr 130 Lys Aap Lys Ala i35 Ala Glu Leu Lys i~~ Leu Gly Aan Ala Leu Asp Val Tyr Gln Gln Ser Leu Glu Asp Trp LeuO Glu Asn Arg Asn 145 150 15b 160 Asp Ala Arg Thr Arq Ser Val Val Ser Asn Gln Phe Ile Ala Leu Asp Leu Asn Phe 1810 Ser Ser Ile Pro i85 Phe Ala Val Ser i9y His Glu Val Leu Leu Leu Ala Val Tyr Ala Gln Ala Val Asn Leu HiOs Leu Leu Leu 210 Arg Aap Ala Ser 215 Phe Gly Glu Glu z2p Gly Phe Thr Pro G1y Glu Ile Ser Arg Phe Tyr Aan Arg Gln Val GlDn Leu Thr Ala Glu Tyr Ser Asp Tyr 2y5 Val Lys Trp Tyr 2y0 Ile Gly Leu Asp 2y5 Leu Lys Gly Thr Thr S4er Lys Ser Trp Leu A5an Tyr His Gln Phe ASrg Arg Glu Met 275 Leu Leu Val Leu 28p Leu Val Ala Leu 285 Pro Asn Tyr Asp Thr Hia Met Tyr Pro Ile Gluo Thr Thr Ala Gln Leu Thr Arg Aap Val Tyr Thr Asp Pro Ile Ala Phe Asn Ile Val Thr Ser Thr Gly Phe Cys Asn Pro Trp 325 Thr His Ser Gly 330 Leu Phe Tyr Glu 335 Glu Asn Asn Val Ile Arg Pro Pro His Leu Phe Asp Ile Leu Ser Ser Val Glu Ile 355 Thr Ser Arg Gly 36y Ile Thr Leu Asn 365 Asp Ala Tyr Ile 3~n0 Tyr Trp Ser Gly 3~5 ThDr Leu Lys Tyr $~ Arg Thr Ala Asp Ser Thr Val Thr Tyr Thr Ala Asn Tyr Gly Ar Ile Thr Ser Glu Lys Aan Ser Phe Ala Leu Glu Asp Arg Asp Ile Dhe Glu Ile Asn Ser Thr Val Ala Asn Leu Ala Aan Tyr Tyr Gln Lys Ala Tyr Gly Val Pro Gly Ser Trp P435 His Met Val Lys 4g Gly Thr Ser Ser T4~5 Thr Ala Tyr Leu Tyr Ser Lys Thr His Thr AlOa Leu Gln Gly C~s Thr G1n Val Tyr Glu Ser Ser Asp Glu Tle Pro Leu Asp Arg Thr Val Pro Va1 Ala Glu Ser Tyr Ser His Bg Leu Ser His Ile 49r0 Ser His Ser Phe 49~ Lys Aan Gly Ser 5D0 TyrS Tyr Gly Ser 5h05 Pro Val Phe Val 52p Thr His Thr Ser 515 Aap Leu Aan Asn 5 O Ile Tyr Ser Asp 5y5 IlDe Thr Gln Ile 530 Ala Val Lys G1y 5~~ Met Leu Tyr Leu Gly GZly Ser Val Val 22 MA53.C1 Gln Gly Pro Gly Phe Thr Gly G1y Asp Ile Leu Lys Arg Thr Asn Pro Ser Ile Leu Gly Thr Phe Ala Val Thr Val Asn Gly Ser Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr Asp Phe Glu Phe Thr Leu 5y5 Leu Gly Asp Thr 600 Glu Lys Asn Arg 605 Asn Lys Thr Met Asp A9sn Gly Ala Ser Leu Thr Tyr Glu Thr Phe Lys Phe Ala Ser Phe Ile Thr Asp Phe Gln Phe Arg Glu Thr Gln Asp Lys Ile Leu Leu Ser Met Gly Asp Phe Ser Ser Gly Gln Glu Val Tyr Ile Asp Arg Ile Glu Phe Ile 660 Val Asp Glu Thr Ty5 Glu Ala Glu Gln 6~~ Leu Glu Ala Ala 6y5 Lys Ala Val Asn 68a0 L6~eu Phe Thr Asn 685 LyOs Asp Gly Leu 6 ~ P7ro Gly Val Thr 69p Tyr Glu Val Asn 710Q Ala Ala Asn Leu Val Glu Cys Leu Ser Asp As5p Leu Tyr Pro Asn Glu Lys Arg Leu Leu Phe Asp Ala Val A72rg Glu Ala Lys Arg 730 5er Gly Ala Arg '36 Leu Leu Gln Asp Pro AsSp Phe GIn Glu Ile Asn Gly Glu Asn G1y Trp Ala Ala Ser 755 Gly Ile Glu Ile 7610 Glu Gly Asp Ala 765 Phe Lys Gly Arg 7yr0 Leu Arg Leu Pro 7~~ Ala Arg Glu Ile 7~~ Thr Glu Thr Tyr Pro T7hr Tyr Leu Tyr Gln LySs Val Glu Glu Glp VaDl Leu Lys Pro ~yr 785 790 79b $D0 Thr Arg Tyr Arg 8p5 Arg Gly Phe Val 8iy Ser Ser Gln Gly 8i6 Glu Ile Tyr Thr Ile Arg His Gln Thr Asn ArOg Ile Val Lys Asn Val Pro Asp Asp $36 Leu Pro Asp Val 8~r0 Pro Val Asn Ser 8~~ Gly Ser Ile Asn 8 ~ Cys Ser Glu Gln By5 Tyr Val Asn Ser ~~ Lebu Glu Gly Glu Asn Arg Ser Gly Asp Ala H5is Glu Phe Sex Leu Pro Ile Asp Ile G1p Glu Leu Asp Tyr 885 Glu Asn Ala Gly 89o Trp Val Gly Phe 8y5 Ile Thr Asp Pro Glu Gly Tyr Ala Thr Leu Gly Asn Leu Glu Leu V9al Glu Glu Gly Pro Leu Ser Gly Asp Ala Leu Glu Arg Leu Glri Arg Glu Glu Gln Gln Trp Lys Ile Gln Met Thr Arg Arg Arg Glu Glu Thr Asp Arg ~~ Tyr Met Ala Ser 9ys0 Gln Ala Val Asp 9 ~ Leu Tyr Ala Asp 9~r0 ~~.j...s~~'m ~i~i 23 MA53.C1 Gln Asp Gln Gln Leu Asn Pro Asp Val Glu Ile Thr Asp Leu Thr Ala Ala Gln Asp Leu Ile Gln Ser Ile Pro Tyr Val Tyr Asn Glu Met Phe Pro Glu Ile Pro Gly Met Asn Tyr Thr Lys Phe Thr Glu Leu Thr Asp Arg Leu Gln Gln Ala Trp Asn l,eu Tyr Aep Gln Arg Asn Ala Ile Pro Asn Gly Asp Phe Arg Asn GIy Leu Ser Asn Trp Asn Ala Thr Pro G1p Val Glu Val Gln Gln Ile Asn FIis Thr Ser Val Leu Val Ile Pro Asn Trp Asp Glu Gln Val Ser Gln Gln Phe Thr Val Gln Pro Asn Gln Arg Tyr Val Leu Arg Val Thr Ala Arg Lys Glu Gly Val Gly Asn Gly Tyr Val Ser IIe Arg Asp Gly G1y Asn Gln Ser Glu Thr Leu Thr Phe Ser Ala Ser Asp Tyr Asp Thr Asn Gly Val Tyr Asn Asp Gln Thr Gly Tyr Ile Thr Lys Thr Val Thr Phe Ile Pro Tyr Thr Asp Gln Met Trp Ile Glu Ile Ser Glu Thr Glu Gly Thr Phe Tyr Ile Glu Ser Val Glu Leu Ile Val i155Va1 Glu

Claims (38)

1. A process for controlling coleopteran insect pests which comprises contacting said insect pests with an insect-controlling effective amount of Bacillus thuringiensis PS50C
having the identifying characteristics of NRRL B-18746.

2. A process, according to claim 1, wherein said insect pest is contacted with an insect-controlling sufficient amount of said Bacillus thuringiensis PS50C by incorporating said Bacillus thuringiensis PS50C into a bait granule and placing said granule on or in the soil when planting seed of a plant upon which plant insect pest is known to feed.

3. A process for controlling soil-inhabiting insect pests of the order Coleoptera which comprises (1) preparing a bait granule comprising Bacillus thuringiensis PS50C having the identifying characteristics of NRRL B-18746, spores or crystals; and (2) placing said bait granule on or in the soil.

4. A process, according to claim 3, wherein said bait granule is applied at the same time corn seed is planted in the soil.

5. A process, according to claim 1, wherein substantially intact B.t PS50C
cells having the identifying characteristics of NRRL B-18746 are treated to prolong the pesticidal activity when the substantially intact cells are applied to the environment of a coleopteran target pest.

6. A composition of matter comprising Bacillus thuringiensis PS50C having the identifying characteristics of NRRL B-18746 or spores or crystals in association with an insecticide carrier.

7. A composition of matter, according to claim 6, wherein said carrier comprises beetle phagostimulants or attractants.

8. A composition of matter comprising Bacillus thuringiensis PS50C having the identifying characteristics of NRRL B-18746 in association with formulation ingredients applied as a seed coating.

9. A biologically pure culture of Bacillus thuringiensis PS50C having the identifying characteristics of NRRL B-18746 having activity against insect pests of the order Coleoptera.

10. A process, according to claim 1, wherein the coleopteran pests are present on stored products.

11. A process, according to claim 1, wherein the coleopteran pest is the Colorado potato beetle.

12. A toxin active against coleopteran pests, said toxin being producible by Bacillus thuringiensis PS50C which has the identifying characteristics of NRRL B-18746, wherein said toxin has a molecular weight of ~ 130 kDa and a predicted peptide sequence as shown in Sequence ID No. 2 or a pesticidal fragment thereof.

13. DNA encoding a Bacillus thuringiensis toxin active against coleopteran pests wherein said toxin has a molecular weight of ~ 130 kDa and a predicted peptide sequence as shown in Sequence ID No. 2 or a pesticidal fragment thereof.

14. A recombinant DNA transfer vector comprising DNA which codes for a Bacillus thuringiensis toxin active against coleopteran pests wherein said toxin has a molecular weight of ~ 130 kDa and a predicted peptide sequence as shown in Sequence ID
No. 2.

15. The DNA transfer vector according to claim 14 wherein said vector is transferred to and replicated in a prokaryotic or eukaryotic host.

16. DNA having the nucleotide sequence shown in Sequence ID No. 1.

17. A bacterial host transformed to express a Bacillus thuringiensis toxin active against coleopteran pests wherein said toxin has a molecular weight of .apprxeq. 130 kDa and a predicted peptide sequence as shown in Sequence ID No. 2.

18. Escherichia coli transformed with a plasmid vector containing a Bacillus thuringiensis toxin gene encoding the Bacillus thuringiensis toxin active against coleopteran pests wherein said toxin has a molecular weight of .apprxeq. 130 kDa and a predicted peptide sequence as shown in Sequence ID No. 2.

19. The bacterial host of claim 17 wherein said bacterial host is Escherichia coli NM522(pMYC1638).

20. A bacterial host according to claim 17, which is a species of Pseudomonas, Azotobacter, Erminia, Serratia, Klebsiella, Rhizobium, Bacillus, Streptomyces, Rhodopseudomonas, Methyphilius, Agrobacterium, Acetobacter or Alcaligenes.

21. A bacterial host according to claim 20, wherein said microorganism is pigmented and phylloplane adherent.

22. A method for controlling coleopteran insects which comprises administering to said insects or to the environment of said insects a bacterial host according to claim 20.

23. A method according to claim 22, wherein said administration is to the rhizosphere.

24. A method according to claim 23, wherein said administration is to the phylloplane.

25. A method according to claim 22, wherein said administration is to a body of water.

26. Treated, substantially intact unicellular microorganism cells containing an intracellular toxin, which toxin is a result of expression of a Bacillus thuringiensis toxin gene which codes for a polypeptide toxin active against coleopteran pests wherein said toxin has a molecular weight of .apprxeq. 130 kDa and a predicted peptide sequence as shown in Sequence ID No. 2, wherein said cells are treated under conditions which prolong the insecticidal activity when said cells are applied to the environment of a target insect.

27. Cells according to claim 26, wherein said cells are treated by chemical or physical means to prolong the insecticidal activity in the environment.

28. Cells according to claim 27, wherein said cells are prokaryotes or lower eukaryotes.

29. Cells according to claim 28, wherein said prokaryotic cells are selected from the group consisting of Enterobacteriaceae, Bacillaceae, Rhizobiaceae, Spirillaceae, Lactobacillaceae, Pseudomonadaceae, Azotobacteraceae, and Nitrobacteraceae.

30. Cells according to claim 28, wherein said lower eukaryotic cells are selected from the group consisting of Phycomycetes, Ascomycetes, and Basidiomycetes.

31. Cells according to claim 26, wherein said cell is a pigmented bacterium, yeast, or fungus.

32. Cells according to claim 26, wherein said microorganism is Pseudomonas and said toxin is a Bacillus thuringiensis toxin active against coleopteran pests wherein said toxin has a molecular weight of .apprxeq. 130 kDa and a predicted peptide sequence as shown in Sequence ID No. 2.

33. Cells according to claim 27, wherein said cells are Pseudomonas and are treated with iodine.

34. Cells, according to claim 33, which are Pseudomonas fluorescens.

35. Plasmid denoted pMYC1638 and deposited under NRRL accession no. B-18751.

36. The bacterial host, according to claim 17, which is a root colonizing bacteria.

37. The method, according to claim 22, wherein said bacterial host is a root colonizing bacteria.

38. A process according to claim 3 wherein said bait granual comprises substantially intact B.t. PSSOC cells having the identifying characteristics of NRRL B-18746 which are treated to prolong the pesticidal activity.