BR102017012660A2 - PLANT AND 3 'UTR PROMOTER FOR TRANSGENE EXPRESSION - Google Patents

Abstract

The present invention relates to compositions and methods for promoting transcription and translation of a nucleotide sequence in a plant or plant cell employing a 3 utr of the oryza sativa ubiquitin-3 gene. some embodiments refer to a 3 'utr of an oryza sativa ubiquitin-3 gene that functions in plants to terminate transcription of operably linked nucleotide sequences.

Description

(54) Title: PLANT PROMOTOR AND 3 'UTR FOR TRANSGENE EXPRESSION (51) Int. Cl .: C12N 15/82; C12N 15/67; C12N 15/63; C12N 15/11; A01H 5/10; (...) (30) Unionist Priority: 06/16/2016 US 62 / 350,898 (73) Holder (s): AGRIGENETICS, INC.

(72) Inventor (s): MANJU GUPTA; PRADEEP MARRI; NAGESH SARDESAI; JEFFERY BERINGER (74) Attorney (s): DANNEMANN, SIEMSEN, BIGLER & IPANEMA MOREIRA (57) Abstract: The present invention relates to compositions and methods to promote the transcription and translation of a nucleotide sequence in a plant or plant cell, employing a 3 'UTR from the Oryza sativa Ubiquitin3 gene. Some modalities refer to a 3 'UTR of an Oryza sativa Ubiquitin-3 gene that works in plants to terminate the transcription of nucleotide sequences operationally

1/88

Descriptive Report of the Invention Patent for PLANT PROMOTER AND 3 'UTR FOR TRANSGENE EXPRESSION.

FIELD OF THE INVENTION [001] This invention generally refers to the field of molecular biology of plants and, more specifically, to the field of expression of transgenes in plants.

BACKGROUND OF THE INVENTION [002] Many species of plants are capable of being transformed with transgenes to introduce agronomically desirable traits or characteristics. The resulting plant species are developed and / or modified to have desired traits. Generally, desirable traits include, for example, improving the quality of nutritional value, increasing yield, granting resistance to pests or diseases, increasing tolerance to drought and stress, improving horticultural qualities (for example, pigmentation and growth), transmitting tolerance to herbicides, allow the production of industrially useful compounds and / or materials from the plant and / or allow the production of pharmaceuticals.

[003] Transgenic plant species comprising multiple pyramidized transgenes at a single genomic locus are produced using plant transformation technologies. Plant transformation technologies result in the introduction of a transgene into a plant cell, recovery of a fertile transgenic plant that contains the transgene stability-integrated copy in the plant genome and subsequent expression of transgenes through transcription and translation of results of the plant genome in transgenic plants that have desirable traits and phenotypes. However, mechanisms that allow the production of transgenic plant species that express high levels of transgePetition 870170040657, of 06/13/2017, p. 7/184

2/88 in multiple genetically manipulated like a pyramid of traits.

[004] Likewise, mechanisms are desirable that allow the expression of a transgene within particular tissues or organs of a plant. For example, a plant's increased resistance to infection by soil-borne pathogens can be achieved by transforming the plant's genome with a pathogen resistance gene so that the pathogen resistance protein is robustly expressed within the plant's roots . Alternatively, it may be desirable to express a transgene in tissue from plants that are in a particular growth or development phase, for example, cell division or elongation. Furthermore, it may be desirable to express a transgene in the tissues of a plant's leaf or stem to provide tolerance against herbicides or resistance against insects or pests above ground.

[005] Therefore, there is a need for new gene regulatory elements that can target the desired levels of transgenic expression in specific plant tissues.

BRIEF SUMMARY [006] In the disclosure modalities of the object, the disclosure refers to a nucleic acid vector comprising a 3 'UTR, ZMEXP18544.1, operationally linked to a polylinker or a short polynucleotide sequence, a Ubiquitin- 3 of non-rice (Oryza sativa), or a combination of the polylinker / short polynucleotide sequence and the Ubiquitin-3 gene of non-Oryza sativa. In these aspects of this embodiment, the 3 'UTR comprises a polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1. Other embodiments include the 3 'UTR which comprises a polynucleotide 1001 bp in length. Also included are modalities for polynucleotides that share

Petition 870170040657, of 6/13/2017, p. 8/184

3/88

80%, 85%, 90%, 92.5%, 95%, 97.5%, 99%, or 99.9% sequence identity at the 3 'RTU of SEQ ID NO: 1. The embodiments include the nucleic acid vector which further comprises a sequence that encodes a selectable marker. Also considered are modalities of the nucleic acid vector, wherein said 3 'UTR is operably linked to a transgene. Examples of such a transgene include a selectable marker or gene product that confers resistance to insecticides, tolerance to herbicides, efficiency in the use of nitrogen, efficiency in the use of water, or nutritional quality. Also considered are modalities of the nucleic acid vector, in which said 3 'UTR is operationally linked to an RNAi that expresses the polynucleotide.

[007] In other respects, the disclosure of the object refers to a nucleic acid (or polynucleotide) comprising a promoter polynucleotide sequence that has at least 80%, 85%, 90%, 92.5%, 95%, 97 , 5%, 99%, and 99.9% sequence identity to SEQ ID NO: 2. In that sense, such a promoter is incorporated into a nucleic acid vector that comprises the 3 'UTR of SEQ ID NO: 1. In aspects of this embodiment, the promoter (for example, SEQ ID NO: 2) is operationally linked to the 5 'end of a polylinker or to a transgene, and the 3' UTR is operationally linked to the 3 'end of a polylinker or to a transgene. Also included in this modality is a nucleic acid vector, in which the promoter further comprises an intron or a 5 '-UTR. Subsequently, the nucleic acid vector containing the promoter of SEQ ID NO: 2 and the 3 'UTR of SEQ ID NO: 1 leads to the expression of a transgene with constitutive tissue-specific expression.

[008] In other aspects, the disclosure of the object refers to a plant that comprises a polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1 operation 870170040657, of 06/13/2017, p. 9/184

4/88 onally linked to a transgene. In this sense, the plant is a monocot or a dicot plant. Specific examples of plants include corn, wheat, rice, sorghum, oats, rye, bananas, sugar cane, soy, cotton, Arabidopsis, tobacco, sunflower and canola. In the modalities, these plants can be transformed, in which the transgene is inserted into the genome of that plant. In the additional embodiments, the plant contains a promoter that comprises a polynucleotide sequence with at least 80%, 85%, 90%, 92.5%, 95%, 97.5%, 99%, or 99.9% identity sequence with SEQ ID NO: 2. In these modalities, SEQ ID NO: 1 is 1001 bp in length. In one aspect of this modality, the 3 'RTU is operationally linked to a transgene. In other embodiments, the plant contains a 3'UTR that comprises a polynucleotide sequence with at least 80%, 85%, 90%, 92.5%, 95%, 97.5%, 99%, or 99.9% sequence identity with SEQ ID NO: 1. In these modalities, SEQ ID NO: 1 is 1001 bp in length. In one aspect of this embodiment, the 3 'RTU of SEQ ID NO: 1 is operationally linked to a transgene. In addition, the modalities refer to a plant comprising the promoter of SEQ ID NO: 2 or a promoter of the rice Ubiquitin-3 gene, in which the expression of the transgene is constitutive. Likewise, the modalities refer to a plant comprising 3'UTR of SEQ ID NO: 1, in which the expression of the transgene is both constitutive and tissue-specific expression as determined by the promoter used to direct the transgene. [009] In other aspects, the disclosure of the object refers to a method to produce a transgenic plant cell. Such a method uses the transformation of a plant cell with a gene expression cassette that comprises a 3'UTR of the Ubiquitin-3 gene from Oryza sativa operationally linked to at least one polynucleotide sequence of interest. Then, the method discloses the isolation

Petition 870170040657, of 6/13/2017, p. 10/184

5/88 of the transformed plant cell comprising the gene expression cassette. In addition, the method considers the production of a transgenic plant cell that comprises the 3'UTR of the Oryza sativa Ubiquitin-3 gene operationally linked to at least one polynucleotide sequence of interest. Likewise, the method includes the regeneration of the transgenic plant cell in a transgenic plant. In addition, the method includes obtaining the transgenic plant, in which the transgenic plant comprises the gene expression cassette comprising the 3'UTR of the Oryza sativa Ubiquitin-3 gene operably linked to at least one polynucleotide sequence of interest. In such an embodiment, the method of transforming a plant cell is carried out with a method of transforming a plant. In other modalities, the method of transforming a plant cell results in a polynucleotide sequence of interest that is stably integrated into the genome of the transgenic plant cell. In aspects of these modalities, the 3'UTR of the Ubiquitin-3 gene from Oryza sativa comprises the polynucleotide of SEQ ID NO: 1.

[0010] In other aspects, the disclosure of the object refers to an isolated polynucleotide that comprises a nucleic acid sequence with at least 80%, 85%, 90%, 92.5%, 95%, 97.5%, 99 %, or 99.9% sequence identity to the polynucleotide of SEQ ID NO: 1. In one embodiment, the isolated polynucleotide further comprises an open reading frame polynucleotide that encodes a polypeptide; and a promoter sequence. In another embodiment, the polynucleotide of SEQ ID NO: 1 is 1001 bp in length.

[0011] In the object disclosure modalities, the disclosure refers to a nucleic acid vector that comprises a 3'UTR operationally linked to: a polylinker sequence; a gene similar to Ubiquitin-3 from non-Oryza sativa; or a combination of the polylinker sequence and the gene similar to the Ubiquitin-3 gene of

Petition 870170040657, of 6/13/2017, p. 11/184

6/88 non-Oryza sativa, wherein said 3'UTR comprises a polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1. In some modalities, the 3'UTR is 1001 bp in length. In additional embodiments, 3'UTR consists of a polynucleotide sequence that has at least 90% sequence identity to SEQ ID NO: 1. In other modalities, 3'UTR terminates the expression of a polynucleotide that encodes a selectable marker. In other modalities, 3'UTR is operationally linked to a transgene. In aspects of this modality, the transgene encodes a selectable marker or gene product that confers resistance to insecticides, tolerance to herbicides, efficiency in the use of nitrogen, efficiency in the use of water, or nutritional quality. The 3'UTR of SEQ ID NO: 1 is provided for use with a promoter, the promoter polynucleotide sequence comprising a sequence that has at least 90% sequence identity with SEQ ID NO: 2, where the promoter polynucleotide sequence is operationally linked to said polylinker or said transgene. In other embodiments, 3'UTR of SEQ ID NO: 1 is provided for use with any known plant promoter sequence, the promoter sequence comprising a sequence that has at least 90% sequence identity with SEQ ID NO: 2 or with a promoter sequence of the Oryza sativa Ubiquitin-3 gene. In another embodiment, 3'UTR of SEQ ID NO: 1 is used for constitutive or tissue-specific expression.

[0012] In yet another embodiment, the disclosure of the object provides a plant that comprises a polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1 operably linked to a transgene or a ligand sequence. According to this modality, the plant is selected from the group consisting of corn, wheat, rice, sorghum, oats, rye, bananas, sugar cane.

Petition 870170040657, of 6/13/2017, p. 12/184

7/88 sugar, soy, cotton, Arabidopsis, tobacco, sunflower and canola. Subsequently, the plant comprising the polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1 may be a Zea mays plant in some embodiments. In other embodiments, the transgene that is operationally linked to the polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1 is inserted into the genome of a plant. In some embodiments, the polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1 is a 3'UTR and said 3'UTR is operably linked to a transgene. In other embodiments, the plant comprises a promoter sequence that comprises SEQ ID NO: 2 or a promoter sequence that has at least 90% sequence identity with SEQ ID NO: 2, wherein the promoter sequence is operably linked to a transgene. In an additional embodiment, the polynucleotide sequence that has at least 90% sequence identity to SEQ ID NO: 1 is used for expression of the transgene with either constitutive or tissue-specific expression. In another embodiment, the polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1 is 1001 bp in length.

[0013] In one embodiment, the disclosure of the object provides a method of producing a transgenic plant cell, the method comprising the steps of: transforming a plant cell with a gene expression cassette comprising a 3'UTR of the Ubiquitin- 3 from Oryza sativa operationally linked to at least one polynucleotide sequence of interest; isolating the transformed plant cell comprising the gene expression cassette; and producing a transgenic plant cell comprising the 3'UTR of the Ubiquitin-3 gene from Oryza sativa operably linked to at least one polynucleotide sequence of interest. In

Petition 870170040657, of 6/13/2017, p. 13/184

8/88 other modalities, the plant cell transformation step is performed with a plant transformation method. The plant transformation method can be selected from the group consisting of an Agrobacterium-mediated transformation method, a biolistic transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome transformation method . In other embodiments, the polynucleotide sequence of interest is constitutively expressed throughout the transgenic plant cell. In some embodiments, the polynucleotide sequence of interest is stably integrated into the genome of the transgenic plant cell. In this sense, the method for producing a transgenic plant cell can also comprise the steps of: regenerating the transgenic plant cell in a transgenic plant; and obtaining the transgenic plant, in which the transgenic plant comprises the gene expression cassette comprising the 3'UTR of the Oryza sativa Ubiquitin-3 gene of SEQ ID NO: 1 operationally linked to at least one polynucleotide sequence of interest. In one embodiment, the transgenic plant cell is a monocotyledonous transgenic plant cell or a dicotyledonous transgenic plant cell. For example, the transgenic dicotyledonous plant cell can be selected from the group consisting of an Arabidopsis plant cell, a tobacco plant cell, a soy plant cell, a canola plant cell and a cotton plant cell. In addition, the monocotyledon transgenic plant cell is selected from the group consisting of a corn plant cell, a rice plant cell, and a wheat plant cell. The 3 'UTR of the Ubiquitin-3 gene from Oryza sativa used in the method can comprise the polynucleotide of SEQ ID NO: 1. In the modalities, the 3'UTR of the Ubiquitin-3 gene from Oryza sativa can also comprise a first polynucleotide sequence of operational interestPetition 870170040657, of 06/13/2017, p. 14/184

9/88 finally connected to the 3 'end of SEQ ID NO: 1.

[0014] In one embodiment, object disclosure provides a method for expressing a polynucleotide sequence of interest in a plant cell, the method comprising introducing into the plant cell a polynucleotide sequence of interest operationally linked to a 3'UTR of the gene of Ubiquitin-3 from Oryza sativa. In some embodiments, the polynucleotide sequence of interest operationally linked to the 3'UTR of the Ubiquitin-3 gene from Oryza sativa is introduced into the plant cell by a plant transformation method. As such, the plant transformation method can be selected from the group consisting of an Agrobacterium-mediated transformation method, a biolistic transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome transformation. In the modalities, the polynucleotide sequence of interest is expressed constitutively throughout the plant cell. In some embodiments, the polynucleotide sequence of interest is stably integrated into the plant cell genome. As such, the transgenic plant cell is a monocot plant cell or a dicot plant cell. As an example, the dicot plant cell is selected from the group consisting of an Arabidopsis plant cell, a tobacco plant cell, a soy plant cell, a canola plant cell and a cotton plant cell. In addition, the monocot plant cell is selected from the group consisting of a corn plant cell, a rice plant cell, and a wheat plant cell.

[0015] In one embodiment, the disclosure of the object provides a transgenic plant cell that comprises a 3'UTR of the Ubiquitin-3 gene from Oryza sativa. In some embodiments, the transgenic plant cell comprises a transgenic event. In one aspect

Petition 870170040657, of 6/13/2017, p. 15/184

10/88 of the modality, the transgenic event comprises an agronomic trait. In this sense, the agronomic trait is selected from the group consisting of an insecticide resistance trait, herbicide tolerance trait, nitrogen use efficiency trait, water use efficiency trait, nutritional quality trait, link to DNA, selectable marker trait, small RNA trait, or any combination thereof. In other modalities, the agronomic trait comprises a trait of tolerance to herbicides. In one aspect of the embodiment, the herbicide tolerance trait comprises an aad-1 coding sequence. In some modalities, the transgenic plant cell produces a consumer product. The consumer goods product is selected from protein concentrate, isolated from proteins, grains, flours, starch, oils or fibers. In one embodiment, the transgenic plant cell is selected from the group consisting of a dicot plant cell or a monocot plant cell. Consequently, the monocot plant cell is a corn plant cell. In other embodiments, the 3'UTR of the Ubiquitin-3 gene from Oryza sativa comprises a polynucleotide with at least 90% sequence identity to the polynucleotide of SEQ ID NO: 1. In yet another embodiment, the 3'UTR of the Ubiquitin-3 gene from Oryza sativa is 1001 bp in length. In other embodiments, the 3'UTR of the Oryza sativa Ubiquitin-3 gene consists of SEQ ID NO: 1. In other modalities, the 3'UTR of the Ubiquitin-3 gene from Oryza sativa is used to express an agronomic trait in a constitutive or tissue-specific way.

[0016] The object disclosure provides an isolated polynucleotide that comprises a nucleic acid sequence with at least 90% sequence identity to the polynucleotide of SEQ ID NO: 1. In some embodiments, the isolated polynucleotide leads to the expression 870170040657, dated 06/13/2017, p. 16/184

11/88 are constitutive or tissue-specific. In other embodiments, the isolated polynucleotide has expression activity within a plant cell. In the embodiments, the isolated polynucleotide comprises an open reading frame polynucleotide that encodes a polypeptide; and a promoter sequence. Other embodiments include the isolated polynucleotide which comprises a nucleic acid sequence having at least 90% sequence identity to the polynucleotide of SEQ ID NO: 1, wherein the polynucleotide of SEQ ID NO: 1 is 1001 bp in length.

[0017] The previous characteristics and other characteristics will become more apparent from the following detailed description of various modalities which proceed with reference to the attached figures. BRIEF DESCRIPTION OF THE FIGURES [0018] Figure 1: This figure is a schematic of the plasmid pDAB116099, which contains the Oryza sativa (rice) promoter of SEQ ID NO: 2 (marked as OsUbi3 promoter) and the 3'UTR of the gene Ubiquitin-3 from Oryza sativa of SEQ ID NO: 1 (marked as ZMEXP18544.1). These regulatory elements are operationally linked to the cry34Ab1 gene. Still contained in this plasmid is the aad-1 gene expression cassette, which contains the Zea mays Ubiquitin 1 promoter (labeled Zm Ubi1 Promoter) and the 3'UTR of Zea mays Lipase (labeled Zm Lip3 3'UTR) . These regulatory elements are operationally linked to the aad-1 gene. [0019] Figure 2: This figure is a schematic of plasmid pDAB113121, which contains the Zea mays Ubiquitin-1 promoter (labeled ZmUbi1 Promoter) and the 3'-UTR of the Solanum tuberosum protease inhibitor-II gene ( marked as StPinII 3'UTR). These regulatory elements are operationally linked to the yellow fluorescent protein reporter gene of the Phialidium species (marked as PhiYFP). Still contained in this plasmid is casPetição 870170040657, of 06/13/2017, p. 17/184

12/88 seven of aad-1 gene expression, which contains the Zea mays Ubiquitin 1 promoter (labeled Zm Ubi1 Promoter) and the Zea mays Lipase 3'-UTR (labeled ZmLip3 3'UTR). These regulatory elements are operationally linked to the aad-1 gene. DETAILED DESCRIPTION

I. Overview of the various modalities [0020] The development of products from transgenic plants is becoming increasingly complex. Commercially viable transgenic plants now require the pyramidation of multiple transgenes at a single locus. Plant promoters and 3 'RTUs used for basic research or biotechnological applications are generally unidirectional, directing only one gene that has been fused at its 3' end (downstream) to the promoter, or its 5 'end (upstream) to 3 'RTU. In this sense, each transgene generally requires a promoter and a 3'UTR for expression, in which multiple regulatory elements are needed to express multiple transgenes within a gene pyramid. With an increasing number of transgenes in the gene pyramids, the same promoter and / or 3'UTR is routinely used to obtain optimal levels of expression patterns for different transgenes. It is necessary to obtain optimal levels of expression of transgenes for the production of a single polygenic trait. Unfortunately, multigenic constructs triggered by the same promoter and / or 3'UTR are known to cause gene silencing, resulting in less effective transgenic products in the field. The promoter and / or repeated 3'UTR elements can lead to gene silencing based on homology. In addition, repetitive sequences within a transgene can lead to homologous intra locus recombination of genes resulting in polynucleotide rearrangements. The silencing and rearrangement of transgenes is likely to have an unwanted effect on the performance of a transPetition plant 870170040657, dated 06/13/2017, p. 18/184

13/88 gene produced to express transgenes. In addition, the excess of transcription factor (TF) binding sites due to the promoter repetition may cause depletion of endogenous TFs resulting in transcriptional inactivation. Given the need to introduce multiple genes into plants for metabolic engineering and trait pyramidation, a variety of promoters and / or 3'UTRs are needed to develop transgenic cultures that induce the expression of multiple genes.

[0021] A particular problem in identifying the promoter and / or 3'UTR is the need to identify tissue-specific promoters, relating to specific cell types, stages of development and / or functions in the plant that are not expressed in other plant tissues. Tissue-specific (ie, tissue-preferred) or organ-specific promoters drive gene expression in a given tissue, such as in the plant's seed, root, leaf or tapetum. Promoters and / or tissue-specific 3'UTRs and stage of development can be identified initially by observing the expression of genes that are expressed in specific tissues or at specific time periods during plant development. These tissue-specific promoters and / or 3'UTRs are necessary for certain applications in the transgenic plant industry and are desirable because they allow the specific expression of heterologous genes in a tissue and / or developmental stage in a selective manner, indicating differential expression of the heterologous gene in different organs, tissues and / or moments, but not in other tissue. For example, a plant's increased resistance to infection by soil-borne pathogens can be achieved by transforming the plant's genome with a pathogen resistance gene so that the pathogen resistance protein is robustly expressed within the plant's roots . Alternatively, it may be desirable to express a

Petition 870170040657, of 6/13/2017, p. 19/184

14/88 transgene in plant tissues that are in a particular growth or development phase, for example, cell division or elongation. Another application is the convenience of using tissue-specific promoters and / or 3'UTRs to confine the expression of transgenes that encode an agronomic trait in specific tissue types such as developing parenchyma cells. As such, a particular problem in identifying promoters and / or 3'UTRs is how to identify promoters and relate the identified promoter to the cell's developmental properties for tissue-specific expression.

[0022] Another problem regarding the identification of a promoter is the requirement to clone all relevant transcriptional control elements of cis action and trans activation so that the cloned DNA fragment triggers transcription in the desired specific expression pattern. Since the control elements are located distally from the translation initiation or departure site, the size of the polynucleotide that is selected to understand the promoter is of importance to provide the level of expression and expression patterns of the polynucleotide sequence of the district Attorney. It is known that the promoter lengths include functional information, and different genes have been shown to have promoters that are longer or shorter than the promoters of the other genes in the genome. Elucidating the promoter transcriptional starting site and predicting the functional gene elements in the promoter region is challenging. Added to the challenge are the inherent complexity, diversity and degenerate nature of regulatory motifs and cis and trans regulatory elements (Blanchette, Mathieu, et al. Genome-wide computational prediction of transcriptional regulatory modules reveals new insights into human gene expression. Genome research 16.5 ( 2006): 656-668). The cis and trans regulatory elements are located in the

Petition 870170040657, of 6/13/2017, p. 20/184

15/88 distal parts of the promoter that regulate the spatial and temporal expression of a gene to occur only at required sites and at specific times (Porto, Milena Silva, et al. Plant promoters: an approach of structure and function. Molecular biotechnology 56.1 (2014 ): 38-49). Existing promoter analysis tools fail to reliably identify such cis regulatory elements in a genomic sequence, thus predicting many false positives, as these tools are generally focused only on the content of the sequence (Fickett JW, Hatzigeorgiou AG (1997) Eukaryotic promoter recognition. Genome research 7: 861-878). Consequently, the identification of promoter regulatory elements requires that an appropriate sequence of a specific size be obtained that will result in inducing the expression of an operably linked transgene in a desirable form.

[0023] Methods and compositions are provided to overcome these problems through the use of regulatory elements of the Ubiquitin-3 gene from Oryza sativa to express transgenes in the plant.

II. Terms and Abbreviations [0024] Throughout the application, numerous terms are used. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given in such terms, the following definitions are provided.

[0025] As used herein, the term intron refers to any nucleic acid sequence comprised in a gene (or expressed polynucleotide sequence of interest) that is transcribed, but not translated. Introns include an untranslated nucleic acid sequence within an expressed DNA sequence, as well as the corresponding sequence in RNA molecules transcribed therefrom. A construct described in this document can also contain strings that increase the stability of translation and / or

Petition 870170040657, of 6/13/2017, p. 21/184

16/88 of mRNA as well as introns. An example of said intron is the first intron of the gene II of the histone H3 variant of Arabidopsis thaliana or any other generally known intron sequence. Introns can be used in combination with a sequence of promoters to increase translation and / or mRNA stability.

[0026] The term isolated as used in this document means to have been removed from its natural environment or removed from other compounds present when the compound is first formed. The term isolated encompasses materials isolated from natural sources as well as materials (e.g., nucleic acids and proteins) recovered after preparation by recombinant expression in a host cell or chemically synthesized compounds such as nucleic acid molecules, proteins and peptides.

[0027] The term purified as used in this document refers to the isolation of a molecule or compound in a form that is significantly free of contaminants normally associated with the molecule or compound in a native or natural environment or significantly enriched in concentration relative to other compounds present when the compound is first formed and media having been increased in purity as a result of being separated from other compounds of the original composition. The term purified nucleic acid is used in this document to describe a sequence of nucleic acids that has been separated, separately produced or purified separately from other biological compounds, including, but not limited to, polypeptides, lipids and carbohydrates, while effecting a chemical change or functional in the component (for example, a nucleic acid can be purified from a chromosome by removing protein contaminants and breaking the chemical bonds that connect the nucleic acid to the rest of the DNA on the chromosome).

Petition 870170040657, of 6/13/2017, p. 22/184

17/88 [0028] The term synthetic as used in this document refers to a polynucleotide molecule (for example, DNA or RNA) that was created by chemical synthesis as an in vitro process. For example, synthetic DNA can be created during a reaction inside an Eppendorf ™ tube so that synthetic DNA is produced enzymatically from a native DNA or RNA strand. Other laboratory methods can be used to synthesize a polynucleotide sequence. Oligonucleotides can be chemically synthesized in an oligosynthesizer through solid phase synthesis using phosphoramidites. The synthesized oligonucleotides can be annealed to one another as a complex, thus producing a synthetic polynucleotide. Other methods for chemically synthesizing a polynucleotide are known in the art and can be readily implemented for use in the present disclosure.

[0029] The term about as used in this document means greater or less than the value or range of values declared by 10 percent, but is not intended to designate any value or range of values only for this broader definition. Each value or range of values preceded by the term about also intends to cover the modality of the declared absolute value or range of values.

[0030] For the purposes of the present disclosure, a gene includes a DNA region that encodes a gene product (see below) as well as DNA regions that regulate the production of the gene product, whose regulatory sequences are or are not adjacent to the coding sequences and / or transcribed. Consequently, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancedPetition 870170040657, of 6/13/2017, p. 23/184

18/88 res, silencers, insulators, borderline elements, origins of replication, matrix binding sites and locus control regions.

[0031] As used in this document, the terms native or natural define a condition found in nature. A native DNA sequence is a DNA sequence present in nature that was produced by natural means or traditional breeding techniques, but was not generated by genetic engineering (for example, using molecular biology / transformation techniques).

[0032] As used in this document, a transgene is defined as a sequence of nucleic acids that encodes a gene product, including, for example, but not limited to, an mRNA. In one embodiment, the transgene is an exogenous nucleic acid where the transgene sequence has been introduced into a host cell by genetic engineering (or the progeny thereof) where the transgene is not normally found. In one example, a transgene encodes an industrial or pharmaceutically useful compound, or a gene that encodes a desirable agricultural trait (for example, a herbicide resistance gene). In yet another example, a transgene is an antisense nucleic acid sequence in which the expression of the antisense nucleic acid sequence inhibits the expression of a target nucleic acid sequence. In yet another embodiment, the transgene is an endogenous nucleic acid in which additional genomic copies of the endogenous nucleic acid are desirable or a nucleic acid that is in antisense orientation with respect to the sequence of a target nucleic acid in a host organism.

[0033] As used herein, the term non-Oryza sativa Ubiquitin-3 transgene or non-Oryza sativa Ubiquitin-3 gene is any transgene that has less than 80% sequence identity to the sequence encoding the gene Ubiquitin-3 from Oryza sativa (SEQ ID NO: 5 with Genbank NCBI accession number

Petition 870170040657, of 6/13/2017, p. 24/184

19/88

NP_001053957.1).

[0034] A gene product as defined in this document is any product made by the gene. For example, the gene product can be a direct transcriptional product of a gene (for example, mRNA, tRNA, rRNA, antisense RNA, interference RNA, ribozyme, structural RNA or any other type of RNA) or a protein produced by translation of an mRNA. Gene products also include RNAs that are modified by processes such as closure, polyadenylation, methylation and editing and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP robosylation, myristylation and glycosylation. The expression of the gene can be influenced by external signals, for example, exposure of a cell, tissue or organisms to an agent that increases or decreases the expression of genes. The expression of a gene can also be regulated anywhere in the pathway from DNA to RNA to protein. The regulation of gene expression occurs, for example, through controls acting on the transcription, translation, transport and processing of RNA, degradation of intermediate molecules such as mRNA or through activation, inactivation, compartmentalization or degradation of specific protein molecules after produced or by combinations thereof. Gene expression can be measured at the RNA level or at the protein level by any method known in the art, including, but not limited to, Northern blot, RT-PCR, Western blot or in vitro, in situ or in vitro protein activity assays alive. [0035] As used in this document, the term gene expression refers to the process by which encoded information from a transcriptional nucleic acid unit (including, for example, genomic DNA) is converted into an operational, non-operational or structural part of a cell, usually including the synthesis of a protein. The expression of the gene can be influenced by it. Petition 870170040657, of 06/13/2017, p. 25/184

External 20/88; for example, exposure of a cell, tissue or organism to an agent that increases or decreases gene expression. The expression of a gene can also be regulated anywhere in the pathway from DNA to RNA to protein. The regulation of gene expression occurs, for example, through controls acting on the transcription, translation, transport and processing of RNA, degradation of intermediate molecules such as mRNA or through activation, inactivation, compartmentalization or degradation of specific protein molecules after produced or by combinations thereof. Gene expression can be measured at the RNA level or at the protein level by any method known in the art, including, but not limited to, Northern blot, RT-PCR, Western blot or in vitro, in situ or in vitro protein activity assays alive.

[0036] As used in this document, homology-based gene silencing (HBGS) is a generic term that includes both transcriptional gene silencing and post-transcriptional gene silencing. The silencing of a target locus by an unbound silencing locus can result from inhibition of transcription (transcriptional gene silencing; TGS) or degradation of mRNA (post-transcriptional gene silencing; PTGS) due to the production of double-stranded RNA (dsRNA) corresponding to the promoter or transcribed sequences, respectively. The involvement of distinct cellular components in each process suggests that TGS and PTGS induced by dsRNA probably result from the diversification of a common ancestor mechanisms. However, a strict comparison of TGS and PTGS has been difficult to obtain as it is usually based on the analysis of different silencing loci. In some instances, a single transgene locus can trigger TGS and PTGS, due to the production of dsRNA corresponding to the promoter and transcribed sequences of different target genes. Mourrain et al. (2007) Plant 225: 365-79. IS

Petition 870170040657, of 6/13/2017, p. 26/184

21/88 siRNAs are likely to be the actual molecules that trigger TGS and PTGS in homologous sequences: siRNAs in this model would trigger the silencing and methylation of homologous sequences in cis and trans by spreading the methylation of transgenic sequences in the endogenous promoter.

[0037] As used in this document, the term nucleic acid molecule (or nucleic acid or polynucleotide) can refer to a polymeric form of nucleotides that can include sense and antisense strands of RNA, cDNA, genomic DNA and synthetic forms and mixed polymers mentioned above. A nucleotide can refer to a ribonucleotide, deoxyribonucleotide or a modified form of any of the types of nucleotide. A nucleic acid molecule as used in this document is synonymous with nucleic acid and polynucleotide. A nucleic acid molecule is generally 10 bases in length, unless otherwise specified. The term can refer to an RNA or DNA molecule of undetermined length. The term includes single or double stranded form of DNA. A nucleic acid molecule can include one or both naturally occurring or modified nucleotides linked to one another by naturally occurring and / or non-naturally occurring nucleotide bonds.

[0038] Nucleic acid molecules can be modified chemically or biologically or may contain bases of unnatural or derivatized nucleotides, as will be readily appreciated by those skilled in the art. Such modifications include, for example, markers, methylation, replacement of one or more naturally occurring nucleotides with an analog, internucleotide modifications (for example, uncharged bonds: for example, methylphosphonates, phosphotriesters, phosphoramidites, carbamates, etc .; charged bonds : for example, phosphorothioates, phosphorodithioates, etc .; fractions

Petition 870170040657, of 6/13/2017, p. 27/184

Pending 22/88: for example, peptides; interleavers: for example, acridine, psoralen, etc .; chelators; alkylators; and modified bonds: for example, alpha anomeric nucleic acids, etc.). The term nucleic acid molecule also includes any topological conformation, including single-stranded, double-stranded, partially-duplexed, triplexed, hooked, circular and padlock shaped.

[0039] Transcription proceeds in a 5 'to 3' manner along a DNA strand. This means that the RNA is made by a sequential addition of ribonucleotide-5'-triphosphates to the 3 'terminal of the growing chain (with a requirement elimination of the pyrophosphate). In a linear or circular nucleic acid molecule, discrete elements (for example, particular nucleotide sequences) can be mentioned as upstream or 5 'to an additional element if they are linked or serial linked to the same nucleic acid in the direction 5 'from that element. Similarly, discrete elements can be downstream or 3 'to an additional element if they are or would be linked to the same nucleic acid in the 3' direction of said element.

[0040] A base position, as used in this document, refers to the location of a particular base or nucleotide residue within a designated nucleic acid. The designated nucleic acid can be defined by alignment (see below) with a reference nucleic acid.

[0041] Hybridization concerns the connection of two polynucleotide strands through hydrogen bonds. Oligonucleotides and their analogs hybridize by hydrogen bonding which includes reverse Watson-Crick, Hoogsteen or Hoogsteen hydrogen bonding between complementary bases. Generally, nucleic acid molecules consist of nitrogenous bases that are pyrimidines (cytosine

Petition 870170040657, of 6/13/2017, p. 28/184

23/88 (C), uracil (U) and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine and the binding of pyrimidine to purine is referred to as base pairing. More specifically, A will make a hydrogen bond with T or U and G will make a bond with C. Complementary refers to the base pairing that occurs between two different nucleic acid sequences or two different regions of the same nucleic acid sequence.

[0042] Specifically hybridizable or specifically complementary are terms that indicate a sufficient degree of complementarity so that a stable and specific link occurs between the oligonucleotide and the target DNA or RNA. The oligonucleotide does not need to be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when the binding of the oligonucleotide to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA and there is a sufficient degree of complementarity to avoid non-specific binding to the oligonucleotide with sequences not something under conditions where binding is desirable, for example, under physiological conditions in the case of in vivo assays or systems. Said connection is referred to as specific hybridization.

[0043] Hybridization conditions resulting from particular degrees of stringency will vary depending on the nature of the hybridization method chosen and the composition and length of the hybridization nucleic acid sequences. Generally, the hybridization temperature and ionic resistance (specifically, the Na + and / or Mg2 + concentration) of the hybridization buffer will contribute to the hybridization stringency, although cleaning periods also influence the stringency. Calculations related to the hybridization conditions necessary to reach specific degrees of rigor are discussed. Petition 870170040657, of 06/13/2017, p. 29/184

24/88 dos in Sambrooket al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed . , vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, chs. 9 and 11.

[0044] As used in this document, stringent conditions encompass conditions under which hybridization will occur only if there is less than 50% disparity between the hybridization molecule and the target DNA. Strict conditions include additional particular levels of rigor. Thus, as used in this document, conditions of moderate stringency are those under which molecules with more than 50% sequence disparity do not hybridize; high stringency conditions are those under which sequences with more than 20% disparity will not hybridize; and very high stringency conditions are those under which sequences with more than 10% disparity will not hybridize.

[0045] In particular modalities, stringent conditions may include hybridization at 65 ° C followed by washes at 65 ° C with 0.1x SSC / 0.1% SDS for 40 minutes.

[0046] Following non-limiting representative hybridization conditions:

[0047] Very high stringency: Hybridization in 5x SSC buffer at 65 ° C for 16 hours: wash twice in 2x SSC buffer at room temperature for 15 minutes each: and wash twice in 0.5x SSC buffer at 65 ° C for 20 minutes each.

[0048] High stringency: Hybridization in 5x-6x SSC buffer at 65-70 ° C for 16-20 hours: wash twice in 2x SSC buffer at room temperature for 5-20 minutes each: and wash twice in 1x SSC buffer at 55-70 ° C for 30 minutes each.

[0049] Moderate stringency: Hybridization in 6x SSC buffer at room temperature at 55 ° C for 16-20 hours; wash in at least twice in 2x-3x SSC buffer at room temperature 870170040657, dated 06/13/2017, pg. 30/184

25/88 at 55 ° C for 20-30 minutes each.

[0050] In particular embodiments, specifically hybridizable nucleic acid molecules can remain bound under hybridization conditions with very high stringency. In these and in additional embodiments, specifically hybridizable nucleic acid molecules can remain bound under highly stringent hybridization conditions. In these and in additional embodiments, specifically hybridizable nucleic acid molecules can remain bound under hybridization conditions with moderate stringency. [0051] Oligonucleotide: An oligonucleotide is a short nucleic acid polymer. Oligonucleotides can be formed by cleaving larger segments of nucleic acids or by polymerizing individual nucleotide precursors. Automatic synthesizers allow the synthesis of oligonucleotides up to several hundred base pairs in length. Since oligonucleotides can bind to a complementary nucleotide sequence, they can be used as probes to detect DNA or RNA. Oligonucleotides composed of DNA (oligodeoxyribonucleotides) can be used in PCR, a technique for amplifying small DNA sequences. In PCR, the oligonucleotide is typically referred to as a primer that allows a DNA polymerase to extend the oligonucleotide and replicate the complementary strand.

[0052] As used in this document, the term sequence identity in the context of two nucleic acid or polypeptide sequences can refer to residues in the two sequences that are the same when aligned for maximum matching over a specified comparison window.

[0053] As used in this document, the term percent sequence identity can refer to the value determined by comparing two sequences ideally aligned (for example, sePetição 870170040657, 06/13/2017, p. 31/184

26/88 nucleic acid sequences and amino acid sequences) over a comparison window, where the portion of the sequence in the comparison window may comprise additions or deletions (for example, gaps) compared to the reference sequence (which does not comprise additions) or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions in which the identical nucleotide or amino acid residue occurs in both sequences to produce the number of corresponding positions, dividing the number of corresponding positions by the total number of positions in the comparison window and multiplying the result per 100 to produce the percentage of the sequence identity.

[0054] Methods for aligning sequences for comparison are well known in the art. Various alignment programs and algorithms are described, for example, in: Smith and Waterman (1981) Adv. Appl. Math. 2: 482; Needleman and Wunsch (1970) J. Mol. Biol. 48: 443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. U.S.A. 85: 2444; Higgins and Sharp (1988) Gene 73: 237-44; Higgins and Sharp (1989) CABIOS 5: 151-3; Corpet et al. (1988) Nucleic Acids Res. 16: 10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8: 155-65; Pearson et al. (1994) Methods Mol. Biol. 24: 307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174: 247-50. A detailed consideration of the sequence alignment methods and homology calculations can be found in, for example, Altschul et al. (1990) J. Mol. Biol. 215: 403-10.

[0055] The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST ™; Altschul et al. (1990)) is available from several sources, including the National Center for Biotechnology Information (Bethesda, MD), and on the internet, for use in connection with various sequence analysis programs. A description of how to determine sequence identity using this program is available on the internet in the help section for BLAST ™. PaPetição 870170040657, dated 06/13/2017, p. 32/184

27/88 For nucleic acid sequence comparisons, the Blast 2 sequences function of the BLAST ™ program (Blastn) can be used by standardized parameters. Nucleic acid sequences with even greater similarity to the reference sequences will exhibit progressive percent identity when evaluated by this method.

[0056] As used herein, the term operably linked refers to a first nucleic acid sequence that is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second acid sequence nucleic. For example, a promoter is operably linked to a coding sequence when the promoter affects the transcription or expression of the coding sequence. When produced recombinantly, sequences of operably linked nucleic acids are generally contiguous and, when necessary, join two protein coding regions in the same reading frame. However, elements need to be contiguous to be operationally linked.

[0057] As used in this document, the term promoter refers to a region of DNA that is usually located upstream (towards the 5 'region of a gene) of a gene and is necessary to initiate and induce transcription of the gene. A promoter may allow the activation or adequate repression of a gene that controls it. A promoter can contain specific sequences that are recognized by transcription factors. These factors can be linked to a DNA promoter sequence that results in the recruitment of DNA polymerase, an enzyme that synthesizes RNA from the coding region of the gene. The promoter generally refers to all gene regulatory elements located upstream of the gene, including upstream promoters, 5'-RTU, introns and leader sequences.

[0058] As used in this document, the term promoter to

Petition 870170040657, of 6/13/2017, p. 33/184

28/88 amount refers to a contiguous polynucleotide sequence that is sufficient to guide the initiation of transcription. As used in this document, an upstream promoter encompasses the transcription initiation site with several sequence motifs that includes TATA box, primer sequence, TFIIB recognition elements and other promoter motifs (Jennifer, EF et al., (2002 ) Genes & Dev., 16: 2583-2592). The upstream promoter provides the site of action for RNA polymerase II which is a multi-subunit enzyme with general or baseline transcription factors such as TFIIA, B, D, R, F and H. These factors come together in a pre complex - initiation of transcription that catalyzes RNA synthesis from the DNA model.

[0059] Activation of the upstream promoter is done by the additional sequence of DNA sequence regulatory elements to which several proteins bind and subsequently interact with the transcription initiation complex to activate the expression of genes. These sequences of gene regulatory elements interact with specific DNA binding factors. These sequence motifs can sometimes be referred to as cis elements. Such cis elements to which tissue-specific and developmental-specific transcription factors bind, individually or in combination, can determine the pattern of spatio-temporal expression of a promoter at the transcriptional level. These cis elements vary greatly in the type of control they exercise on the operationally linked genes. Some elements act to increase the transcription of genes operationally linked in response to environmental responses (for example, temperature, humidity and injury). Other cis elements can respond to development clues (eg, germination, seed maturation and flowering) and spatial information (eg, tissue specificity). See, for example, Langridge et al., (1989) Proc. Natl. Acad. Sci. USA 86: 3219-23. Those

Petition 870170040657, of 6/13/2017, p. 34/184

29/88 cis elements are located at a varying distance from the starting point of transcription, some cis elements (called proximal elements) are adjacent to a minimal nucleus promoter region although other elements can be positioned several kilobases upstream or downstream downstream of the promoter (potentializers). [0060] As used in this document, the terms 5 'or 5'-UTR untranslated region are defined as the untranslated segment at the 5' terminal of mature pre-mRNAs or mRNAs. For example, in mature mRNAs, a 5'-RTU normally houses, at its 5 'end, * pg21a 7-methylguanosine cap and is involved in many processes, such as splicing, polyadenylation, mRNA export towards the cytoplasm, identification of the 5 'end of the mRNA by the translational machinery, and protection of the mRNAs against degradation.

[0061] As used herein, the term transcription terminator is defined as the segment transcribed at the 3 'terminal of mature pre-mRNAs or mRNAs. For example, longer stretches of DNA beyond the polyadenylation signal site are transcribed as a pre-mRNA. This DNA sequence usually contains a transcription termination signal for proper processing of the premRNA into the mature mRNA.

[0062] As used in this document, the terms 3 'or 3'-UTR untranslated region are defined as the untranslated segment at the 3' terminal of mature pre-mRNAs or mRNAs. For example, in mature mRNAs, this region is home to the poly (A) tail and is known to have many roles in mRNA stability, initiation of translation and mRNA export. In addition, 3'-UTR is considered to include the polyadenylation signal and transcription terminator.

[0063] As used in this document, the term pulley signalPetition 870170040657, dated 06/13/2017, p. 35/184

Denilation refers to a sequence of nucleic acids present in mRNA transcripts that allows transcripts, when in the presence of a poly (A) polymerase, to be polyadenylated at the polyadenylation site, for example, located at bases 10 to 30 downstream of the poly- (A) signal. Many polyadenylation signals are known in the art and are useful for the present invention. An exemplary sequence includes AAUAAA and variants thereof, as described in Loke J., etal., (2005) Plant Physiology 138 (3); 1457-1468.

[0064] A DNA binding transgene is a polynucleotide coding sequence that encodes a DNA binding protein. The DNA-binding protein is subsequently able to bind to another molecule. A binding protein can bind to, for example, a DNA molecule (a DNA binding protein), an RNA molecule (an RNA binding protein), and / or a protein molecule (a binding protein the protein). In the case of a protein-binding protein, it can bind itself (to form homodimers, homotrimers, etc.) and / or it can bind to one or more molecules of a different protein or proteins. A binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA-binding, RNA-binding and protein-binding activity.

[0065] Examples of DNA binding proteins include; meganucleases, zinc fingers, CRISPRs and TALE binding domains that can be genetically engineered to bind to a predetermined nucleotide sequence. Typically, genetically engineered DNA-binding proteins (for example, zinc fingers, CRISPRs or TALEs) are non-naturally occurring proteins. Non-limiting examples of methods for genetically engineered DNA binding proteins are design and selection. A projected DNA-binding protein is a protein that does not occur in naturePetition 870170040657, 06/13/2017, p. 36/184

31/88 za whose design / composition results mainly from rational criteria. Rational design criteria include applying substitution rules and computerized algorithms to process information in an existing ZFP, CRISPR and / or TALE information storage database and link data. See, for example, US Patents 6,140,081; 6,453,242 and 6,534,261; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496 and US Publications No. 20110301073, 20110239315 and 20119145940.

[0066] A zinc finger DNA binding protein (or binding domain) is a protein or domain within a larger protein that binds to DNA in a specific sequence way through one or more zinc fingers that are regions of amino acid sequences within the binding domain whose structure is stabilized through the coordination of a zinc ion. The term zinc finger DNA binding protein is generally abbreviated as a zinc finger protein or ZFP. Zinc finger binding domains can be genetically engineered to bind to a predetermined nucleotide sequence. Non-limiting examples of methods for genetic manipulation of zinc finger proteins are design and selection. A designed zinc finger protein is a protein that does not occur in nature whose design / composition results mainly from rational criteria. Rational design criteria include application of substitution rules and computerized algorithms to process information in an information storage database of existing ZFP drawings and binding data. See, for example, Pat. No. 6,140,081; 6,453,242; 6,534,261 and 6,794,136; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496.

[0067] In other examples, the DNA-binding domain of a

Petition 870170040657, of 6/13/2017, p. 37/184

32/88 or more of the nucleases comprises a naturally occurring DNA binding domain or genetically engineered TAL (non-naturally occurring). See, for example, US Patent Publication No. 20110301073, incorporated by reference in its entirety into this document. Pathogenic bacteria from plants of the genus Xanthomonas are known to cause many diseases in plants of important crops. The pathogenicity of Xanthomonas depends on a conserved type III secretion system (T3S) that injects more of different effector proteins into the plant cell. Among these injected proteins are transcription activator-type effectors (TALEN) that mimic plant transcriptional activators and manipulate the transcriptome (see Kay et al., (2007) Science 318: 648-651). These proteins contain a DNA binding domain and a transcriptional activation domain. One of the best characterized TAL effectors is AvrBs3 from Xanthomonas campestgrispv. Vesicatoria (see Bonas et al., (1989) Mol Gen Genet 218: 127-136 and WO2010079430). TAL effectors contain a centralized domain of tandem repeats, each repeat containing approximately 34 amino acids that are key to the specificity of the DNA binding of these proteins. In addition, they contain a nuclear localization sequence and an acid transcriptional activation domain (for an analysis, see Schornack S, et al., (2006) J Plant Physiol 163 (3): 256-272). In addition, in the phytopathogenic bacteria Ralstonia solanacearum, two genes, named brg11 and hpx17, were found to be homologous to the AvrBs3 family of Xanthomonas in the GMI1000 biovar strain and in the RS1000 biovar 4 strain of R. solanacearum (See Heuer et al. ( 2007) Appl and Enviro Micro 73 (13): 4379-4384). These genes are 98.9% identical in the nucleotide sequence of each, but differ by a deletion of 1.575 bp in the hpx17 repeat domain. However, both gene products have less than 40% sequence identity

Petition 870170040657, of 6/13/2017, p. 38/184

33/88 with proteins from the Xanthomonas AvrBs3 family. See, for example, US Patent Publication No. 20110301073, incorporated by reference in its entirety into this document.

[0068] The specificity of these TAL effectors depends on the sequences found in the tandem repetitions. The repeated sequence comprises approximately 102 bp and the repetitions are typically 91-100% homologous with each other (Bonas et al., Ibid). The repetition polymorphism is usually located at positions 12 and 13 and appears to be a one-to-one correspondence between the identity of hypervariable di-residues at positions 12 and 13 with the identity of contiguous nucleotides in the target sequence of TAL effectors (see Moscow and Bogdanove, (2009) Science 326: 1501 and Boch et al., (2009) Science 326: 1509-1512). Experimentally, the natural code for DNA recognition of these TAL effectors has been determined so that an HD sequence at positions 12 and 13 results in binding to cytosine (C), NG binds to T, NI to A, C, G or T , NN binds to A or G and ING binds to T. These DNA binding repeats have been assembled into proteins with new combinations and numbers of repeats to create artificial transcription factors that are able to interact with new sequences and activate expression of a non-endogenous reporter gene in plant cells (Boch et al., ibid). Genetically engineered TAL proteins have been linked to an I Fok cleavage domain medium to result in a TAL effector domain nuclease fusion (TALEN) exhibiting activity in a yeast reporter assay (plasmid based target).

[0069] The CRISPR nuclease system (Short Palindromic Repeats Grouped and Regularly Interspaced) / Cas (Associated with CRISPR) is a nuclease system recently manipulated genetically based on a bacterial system that can be used for genome engineering. It is based in part on the immune response

Petition 870170040657, of 6/13/2017, p. 39/184

34/88 adaptive of many bacteria and Archaea. When a virus or plasmid invades a bacterium, the invading DNA segments are converted into CRISPR RNAs (crRNA) by the immune response. This crRNA then associates through a region of additional complementarity with another type of RNA called tracrRNA to guide the Cas9 nuclease to a region homologous to the crRNA in the target DNA called a protospace. Cas9 cleaves the DNA to generate double-stranded blanks (DSB) at the sites specified by a 20 nucleotide guide sequence contained within the crRNA transcript. Cas9 requires both crRNA and tracrRNA for recognition and cleavage of site-specific DNA. This system has now been genetically engineered so that the crRNA and tracrRNA can be combined into one molecule (the single guide RNA) and the equivalent crRNA portion of the single guide RNA can be genetically engineered to guide the Cas9 nuclease to target any desired sequence (see Jinek et al., (2012) Science 337, pp. 816-821, Jinek et al., (2013), eLife 2: e00471, and David Segal, (2013) eLife 2: e00563). Thus, the CRISPR / Cas system can be genetically engineered to create a DSB on a desired target in a genome and repairing the DSB can be influenced by the use of repair inhibitors to cause an increase in error-prone repair.

[0070] In other examples, the DNA binding transgene is a site-specific nuclease comprising a genetically engineered (non-naturally occurring) endangered Meganuclease (also described as a return endonuclease). Recognition sequences of return endonucleases or meganucleases such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsrnI, I-PanI, I-SceII, I-PpoI, I- SceIII, I-CreI, I-TevI, I-TevII and I-TevIII are known. See also US Patent No. 5,420,032; US Patent No. 6,833,252; Belfort et al., (1997) Nucleic Acids Res. 25: 3379-30 3388; Dujon et al., (1989)

Petition 870170040657, of 6/13/2017, p. 40/184

35/88

Gene 82: 115-118; Perler et al., (1994) Nucleic Acids Res. 22, 11127; Jasin (1996) Trends Genet. 12: 224-228; Gimble et al., (1996) J. Mol. Biol. 263: 163-180; Argast et al., (1998) J. Mol. Biol. 280: 345-353 and the New England Biolabs catalog. In addition, the DNA binding specificity of returning endonucleases and meganucleases can be engineered to bind to unnatural target sites. See, for example, Chevalier et al., (2002) Molec. Cell 10: 895-905; Epinat et al., (2003) Nucleic Acids Res. 5 31: 2952-2962; Ashworth et al., (2006) Nature 441: 656-659; Paques et al., (2007) Current Gene Therapy 7: 49-66; US Patent Publication No. 20070117128. The DNA binding domains of returning endonucleases and meganucleases can be altered in the context of the nuclease as a whole (for example, so that the nuclease includes the cognate cleavage domain) or can be fused in a heterologous cleavage domain. [0071] As used in this document, the term transformation encompasses all the techniques that a nucleic acid molecule can be introduced into said cell. Examples include, but are not limited to: transfection with viral vectors; transformations with plasmid vectors: electroporation; lipofection; microinjection (Mueller et al., (1978) Cell 15: 579-85); Agrobacterium-mediated transfer; direct DNA uptake; WHISKERS ™ -mediated transformation; and a bombardment of microprojectiles. These techniques can be used for stable and transient transformation of a plant cell. Stable transformation refers to the introduction of a nucleic acid fragment into a host organism's genome resulting in genetically stable inheritance. When transformed stably, the nucleic acid fragment is stably integrated into the genome of the host organism and any subsequent generation. Host organisms containing the transformed nucleic acid fragments are referred to as transgenic organisms. Petition 870170040657, 06/13/2017, p. 41/184

36/88 cos. Transient transformation refers to the introduction of a nucleic acid fragment into the nucleus or organelle containing DNA from a host organism resulting in expression of genes without genetically stable inheritance.

[0072] An exogenous nucleic acid sequence. In one example, a transgene is a sequence of genes (for example, a herbicide-resistant gene), a gene that encodes an industrially or pharmaceutically useful compound, or a gene that encodes a desirable agricultural trait. In yet another example, the transgene is an antisense nucleic acid sequence in which the expression of the antisense nucleic acid sequence inhibits the expression of a target nucleic acid sequence. A transgene can contain regulatory sequences operably linked to the transgene (for example, a promoter). In some embodiments, a sequence of polynucleotides of interest is a transgene. However, in other embodiments, a polynucleotide sequence of interest is an endogenous nucleic acid sequence in which additional genomic copies of the endogenous nucleic acid sequence are desirable or a nucleic acid sequence that is in the antisense orientation with respect to the sequence of a target nucleic acid molecule in a host organism.

[0073] As used in this document, the term a transgenic event is produced by transforming plant cells with heterologous DNA, that is, a nucleic acid construct that includes a transgene of interest, regeneration of a plant population resulting from the insertion of the transgene in the plant genome and selection of a particular plant characterized by insertion into a particular location in the genome. The term event refers to the original transformant and progeny of the transformant that includes heterologous DNA. The term event also refers to the progeny produced by a crossbreeding. Petition 870170040657, of 06/13/2017, p. 42/184

37/88 between the transformant and another variety that includes genomic / transgene DNA. Even after repeated crossing in a recurrent relative, the inserted transgene DNA and flanking genomic DNA (genomic / transgene DNA) from the transformed relative is present in the progeny of the crossing at the same chromosomal site. The term event also refers to the DNA of the original transformant and its progeny comprising the inserted DNA and flanking genomic sequence immediately adjacent to the inserted DNA that is expected to be transferred to a progeny that receives inserted DNA, including the transgene of interest as a result of a sexual cross of a parental lineage that includes the inserted DNA (for example, the original transformant and progeny resulting from self-crossing) and a parental lineage that does not contain the inserted DNA.

[0074] As used herein, the terms Polymerase Chain Reaction or PCR define a procedure or technique in which minute amounts of nucleic acid, RNA and / or DNA are amplified as described in Pat. US No. 4,668 3,195 issued July 28, 1987. Generally, sequence information at the ends of the region of interest or beyond needs to be available so that oligonucleotide primers can be designated and these primers will be identical or similar in sequence to those opposite strips of the model to be amplified. The 5 'terminal nucleotides of the two primers can match the ends of the amplified material. PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, etc. See generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51: 263 (1987); Erlich, ed., PCR Technology, (Stockton Press, NY,

Petition 870170040657, of 6/13/2017, p. 43/184

38/88

1989).

[0075] As used in this document, the term primer refers to an oligonucleotide capable of acting as a synthesis initiation point together with a complementary strand when conditions are suitable for synthesis of an initiator extension product. Synthesis conditions include the presence of four different deoxyribonucleotide triphosphates and at least one polymerization inducing agent such as reverse transcriptase or DNA polymerase. These are present in a suitable buffer that can include constituents that are cofactors or that affect conditions such as pH and the like at various suitable temperatures. A primer is preferably a single strand sequence so that amplification efficiency is optimized, but double strand strings can be used.

[0076] As used in this document, the term probe refers to an oligonucleotide that hybridizes to a target sequence. In the TaqMan ^® or TaqMan ^® style test procedure, the probe hybridizes to a portion of the target located between the annealing site and the two primers. A probe includes about eight nucleotides, about ten nucleotides, about fifteen nucleotides, about twenty nucleotides, about thirty nucleotides, about forty nucleotides or about fifty nucleotides. In some embodiments, a probe includes from about eight nucleotides to about fifteen nucleotides. A probe can also include a detectable marker, for example, a fluorophore (Texas-Red®, Fluorescein isothiocyanate, etc.). The detectable marker can be covalently linked directly to the probe oligonucleotide, for example, located at the 5 'end of the probe or at the 3' end of the probe. A probe including a fluorophore can also include a suppressor, for example, Black Hole Quencher ™, Iowa Black ™, etc.

Petition 870170040657, of 6/13/2017, p. 44/184

39/88 [0077] As used herein, the terms restriction endonucleases and restriction enzymes refer to bacterial enzymes that cut double-stranded DNA at or near the specific nucleotide sequence. Type-2 restriction enzymes recognize and cleave DNA at the same site and include, but are not limited to XbaI, BamHI, HindIII, EcoRI, XhoI, SalI, KpnI, AvaI, PstI and SmaI.

[0078] As used in this document, the term vector is used interchangeably with the terms construct, cloning vector and expression vector and means the vehicle by which a DNA or RNA sequence (for example, a foreign gene) can be introduced into a host cell in order to transform the host and promote expression (for example, transcription and translation) of the introduced sequence. A non-viral vector is intended to mean any vector that does not comprise a virus or retrovirus. In some embodiments, a vector is a DNA sequence comprising at least one DNA replication origin and at least one selectable marker gene. Examples include, but are not limited to, a plasmid, cosmid, bacteriophage, bacterial artificial chromosome (BAC) or virus that carries exogenous DNA into a cell. A vector can also include one or more genes, antisense molecules, and / or selectable marker genes and other genetic elements known in the art. A vector can transduce, transform or infect a cell, thereby causing the cell to express the nucleic acid molecules and / or proteins encoded by the vector. The term plasmid defines a circular strand of nucleic acids capable of autosomal replication in a prokaryotic or eukaryotic host cell. The term includes nucleic acid which can be DNA or RNA and can be single or double stranded. The definition plasmid can also include sequences that correspond to a bacterial origin of replication.

Petition 870170040657, of 6/13/2017, p. 45/184

40/88 [0079] As used in this document, the term selectable marker gene as used in this document defines a gene or other expression cassette that encodes a protein that facilitates the identification of cells in which the selectable marker gene is inserted. For example, a selectable marker gene encompasses reporter genes as well as genes used in plant transformation to, for example, protect plant cells from a selective agent or provide resistance / tolerance to a selective agent. In one embodiment, only those cells or plants that receive a selectable functional marker are able to divide or grow under conditions with a selective agent. Examples of selective agents can include, for example, antibiotics, including spectinomycin, neomycin, kanamycin, paromomycin, gentamicin and hygromycin. These selectable markers include neomycin phosphotransferase (npt II) which expresses an enzyme that confers resistance to antibiotic kanamycin and genes for related antibiotics, neomycin, paromomycin, gentamicin and G418 and the gene for hygromycin phosphotransferase (hpt) that expresses an enzyme that confers resistance to hygromycin. Other selectable marker genes may include genes that encode herbicide resistance including bar or pat (resistance to ammonium glufosinate or phosphinothricin), acetolactate synthase (ALS, resistance against inhibitors such as sulfonylureas (SUs), imidazolinones (IMIs), triazolopyrimidines (TPs ), pyrimidinyl oxybenzoates (POBs), and sulfonylamino carbonyl triazolinones that prevent the first step in the synthesis of branched chain amino acids), glyphosate, 2,4-D and resistance or sensitivity to metals. Examples of reporter genes that can be used as a selectable marker gene include visual observation of expressed reporter gene proteins such as proteins encoding β-glucuronidase (GUS), luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP) , DsRed, βPetition 870170040657, of 06/13/2017, p. 46/184

41/88 galactosity, chloramphenicol acetyltransferase (CAT), alkaline phosphatase and the like. The phrase positive marker refers to plants that have been transformed to include a selectable marker gene. [0080] As used in this document, the term detectable marker refers to a marker capable of detection, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, chemiluminescent compound, metallic chelator or enzyme. Examples of detectable markers include, but are not limited to, the following: fluorescent markers (eg, FITC, rhodamine, lanthanide phosphors), enzyme markers (eg, horseradish peroxidase, β-galactosity, luciferase, alkaline phosphatase), chemiluminescent, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, secondary antibody binding sites, metal binding domains, epitope flags). In one embodiment, a detectable marker can be connected by the spacer arms of various lengths to reduce the potential steric impediment.

[0081] As used in this document, the terms cassette, expression cassette and gene expression cassette refer to a segment of DNA that can be inserted into a nucleic acid or polynucleotide at specific restriction sites or by homologous recombination. As used in this document, the DNA segment comprises a polynucleotide that encodes a polypeptide of interest and the cassette and restriction sites are designed to ensure insertion of the cassette into the appropriate reading frame for transcription and translation. In one embodiment, an expression cassette can include a polynucleotide that encodes a polypeptide of interest and that contains elements in addition to the polynucleotide that facilitates the transformation of a particular host cell. In one embodiment, a

Petition 870170040657, of 6/13/2017, p. 47/184

The expression gene may also include elements that allow increased expression of a polynucleotide that encodes a polypeptide of interest in a host cell. Such elements may include, but are not limited to: a promoter, a minimal promoter, an enhancer, a response element, a terminator sequence, a polyadenylation sequence and the like.

[0082] As used in this document, a linker or spacer is a bond, molecule or group of molecules that link two separate entities into one another. Connectors and spacers can provide optimal spacing of two entities and can also provide a labile connection that allows two entities to be separated from each other. Labile bonds include photocleavable groups, acid labile fractions, base labile fractions and enzyme cleavable groups. The term polylinker or multiple cloning site as used in this document defines a group of three or more type 2 restriction enzyme sites located within 10 nucleotides of one another in a nucleic acid sequence. In other cases, the term polylinker, as used in this document, refers to a stretch of nucleotides that are directed to join two sequences by means of any seamless cloning method (i.e., GibsonAssembly®, NEBuilder HiFiDNA Assembly®, Golden Gate Assembly, BioBrick® Assembly, etc.). Constructs comprising a polylinker are used for insertion and / or excision of nucleic acid sequences such as a gene's coding region. [0083] As used in this document, the term control refers to a sample used in an analytical procedure for comparison purposes. A control can be positive or negative. For example, where the purpose of an analytical procedure is to detect a differential transcript or polypeptide expressed in cells or tissue, it is generally preferable to include a positive control such as 870170040657, of 06/13/2017, p. 48/184

43/88 a sample of a known plant exhibiting the desired expression and a negative control, such as a sample of a known plant lacking the desired expression.

[0084] As used in this document, the term plant includes an entire plant and any descendant, cell, tissue or part of a plant. A class of plant that can be used in the present invention is generally as broad as the class of upper and lower plants receptive to mutagenesis including angiosperms (monocot and dicot plants), gymnosperms, ferns and multicellular algae. Thus, plant includes dicotyledonous and monocotyledonous plants. The term plant parts includes any part (s) of a plant, including, for example, and without limitation: seed (including mature seed and immature seed), a plant cut: a plant cell; a plant cell culture; a plant organ (for example, pollen, embryo, flowers, fruits, branches, leaves, roots, stems and explants). A plant tissue or plant organ can be a seed, protoplast, callus or any other group of plant cells that is organized into a structural or functional unit. A plant cell or tissue culture may be able to regenerate a plant containing the physiological and morphological characteristics of the plant from which the cell or tissue was obtained and to regenerate a plant significantly with the same genotype as the plant. In contrast, some plant cells are not able to be regenerated to produce plants. Regenerable cells in a plant cell or tissue culture can be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, root tips, silks, flowers, nuclei, ears, cobs, barks or stems.

[0085] Plant parts include parts that can be harvested and parts useful for propagation of progeny plants. Parts of plants useful for propagation include, for example, and without limitation: sePetição 870170040657, dated 06/13/2017, p. 49/184

44/88 mind; fruit; a cut; a seedling; a bulb and a rhizome. A harvestable part of a plant can be any useful part of a plant, including, for example and without limitation: flower; pollen; changes; bulb; leaf; stalk; fruit; seed and root.

[0086] A plant cell is the structural and physiological unit of the plant, comprising a protoplast and a cell wall. A plant cell can be in the form of a single isolated cell or an aggregate of cells (for example, a friable callus and a cultured cell) and can be part of a higher organized unit (for example, a plant tissue, an organ plant and plant). Thus, a plant cell can be a protoplast, a gamete-producing cell, or a cell or set of cells that can regenerate in an entire plant. As such, a seed that comprises multiple plant cells and is capable of regenerating an entire plant is considered to be a plant cell in the modalities of this document.

[0087] As used in this document, the term small RNA refers to several classes of non-coding ribonucleic acids (ncRNA). The term small RNA describes short chains of ncRNA produced in bacterial cells, animals, plants and fungi. These short ncRNA strands can be produced naturally within the cell or can be produced by introducing an exogenous sequence that expresses the short chain or ncRNA. Small RNA sequences do not code directly for a protein and differ depending on another RNA in that small RNA sequences are only transcribed and not translated. Small RNA sequences are involved in other cellular functions, including gene expression and modification. Small RNA molecules are generally made up of about 20 to 30 nucleotides. Small RNA sequences can be derived from larger precursors. PREPETITION 870170040657, of 06/13/2017, p. 50/184

45/88 cursors form structures that double over each other in self-complementary regions that are processed by the nuclease Dicer in animals or DCL1 in plants.

[0088] Many types of small RNA exist naturally or are produced artificially, including microRNAs (miRNAs), short interference RNA (siRNAs), antisense RNA, short hook RNA (shRNA) and small nucleolar RNAs (snoRNAs). Certain types of small RNA, such as microRNA and siRNA, are important in gene silencing and RNA interference (RNAi). Gene silencing is a process of genetic regulation in which a gene that would normally be expressed is turned off by an intracellular element, in this case, the small RNA. The protein that would normally be formed by this genetic formation is not formed due to interference and the information encoded in the gene is blocked by expression.

[0089] As used in this document, the term small RNA encompasses RNA molecules described in the literature as tiny RNA (Storz, (2002) Science 296: 1260-3; Illangasekare et al., (1999) RNA 5: 1482-1489) ; small prokaryotic RNA (sRNA) (Wassarman et al., (1999) Trends Microbiol. 7: 37-45); noncoding eukaryotic RNA (ncRNA); micro-RNA (miRNA); small non-mRNA (snmRNA); functional RNA (fRNA); transfer RNA (tRNA); catalytic RNA [e.g., ribozymes, including self-acylating ribozymes (Illangaskare et al., (1999) RNA 5: 1482-1489); small nucleolar RNAs (snoRNAs), tmRNA (also known as 10S RNA, Muto et al., (1998) Trends Biochem Sci. 23: 25-29; and Gillet et al., (2001) Mol Microbiol. 42: 879-885 ); RNAi molecules, including, without limitation, small interfering RNA (siRNA), endoribonuclease-prepared siRNA (e-siRNA), short hairpin RNA (shRNA), and small temporally regulated RNA (stRNA), diced siRNA (d-siRNA), and aptamers, oligonucleotides and other nucleic acids

Petition 870170040657, of 6/13/2017, p. 51/184

46/88 synthetics that comprise at least one uracil base.

[0090] Unless specifically explained to the contrary, all technical and scientific terms used in this document have the same meaning as commonly understood by those skilled in the art. Definitions of common terms in molecular biology can be found in, for example: Lewin, Genes V, Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Meyers (ed.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

[0091] As used in this document, one, one and a / o include references in the plural, unless the context dictates clearly and ambiguously to the contrary.

III. Regulatory Elements of the Ubiquitin-3 Gene of Oryza sativa and

Nucleic Acids Understanding the Same [0092] Methods and compositions are provided for using a promoter or a 3 'UTR of a Ubiquitin-3 gene from Oryza sativa to express transgenes similar to the Ubiquitin-3 gene from non-Oryza sativa in plants . In one embodiment, a 3 'UTR can be the 3' UTR of the Ubiquitin-3 gene from Oryza sativa of SEQ ID NO: 1.

[0093] Transgene expression can be regulated by the 3 'untranslated gene region (ie, 3'UTR) located downstream of the gene's coding sequence. Both the promoter and a 3 'UTR can regulate the expression of the transgene. Although a promoter is required to induce transcription, a region of the 3 'UTR gene can terminate transcription and initiate polyadenylation of a resulting mRNA transcript for translation and protein synthesis. A 3 'UTR gene region assists in the stable expression of a transgene. In a modaliPetição 870170040657, of 06/13/2017, p. 52/184

47/88, a gene expression cassette comprises a 3'-RTU. In one embodiment, a 3'-UTR can be a 3'-UTR of the Ubiquitin-3 gene from Oryza sativa. In one embodiment, a gene expression cassette comprises a 3'-RTU, in which the 3'-RTU is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 1. In one embodiment, a gene expression cassette comprises a 3'-RTU of the Oryza sativa Ubiquitin-3 gene that is operationally linked to a transgene. In an illustrative embodiment, a gene expression cassette comprises a 3'-RTU that is operationally linked to a transgene, where the transgene can be an insecticide resistance transgene, a herbicide tolerance transgene, a use efficiency transgene nitrogen, a water-efficient transgene, a nutritional-quality transgene, a DNA-binding transgene, a selectable marker transgene, or combinations thereof.

[0094] In one embodiment, a gene expression cassette comprises the 3 'UTR of a Ubiquitin-3 gene from Oryza sativa and a promoter, where the promoter is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 2. In one embodiment, a gene expression cassette comprises the 3 'UTR of a Ubiquitin-3 gene from Oryza sativa and a promoter, wherein the promoter is from a Ubiquitin-3 gene from Oryza sativa. In one embodiment, a gene expression cassette comprises the 3 'UTR of an Oryza sativa Ubiquitin-3 gene and a promoter, in which the promoter originates from a plant (for example, promoter of the chlorophyll-binding protein gene a / b of Zea mays or Zea mays Ubiquitin 1 promoter), a virus (for example, Cassava rib mosaic virus promoter), or a bacterium (for example, delta mas de Agrobacterium tumefaciens).

Petition 870170040657, of 6/13/2017, p. 53/184

48/88

In an illustrative embodiment, a gene expression cassette comprises a 3 'UTR of the Ubiquitin-3 gene from Oryza sativa that is operationally linked to a transgene, where the transgene can be an insecticide-resistant transgene, a transgene of tolerance to herbicides, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.

[0095] In one embodiment, a nucleic acid vector comprises a gene expression cassette as disclosed in this document. In one embodiment, a vector can be a plasmid, a cosmid, a bacterial artificial chromosome (BAC), a bacteriophage, a virus or a polynucleotide fragment excised for use in direct transformation or targeting a gene such as a donor DNA.

[0096] According to one embodiment, a nucleic acid vector is provided which comprises a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a 3'UTR of the Oryza sativa Ubiquitin-3 gene operably linked to a polylinker sequence, to a Ubiquitin-3 gene from non-Oryza sativa or combinations thereof. In one embodiment, the recombinant gene cassette comprises a 3'UTR of the Oryza sativa Ubiquitin-3 gene operably linked to a non-Oryza sativa Ubiquitin-3 gene. In one embodiment, the recombinant gene cassette comprises a 3'UTR of the Oryza sativa Ubiquitin-3 gene, as disclosed in this document, operationally linked to a polylinker sequence. The polylinker is operationally linked to the 3'UTR of the Ubiquitin-3 gene from Oryza sativa in such a way that this insertion of a coding sequence in one of the restriction sites of the polylinker will link the operationPetition 870170040657, of 06/13/2017, page . 54/184

49/88 the coding sequence, allowing the expression of the coding sequence when the vector is transformed or transfected into a host cell.

[0097] According to one embodiment, a nucleic acid vector is provided which comprises a gene cassette consisting of a gene promoter, a Ubiquitin-3 gene from non-Oryza sativa, and a 3'-UTR from the Ubiquitin gene -3 of Oryza sativa from SEQ ID NO:

1. In one embodiment, the 3 'UTR of the Oryza sativa Ubiquitin-3 gene of SEQ ID NO: 1 is operably linked to the 3' end of the non-Oryza sativa Ubiquitin-3 transgene. In another embodiment, the 3 'untranslated sequence comprises SEQ ID NO: 1, or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID NO: 1. According to In one embodiment, a nucleic acid vector is provided that comprises a gene cassette consisting of a promoter, a non-Oryza sativa Ubiquitin-3 gene and a 3 'UTR, where the promoter is operably linked to the 5' end of the non-Oryza sativa Ubiquitin-3 gene and the 3 'UTR of SEQ ID NO: 1 is operably linked to the 3' end of the non-Oryza sativa Ubiquitin-3 gene. In another embodiment, the 3 'untranslated sequence comprises SEQ ID NO: 1 or a sequence that has at least 80, 85, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 1. In another In this embodiment, the 3 'untranslated sequence consists of SEQ ID NO: 1, or a 1001 bp sequence that has 80, 85, 90, 95 or 99% sequence identity to SEQ ID NO: 1.

[0098] In one embodiment, a nucleic acid construct is provided that comprises a promoter and a Ubiquitin-3 gene from non-Oryza sativa and optionally one or more of the following elements:

a) a 5 'untranslated region;

Petition 870170040657, of 6/13/2017, p. 55/184

50/88

b) an intron; and

c) a 3 'untranslated region, [0099] where [00100] the promoter consists of SEQ ID NO: 2 or a promoter sequence known as the promoter of the Oryza sativa Ubiquitin-3 gene;

[00101] the intron region consists of a known intron sequence; and [00102] the 3 'untranslated region consists of SEQ ID NO: 1 or a sequence with 98% sequence identity to SEQ ID NO: 1; wherein, further, said promoter is operationally linked to said transgene and each optional element, when present, is also operationally linked to the promoter and transgene. In another embodiment, a transgenic cell is provided that comprises the nucleic acid construct disclosed immediately above. In one embodiment, the transgenic cell is a plant cell, and in another embodiment, a plant is provided in which the plant comprises said transgenic cells.

[00103] In one embodiment, a nucleic acid construct comprising a promoter and a transgene of Ubiquitin-3 from non-Oryza sativa and optionally one or more of the following elements is provided:

a) an intron; and

b) a 3 'untranslated region, [00104] where [00105] the promoter consists of SEQ ID NO: 2 or a promoter sequence known as the promoter for the Oryza sativa Ubiquitin-3 gene;

[00106] the intron region consists of a known intron sequence;

Petition 870170040657, of 6/13/2017, p. 56/184

51/88 [00107] the 3 'untranslated region consists of SEQ ID NO: 1 or a sequence with 98% sequence identity to SEQ ID NO: 1; wherein, further, said promoter is operationally linked to said transgene and each optional element, when present, is also operationally linked to the promoter and transgene. In another embodiment, a transgenic cell is provided that comprises the nucleic acid construct disclosed immediately above. In one embodiment, the transgenic cell is a plant cell, and in another embodiment, a plant is provided in which the plant comprises said transgenic cells.

[00108] According to one embodiment, the nucleic acid vector further comprises a sequence that encodes a selectable marker. According to one embodiment, the recombinant gene cassette is operably linked to an edge of the Agrobacterium T-DNA. According to one embodiment, the recombinant gene cassette further comprises a first and a second edge of the T-DNA, wherein the first edge of the T-DNA is operationally linked to one end of the gene construct, and the second edge of the T- DNA DNA is operationally linked to the other end of the gene construct. The first and second edges of the Agrobacterium T-DNA can be independently selected from the T-DNA edge sequences that originate from bacterial strains selected from the group consisting of an edge of the Agrobacterium T-DNA that synthesizes nopaline, an edge of the Agrobacterium T-DNA that synthesizes octopine, an edge of Agrobacterium T-DNA that synthesizes mannopine, an edge of Agrobacterium T-DNA that synthesizes succinamopin, or any combination thereof. In one embodiment, an Agrobacterium strain selected from the group consisting of a nopaline synthesizing strain, a manopin synthesizing strain, a succinamopin synthesizing strain, or a strain is provided

Petition 870170040657, of 6/13/2017, p. 57/184

52/88 octopine synthesizer, wherein said strain comprises a plasmid in which the plasmid comprises a transgene operably linked to a sequence selected from SEQ ID NO: 1 or a sequence having 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 1.

[00109] Transgenes of interest that are suitable for use in the present disclosed constructs include, but are not limited to, coding sequences that confer (1) resistance to pests or diseases, (2) tolerance to herbicides, (3) agronomic traits of added value, such as: improved yield, efficient use of nitrogen, efficient use of water and nutritional quality, (4) binding of a protein to DNA in a site-specific way, (5) expression of small RNA, and (6) selectable markers. According to one modality, the transgene encodes a selectable marker or gene product that confers resistance to insecticides, tolerance to herbicides, expression of small RNA, efficiency in the use of nitrogen, efficiency in the use of water, or nutritional quality.

1. Insect Resistance [00110] Several selectable markers are also described as reporter genes that can be operationally linked to the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa comprising SEQ ID NO: 1, or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 1. Operationally linked sequences can then be incorporated into a vector chosen to allow the identification and selection of transformed plants (transformants). Insect resistance coding sequences are known in the art. Since the modalities of insect resistance coding sequences can be operationally linked to the regulatory elements of the object of the disclosure, the following features are provided. The coding strings that PROPetition 870170040657, of 06/13/2017, p. 58/184

53/88 provide resistance to exemplary lepidopteran insects include: crylA; cry1A.105; crylAb; crylAb (truncated); cry1Ab-Ac (fusion protein); crylAc (marketed as Widestrike®); crylC; crylF (marketed as Widestrike®); cry1Fa2; cry2Ab2; cry2Ae; cry9C; mocrylF; pinlI (protease inhibitor protein); vip3A (a); and vip3Aa20. Exemplary coding sequences that provide resistance to coleopteran insects include: cry34Ab1 (marketed as Herculex®); cry35Ab1 (marketed as Herculex®); cry3A; cry3Bb1; dvsnf7; and mcry3A. Coding sequences that provide resistance to multiple exemplary insects include ecry31.Ab. The above list of insect resistance genes is not intended to be limiting. Any insect resistance genes are covered by the present disclosure.

2. Herbicide Tolerance [00111] Several selectable markers are also described as reporter genes that can be operationally linked to the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa comprising SEQ ID NO: 1, or a sequence that has 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 1. Operationally linked sequences can then be incorporated into a vector chosen to allow the identification and selection of transformed plants (transformants). Exemplary herbicide tolerance coding sequences are known in the art. Since the modalities of herbicide tolerance coding sequences can be operationally linked to the regulatory elements of the object of the disclosure, the following features are provided. The herbicide glyphosate contains a mode of action through the inhibition of the enzyme EPSPS (5enolpyruvylchiquimate-3-phosphate synthase). This enzyme is involved in the biosynthesis of aromatic amino acids that are essential for plant growth and development. Various enzymatic mechanisms are known in the art that can be used to inhibit

Petition 870170040657, of 6/13/2017, p. 59/184

54/88 this enzyme. The genes that encode these enzymes can be operationally linked to the regulatory elements of the gene of the object of the disclosure. In one embodiment, selectable marker genes include, but are not limited to, the genes encoding glyphosate resistance genes that include: mutant EPSPS genes, such as 2mEPSPS genes, cp4 EPSPS genes, mEPSPS genes, dgt-28 genes; aroA genes; and glyphosate degradation genes, such as glyphosate acetyl transferase (gat) genes and glyphosate oxidase (gox) genes. These traits are currently marketed as Gly-Tol ^TM , Optimum® GAT®, Agrisure® GT and Roundup Ready®. Resistance genes for the glufosinate and / or bialaphos compounds include the dsm-2, bar and pat genes. The bar and pat lines are currently marketed as LibertyLink®. Also included are the tolerance genes that provide resistance to 2,4-D, such as the aad-1 genes (it should be noted that the aad-1 genes have additional activity on the aryloxyphenoxypropionate herbicides) and the aad-12 genes (it should be noted that the aad-12 genes have additional activity on synthetic pyridyloxyacetate auxins). These traits are marketed as Enlist® crop protection technology. Resistance genes for ALS inhibitors (sulfonylureas, imidazolinones, triazolopyrimidines, pyrimidinylthiobenzoates and sulfonylaminocarbonyl-triazolinones) are well known in the art. These resistance genes most commonly result from point mutations in the sequence of the ALS coding gene. Other ALS inhibitor resistance genes include the hra genes, the csr1-2 genes, Sr-HrA genes and the surB genes. Some of the features are marketed under the trade name Clearfield®. Herbicides that inhibit HPPD include pyrazolones, such as pyrazoxifene, benzofenap and topramezone; tricetones, such as mesotrione, sulcotrione, tembotrione, benzobicyclone; and diketonitriles, such as isoxaflutol. These HPPD herbicides exemplify Petition 870170040657, of 06/13/2017, p. 60/184

55/88 res can be tolerated by the known traits. Examples of HPPD inhibitors include the hppdPF_W336 genes (for isoxaflutol resistance) and the avhppd-03 genes (for meostrione resistance). An example of traits tolerant to the oxynil herbicide include the bxn gene, which has been shown to confer resistance to the herbicide / antibiotic bromoxynil. Resistance genes for dicamba include the dicamba monooxygenase (dmo) gene as disclosed in International PCT Publication No. WO 2008/105890. The resistance genes for PPO or PROTOX-inhibiting herbicides (for example, acifluorfen, butafenacil, flupropazil, pentoxazone, carfentrazone, fluazolate, piraflufen, aclonifene, azafenidin, flumioxazin, flumiclorac, bifenox, fluifen, fluifen ) are known in the art. Exemplary genes that confer resistance to PPO include the overexpression of a PPO enzyme from Arabidopsis thaliana of the wild type (Lermontova I and Grimm B, (2000) Overexpression of plastidic protoporphyrinogen IX oxidase leads to resistance to the diphenylether herbicide acifluorfen. Plant Physiol 122: 75 -83.), The B. subtilis PPO gene (Li, X. and Nicholl D. 2005. Development of PPO inhibitorresistant cultures and crops. Pest Manag. Sci. 61: 277-285 and Choi KW, Han O, Lee HJ, Yun YC, Moon YH, Kim MK, Kuk YI, Han SU and Guh JO, (1998) Generation of resistance to the diphenyl ether herbicide, oxyfluorfen, via expression of the Bacillus subtilis protoporphyrinogen oxidase gene in transgenic tobacco plants. Biosci Biotechnol Biochem 62: 558-560.) Resistance genes for proprionic pyridinoxy or phenoxy acids and cyclohexones include the genes encoding the ACCase inhibitor (for example, Acc1-S1, Acc1-S2 and Acc1-S3). Exemplary genes that confer resistance to cyclohexanediones and / or aryloxyphenoxypropanoic acid include haloxifop, diclofop, phenoxyprop, fluazifop and quizalofop. Finally, herbicides that can inhibit photosynthesis, including triazine or benzonitrile, acquire tolerance by Petition 870170040657, dated 06/13/2017, p. 61/184

56/88 the psbA genes (triazine tolerance), 1s + genes (triazine tolerance) and by the nitrilase genes (benzonitrile tolerance). The above list of herbicide tolerance genes is not intended to be limiting. Any of the herbicide tolerance genes are encompassed by the present disclosure.

3. Agronomic Traits [00112] Several selectable markers are also described as reporter genes that can be operationally linked to the 3 'UTR of the Oryza sativa Ubiquitin-3 gene comprising SEQ ID NO: 1, or a sequence that has 80, 85 , 90, 95 or 99% sequence identity with SEQ ID NO: 1. Operationally linked sequences can then be incorporated into a chosen vector to allow the identification and selection of transformed plants (transformants). Coding sequences of exemplary agronomic traits are known in the art. Since the modalities of coding sequences of agronomic traits can be operationally linked to the regulatory elements of the object of the disclosure, the following traits are provided. The delayed softening of fruits as provided by the pg genes inhibits the production of the polygalacturonase enzyme responsible for the breakdown of the pectin molecules in the cell wall and thus causes the delayed softening of the fruit. In addition, delayed fruit ripening / senescence of the acc genes acts to suppress normal expression of the native acc synthase gene, resulting in reduced ethylene production and delayed fruit ripening. Meanwhile, the accd genes metabolize the precursor of the fruit's ripening hormone, resulting in delayed ripening of the fruit. Alternatively, the sam-k genes cause delayed ripening by reducing S-adenosylmethionine (SAM), a substrate for the production of ethylene. Phenotypes of drought stress tolerance, as per ProPetition 870170040657, dated 06/13/2017, p. 62/184

57/88 proportioned by the cspB genes, maintain normal cellular functions under conditions of water stress by preserving the stability and translation of RNA. Another example includes the EcBetA genes that catalyze the production of the osmoprotective compound, glycine betaine, which gives tolerance to water stress. In addition, the RmBetA genes catalyze the production of the osmoprotective compound, glycine betaine, which gives tolerance to water stress. The intensification of photosynthesis and yield is provided with the bbx32 gene that expresses a protein that interacts with one or more endogenous transcription factors to regulate the physiological processes of the plant's day / night. Ethanol production can be increased by the expression of the amy797E genes that encode a thermostable alpha-amylase enzyme that increases bioethanol production by increasing the amylase thermostability used in starch degradation. Finally, modified amino acid compositions can result from the expression of the cordapA genes that encode a dihydrodipicolinate synthase enzyme that increases the production of the amino acid lysine. The above list of coding sequences for agronomic traits is not intended to be limiting. Any coding sequence for an agronomic trait is covered by the present disclosure.

4. DNA-Binding Proteins [00113] Several selectable markers are also described as reporter genes that may be operationally linked to the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa comprising SEQ ID NO: 1, or a sequence having 80, 85, 90, 95 or 99% sequence identity with SEQ ID NO: 1. Operationally linked sequences can then be incorporated into a chosen vector to allow identification and selection of transformed plants (transformants). The coding sequences for DNA binding proteins are known in the art. Once the

Petition 870170040657, of 6/13/2017, p. 63/184

58/88 modalities of the DNA-binding protein coding sequences can be operationally linked to the regulatory elements of the object of the disclosure, the following types of DNA-binding proteins can include zinc fingers, Talens, CRISPRS and meganucleases. The above list of DNA-binding protein coding sequences is not intended to be limiting. Any coding sequences for DNA binding proteins are covered by the present disclosure.

5. Small RNA [00114] Several selectable markers are also described as reporter genes that can be operationally linked to the 3 'UTR of the Oryza sativa Ubiquitin-3 gene comprising SEQ ID NO: 1, or a sequence having 80, 85 , 90, 95 or 99% sequence identity with SEQ ID NO: 1. Operationally linked sequences can then be incorporated into a chosen vector to allow the identification and selection of transformed plants (transformants). Characteristics of small exemplary RNAs are known in the art. Since the modalities of small RNA coding sequences can be operationally linked to the regulatory elements of the object of the disclosure, the following features are provided. For example, the delayed ripening / senescence of the fruit of the small anti-eff RNA delays ripening by suppressing ethylene production by silencing the ACO gene that encodes an ethylene-forming enzyme. The altered production of lignin from the small ccomt RNA reduces the content of guanacil (G) lignin through the inhibition of endogenous S-adenosyl-L-methionine: trans-caffeyl CoA 3-O-methyltransferase (CCOMT gene). In addition, the tolerance to black spot crushing in Solanum verrucosum can be reduced by the small Ppo5 RNA that triggers the degradation of Ppo5 transcripts to prevent deposition 870170040657, of 06/13/2017, p. 64/184

59/88 development of crushing with black spot. Also included is the small RNA dvsnf7 that inhibits the corn rootworm larva with dsRNA containing a 240 bp fragment of the Snf7 gene of the corn rootworm larva. Modified starch / carbohydrates can result from small RNAs, such as the small pPhL RNA (degrades PhL transcripts to limit the formation of reduced sugars through starch degradation) and the small pR1 RNA (degrades R1 transcripts to limit formation reduced sugars through starch degradation). In addition, benefits, such as reduced acrylamide, result from the small asnl RNA that triggers Asn1 degradation to decrease asparagine formation and reduce polyacrylamide. Finally, the non-darkened phenotype of the small pgas suppression RNA results in the suppression of PPO to produce apples with an un-darkened phenotype. The above list of small RNAs is not intended to be limiting. Any small RNA coding sequences are covered by the present disclosure.

6. Selectable Markers [00115] Several selectable markers are also described as reporter genes that can be operationally linked to the 3 'UTR of the Oryza sativa Ubiquitin-3 gene comprising SEQ ID NO: 1, or a sequence having 80, 85 , 90, 95 or 99% sequence identity with SEQ ID NO: 1. Operationally linked sequences can then be incorporated into a chosen vector to allow the identification and selection of transformed plants (transformants). Many methods are available to confirm the expression of selectable markers in transformed plants, including, for example, DNA sequencing and PCR (polymerase chain reaction), Southern blotting, RNA blotting, immunological methods for detecting a protein expressed at

Petition 870170040657, of 6/13/2017, p. 65/184

60/88 from the vector. But, generally, reporter genes are observed through visual observation of proteins that, when expressed, produce a colored product. Exemplary reporter genes are known in the art and encode β-glucuronidase (GUS), luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP, Phi-YFP), red fluorescent protein (DsRFP, RFP, etc.), βgalactosidase, and similar (see Sambrook, et al., Molecular Cloning: A Laboratory Manual, third edition, Cold Spring Harbor Press, NY, 2001, the content of which is fully incorporated into this document by reference).

[00116] Selectable marker genes are used for selection of transformed cells or tissues. Selectable marker genes include genes that encode antibiotic resistance, such as those that encode neomycin phosphotransferase II (NEO), spectinomycin / streptinomycin resistance (AAD), and hygromycin phosphotransferase (HPT or HGR), as well as genes that confer resistance herbicidal compounds. Herbicide resistance genes usually encode a modified herbicide-insensitive target protein or an enzyme that degrades or detoxifies the herbicide in the plant before it acts. For example, resistance to glyphosate was obtained through the use of genes encoding mutant target enzymes, 5-enolpyruvylchiquimate-3-phosphate synthase (EPSPS). EPSPS genes and mutants are well known, and described in more detail below. Resistance to ammonium glufosinate, bromoxynil and 2,4-dichlorophenoxyacetate (2,4-D) was obtained through the use of bacterial genes encoding PAT or DSM-2, a nitrilase, an AAD-1, or an AAD-12 , each of which are examples of proteins that detoxify their respective herbicides.

[00117] In one embodiment, herbicides can inhibit the growth point or meristem, including imidazolinone or sulfonylurea, and

Petition 870170040657, of 6/13/2017, p. 66/184

61/88 The genes for resistance / tolerance of acetohydroxy acid synthase (AHAS) and acetolactate synthase (ALS) for these herbicides are well known. Glyphosate resistance genes include mutant 5-enolpyruvylchiquimate-3-phosphate synthase (EPSPs) and dgt-28 genes (through the introduction of recombinant nucleic acids and / or various forms of in vivo mutagenesis of native EPSPs genes), genes aroA and glyphosate acetyl transferase (GAT) genes, respectively). Resistance genes for other phosphono-compounds include the bar and pat genes of the Streptomyces species, including Streptomyces hygroscopicus and Streptomyces viridichromogenes, and proprionic pyridinoxy or phenoxy acids and cyclohexones (genes encoding the ACCase inhibitor). Exemplary genes that confer resistance to cyclohexanediones and / or aryloxyphenoxypropanoic acid (including haloxifop, diclofop, phenoxyprop, fluazifop, quizalofop) include the acetyl coenzyme A carboxylase (ACCase) genes; Acc1-S1, Acc1-S2 and Acc1S3. In one embodiment, herbicides can inhibit photosynthesis, including triazine (psbA and 1s + genes) or benzonitrile (nitrilase gene). In addition, these selectable markers may include positive selection markers, such as the enzyme phosphomannose isomerase (PMI).

[00118] In one embodiment, selectable marker genes include, but are not limited to, the genes encoding: 2,4-D; neomycin phosphotransferase II; cyanamide hydratase; aspartate kinase; dihydrodipicolinate synthase; tryptophan decarboxylase; dihydrodipicolinate synthase and desensitized aspartate kinase; bar gene; tryptophan decarboxylase; neomycin phosphotransferase (NEO); hygromycin phosphotransferase (HPT or HYG); dihydrofolate reductase (DHFR); phosphinothricin acetyltransferase; 2,2-dichloropropionic acid dehalogenase; acetohydroxy acid synthase; 5-enolpyruvylchiquimatophosphate synthase (aroA); haloarylnitrilase; acetyl-coenzyme A carboxylase;

Petition 870170040657, of 6/13/2017, p. 67/184

62/88 dihydropterate synthase (south I); and 32 kD photosystem II polypeptide (psbA). One embodiment also includes selectable marker genes that encode resistance to: chloramphenicol; methotrexate; hygromycin; spectinomycin; bromoxynil; glyphosate; and phosphinothricin. The above list of selectable marker genes is not intended to be limiting. Any selectable reporter or marker gene is covered by the present disclosure.

[00119] In some embodiments, coding sequences are synthesized for optimal expression in a plant. For example, in one embodiment, a coding sequence for a gene has been modified by codon optimized to enhance expression in plants. An insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, or a marker transgene selectable can be optimized for expression in a specific species of plant or, alternatively, can be modified for optimal expression in dicotyledonous or monocotyledonous plants. The preferred plant codons can be determined from the highest frequency codons in the proteins expressed in greater quantity, in the specific plant species of interest. In one embodiment, a coding sequence, gene, or transgene is manipulated to be expressed in plants at a higher level, resulting in greater transformation efficiency. Methods for the optimization of plant genes are well known. Guidance regarding the optimization and production of synthetic DNA sequences can be found, for example, in WO2013016546, WO2011146524,

WO1997013402, US Patent No. 6166302, and US Patent No. 5380831, incorporated herein by reference.

TRANSFORMATION

Petition 870170040657, of 6/13/2017, p. 68/184

63/88 [00120] Suitable methods for transforming plants include any method by which DNA can be introduced into a cell, for example and without limitation: electroporation (see, for example, U.S. Patent 5,384,253); bombardment of microprojectiles (see, for example, U.S. Patents 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861, and 6,403,865); Agrobacterium-mediated transformation (see, for example, U.S. Patents 5,635,055, 5,824,877, 5,591,616; 5,981,840, and 6,384,301); and protoplast transformation (see, for example, U.S. Patent 5,508,184).

[00121] A DNA construct can be introduced directly into the genomic DNA of the plant cell using techniques, such as shaking with silicon carbide fibers (see, for example, US Patents 5,302,523 and 5,464,765), or the constructs of DNA can be introduced directly into plant tissue using biological methods, such as bombardment of DNA particles (see, for example, Klein et al. (1987) Nature 327: 70-73). Alternatively, the DNA construct can be introduced into the plant cell through nanoparticle transformation (see, for example, US Patent Publication No. 20090104700, which is incorporated herein in its entirety by reference).

[00122] In addition, gene transfer can be achieved using non-Agrobacterium bacteria or viruses, such as Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, potato X virus, cauliflower mosaic virus and cassava rib mosaic virus and / or tobacco mosaic virus, see, for example, Chung et al. (2006) Trends Plant Sci. 11 (1): 1-4.

[00123] Through the application of transformation techniques, cells of almost any plant species can be transformed in a stable manner, and these cells can be developed in transgenic plants by well-known techniques. For example,

Petition 870170040657, of 6/13/2017, p. 69/184

64/88 techniques that may be particularly useful in the context of cotton processing are described in U.S. Patents 5,846,797, 5,159,135, 5,004,863, and 6,624,344; techniques for transforming Brassica plants in particular are described, for example, in U.S. Patent 5,750,871; techniques for processing soy are described, for example, in U.S. Patent 6,384,301; and techniques for processing corn are described, for example, in U.S. Patents 7,060,876 and 5,591,616, and International PCT Publication WO 95/06722.

[00124] After efficient distribution of an exogenous nucleic acid to a recipient cell, a transformed cell is generally identified for cultivation and regeneration of later plants. In order to improve the ability to identify transformants, one may wish to employ a selectable marker gene with the transformation vector used to generate the transformant. In an illustrative embodiment, a population of transformed cells can be assessed by exposing the cells to a selective agent or agents, or the cells can be screened for the desired marker gene trait. [00125] Cells that survive exposure to a selective agent, or cells that have been classified positive in a screening assay, can be grown in media that supports plant regeneration. In one embodiment, any suitable plant tissue culture media can be modified by including additional substances, such as growth regulators. The tissue can be kept in a basic medium with growth regulators until sufficient tissue is available to begin the plant's regeneration efforts, or following repeated rounds of manual selection, until the tissue morphology is suitable for regeneration (for example , at least 2 weeks), and then transferred to the conductive medium for bud formation. The cultures are transferred periodically until sufficient training has taken place

Petition 870170040657, of 6/13/2017, p. 70/184

65/88 of the bud. Once the shoots are formed, they are transferred to a conductive medium for the formation of the bud. Once sufficient roots are formed, the plants can be transferred to the soil for later growth and maturity.

MOLECULAR CONFIRMATION [00126] A transformed plant cell, callus, tissue or plant can be identified and isolated by selecting or screening the manipulated plant material for traits encoded by the marker genes present in the transforming DNA. For example, selection can be performed by cultivating the plant material manipulated in the medium containing an inhibitory amount of the antibiotic or herbicide to which the transformation gene construct confers resistance. In addition, transformed plants and plant cells can also be identified by screening for activities of any visible marker genes (for example, the β-glucuronidase, luciferase or gfp genes) that may be present in the recombinant nucleic acid constructs. These selection and screening methodologies are well known to those skilled in the art. Molecular confirmation methods that can be used to identify transgenic plants are known to those skilled in the art. Several exemplary methods are described in more detail below.

[00127] Molecular hybridization probes (molecular beacons) have been described for use in the detection of sequences. In short, a FRET oligonucleotide probe is designed to overlap the junction of insert DNA and flanking genomics. The FRET probe's unique structure results in it containing a secondary structure that keeps the fluorescent and suppressor fractions in close proximity. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and

Petition 870170040657, of 6/13/2017, p. 71/184

66/88 dNTPs. After successful PCR amplification, hybridization of the FRET probe (s) in the target sequence results in the removal of the secondary structure of the probe and in the spatial separation of the fluorescent and suppressor fractions. A fluorescent signal indicates the presence of the flanking genomic / transgene insert sequence due to successful amplification and hybridization. Such an assay with molecular hybridization probe to detect how an amplification reaction is a modality of subject disclosure.

[00128] Hydrolysis probe assay, also known with TAQMAN ^® (Life Technologies, Foster City, California), is a method of detecting and quantifying the presence of a DNA sequence. Briefly, a FRET oligonucleotide probe is designed with an oligo inside the transgene and one in the genomic flanking sequence to detect specific events. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the cleavage and release of the fluorescent fraction away from the suppressor fraction in the FRET probe. A fluorescent signal indicates the presence of the genomic / flanking insert sequence due to successful amplification and hybridization. Such a hydrolysis probe assay for detecting how an amplification reaction is a modality of subject disclosure.

[00129] KASPar® assays are a method of detecting and quantifying the presence of a DNA sequence. Briefly, the genomic DNA sample comprising the integrated gene expression cassette polynucleotide is displayed using a good base polymerase chain reaction (PCR) assay known as the KASPar ^® assay system. The KASPar ^® assay used in the practice of publicizing the subject may use a mixture of PCR assays

Petition 870170040657, of 6/13/2017, p. 72/184

67/88 of KASPar® containing several primers. The primers used in the PCR assay mixture can comprise at least one forward primer and at least one reverse primer. The forward primer contains a sequence corresponding to a specific region of the DNA polynucleotide and the reverse primer contains a sequence corresponding to a specific region of the genomic sequence. In addition, the primers used in the PCR assay mixture can comprise at least one forward primer and at least one reverse primer. For example, the KASPar® PCR assay mixture can use two forward primers corresponding to two different alleles and one reverse primer. One of the direct primers contains a sequence corresponding to the specific region of the endogenous genomic sequence. The second direct primer contains a sequence corresponding to a specific region of the DNA polynucleotide. A reverse primer contains a sequence corresponding to the specific region of the genomic sequence. Such a KASPar® assay for detecting an amplification reaction is a modality of subject disclosure.

[00130] In some embodiments the fluorescent signal or fluorescent dye is selected from the group consisting of a fluorescent dye of HEX, a fluorescent dye of FAM, a fluorescent dye of JOE, a fluorescent dye of TET, a fluorescent dye Cy 3, a fluorescent dye fluorescent dye of Cy 3.5, fluorescent dye of Cy 5, fluorescent dye of Cy 5.5, fluorescent dye of 7 Cy and fluorescent dye of ROX.

[00131] In other embodiments, the amplification reaction is performed using the appropriate second fluorescent DNA dyes that are capable of labeling cellular DNA in a concentration range detectable by flow cytometry and have a fluorescent emission spectrum that is detectable by a real-time thermal cycler.

Petition 870170040657, of 6/13/2017, p. 73/184

68/88

This should be appreciated by those of ordinary knowledge that other nucleic acid dyes are known and are continually being identified. Any suitable nucleic acid dye with appropriate emission and excitation spectra can be employed, such as YO-PRO-1®, SYTOX Green®, SYBR Green I®, SYTO11®, SYTO12®, SYTO13®, BOBO®, YOYO® and TOTO®. In one embodiment, a second fluorescent DNA dye is SYTO13® used in less than 10 μΜ, less than 4 μΜ or less than 2.7 μΜ.

[00132] In additional modalities, Next Generation Sequencing (NGS) can be used for detection. As described by Brautigma et al., 2010, DNA sequence analysis can be used to determine the nucleotide sequence of the amplified and isolated fragment. The amplified fragments can be isolated and sub-subsubcloned into a vector and sequenced using the chain terminator method (also known as Sanger sequencing) or dye terminator sequencing. In addition, amplicon can be sequenced with Next Generation Sequencing. NGS technologies do not require the sub-sub-subcloning step and multiple sequencing readings can be completed in a single reaction. Three NGS platforms are commercially available, the Genome Sequencer FLX ™ from 454 Life Sciences / Roche, the Illumina Genome Analyzer ™ from Solexa and Applied Biosystems' SOLiD ™ (acronym for: Sequencing by Oligo Ligation and Detection). In addition, there are two methods of molecule sequencing that are currently being developed. This includes true Single Molecule Sequencing (tSMS) by Helicos Bioscience ™ and Single Molecule Real Time ™ sequencing (SMRT) by Pacific Biosciences.

[00133] Genome Sequencher FLX ™ which is marketed by 454

Petition 870170040657, of 6/13/2017, p. 74/184

69/88

Life Sciences / Roche is a long-reading NGS, which uses PCR emulsion and pyro sequencing to generate sequencing readings. DNA fragments of 300 - 800 bp or libraries containing fragments of 3 - 20 kb can be used. The reactions can produce more than one million readings of about 250 to 400 bases per run for a total yield of 250 to 400 megabases. This technology produces the longest readings, but the total sequence output per run is low compared to other NGS technologies. [00134] Illumina Genome Analyzer ™ which is marketed by Solexa ™ is a short reading of NGS that uses sequencing by synthesis with reversible terminator nucleotides marked with fluorescent dye and is based on solid phase PCR. Construction of libraries for sequencing ends in pairs containing DNA fragments up to 10 kb can be used. The reactions produce over 100 million short readings that are 35 - 76 bases in length. This data can produce 3 - 6 gigabases per run.

[00135] The Sequencing system by Oligo Ligation and Detection (SOLiD) marketed by Applied Biosystems ™ is a short reading technology. This NGS technology uses fragmented double-stranded DNA that is up to 10 kb in length. The system uses sequencing by binding dye-labeled oligonucleotide primers and emulsion PCR to generate one billion short readings that result in a total sequence output of up to 30 gigabases per run.

[00136] tSMS from Helicos Bioscience ™ and SMRT from Pacific Biosciences ™ apply a different approach that uses unique DNA molecules for sequence reactions. The Helicos ™ tSMS system produces up to 800 million short readings that result in 21 gigabases per run. These reactions are completed using nucleotidePetition 870170040657, of 6/13/2017, p. 75/184

70/88 virtual terminator deos labeled with fluorescent dye that are described as a synthesis sequencing approach. [00137] The SMRT Next Generation Sequencing system marketed by Pacific Biosciences ™ uses a real-time sequence by synthesis. This technology can produce readings up to 1,000 bp in length as a result of not being limited by reversible terminators. The gross reading yield, which is equivalent to one fold coverage of a human diploid genome, can be produced daily using this technology.

[00138] In another embodiment, detection can be completed using blotting assays, including Western blots, Northern blots and Southern blots. Such blotting assays are techniques commonly used in biological research for the identification and quantification of biological samples. These tests include first separating the sample components into gels by electrophoresis, followed by transferring the electrophoretically separated components from the gels to transfer membranes that are made of materials such as nitrocellulose, polyvinylidene fluoride (PVDF), or nylon. Analytes can also be directly located on these supports or directed to specific regions on the supports, applying vacuum, capillary action or pressure, without prior separation. Transfer membranes are commonly subjected to treatment after transfer to increase the capacity of the analytes to be distinguished from each other and detected, either visually or by automated readers.

[00139] In an additional embodiment the detection can be completed using an ELISA assay, which uses a solid-phase enzyme immunoassay to detect the presence of a substance, usually an antigen, in a liquid sample or wet sample. The antigens in the sample are attached to a plate surface. Then, an additional specific antibody is applied over SUPetition 870170040657, of 06/13/2017, p. 76/184

71/88 perimeter can then bind to the antigen. This antibody is bound to an enzyme and, in the final step, a substance containing an enzyme substrate is added. The subsequent reaction produces a detectable signal, most commonly, a color change in the substrate.

TRANSGENIC PLANTS [00140] In one embodiment, a plant, plant tissue, or plant cell comprises a 3'UTR of the Ubiquitin-3 gene from Oryza sativa. In one embodiment, a plant, plant tissue, or plant cell comprises the 3'UTR of the Ubiquitin-3 gene from Oryza sativa from a sequence selected from SEQ ID NO: 1 or a sequence that is 80%, 85%, 90% , 95% or 99.5% sequence identity with a sequence selected from SEQ ID NO: 1. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID NO: 1, or a sequence that is 80%, 85%, 90%, 95% or 99.5 % sequence identity with a selected sequence of SEQ ID NO: 1 that is operationally linked to a non-Oryza sativa Ubiquitin-3 gene. In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a 3'UTR of the Oryza sativa Ubiquitin-3 gene that is operationally linked to a transgene, where the transgene can be a transgene insecticide resistance, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.

[00141] According to one embodiment, a plant, plant tissue, or plant cell is provided in which the plant, plant tissue or plant cell comprises a sequence derived from the 3'UTR of the gene

Petition 870170040657, of 6/13/2017, p. 77/184

72/88 of Oryza sativa's Ubiquitin-3 operatively linked to a transgene, wherein the sequence derived from the 3'UTR of the Oryza sativa's Ubiquitin-3 gene comprises a sequence SEQ ID NO: 1 or a sequence having 80%, 85 %, 90%, 95% or 99.5% sequence identity to SEQ ID NO: 1. In one embodiment, a plant, plant tissue or plant cell is provided in which the plant, plant tissue or plant cell comprises SEQ ID NO: 1, or a sequence that is 80%, 85%, 90%, 95% or 99.5% sequence identity to SEQ ID NO: 1 operationally linked to a non-Oryza sativa Ubiquitin-3 gene. In one embodiment, the plant, plant tissue or plant cell is a dicot or monocot plant or a cell or tissue derived from a dicot or monocot plant. In one embodiment, the plant is selected from the group consisting of corn, rice, sorghum, oats, rye, bananas, sugar cane, cotton, sunflower and canola. In one embodiment, the plant is Zea mays. According to a modality of the plant, plant tissue or plant cell comprises SEQ ID NO: 1 or a sequence having 80%, 85%, 90%, 95% or 99.5% sequence identity with SEQ ID NO: 1 operationally linked to a non-Oryza sativa Ubiquitin-3 gene. In a plant embodiment, plant tissue or plant cell comprises a promoter operably linked to a transgene in which the promoter consists of SEQ ID NO: 1 or a sequence having 80%, 85%, 90%, 99.5% or 95% of sequence identity with SEQ ID NO: 1. According to one embodiment, the gene construct comprising the 3'UTR sequence of the Oryza sativa Ubiquitin-3 gene operationally linked to a transgene is incorporated into the genome of the plant, plant tissue or plant cell.

[00142] In one embodiment, a plant, plant tissue or plant cell, according to the methods disclosed in this document can

Petition 870170040657, of 6/13/2017, p. 78/184

73/88 be a dicot plant. The dicot plant, plant tissue or plant cell can be, but is not limited to, alfalfa, rapeseed, canola, Indian mustard, Ethiopian mustard, soy, sunflower, cotton, beans, broccoli, cabbage, cauliflower, celery, cucumber, eggplant, lettuce; melon, pea, pepper, peanut, potato, pumpkin, radish, spinach, sugar beet, sunflower, tobacco, tomato and watermelon.

[00143] One skilled in the art will recognize that after the stable exogenous sequence is stably incorporated into transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending on the species being bred.

[00144] The present disclosure also covers seeds of the transgenic plants described above, in which the seeds have the transgene or gene construct containing the gene regulatory elements of the subject disclosure. The present disclosure further encompasses progeny, clones, cell lines or cells of the transgenic plants described above, wherein said progeny, clone, cell line or cell has the transgene or gene construct containing the gene regulatory elements of the subject disclosure.

[00145] The present disclosure also covers the cultivation of transgenic plants described above, in which the transgenic plants have the transgene or gene construct containing the gene regulatory elements of the subject disclosure. Accordingly, such transgenic plants can be designed to, inter alia, have one or more desired traits or transgenic events containing the gene regulatory elements of the subject matter, being transformed with nucleic acid molecules according to the invention and can be harvested or grown by any method known to those skilled in the art.

Petition 870170040657, of 6/13/2017, p. 79/184

74/88

METHOD OF EXPRESSION OF A TRANSGENE [00146] In one embodiment, a method of expression of at least one transgene in a plant comprises the cultivation of a plant comprising a 3'UTR of the Ubiquitin-3 gene from Oryza sativa operationally linked to at minus a transgene or a polylinker sequence. In another embodiment, the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa consists of a sequence selected from SEQ ID NO: 1 or a sequence that has 80%, 85%, 90%, 95% or 99.5% identity sequence with a selected sequence from SEQ ID NO: 1. In one embodiment, a method of expressing at least one transgene in a plant comprises cultivating a plant comprising a promoter of the Oryza sativa Ubiquitin-3 gene and a 3'UTR of the Oryza sativa Ubiquitin-3 gene. linked to at least one transgene. In one embodiment, a method of expressing at least one transgene in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a 3'UTR of the Oryza sativa Ubiquitin-3 gene operably linked to at least one transgene.

[00147] In one embodiment, a method of expressing at least one transgene in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 3'UTR of the Oryza sativa Ubiquitin-3 gene operatively linked to at least one transgene. In one embodiment, the 3'UTR of the Oryza sativa Ubiquitin-3 gene consists of a sequence selected from SEQ ID NO: 1 or a sequence that has 80%, 85%, 90%, 95% or 99.5% sequence identity with a selected sequence from SEQ ID NO: 1. In one embodiment, a method of expressing at least one transgene in a plant comprises the cultivation of a plant that comprises an exposure cassette 870170040657, of 06/13/2017, p. 80/184

75/88 gene pressure comprising a promoter of the Oryza sativa Ubiquitin-3 gene and a 3'UTR of the Oryza sativa Ubiquitin-3 gene operably linked to at least one transgene. In one embodiment, a method of expressing at least one transgene in a plant comprises cultivating a plant that comprises a gene expression cassette that comprises a 3'UTR of the Oryza sativa Ubiquitin-3 gene operably linked to at least one transgene. In one embodiment, a method of expressing at least one transgene in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a gene expression cassette containing a 3'UTR of the Ubiquitin-3 gene of Oryza sativa operationally linked to at least one transgene. In one embodiment, a method of expressing at least one transgene in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a gene expression cassette, a promoter of the Oryza Ubiquitin-3 gene sativa and a 3'UTR of the Oryza sativa Ubiquitin-3 gene operably linked to at least one transgene.

[00148] The following examples are provided to illustrate certain particularities and / or modalities. Examples should not be interpreted to limit disclosure to the particularities or modalities exemplified.

EXAMPLES

Example 1: New Design of a Combination of Optimized Regulatory Elements from an Oryza sativa Ubiquitin-3 Gene [00149] The specific downstream polynucleotide sequences referred to as 3 '(3' RTU) untranslated regions are commonly multifunctional in vivo . RNA processing and maturation were recognized as key control points for postPetition control 870170040657, dated 06/13/2017, p. 81/184

76/88 transcription of eukaryotic gene expression. (Szostak and Gebauer, 2012; Wilusz and Spector, 2010; Barrett et al., 2012; and Moore, 2005). These polynucleotide sequences can influence the rate of nuclear export, subcellular localization, transcript stability and translation. In addition, the 3 'RTUs are key target sites for control by small non-coding RNAs. Although many of these mechanisms negatively regulate gene expression, this regulation can also be used to effectively locate transcripts in specific cell types for stable accumulation and subsequent gene expression (Patel et al., 2006). From the evaluation of the contiguous chromosomal sequence associated with the Oryza sativa Ubiquitin-3 promoter, or with other known promoters, a 1001 bp 3 'UTR polynucleotide sequence (SEQ ID NO: 1) was identified and isolated for use in the expression of heterologous coding sequences.

SEQ ID NO: 1;

g cgtgtg ctgtg gtg cag cattg g acttcattatacctatg ccg ctcgtctgtcatatcatcgtgtcatg gttgtgttgtgttctggtttagagtccctaagttgtgttgatactattatccatactagtacaatttgcttcac tgtg catcg gtaccaatcg atg atattatcattctacttctgttaatgtttctg g atgtttg atccg g at g g attctgtttgtg cattg ctcacatg g tcgtaaccg g ccactgttg CG cgtg CCTG ttg atcaatctg tttgcgcttgacggtttctgatgcttggaattggggtgtcgatgttggtttggttatctatcctggtatgtttg ttgatttcatgcgcatttcagtctttacggcttctgatgcttggaattctaatggtgttggttgatttcacaat TG GG CTG GTG CG gtttg gtg cctaaaaaaaatg gg agtacctatacatctttcg AAAG attttg atg the tcgtatcacacagattttgatgatcgtatcacacagatttttaatctttgaattaaaatccgatagatat aataaaaagtaaaaagtaattaagaaacaccataatggacactaaattaccatatcctcgagaa aaagaccaaatccaataaaaaagaaaaagaccaaatccaatacaaaatttaaaatttacatgc gaagattcaaaaattacagtgtaacttacaaaagttacaatgtaagtttcataaattacactgtaact tacaagaaaatgcactgtaaatttaagtgagaaaatcgagtgagagataagaaaaaatctttcg agtgagatatagcaaaattgaaaaaaaattggtttgggcccaaaaatggttgagggcccattcgg ccattccccaatcccaaccatcg cgtcctactccag ccg ccg ctg ccacccacgtccgtcg g cg c catg g ccg ccg ccaag g ag ctccttcg ccg g ctccag cg a

Petition 870170040657, of 6/13/2017, p. 82/184

77/88

Example 2: Construction of the Vector (pDAB116099) [00150] The vector pDAB116099 was constructed to incorporate the new combination of regulatory polynucleotide sequences flanking a transgene. The pDAB116099 vector construct contained a gene expression cassette, in which the cry34Ab1 transgene (B. thurengiensis reporter gene) was triggered by the promoter of the Ubiquitin-3 gene from Oryza sativa of SEQ ID NO: 2 (promoter of Ubiquitin-3 by Oryza sativa; Sivamani E, Qu R, (2006), Plant Mol Biol 60: 225239), and flanked by the 3 'RTU of the Oryza sativa Ubiquitin-3 gene of SEQ ID NO: 1 (ZMEXP18544.1). A diagram of this gene expression cassette is shown in Figure 1 and is provided as SEQ ID NO: 3. The vector also contained a selectable marker gene expression cassette that contained the aad-1 transgene (AAD-1; US Patent No. 7,838,733) triggered by the Zea mays Ubiquitin 1 promoter (Promoter Zm Ubi1; Christensen et al. , (1992) Plant Molecular Biology 18; 675-689) and was terminated by the Lipase 3'UTR of Zea mays (Zm Lip 3'UTR; US Patent No. 7,179,902). A diagram of this gene expression cassette is shown in Figure 1 and is provided as SEQ ID NO: 4. This construct was built by the synthesis of the newly designated 3'UTR of the Ubiquitin-3 of Oryza sativa (ZMEXP18544.1) and cloning of the promoter into an input vector of GeneArt Seamless Cloning ™ (Life Technologies) (WO2014018512). The resulting input vector contained the 3'UTR of the Oryza sativa Ubiquitin-3 gene that encloses the cry34Ab1 transgene, and was integrated into a target vector using the Gateway ™ cloning system (Life Technologies) and electroporated into the DAt13192 strain Agrobacterium tumefaciens (International Patent Publication No. WO2012016222). The resulting binary plasmid clones, pDAB116099, were obtained and the plasmid DNA was isolated and confirmed by restriction enzyme digestions and sequencing. The resulting construct

Petition 870170040657, of 6/13/2017, p. 83/184

78/88 contained a combination of regulatory elements that drive the constitutive expression of a transgene.

[00151] A negative control construct, pDAB113121, was assembled, containing a reporter gene instead of the cry34Ab1 gene of the yellow fluorescent protein (PhiYFP; Shagin et al., (2004) Mol Biol Evol 21; 841-50) (Figure 2) and containing the Zea mays Ubiquitin 1 promoter (ZmUbi1 Promoter) and regulatory elements of Solanum tuberosum protease inhibitor-3'UTR (StPinII 3'UTR; An et al., (1989) Plant Cell 1; 115- 22). The same aad-1 expression cassette as the one in pDAB116099. This control construct was transformed into plants with the same reagents and protocols as those of pDAB116099.

Example 3: Transformation of Maize [00152] Transformation of Agrobacterium tumefaciens:

[00153] The binary expression vectors were transformed into the DAt13192 strain of Agrobacterium tumefaciens (RecA deficient ternary strain) (Pub. Of International Pat. No. WO2012016222). Bacterial colonies were selected and binary plasmid DNA was isolated and confirmed by restriction enzyme digestion. [00154] Start of Agrobacterium Culture [00155] Agrobacterium cultures were streaked from glycerol stocks in minimal AB medium (Gelvin, S., 2006, Agrobacterium Virulence Gene Induction, in Wang, K., ed., Agrobacterium Protocols Second Edition Vol. 1, Humana Press, page 79; made without sucrose and with 5 g / L of glucose and 15 g / L of Bacto ™ agar) and incubated at 20 ° C in the dark for 3 days. The Agrobacterium cultures were then streaked onto a YEP medium plate (Gelvin, s., 2006, Agrobacterium Virulence GeneInduction, in Wang, K., ed. Agrobacterium Protocols Second Edition Vol. 1, Humana Press, p. 79) and incubated at 20 ° C in the dark for 1 day.

Petition 870170040657, of 6/13/2017, p. 84/184

79/88 [00156] On the day of an experiment, a mixture of inoculation medium (2.2 g / L of MS salts, 68.4 g / L of sucrose, 36 g / L of glucose, 115 mg / L of L-proline, 2 mg / L glycine, 100 mg / L myo-Inositol, 0.05 mg / L nicotinic acid, 0.5 mg / L pyridoxine HCl, 0.5 mg / L thiamine HCl) and acetosyringone was prepared in a volume appropriate to the size of the experiment. A 1 M stock solution of acetosyringone in 100% dimethylsulfoxide was added to the inoculation medium to make a final concentration of acetosyringone of 200 μΜ. [00157] For each construct, 1-2 cycles of Agrobacterium from the YEP plate were suspended in 15 ml of the acetosyringone / inoculation medium mixture in a sterile, disposable 50 ml centrifuge tube and the optical density of the solution at 600 nm ( OD ₆₀₀ ) was measured on a spectrophotometer. The suspension was then diluted to 0.25-0.35 OD ₆₀₀ using the additional acetosyringone inoculation / mixture medium. The Agrobacterium suspension tube was then placed horizontally on a platform shaker set at about 75 rpm at room temperature for between 1 and 4 hours before use. [00158] Maize Transformation [00159] The experimental constructs were transformed into maize through Agrobacterium-mediated transformation of immature embryos isolated from the pure line, Zea mays cv B104. The method used is similar to those published by Ishida et al., (1996) Nature Biotechnol 14: 745-750 and Frame et al., (2006) Plant Cell Rep 25: 10241034, but with several modifications and improvements to make the method passable high productivity transformation. An example of a method used to produce a number of transgenic events in corn is given in US Patent Application Publication No. US 2013/0157369 A1, starting with the stages of infection and embryo cultivation.

Example 4: Molecular Confirmation of T ₀ Copy Number

Petition 870170040657, of 6/13/2017, p. 85/184

80/88 [00160] Putative transgenic islet plants were sampled at leaf stage V2-3 for the presence of the transgene using quantitative PCR assays with cry34Ab1 and AAD-1. Total DNA was extracted from 4 leaf perforations using the MagAttract® DNA extraction kit (Qiagen) according to the manufacturer's instructions.

[00161] To detect the genes of interest, gene-specific DNA fragments were amplified with TaqMan® primer / probe sets containing a FAM-labeled fluorescent probe for the cry34Ab1 gene and a HEX-labeled fluorescent probe for the control of the gene reference of endogenous invertase. The following primers were used for the amplifications of the cry34Ab1e gene of the endogenous invertase reference gene.

[00162] Cry34Ab 1 Primers / Probes:

[00163] Direct initiator: TQ.8v6.1.F: GCCATACCCTCCAGTTG (SEQ ID NO: 6) [00164] Reverse initiator: TQ.8v6.1.R: GCCGTTGATGGAGTAGTAGATGG (SEQ ID NO: 7) [00165] Probe: TQ .8v6.1.MGB.P: 5 '- / 56-FAM / CCGAATCCAACGGCTTCA / MGB (SEQ ID NO: 8) [00166] Invertase Initiators:

[00167] Direct initiator: InvertaseF: TGGCGGACGACGACTTGT (SEQ ID NO: 9) [00168] Reverse initiator: InvertaseR: AAAGTTTGGAGGCTGCCGT (SEQ ID NO: 10) [00169] Invertase Probe: 5 '/ 5HEX / CGAGTAGGGGTAGCT (SEQ ID NO: 11) [00170] Next, the PCR reactions were performed in a final 10 µl reaction volume containing 5 µl of Roche LightCycler® 480 Master Mix of Probes (Roche Applied Sciences, Indianapolis, IN); 0.4 pl of each TQ.8v6.1.F, TQ.8v6.1.R, Invertase F, and

Petition 870170040657, of 6/13/2017, p. 86/184

81/88

InvertaseR of 10 μΜ of stock solutions for a final concentration of 400 nM; 0.4 μl of each TQ.8v6.1.MGB.P and Invertase probe of 5 μΜ of stock solutions for a final concentration of 200 nM, 0.1 μΙ of 10% polyvinylpyrrolidone (PVP) for a final concentration of 0.1%; 2 μl of 10 ng ^ l of genomic DNA and 0.5 μl of water. The DNA was amplified in a 480 Roche LightCycler® system under the following conditions: 1 cycle of 95 ° C for 10 min; 40 cycles of the following 3 steps: 95 ° C for 10 seconds; 58 ° C for 35 seconds and 72 ° C for 1 second, and a final cycle of 4 ° C for 10 seconds. The number of copies of cry34Ab1 was determined by comparing the Target (gene of interest) / Reference (Invertase gene) values for unknown samples (yield by LightCycler® 480) with the Target / Reference values of the copy number controls for cry34Ab1.

[00171] Detection of the AAD-1 gene was performed as described above for the cry34Ab1 gene using the endogenous invertase reference gene. The sequences of the AAD-1 primer were as follows;

[00172] AAD1 direct primer: TGTTCGGTTCCCTCTACCAA (SEQ ID NO: 12) [00173] AAD1 reverse primer: CAACATCCATCACCTTGACTGA (SEQ ID NO: 13) [00174] AAD1 probe: 5'FAM / CACAGAACCGGGTCCT '(SEQ ID NO: 14) [00175] Finally, T ₀ plants containing the gene of interest were sampled in V4-5 leaf ELISA assays for cry34Ab1 and AAD-1. Four leaf holes were sampled. Another set of plants was sampled in V4-5 for the entire root mass for both ELISA assays for proteins. The ELISA assays for Cry34Ab1 (Agdia, Inc., Elkart, IN) and AAD1 (Acadia BioScience) of form 870170040657, of 06/13/2017, p. 87/184

82/88 lha and root were performed according to the manufacturer's instructions. The ELISA assay for Cry34Ab1 was expressed as parts per million (or ng of protein per mg of total plant protein). Whole root protein assays were performed using the Bradford detection method according to the manufacturer's instructions.

[00176] The T ₀ plants were self-fertilized and crossed with non-transgenic Zea mays cv B104 transformation lines to obtain T1 seeds. Five to six transgenic strains or events from each of the constructs of the test regulatory element proceeded to studies of the T ₁ protein. In this sense, 30-40 T1 seeds from each event were sown; the seedlings were sprayed with SureII® at the V2-3 stage of development to kill non-GM segregants.

Example 5: Molecular Confirmation of Protein Accumulation [00177] Next, the transgenic plants were sampled at multiple stages of plant development for ELISA for Cry34Ab1 (Agdia, Inc .; Cat # 04500/4800) and AAD-1 (Envirologix; Cat # 11638) as follows: leaf (V4, V12 and R3) and roots (V4). All tissues were isolated and placed in tubes soaked in dry ice; which were then transferred to -80 ° C. Frozen tissues other than leaves were lyophilized prior to protein extraction by ELISA.

[00178] Putative transgenic T1 plants containing cry34Ab1, and aad-1 transgenes were sampled in leaf ELISA assays for V4, V12 and R3. Four leaf holes were sampled. Perforations of the sheet were placed in a tube and a single 1/8 stainless steel ball (Hoover Precision Products, Cumming, GA, USA) was added to each 1.2 ml tube containing 300 pl of extraction buffer (PBST supplemented with 0.5 mM ETDA and 1.0 mM DTT). The samples were processed on a Genogrinder ™ (SPEX

Petition 870170040657, of 6/13/2017, p. 88/184

83/88

SamplePrep, Metuchen, NJ) at 1,500 rpm for 4 minutes. The samples were centrifuged at 4,000 rpm for 2 minutes in a Sorvall Legend XFR ™ centrifuge. Then, an additional 300 μΙ of extraction buffer was added and the samples were further processed in a Genogrinder ™ at 1,500 rpm for 2 minutes. The samples were centrifuged again at 4,000 rpm for 7 minutes. Finally, the supernatant was collected and ELISA assays were completed at different dilutions along with protein standards using the commercially available ELISA assay kits for Cry34Ab1 (Agdia, Inc.) and AAD-1 (Envirologiz, Inc.), following the protocols developed at Dow AgroSciences. Protein extraction for ELISAs for various types of tissue was performed by grinding the lyophilized tissue on an ink shaker for 30 seconds in the presence of eight 0.25 ceramic spheres (MP Biomedicals, USA, catalog # 6540-422 ). For fabrics that needed additional shredding, the shredding step was repeated for another 30 seconds. Garnet powder was added in 2 ml tubes to cover the curved portion at the bottom of the tube. The coarsely ground tissue was transferred to 2 ml tubes to fill up to the 0.5 ml mark. A ceramic sphere was added to each tube, as well as 0.6 ml of the PBST partial extraction buffer supplemented with 5 mM EDTA, 5 mM DTT, and 1% plant protease inhibitor cocktail). All tubes were kept on ice for 10 minutes. The frozen tubes were transferred to the 2 ml Genogrinder® container. The samples were ground for 45 seconds. Then, 40 μl of 10% Tween®-20 and 300 μl of extraction buffer were added to the samples. The samples were ground for another 45 seconds with 5 minutes of cooling between them. Finally, each sample was centrifuged at 13,000 rpm for 7 minutes, and the supernatant was carefully transferred to a new tube to collect the extract. The extract was diluted

Petition 870170040657, of 6/13/2017, p. 89/184

84/88 as needed for sheet tissues from ELISA assays. A similar assay was used for the other plant tissues. Example 6: Gene Expression Profiles Operationally Linked to Oryza sativa's Ubiquitin-3 Regulatory Elements in Crop Plants [00179] The 3 'UTR regulatory element of the Oryza sativa's Ubiquitin-3 gene of SEQ ID NO: 1, as provided in pDAB116099, resulted in the constitutive expression of the cry34Ab1 gene in transgenic corn events. Table 1 summarizes the robust expression of the cry34Ab1 gene in several types of tissue and at different stages of development. Little or no expression of Cry34Ab1 on the leaf was observed or detected in the events of the plant transformed with the negative control construct, pDAB113121. This construct, pDAB113121, did not contain the cry34Ab1 transgene. All constructs expressed the aad-1 gene in the tissues that were analyzed.

Table 1. Resulting from the ELISA representing the protein levels of Cry34Ab1 and AAD-1 resulting from the expression of transgenes in several types of corn tissue. The indicated samples were obtained from the described tissue types of T1 transgenic plants.

Construct No. Kind of fabric Events analyzed- From Samples analyzed- of Cry34Ab Average 1 (ng / mg) STANDARD Average AAD-1 (ng / mg) STANDARD pDAB113121 Sheet V4 1 8 0 0 785 131 pDAB116099 Sheet V4 5 32 347 72 103 80 pDAB116099 leaf V12 5 14 278 126 325 171 pDAB116099 Sheet R3 5 15 474 204 680 172 pDAB116099 Root V4 4 12 2973 1164 3768 832

As such, a new gene regulatory element of the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa (SEQ ID NO: 1) has been identified and characterized. New elements are disclosed for the first time

Petition 870170040657, of 6/13/2017, p. 90/184

85/88 3'UTR regulators for use in gene expression constructs. Example 7: Agrobacterium-Mediated Transformation of Genes Operationally Linked to the 3 'RTU of the Ubiquitin-3 gene from Oryza sativa [00181] Soy can be transformed with genes operably linked to the 3' RTU of the Ubiquitin-3 gene from Oryza sativa via of using the same techniques described previously in Example # 11 or Example # 13 of patent application WO 2007/053482.

[00182] Cotton can be transformed with genes operationally linked to the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa using the same techniques described previously in Example # 14 of US Patent No. 7,838,733 or Example # 12 of patent application WO 2007/053482 (Wright et al.).

[00183] Canola can be transformed with genes operationally linked to the 3 'UTR of the Oryza sativa Ubiquitin-3 gene using the same techniques described previously in Example # 26 of US Patent No. 7,838,733 or Example # 22 of patent application WO 2007/053482 (Wright et al.).

[00184] Wheat can be transformed with genes operationally linked to the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa using the same techniques described previously in Example # 23 of patent application WO 2013 / 116700A1 (Lira et al. ).

[00185] Rice can be transformed with genes operationally linked to the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa using the same techniques described previously in Example # 19 of patent application WO 2013 / 116700A1 (Lira et al. ).

Example 8: Agrobacterium-Mediated Transformation of Genes Operationally Linked to the Regulatory Element of the Ubiquitin-3 gene from Oryza sativa [00186] In light of the disclosure of the subject, the additional cultures poPetição 870170040657, 06/13/2017, p. 91/184

86/88 may be transformed according to the modalities of subject disclosure using techniques that are known in the art. For agrobacterium-mediated transformation of rye, see, for example, Popelka JC, Xu J, Altpeter F., Generation of rye with low transgene copy number after biolistic gene transfer and production of (Secale cereale L.) plants instantly marker-free transgenic rye, Transgenic Res. October 2003; 12 (5): 587-96.). For agrobacterium-mediated transformation of sorghum, see, for example, Zhao et al., Agrobacterium-mediated sorghum transformation, Plant Mol Biol. December 2000; 44 (6): 789-98. For Agrobacterium-mediated transformation, see, for example, Tingay et al, Agrobacterium tumefaciens-mediated barley transformation, The Plant Journal, (1997) 11: 1369-1376. For Agrobacterium-mediated transformation of wheat, see, for example, Cheng et al., Genetic Transformation of Wheat Mediated by Agrobacterium tumefaciens, Plant Physiol. November 1997; 115 (3): 971-980. For Agrobacterium-mediated transformation of rice, consultant, for example, Hiei et al, Transformation of rice mediated by Agrobacterium tumefaciens, Plant Mol. Biol. September 1997; 35 (1-2): 205-18.

[00187] The Latin names for these and other plants are given below. It should be clear that other transformation techniques (nonAgrobacterium) can be used to transform genes operationally linked to the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa, for example, in these and other plants. Examples include, but are not limited to; corn (Zea mays), wheat (Triticum spp.), rice (Oryza spp. and Zizania spp.), barley (Hordeum spp.), cotton (Abroma augusta and Gossypium spp.), soy (Glycine max), sugar and beets (Beta spp.), Sugar cane (Arenga pinnata), tomato (Lycopersicon esculentum and other spp., Physalis ixocarpa, Solanum incanum and other spp., And Cyphomandra betacea), potato (Solanum tuberosum), potato

Petition 870170040657, of 6/13/2017, p. 92/184

87/88 sweet (Ipomoea potatoes), rye (Secale spp.), Peppers (Capsicum annuum, chinense, and frutescens), lettuce (Lactuca sativa, perennis, and pulchella), cabbage (Brassica spp.), Celery (Apium graveolens) , eggplant (Solanum melongena), peanuts (Arachis hypogea), sorghum (Sorghum spp.), alfalfa (Medicago sativa), carrots (Daucus carota), beans (Phaseolus spp. and other genera), oats (Avena sativa and strigosa), peas (Pisum, Vigna, and Tetragonolobus spp.), sunflower (Helianthus annuus), pumpkin (Cucurbita spp.), cucumber (Cucumis sativa), tobacco (Nicotiana spp.), Arabidopsis (Arabidopsis thaliana), peat (Lolium, Agrostis, Poa, Cynodon, and other genera), clover (Trifolium), vetch (Vicia). The transformation of these plants, with genes operationally linked to the 3 'UTR of the Ubiquitin-3 gene of Oryza sativa, for example, is contemplated in the modalities of disclosing the object. [00188] The use of the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa to terminate the operationally linked genes can be used in many perennial and deciduous wood species. Such applications are also within the scope of the modalities of this disclosure. These species include, but are not limited to; alder (Alnus spp.), ash (Fraxinus spp.), poplar and poplar species (Populus spp.), beech (Fagus spp.), birch (Betula spp.), cherry (Prunus spp.), eucalyptus (Eucalyptus spp. .), bitter walnut (Carya spp.), maple (Acer spp.), oak (Quercus spp.), and pine (Pinus spp.).

[00189] The use of the 3 'UTR of the Ubiquitin-3 gene from Oryza sativa to terminate the operationally linked genes can be used in many ornamental and fruit species. Such applications are also within the scope of the modalities of this disclosure. Examples include, but are not limited to; rose (Rosa spp.), fiery shrub (Euonymus spp.), petunia (Petunia spp.), begonia (Begonia spp.), rhododendron (Rhododendron spp.), Wild or domestic apple (Malus spp.), pear (Pyrus spp.) .), peach (Prunus spp.) and marigold (Tagetes

Petition 870170040657, of 6/13/2017, p. 93/184

88/88 spp.).

[00190] Although a variety of exemplary aspects and modalities have been discussed above, those skilled in the art will recognize certain modifications, permutations, additions and respective subcombination. It is therefore intended that the following appended claims and claims are henceforth interpreted to include all such modifications, permutations, additions and subcombination as they are in their true spirit and scope.

Petition 870170040657, of 6/13/2017, p. 94/184

1/4

Claims (26)

1. Nucleic acid vector characterized by the fact that it comprises a 3 'RTU operationally linked to: a) a polylinker or a short polynucleotide sequence; b) a Ubiquitin-3 gene from non-Oryza sativa; or c) a combination of a) and b), wherein said 3 'UTR comprises a polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1. 2. Nucleic acid vector according to claim 1, characterized by the fact that said 3 'RTU is 1001 bp in length. Nucleic acid vector according to claim 1, characterized in that said 3 'UTR consists of a polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1. Nucleic acid vector according to any one of claims 1 to 3, characterized in that it further comprises a sequence encoding a selectable marker. 5. Nucleic acid vector according to claim 1, characterized by the fact that said 3 'RTU is operationally linked to a transgene. 6. Nucleic acid vector according to claim 5, characterized by the fact that the transgene encodes a selectable marker or gene product that confers resistance to insecticides, tolerance to herbicides, expression of an RNAi, miRNA, siRNA, efficiency nitrogen use, water use efficiency or nutritional quality. Nucleic acid vector according to any one of claims 1 to 3 or 5, characterized in that it further comprises a promoter polynucleotide sequence that has at least Petition 870170040657, of 6/13/2017, p. 95/184 2/4 minus 90% sequence identity with SEQ ID NO: 2, wherein the promoter sequence is operably linked to said polylinker or said transgene. Nucleic acid vector according to any one of claims 1 to 3 or 5, characterized in that it further comprises an intron sequence. Nucleic acid vector according to claim 1, characterized by the fact that said 3'UTR has constitutive or tissue-specific expression. 10. Plant characterized by the fact that it comprises a polynucleotide sequence that has at least 90% sequence identity with SEQ ID NO: 1 operationally linked to a transgene. 11. Plant, according to claim 10, characterized by the fact that said plant is selected from the group consisting of corn, wheat, rice, sorghum, oats, rye, bananas, sugar cane, cotton, Arabidopsis, tobacco, sunflower and canola. 12. Plant, according to claim 10, characterized by the fact that said plant is Zea mays. 13. Plant according to any one of claims 10 to 12, characterized by the fact that the transgene is inserted into the genome of said plant. 14. Plant according to claim 10, characterized by the fact that a 3 'RTU comprises a polynucleotide sequence with at least 90% sequence identity to SEQ ID NO: 1, and said 3' RTU has 1001 bp of lenght. 15. Plant according to claim 14, characterized by the fact that it comprises a promoter sequence comprising SEQ ID NO: 2, in which the promoter sequence is operationally linked to said transgene. Petition 870170040657, of 6/13/2017, p. 96/184 3/4 16. Plant, according to claim 15, characterized by the fact that said transgene has a constitutive or tissue-specific expression. 17. Plant, according to claim 15, characterized by the fact that said promoter is a promoter of the Oryza sativa Ubiquitin-3 gene. 18. Transgenic seed characterized by the fact that it is produced from the plant, as defined in claim 10. 19. Method for producing a transgenic plant cell, characterized by the fact that it comprises the steps of: a) transforming a plant cell with a gene expression cassette comprising a 3'UTR of the Ubiquitin-3 gene from Oryza sativa operably linked to at least one polynucleotide sequence of interest; b) isolating the transformed plant cell comprising the gene expression cassette; and, c) to produce a transgenic plant cell comprising the 3'UTR of the Oryza sativa Ubiquitin-3 gene operably linked to at least one polynucleotide sequence of interest. 20. Method according to claim 19, characterized by the fact that the transformation of a plant cell is carried out with a plant transformation method. 21. Method according to claim 19, characterized by the fact that the polynucleotide sequence of interest is stably integrated into the genome of the transgenic plant cell. 22. Method, according to claim 19, characterized by the fact that it also comprises the steps of: d) regeneration of the transgenic plant cell in a transgenic plant; and, e) obtaining the transgenic plant, in which the transPetition plant 870170040657, dated 06/13/2017, p. 97/184 4/4 gene comprises the gene expression cassette comprising the 3'UTR of the Oryza sativa Ubiquitin-3 gene according to claim 1, operably linked to at least one polynucleotide sequence of interest. 23. 3'UTR of the Oryza sativa Ubiquitin-3 gene, as defined in claim 19, characterized in that the 3'UTR of the Oryza sativa Ubiquitin-3 gene comprises the polynucleotide of SEQ ID NO: 1. 24. Isolated polynucleotide characterized by the fact that it comprises a nucleic acid sequence with at least 90% sequence identity to the polynucleotide of SEQ ID NO: 1. 25. Isolated polynucleotide according to claim 24, characterized in that it further comprises an open reading frame polynucleotide that encodes a polypeptide; and a promoter sequence. 26. Isolated polynucleotide according to claim 24, characterized in that the polynucleotide of SEQ ID NO: 1 is 1001 bp in length. Petition 870170040657, of 6/13/2017, p. 98/184 1/1 Border B of T-DNA trfA oriT Cry34AB1 v2 ZMEXP18544.1 AAD-1 v3 T-DNA edge A T-DNA edge A T-DNA edge A Zml_ip3 ’UTRv1