BR102013022374B1

BR102013022374B1 - Modified Leishmania ssp. gene, process for obtaining protein and use as antigen in vaccine composition or in immunodiagnosis

Info

Publication number: BR102013022374B1
Application number: BR102013022374-3A
Authority: BR
Inventors: Ricardo Tostes Gazzinelli; Ana Paula Salles Moura Fernandes; Leonardo Miranda Damasceno
Original assignee: Universidade Federal De Minas Gerais
Priority date: 2013-09-02
Filing date: 2013-09-02
Publication date: 2022-04-19
Also published as: BR102013022374A2; WO2015029002A1

Abstract

GENE MODIFICADO DE Leishmania ssp., PROCESSO PARA OBTENÇÃO DE PROTEÍNA E USO COMO ANTÍGENO EM COMPOSIÇÃO VACINAL OU EM IMUNODIAGNÓSTICO A presente invenção descreve uma sequência nucleotídica resultante da modificação e redução do gene que codifica a proteína A2 de Leishmania, bem como seu processo de obtenção e seus usos e uma composição vacinal contendo a proteína obtida a partir deste gene modificado. As modificações introduzidas viabilizam a execução mais eficiente de técnicas de Biologia Molecular, como PCR, clonagem e expressão heteróloga, bem como permitem a expressão da proteína A2HlS-OZ em células procarióticas com maior rendimento. Esses aspectos são especialmente interessantes para o controle de qualidade e produção da proteína em escala industrial. A proteína A2HlS-OZ obtida a partir deste gene modificado poderá ser utilizada como antígeno vacinal na prevenção de leishmaniose canina ou humana ou como antígeno para imunodiagnóstico da leishmaniose visceral.MODIFIED GENE OF Leishmania ssp., PROCESS FOR OBTAINING PROTEIN AND USE AS AN ANTIGEN IN VACCINE COMPOSITION OR IN IMMUNODIAGNOSIS The present invention describes a nucleotide sequence resulting from the modification and reduction of the gene encoding Leishmania A2 protein, as well as its process of obtaining and its uses and a vaccine composition containing the protein obtained from this modified gene. The modifications introduced make it possible to perform Molecular Biology techniques more efficiently, such as PCR, cloning and heterologous expression, as well as allowing the expression of the A2HlS-OZ protein in prokaryotic cells with higher yields. These aspects are especially interesting for quality control and protein production on an industrial scale. The A2HlS-OZ protein obtained from this modified gene can be used as a vaccine antigen in the prevention of canine or human leishmaniasis or as an antigen for the immunodiagnosis of visceral leishmaniasis.

Description

A presente invenção descreve uma sequência nucleotídica resultante da modificação e redução do gene que codifica a proteína A2 de Leishmania, bem como seu processo de obtenção e seus usos e uma composição vacinai contendo a proteína obtida a partir deste gene modificado. As modificações introduzidas viabilizam a execução mais eficiente de técnicas de Biologia Mcjlecular, como PCR, clonagem e expressão heteróloga, bem como permitem a expressão da proteína A2HIS-OZ em células procarióticas com maior rendimento. Esses aspectos são especialmente interessantes para o controle de qualidade e produção da proteína em escala industrial. A proteína A2HIS- OZ obtida a partir deste gene modificado poderá ser utilizada como antígeno vacinai na prevenção de leishmaniose canina ou humana ou como antígeno para imunodiagnóstico da leishmaniose visceral.The present invention describes a nucleotide sequence resulting from the modification and reduction of the gene encoding Leishmania A2 protein, as well as its process of obtaining and its uses, and a vaccine composition containing the protein obtained from this modified gene. The modifications introduced enable a more efficient execution of Mcjlecular Biology techniques, such as PCR, cloning and heterologous expression, as well as allowing the expression of the A2HIS-OZ protein in prokaryotic cells with higher yields. These aspects are especially interesting for quality control and protein production on an industrial scale. The A2HIS-OZ protein obtained from this modified gene can be used as a vaccine antigen in the prevention of canine or human leishmaniasis or as an antigen for the immunodiagnosis of visceral leishmaniasis.

As leishmanioses são doenças parasitárias endêmicas em cerca de 88 países, dentre os quais 72 são países em desenvolvimento. São causadas por uma variedade de espécies de protozoários pertencentes ao gênero Leishmania e se apresentam clinicamente como lesões cutâneas, mucocutâneas ou sob a forma de infecção visceral (World Health Organization. Program for the surveillance and control of leishmaniasis. Acesso em: <http://who.int/emc/diseases/leish/index.html 2005>). Alterações nas funções do baço, fígado e da medula óssea são observadas nos pacientes infectados, sendo que a infecção pode tornar-se crônica e causar febre irregular de longa duração, hepatoesplenomegalia, linfadenopatia, anemia, leucopenia, edema, debilidade progressiva e emagrecimento, podendo levar à morte na ausência de tratamento. Indivíduos infectados podem também permanecer assintomáticos, embora cerca de 20% dos indivíduos em regiões endêmicas desenvolvam a forma clássica da doença (SUNDAR, S.; RAI, M. Laboratory diagnosis of visceral leishmaniasis. Archive of "Clinical and Diagnostic Laboratory Immunology, v. 9, n. 5, 2002).Leishmaniasis are endemic parasitic diseases in about 88 countries, among which 72 are developing countries. They are caused by a variety of protozoan species belonging to the genus Leishmania and present clinically as cutaneous, mucocutaneous or visceral infections (World Health Organization. Program for the surveillance and control of leishmaniasis. Access at: <http:/ /who.int/emc/diseases/leish/index.html 2005>). Changes in the functions of the spleen, liver and bone marrow are observed in infected patients, and the infection can become chronic and cause irregular long-lasting fever, hepatosplenomegaly, lymphadenopathy, anemia, leukopenia, edema, progressive weakness and weight loss, which may lead to death in the absence of treatment. Infected individuals may also remain asymptomatic, although about 20% of individuals in endemic regions develop the classic form of the disease (SUNDAR, S.; RAI, M. Laboratory diagnosis of visceral leishmaniasis. Archive of "Clinical and Diagnostic Laboratory Immunology, v. 9, no. 5, 2002).

Cães infectados, mesmo assintomáticos, apresentam grande quantidade de parasites na pele, o que favorece a infecção do inseto vetor a partir deste reservatório e, conseqüentemente, a transmissão para o homem (TESH, R. Control of Zoonotic Visceral Leishmaniasis: Is It Time to Change Strategies? The American Journal of Tropical Medicine and Hygiene, v. 52, p. 287-292, 1995). O tratamento da leishmaniose visceral canina (LVC), independente do fármaco utilizado, não é viável como medida de controle da doença. O tratamento tem custo elevado e, freqüentemente, cães tratados e clinicamente curados sofrem recaídas, permanecendo como fontes de infecção para o vetor, aléhri de aumentar o risco de seleção de linhagens resistentes a tais fármacos, com sérias implicações para o tratamento do homem (GRAMICCIA, M.; GRADONI, L. The current status of zoonotic leishmaniases and approaches to disease control. International Journal for Parasitology, v. 35, p. 1169-1180, 2005).Infected dogs, even asymptomatic, present a large amount of parasites on the skin, which favors the infection of the insect vector from this reservoir and, consequently, the transmission to humans (TESH, R. Control of Zoonotic Visceral Leishmaniasis: Is It Time to Change Strategies, The American Journal of Tropical Medicine and Hygiene, v. 52, p. 287-292, 1995). The treatment of canine visceral leishmaniasis (CVL), regardless of the drug used, is not viable as a measure to control the disease. Treatment is expensive and, frequently, treated and clinically cured dogs suffer relapses, remaining sources of infection for the vector, in addition to increasing the risk of selecting strains resistant to such drugs, with serious implications for the treatment of humans (GRAMICCIA , M.; GRADONI, L. The current status of zoonotic leishmaniasis and approaches to disease control. International Journal for Parasitology, v. 35, p. 1169-1180, 2005).

O procedimento mais utilizado no controle da LVC, inclusive regulamentado pela Organização Mundial de Saúde (OMS) e adotado pelo Ministério da Saúde do Brasil, é a eliminação dos cães soropositivos para antígenos de Leishmania, os quais são detectados por meio do diagnóstico sorológico ou pela presença de sintomas clínicos.' No entanto, tais procedimentos acarretam profunda tristeza e indignação aos seus donos que, por vezes, preferem omitir a doença aos órgãos competentes, até a proximidade da morte dos animais quando, nesses casos, já se tornaram importantes transmissores do parasita (TESH, R. Control of Zoonotic Visceral Leishmaniasis: Is It Time to Change Strategies? The American Journal of Tropical Medicine and Hygiene, v. 52, p. 287-292, 1995).The most used procedure in the control of CVL, including regulated by the World Health Organization (WHO) and adopted by the Ministry of Health of Brazil, is the elimination of seropositive dogs for Leishmania antigens, which are detected through serological diagnosis or by presence of clinical symptoms.' However, such procedures cause deep sadness and indignation to their owners, who sometimes prefer to omit the disease to the competent bodies, until the animals are close to death, when, in these cases, they have already become important transmitters of the parasite (TESH, R. Control of Zoonotic Visceral Leishmaniasis: Is It Time to Change Strategies? The American Journal of Tropical Medicine and Hygiene, v. 52, pp. 287-292, 1995).

O desenvolvimento de uma vacina que seja eficaz em proteger o cão e, consequentemente, diminuir as taxas de transmissão para o homem ainda é de grande relevância para o controle da leishmaniose. No Brasil, os Ministérios da Saúde e da Agricultura preconizam, de acordo com a portaria interministerial 034/2008, que esta vacina, uma vez aplicada nos cães, seja capaz de induzir uma resposta imunológica eficaz em reduzir o parasitismo tecidual e a transmissão do parasita ao inseto vetor, o que pode ser evidenciado por meio de xenodiagnóstico, reação em cadeia da polimerase (PCR) ou imunohistoquímica. Adicionalmente, esta vacina deve ser capaz de permitir a distinção sorológica dos cães vacinados daqueles infectados, empregando métodos laboratoriais de baixo custo, disponíveis na rede pública e que não onerem o sistema de saúde do País. Portanto, a adoção de uma vacina como nova medida de controle da Leishmaniose não deve interferir nas medidas de controle vigentes.The development of a vaccine that is effective in protecting the dog and, consequently, reducing the rates of transmission to humans is still of great relevance for the control of leishmaniasis. In Brazil, the Ministries of Health and Agriculture recommend, according to interministerial decree 034/2008, that this vaccine, once applied to dogs, is capable of inducing an effective immune response to reduce tissue parasitism and parasite transmission. to the insect vector, which can be evidenced by means of xenodiagnosis, polymerase chain reaction (PCR) or immunohistochemistry. Additionally, this vaccine must be capable of allowing the serological distinction of vaccinated dogs from those infected, using low-cost laboratory methods, available in the public network and which do not burden the country's health system. Therefore, the adoption of a vaccine as a new measure to control Leishmaniasis should not interfere with the current control measures.

A maioria das pesquisas focando o desenvolvimento de vacinas baseia- se na identificação de moléculas do parasita e em protocolos de imunização qu£ tenham a capacidade de induzir resposta imune celular Th1, requisito essencial para indução de proteção à doença. Entretanto, vacinas contra LVC são de difícil desenvolvimento e por isso, ainda raras. Uma delas, a Leishmune®, utiliza como ativo vacinai um complexo antigênico purificado, incluindo proteínas, que corresponde ao complexo Fucose-Manose Ligante (FML) presente na superfície do parasita (Universidade Federal do Rio de Janeiro. Composição contendo frações de células de leishmania, denominadas antígeno FML "fucose mannose ligand" ou "ligante de fucose-manose", uso do antígeno FML e de suas subtrações e componentes para as aplicações em imunodiagnóstico específico da leishmaniose visceral humana e animal, para aplicações em vacinação, tratamento ou imunoterapia contra a leishmaniose visceral humana e canina. BR n. PI 9302386-3 A, 17 jun. 1993). A desvantagem deste produto é que, uma vez vacinado com ele, o animal desenvolverá pesada resposta por anticorpos específicos contra o parasita, tornando-o soropositivo. Assim, o diagnóstico sorológico acusará a infecção (falso-positivo) e os cães vacinados deverão ser sacrificados.Most of the research focused on vaccine development is based on the identification of parasite molecules and on immunization protocols that have the ability to induce a Th1 cellular immune response, an essential requirement for inducing protection against the disease. However, vaccines against CVL are difficult to develop and, therefore, still rare. One of them, Leishmune®, uses a purified antigenic complex, including proteins, which corresponds to the Fucose-Mannose Ligand (FML) complex present on the surface of the parasite (Federal University of Rio de Janeiro. Composition containing Leishmania cell fractions) as a vaccine active , called FML antigen "fucose mannose ligand" or "fucose-mannose ligand", use of the FML antigen and its subtractions and components for applications in specific immunodiagnosis of human and animal visceral leishmaniasis, for applications in vaccination, treatment or immunotherapy against human and canine visceral leishmaniasis (BR No PI 9302386-3 A, June 17, 1993). The disadvantage of this product is that, once vaccinated with it, the animal will develop a heavy response by specific antibodies against the parasite, making it seropositive. Thus, the serological diagnosis will show the infection (false-positive) and the vaccinated dogs must be euthanized.

Além disso, a não diferenciação por métodos tradicionais de animais infectados daqueles vacinados gera um grande problema para a saúde pública. O diagnóstico preconizado pelos órgãos públicos é o sorológico, sendo que os inquéritos epidemiológicos realizados pelo Ministério da Saúde se baseiam, em parte, nos resultados sorológicos de cães. Logo, com o advento da vacinação pela Leishmune® e tendo em vista o efeito anteriormente citado, os resultados obtidos não são reais. Por meio de outros exames, como a Reação em Cadeia da Polimerase (PCR) ou imunocitoquímica, é possível diferenciar os cães soropositivos devido à vacinação ou infecção. No entanto, a execução destes exames exige técnicas aprimoradas, equipamento e reagentes de elevado custo, além de técnicos capacitados para garantir fidelidade de resultados, tornando seu uso em saúde pública de difícil implantação e de elevado custo financeiro.In addition, the non-differentiation by traditional methods of infected animals from those vaccinated creates a major problem for public health. The diagnosis recommended by public bodies is serological, and the epidemiological surveys carried out by the Ministry of Health are based, in part, on the serological results of dogs. Therefore, with the advent of Leishmune® vaccination and in view of the aforementioned effect, the results obtained are not real. Through other tests, such as the Polymerase Chain Reaction (PCR) or immunocytochemistry, it is possible to differentiate seropositive dogs due to vaccination or infection. However, the execution of these tests requires improved techniques, equipment and expensive reagents, in addition to trained technicians to guarantee fidelity of results, making their use in public health difficult to implement and of high financial cost.

O antígeno A2 foi identificado inicialmente em Leishmania (Leishmania) donovani, por Charest & Matlashewski (1994), a partir de uma biblioteca de ícDNA de formas amastigotas desta espécie. Cópias múltiplas do gene A2 estão agrupadas no cromossomo 22 (850 kb) de L. (L.) donovani, sendo que esses genes são conservados também nas espécies L. (L.) infantum, L. (L.) chagasi, L. (L.) amazonensis e L. (L.) mexicana (CHAREST, H.; MATLASHEWSKI, G. Developmental gene expression in Leishmania donovani: differential cloning and analysis of an amastigote-stage-specific gene. Molecular and Cellular Biology, v. 14, n. 5, p. 2975-2984, 1994; GHEDIN, E. et al. Antibody response against a Leishmania donovani amastigote-stage-specific protein in patients with visceral leishmaniasis. Clinical and Diagnostic Laboratory Immunology, v. 4, n. 5, p. 530-535, 1997). A proteína A2 é composta por uma sequência de dez aminoácidos, repetida de 40 a 90 vezes, dependendo do gene da “família A2” que a codifica (CHAREST, H.; MATLASHEWSKI, G. Developmental gene expression in Leishmania donovani: differential cloning and analysis of an amastigote-stage-specific gene. Molecular and Cellular Biology, v. 14, n. 5, p. 2975-2984, 1994; ZHANG et al. Identification and overexpression of the A2 amastigote-specific protein in Leishmania donovani. Molecular and Biochemical Parasitology, v. 78, p. 79-90, 1996).The A2 antigen was initially identified in Leishmania (Leishmania) donovani, by Charest & Matlashewski (1994), from an icDNA library of amastigote forms of this species. Multiple copies of the A2 gene are clustered on chromosome 22 (850 kb) of L. (L.) donovani, and these genes are also conserved in the species L. (L.) infantum, L. (L.) chagasi, L. (L.) amazonensis and L. (L.) mexicana (CHAREST, H.; MATLASHEWSKI, G. Developmental gene expression in Leishmania donovani: differential cloning and analysis of an amastigote-stage-specific gene. Molecular and Cellular Biology, v. 14, No. 5, pp. 2975-2984, 1994; GHEDIN, E. et al. Antibody response against Leishmania donovani amastigote-stage-specific protein in patients with visceral leishmaniasis. Clinical and Diagnostic Laboratory Immunology, v. 4, n. 5, pp. 530-535, 1997). The A2 protein is composed of a sequence of ten amino acids, repeated from 40 to 90 times, depending on the “A2 family” gene that encodes it (CHAREST, H.; MATLASHEWSKI, G. Developmental gene expression in Leishmania donovani: differential cloning and analysis of an amastigote-stage-specific gene. Molecular and Cellular Biology, v. 14, n. 5, pp. 2975-2984, 1994; ZHANG et al. Identification and overexpression of the A2 amastigote-specific protein in Leishmania donovani. and Biochemical Parasitology, v. 78, p. 79-90, 1996).

A vacina Leish-Tec® foi desenvolvida contra leishmaniose canina e sua formulação vacinai é composta pela proteína recombinante A2, produzida em Escherichia coli, e associada a adjuvantes, como a saponina (Universidade Federal de Minas Gerais. Processo para vacina recombinante contra a leishmaniose visceral canina contendo o antígeno recombinante A2 e que permite a distinção sorológica entre animais vacinados de animais infectados.The Leish-Tec® vaccine was developed against canine leishmaniasis and its vaccine formulation is composed of the recombinant protein A2, produced in Escherichia coli, and associated with adjuvants such as saponin (Federal University of Minas Gerais. Process for recombinant vaccine against visceral leishmaniasis canina containing the A2 recombinant antigen and which allows serological distinction between vaccinated and infected animals.

BR n. PI 0603490-0 A, 21 jul. 2006). Por se tratar de um antígeno específico do estágio amastigota de várias espécies de Leishmania, os anticorpos gerados nos cães pelo processo de vacinação com este antígeno não são reativos nos testes de diagnóstico sorológico da infecção, uma vez que os testes disponíveis na rotina laboratorial da rede pública de saúde brasileira utilizam antígenos provenientes da forma promastigota do parasita. Portanto, os cães vacinados com Leish-Tech® permanecem soronegativos após o processo de imunização e portanto, possibilita a diferenciação sorológica entre os animais vacinados com A2 daqueles infectados.BR no. PI 0603490-0 A, 21 Jul. 2006). As it is a specific antigen of the amastigote stage of several Leishmania species, the antibodies generated in dogs by the vaccination process with this antigen are not reactive in the serological diagnosis tests of the infection, since the tests available in the laboratory routine of the network Brazilian public health system use antigens from the promastigote form of the parasite. Therefore, dogs vaccinated with Leish-Tech® remain seronegative after the immunization process and therefore, allows serological differentiation between animals vaccinated with A2 from those infected.

Também são encontrados no estado da arte alguns documentos relacionados à utilização do antígeno A2 como reagente para vacinação contra a leishmaniose. A patente US5733778, intitulado “A2 gene of leishmania which is differentially-expressed in amastigote form”, reivindica uma sequência de nucleotídeos do gene A2, isolado e purificado de Leishmania donovani, bem como a sequência de aminoácidos codificada por ele. Também reivindica o plasmídio pGECO 90 contendo este fragmento de DNA e sua expressão em bactérias.Some documents related to the use of the A2 antigen as a reagent for vaccination against leishmaniasis are also found in the state of the art. US5733778, entitled "A2 gene of leishmania which is differentially-expressed in amastigote form", claims a nucleotide sequence of the A2 gene, isolated and purified from Leishmania donovani, as well as the amino acid sequence encoded by it. It also claims the pGECO 90 plasmid containing this DNA fragment and its expression in bacteria.

Já o pedido WO02/078735, intitulado “Leishmania vaccines” descreve uma vacina de DNA que desencadeia resposta imune contra infecção por Leishmania donovani. Esta vacina se baseia em um vetor que contém uma sequência de nucleotídeo do gene A2 além de uma sequência que codifica o gene E6 do papilomavírus humano.WO02/078735, entitled “Leishmania vaccines” describes a DNA vaccine that triggers an immune response against Leishmania donovani infection. This vaccine is based on a vector that contains an A2 gene nucleotide sequence in addition to a sequence encoding the human papillomavirus E6 gene.

O pedido WO9506729, intitulado “Differentially expressed leishmania genes and proteins”, reivindica a utilização, como vacina, do antígeno A2 sob a forma de proteína recombinante ou DNA e também de parasitas atenuados cujo gene de virulência foi inativado.WO9506729, entitled “Differentially expressed leishmania genes and proteins”, claims the use, as a vaccine, of the A2 antigen in the form of recombinant protein or DNA and also of attenuated parasites whose virulence gene has been inactivated.

No pedido de patente PI 0603490-0, intitulado “Processo para vacina recombinante contra a leishmaniose visceral canina contendo o antígeno recombinante A2 e que permite a distinção sorológica entre animais vacinados de animais infectados”, se menciona a produção de A2 recombinante por fermentação. A sequência codificante deste antígeno foi clonada no vetor de expressão de proteínas pET. A cepa BL21 de Escherichia coli foi transformada e, dessa forma, a proteína A2 foi expressa com cauda de 6 aminoácidos histidina na posição N-terminal que permite a purificação da proteína recombinante por meio de cromatografia de afinidade com níquel. Entretanto, o processo ora proposto é melhorado em relação ao descrito em PI 0603490-0, de modo que permite a obtenção da proteína com maior rendimento e maior pureza.In patent application PI 0603490-0, entitled “Process for recombinant vaccine against canine visceral leishmaniasis containing the recombinant A2 antigen and which allows serological distinction between vaccinated and infected animals”, mention is made of the production of recombinant A2 by fermentation. The coding sequence of this antigen was cloned into the pET protein expression vector. The Escherichia coli strain BL21 was transformed and, thus, the A2 protein was expressed with a 6-amino acid histidine tag at the N-terminal position, which allows the purification of the recombinant protein by means of nickel affinity chromatography. However, the process proposed here is improved in relation to the one described in PI 0603490-0, in a way that allows obtaining the protein with greater yield and greater purity.

A presente invenção descreve uma sequência nucleotídica obtida a partir de modificações introduzidas no gene que codifica a proteína A2 de Leishmania. Além dessa nova sequência diferir de todas as outras encontradas noíestado da técnica e citadas anteriormente, ela permite a realização mais eficiente de técnicas de Biologia Molecular, como PCR e clonagem, e a expressão heteróloga, com maior rendimento, da proteína A2HIS em células procarióticas. Portanto, a presente invenção se difere de tudo o que foi mencionado e encontrado no estado da arte.The present invention describes a nucleotide sequence obtained from modifications introduced in the gene encoding the Leishmania A2 protein. In addition to this new sequence differing from all the others found in the state of the art and mentioned above, it allows for a more efficient performance of Molecular Biology techniques, such as PCR and cloning, and the heterologous expression, with higher yield, of the A2HIS protein in prokaryotic cells. Therefore, the present invention differs from everything mentioned and found in the state of the art.

BRIEF DESCRIPTION OF THE FIGURES

A Figura 1 é uma representação esquemática do mapa do plasmídeo de expressão pET-A2HIS-OZ, construído a partir da inserção do gene modificado de A2HIS no vetor de expressão pET9a24a. Legenda: T7 Promoter - promotor de expressão T7; RBS - sítio de ligação ribossomal; MCS - sítio múltiplo de clonagem; T7 Term - terminação de transcrição; F1 ORI - origem de replicação F1; KN(R) - gene codificador de resistência à kanamicina; pBR322 Ori - origem de replicação de E. coli.Figure 1 is a schematic representation of the pET-A2HIS-OZ expression plasmid map constructed from the insertion of the modified A2HIS gene into the pET9a24a expression vector. Caption: T7 Promoter - T7 expression promoter; RBS - ribosomal binding site; MCS - multiple cloning site; T7 Term - transcription termination; F1 ORI - F1 origin of replication; KN(R) - gene encoding kanamycin resistance; pBR322 Ori - E. coli origin of replication.

A Figura 2 representa um ensaio de imunodetecção analisando a expressão em fermentador da proteína A2HIS-OZ utilizando anticorpo anti- 6xHIS. Legenda: KDa - kilo Daltons; M - marcador molecular; S - fração solúvel; I - fração insolúvel; os números correspondem ao tempo de indução com IPTG. A seta indica posição da A2HIS.Figure 2 depicts an immunodetection assay analyzing fermenter expression of A2HIS-OZ protein using anti-6xHIS antibody. Legend: KDa - kilo Daltons; M - molecular marker; S - soluble fraction; I - insoluble fraction; the numbers correspond to the induction time with IPTG. Arrow indicates position of A2HIS.

A Figura 3 é a imagem do resultado da purificação da proteína A2HIS- OZ após eletroforese (SDS-PAGE, gel 12% e corado com coomassie). A seta indica a posição da A2HIS-OZ. Legenda: KDa - kilo Daltons; M - marcador molecular; 1 - proteína total antes da purificação; 2 - Flow through da coluna de quelato de níquel; 3 - fração da eluição da proteína A2HIS-OZ da coluna de quelato de níquel; 4 - fração da eluição da proteína A2HIS-OZ após diálise para próxima etapa de purificação em coluna de resina aniônica; 5 - fração da eluição da proteína A2HIS-OZ da coluna de resina aniônica.Figure 3 is the image of the result of A2HIS-OZ protein purification after electrophoresis (SDS-PAGE, 12% gel and coomassie stained). The arrow indicates the position of A2HIS-OZ. Legend: KDa - kilo Daltons; M - molecular marker; 1 - total protein before purification; 2 - Flow through the nickel chelate column; 3 - elution fraction of A2HIS-OZ protein from the nickel chelate column; 4 - fraction of the elution of the A2HIS-OZ protein after dialysis for the next purification step in an anionic resin column; 5 - A2HIS-OZ protein elution fraction from the anionic resin column.

A Figura 4 é a imagem do resultado do teste de estabilidade da proteína A2HIS-OZ após eletroforese (SDS-PAGE, gel 12% e corado com coomassie). A seta indica posição da A2HIS-OZ. KDa - kilo Daltons; M - marcador molecular; 1 - 500 ng de A2HIS (padrão); 2 - 500 ng de A2HIS-OZ após armazenamento a 4°C em solução aquosa por três meses.Figure 4 is the image of the A2HIS-OZ protein stability test result after electrophoresis (SDS-PAGE, 12% gel and coomassie stained). Arrow indicates position of A2HIS-OZ. KDa - kilo Daltons; M - molecular marker; 1 - 500 ng of A2HIS (standard); 2 - 500 ng of A2HIS-OZ after storage at 4°C in aqueous solution for three months.

A Figura 5 mostra o teste em que a proteína A2HIS-OZ foi submetida a eletroforese (SDS-PAGE, gel 12%) e transferida para membrana de nitrocelulose. A proteína foi submetida a reação com soros de cães vacinados com a vacina Leish-Tec®, que contém a proteína A2HIS original, ou placebo ou com o anticorpo monoclonal anti-A2.Figure 5 shows the test in which the A2HIS-OZ protein was subjected to electrophoresis (SDS-PAGE, 12% gel) and transferred to a nitrocellulose membrane. The protein was reacted with sera from dogs vaccinated with the Leish-Tec® vaccine, which contains the original A2HIS protein, or placebo or with the anti-A2 monoclonal antibody.

A Figura 6 mostra o resultado da análise por western blot da proteína A2HIS-OZ empregando pool de soros humanos de pacientes com LV sintomática (canaleta 2) ou de indivíduos controle não infectados (canaleta 1).Figure 6 shows the result of western blot analysis of the A2HIS-OZ protein using a pool of human sera from patients with symptomatic VL (lane 2) or from uninfected control subjects (lane 1).

A Figura 7 mostra gráficos relativos aos níveis de anticorpos anti-A2, determinados por ELISA, após vacinação de camundongos BALB/c com a proteína A2HIS associada aos adjuvantes Alúmen + CpG ou MPLA.Figure 7 shows graphs relating to the levels of anti-A2 antibodies, determined by ELISA, after vaccination of BALB/c mice with the A2HIS protein associated with the adjuvants Alum + CpG or MPLA.

A Figura 8 mostra gráfico relativo à quantificação de células produtoras de IFN-y quando submetidos a diferentes estímulos (ELISPOT). Legenda: * - P < 0,05, quando comparado com o estímulo por RPMI; n = 4 animais.Figure 8 shows a graph relating to the quantification of IFN-y producing cells when subjected to different stimuli (ELISPOT). Caption: * - P < 0.05, when compared with the RPMI stimulus; n = 4 animals.

A Figura 9 mostra gráfico relativo à produção/dosagem de IFN-y em sobrenadante de cultura de esplenócitos de camundongos imunizados quando submetidos a diferentes estímulos (ELISA). Legenda: * - P < 0,05, quando comparado com o estímulo por RPMI; n = 4 animais.Figure 9 shows a graph relating to the production/dosage of IFN-γ in culture supernatant of splenocytes from immunized mice when subjected to different stimuli (ELISA). Caption: * - P < 0.05, when compared with the RPMI stimulus; n = 4 animals.

A Figura 10 mostra gráfico que representa os resultados da produção de IFN-gama por esplenócitos de camundongos que receberam PBS (G1); A2HIS- OZ (G2); ALUM + MPL + 10μg A2HIS-OZ (G3); ALUM + MPL (G4); ALUM + MPL + 10μg rA2HIS original (G5); e ALUM + MPL + 50μg rA2HIS original (G6).Figure 10 shows a graph representing the results of IFN-gamma production by splenocytes from mice that received PBS (G1); A2HIS-OZ (G2); ALUM + MPL + 10μg A2HIS-OZ (G3); ALUM + MPL (G4); ALUM + MPL + 10μg original rA2HIS (G5); and ALUM + MPL + 50μg original rA2HIS (G6).

A Figura 11 mostra gráfico que representa os resultados da quantificação da carga parasitária do baço e fígado de camundongos vacinados com A2HIS-OZ (A2HIS-OZ/MPLA ou A2HIS-OZ/CPG/Alumen) e desafiados com Leishmania L. infantum. Os resultados foram expressos em função da média entre os logarítimos negativos do título para o órgão de cada grupo. O teste não paramétrico de Mann-Whitney foi utilizado com intervalo de confiança de 95%. n = 6 animais.Figure 11 shows a graph representing the results of the quantification of the parasite load of the spleen and liver of mice vaccinated with A2HIS-OZ (A2HIS-OZ/MPLA or A2HIS-OZ/CPG/Alumen) and challenged with Leishmania L. infantum. The results were expressed as a function of the mean between the negative logarithms of the titer for the organ of each group. The nonparametric Mann-Whitney test was used with a confidence interval of 95%. n = 6 animals.

DETAILED DESCRIPTION OF THE INVENTION

A presente invenção descreve uma sequência nucleotídica resultante da modificação e redução do gene de que codificá a proteína A2 de Leishmania, bejn como seu processo de obtenção e seus usos e uma composição vacinai contendo a proteína obtida a partir deste gene modificado. As modificações introduzidas facilitam a manipulação molecular e viabilizam a execução mais eficiente de técnicas de Biologia Molecular, como PCR e clonagem. Essas técnicas são muito importantes nas etapas de controle de qualidade e rastreabilidade de lotes e estoques sementes, na produção em escala industrial. Além disso as modificações aumentam a estabilidade do gene durante a expressão heteróloga, por fermentação, em células procarióticas.The present invention describes a nucleotide sequence resulting from the modification and reduction of the gene that encodes the Leishmania A2 protein, as well as the process for obtaining it and its uses, and a vaccine composition containing the protein obtained from this modified gene. The modifications introduced facilitate molecular manipulation and enable a more efficient execution of Molecular Biology techniques, such as PCR and cloning. These techniques are very important in the stages of quality control and traceability of lots and seed stocks, in production on an industrial scale. Furthermore the modifications increase the stability of the gene during heterologous expression, by fermentation, in prokaryotic cells.

Para a obtenção do antígeno, denominado A2HIS-OZ, a sequência de DNA codificadora foi otimizada (SEQ ID N°1), para melhor expressão em E. coli, e sintetizada in vitro. A otimização consistiu na substituição de códons que são mais utilizados por bactérias do que por organismos eucariontes, encontrando assim maior abundância de RNA transportadores para tradução da proteína em bactérias (Tabela 1).Tabela 1: Relação entre os códons e seus respectivos aminoácidos na molécula original e na molécula sintetizada.

To obtain the antigen, called A2HIS-OZ, the coding DNA sequence was optimized (SEQ ID N°1), for better expression in E. coli, and synthesized in vitro. The optimization consisted of replacing codons that are more used by bacteria than by eukaryotic organisms, thus finding a greater abundance of RNA carriers for protein translation in bacteria (Table 1).Table 1: Relationship between codons and their respective amino acids in the molecule original and in the synthesized molecule.

Na sequência original, observa-se que cada aminoácido é codificado por um número menor de códons em comparação com a molécula sintética. Por exemplo, o aminoácido prolina é codificado somente pelo códon CCG na sequência original; sendo assim, foi substituído alternadamente pelos códons CCT, CCA e CCG, que codificam esse mesmo aminoácido na sequência otimizada. Outro exemplo refere-se à alternância entre os códons TCC, AGT, TCT, AGC, TCA para serina na molécula otimizada, enquanto apenas os códons TCC, TCT são encontrados na molécula original (Tabela 1).In the original sequence, it is observed that each amino acid is encoded by a smaller number of codons compared to the synthetic molecule. For example, the amino acid proline is encoded only by the codon CCG in the original sequence; therefore, it was alternately replaced by the codons CCT, CCA and CCG, which encode this same amino acid in the optimized sequence. Another example refers to the alternation between TCC, AGT, TCT, AGC, TCA codons for serine in the optimized molecule, while only TCC, TCT codons are found in the original molecule (Table 1).

A proteína A2HIS-OZ obtida a partir deste gene modificado tem aproximadamente 24 KDa, ou seja, seu tamanho é reduzido em relação ao original. Na proteína original, a sequência de aminoácidos vgpqsvgpls/vgplsvgpqs se repete diversas vezes, sendo codificada por mais de 20 repetições da sequência de nucleotídeos “gttggcccgcagtccgtcggcccgctctct”, a qual apresenta poucas variações, como demonstrado na Tabela 2. Ademais, nesta sequência nucleotídica são utilizados poucos códons sinônimos para cada um dos aminoácidos presentes, como demonstrado na Tabela 1. Esse grande número de repetições idênticas aumenta a probabilidade de pareamento equivocado das sequências internas da molécula, bem como de oligonucleotídeos iniciadores (primers) durante as reações de PCR ou sequenciamento. Como consequência, diversos produtos são formados durante essas reações, dificultando a análise e interpretação precisa dos resultados. Na sequência otimizada, essa limitação foi contornada uma vez que o número de vezes em que uma mesma sequência de nucleotídeos se repete foi limitando, implicando seu menor tamanho. Também, a substituição e a alternância de códons sinônimos entre as repetições permitiu um pareamento mais preciso da molécula e dos oligonucleotídeos (Tabela 2).The A2HIS-OZ protein obtained from this modified gene is approximately 24 KDa, that is, its size is reduced in relation to the original. In the original protein, the amino acid sequence vgpqsvgpls/vgplsvgpqs is repeated several times, being encoded by more than 20 repetitions of the nucleotide sequence “gttggcccgcagtccgtcggcccgctctct”, which has few variations, as shown in Table 2. few synonymous codons for each of the amino acids present, as shown in Table 1. This large number of identical repeats increases the probability of mispairing of the internal sequences of the molecule, as well as of oligonucleotide primers (primers) during PCR or sequencing reactions. As a consequence, several products are formed during these reactions, making it difficult to analyze and accurately interpret the results. In the optimized sequence, this limitation was circumvented since the number of times in which the same nucleotide sequence is repeated was limited, implying its smaller size. Also, the substitution and alternation of synonymous codons between the repeats allowed a more precise pairing of the molecule and the oligonucleotides (Table 2).

Outra modificação consiste em uma sequência codificadora de seis resíduos de histidina (cauda de histidina) que foi adicionada na região C- terminal, upstream ao códon de parada, para facilitar a purificação inicial do antígeno. Tabela 2: Comparação entre as repetições que codificam a sequência de aminoácidos vgpqsvgpls/vgplsvgpqs na sequência original e na sequência otimizada.

Another modification consists of a sequence encoding six histidine residues (histidine tail) that was added in the C-terminal region, upstream of the stop codon, to facilitate the initial purification of the antigen. Table 2: Comparison between the repeats encoding the amino acid sequence vgpqsvgpls/vgplsvgpqs in the original sequence and in the optimized sequence.

De modo geral, o tamanho reduzido da proteína A2HIS-OZ obtida a partir desta sequência otimizada tem como vantagem uma menor exposição à ação de proteases presentes no hospedeiro recombinante. Ademais, a proteína apresenta propriedades físico-químicas que facilitam sua purificação e, logo, sua obtenção em alto grau de pureza e aumentam sua estabilidade em solução. A A2HIS-OZ poderá ser utilizada como antígeno vacinai na prevenção de leishmaniose canina e como antígeno para imunodiagnóstico de leishmanioses.In general, the reduced size of the A2HIS-OZ protein obtained from this optimized sequence has the advantage of lower exposure to the action of proteases present in the recombinant host. Furthermore, the protein has physicochemical properties that facilitate its purification and, therefore, its obtainment in a high degree of purity and increase its stability in solution. A2HIS-OZ can be used as a vaccine antigen in the prevention of canine leishmaniasis and as an antigen for immunodiagnosis of leishmaniasis.

O processo para obtenção da A2HIS-OZ consiste, basicamente, em transformar uma bactéria com um vetor de expressão no qual foi inserido o gene modificado (SEQ ID N°1), induzir a expressão da proteína e purificá-la. A proteína obtida poderá ser utilizada tanto no imunodiagnóstico como na profilaxia de leishmanioses.The process for obtaining A2HIS-OZ basically consists of transforming a bacterium with an expression vector in which the modified gene was inserted (SEQ ID N°1), inducing the expression of the protein and purifying it. The protein obtained can be used both in immunodiagnosis and in the prophylaxis of leishmaniasis.

Para melhor compreensão, seguem alguns exemplos, não limitantes, da presente invenção.For better understanding, some non-limiting examples of the present invention follow.

EXAMPLE 1: Construction of vector containing the modified A2HIS gene

Para a produção da proteína A2HIS-OZ, a sequência sintética codificadora (SEQ ID N°1) foi inserida entre os sítios Nde\ e A/otl no vetor de expressão pET9a24a. Para isso, 1 μg do plasmídeo pUC57 foi linearizado com as enzima Notl e Nde\ e submetido à purificação em gel de agarose. O fragmento purificado foi ligado ao vetor pET9a24a, linearizado com as mesmas enzimas e purificado da mesma forma, a 4°C “overnight”, com a enzima T4 DNA Ligase.For the production of the A2HIS-OZ protein, the synthetic coding sequence (SEQ ID NO:1) was inserted between the Nde I and A/ot I sites in the pET9a24a expression vector. For this, 1 μg of plasmid pUC57 was linearized with the enzymes Notl and Nde\ and submitted to agarose gel purification. The purified fragment was ligated into pET9a24a vector, linearized with the same enzymes and purified in the same way, at 4°C overnight, with the enzyme T4 DNA Ligase.

A cepa de Escherichia coli C41 (DE3) foi transformada com o plasmídeo de expressão obtido (Figura 1). Após a ligação, 50μL de uma cultura quimiocompetente de E. coli C41 foi transformada com 2μL do sistema da ligação contendo o plasmídeo da Figura 1. Após 30 minutos de incubação em gelo, as culturas foram submetidas a choque térmico de 1 minuto a 42°C e retornadas ao banho de gelo por 2 minutos. Em seguida, foram plaqueadas em Ágar Luria Bertani (LB) contendo 50μg/mL de ampicilina para a seleção das células resistentes. As colônias selecionadas tiveram o plasmídeo extraído utilizando kit comercial e submetidas ao teste de digestão com as enzimas usâdas para clonagem para a liberação do inserto.Escherichia coli strain C41 (DE3) was transformed with the expression plasmid obtained (Figure 1). After ligation, 50μL of a chemocompetent culture of E. coli C41 was transformed with 2μL of the ligation system containing the plasmid of Figure 1. After 30 minutes of incubation on ice, the cultures were subjected to heat shock for 1 minute at 42° C and returned to the ice bath for 2 minutes. Then, they were plated on Luria Bertani Agar (LB) containing 50μg/mL of ampicillin for the selection of resistant cells. The selected colonies had the plasmid extracted using a commercial kit and submitted to the digestion test with the enzymes used for cloning to release the insert.

O sequenciamento da região de expressão do plasmídeo confirmou a inserção e a correta identidade da sequência codificadora do A2HIS-OZ.Sequencing of the plasmid expression region confirmed the insertion and correct identity of the A2HIS-OZ coding sequence.

EXAMPLE 2: Expression of the A2HIS-OZ protein encoded by the modified gene

Os clones de E. coli C41 (DE3) contendo o pET-A2HIS foram submetidos a experimentos de expressão de pequena (erlenmeyer 250mL) e media (fermentador 2L) escala.E. coli C41 (DE3) clones containing pET-A2HIS were submitted to small (250mL Erlenmeyer flask) and medium (2L fermenter) scale expression experiments.

Ao biorreator, no qual a saturação de O2 e o pH. foram previamente calibrados, são conectadas uma garrafa contendo 700 mL de meio de fermentação (FeSO4.7H2O - 0,08g,hexametafosfato de sódio - 2,4g, cloreto de amónio - 1,68g, ácido cítrico monohidratado - 1,38g, hidróxido de amónio 30% 1,6mL, extrato de levedura - 12g,MgSO4.7H2O - 0,64g, 0,1 M MnCI2.4H2O- 8μL e água deionizada qsp. 700mL) acrescido de 500μL de Antifoam 204, uma garrafa de solução de glicose esterilizada (16% p/v), uma garrafa contendo 80mL de meio de inoculação (FeSO4.7H2O - 0,1g/L,hexametafosfato de sódio - 3,0g/L, cloreto de amónio 2,1 g/L, ácido cítrico monohidratado - 1,73g/L, hidróxido de amónio 30% - 0,2% v/v, extrato de levedura - 15g/L, glicose - 20g/L, MgSO4.7H2O- 0,8g/L, 0,1 M MnCI2.4H2O- 0,001% v/v e água deionizada qsp. 1000mL) acrescido de Kanamicina - 100μg/mL e Cloranfenicol - 36μg/mL ao qual foram inoculados os clones de E. coli transformados com o vetor de expressão pET-A2HIS e uma garrafa contendo 250mL de concentrado de glicose (Glicose - 550,0g/L, FeSO4.7H2O - 0,2g/L, MgSO4.7H2O - 21 ,Og/L, citrato desódio.2H2O - 5,2g/L, 0,1 M MnCI2.4H2O - 24,2% v/v, carbonato de amónio 6,0g/L, hexametafosfato de sódio - 6,0g/L e água deionizada qsp. 1000mL), previamente adicionada a 250mL de um Concentrado de Extrato de Levedura (420g/L) e contendo Kanamicina (100μg/mL) e Cloranfenicol (36μg/mL). Essa cultura foi incubada sob agitação a temperatura 32-37°C. Todos esses meios e soluções são bombeados para o fermentador, onde ocorre a fermentação sob pressão de O2 (18-20%), temperatura (32-37°C) e agitação constantes, controlando-se o pH entre 6,80-6,90. tTo the bioreactor, in which the O2 saturation and the pH. were previously calibrated, a bottle containing 700 mL of fermentation medium (FeSO4.7H2O - 0.08g, sodium hexametaphosphate - 2.4g, ammonium chloride - 1.68g, citric acid monohydrate - 1.38g, sodium hydroxide 30% ammonium 1.6mL, yeast extract - 12g, MgSO4.7H2O - 0.64g, 0.1M MnCl2.4H2O- 8μL and deionized water qsp. 700mL) plus 500μL of Antifoam 204, a bottle of glucose solution (16% w/v), a bottle containing 80mL of inoculation medium (FeSO4.7H2O - 0.1g/L, sodium hexametaphosphate - 3.0g/L, ammonium chloride 2.1g/L, citric acid monohydrate - 1.73g/L, ammonium hydroxide 30% - 0.2% v/v, yeast extract - 15g/L, glucose - 20g/L, MgSO4.7H2O- 0.8g/L, 0.1M MnCl2.4H2O- 0.001% v/v and deionized water qsp. 1000mL) plus Kanamycin - 100μg/mL and Chloramphenicol - 36μg/mL to which E. coli clones transformed with the expression vector pET-A2HIS and a bottle were inoculated containing 250mL of glucose concentrate (Glucose - 550.0g/L, FeSO4.7H2O - 0.2g/L, MgSO4.7H2O - 21.0g/L, sodium citrate.2H2O - 5.2g/L, 0.1M MnCl2.4H2O - 24.2% v/v, ammonium carbonate 6.0g/L, sodium hexametaphosphate - 6.0g/L and deionized water qsp. 1000mL), previously added to 250mL of a Yeast Extract Concentrate (420g/L) and containing Kanamycin (100μg/mL) and Chloramphenicol (36μg/mL). This culture was incubated under agitation at 32-37°C. All these media and solutions are pumped to the fermenter, where fermentation takes place under O2 pressure (18-20%), constant temperature (32-37°C) and agitation, controlling the pH between 6.80-6, 90. t

A expressão da proteína recombinante A2HIS no fermentador foi obtida após a indução da cultura de bactérias com IPTG (isopropil-β-D- tiogalactopiranosídeo) em uma concentração final de 0,6 a 1mM. Neste passo, a temperatura é reduzida para 30-32°C e o pH controlado a 6,80-6,90, através da adição do concentrado de glicose. A fermentação é finalizada com a utilização completa do concentrado de glicose.The expression of the recombinant protein A2HIS in the fermenter was obtained after inducing the culture of bacteria with IPTG (isopropyl-β-D-thiogalactopyranoside) at a final concentration of 0.6 to 1mM. In this step, the temperature is reduced to 30-32°C and the pH controlled to 6.80-6.90 by adding the glucose concentrate. The fermentation is completed with the complete utilization of the glucose concentrate.

A cultura do fermentador foi centrifugada a frio e o sobrenadante foi descartado. As células foram ressuspendidas em tampão de lise (50 mM Tris- Cl pH 8,0, 50 mM NaCI, 1 mM EDTA) em uma proporção de 10 mL de tampão para cada grama úmida de biomassa. Em seguida, a suspensão de células foi homogeneizada por três vezes.The fermenter culture was cold centrifuged and the supernatant was discarded. Cells were resuspended in lysis buffer (50 mM Tris-Cl pH 8.0, 50 mM NaCl, 1 mM EDTA) in a ratio of 10 mL of buffer for each wet gram of biomass. Then, the cell suspension was homogenized three times.

O homogeneizado foi centrifugado a frio e o sobrenadante descartado. O pellet foi ressuspendido em tampão de lavagem (100 mM Fosfato de sódio pH 7,2, 0,5 M NaCI, 1 mM β-mercaptoetanol, 0,5% Triton X-100) em uma proporção de 10mL/grama de pellet. A suspensão foi centrifugada a frio e o sobrenadante descartado.The homogenate was cold centrifuged and the supernatant discarded. The pellet was resuspended in wash buffer (100 mM Sodium Phosphate pH 7.2, 0.5 M NaCl, 1 mM β-mercaptoethanol, 0.5% Triton X-100) at a rate of 10mL/gram of pellet. The suspension was cold centrifuged and the supernatant discarded.

O pellet resultante foi ressuspendido em tampão de ligação (20 mM Fosfato de sódio pH 7,5, 0,5 M NaCI, 5 mM Imidazol, 8 M Uréia) em uma proporção de 10 mL/grama de pellet. Esta suspensão foi misturada à temperatura ambiente por 1-2 horas. A suspensão foi centrifugada a frio, o pellet resultante foi descartado e o sobrenadante foi recolhido para a purificação.The resulting pellet was resuspended in binding buffer (20 mM Sodium Phosphate pH 7.5, 0.5 M NaCl, 5 mM Imidazole, 8 M Urea) at a rate of 10 mL/gram of pellet. This suspension was mixed at room temperature for 1-2 hours. The suspension was cold centrifuged, the resulting pellet discarded and the supernatant collected for purification.

Testes de imunodetecção com anticorpos específicos para a cauda de histidina (anti-6xHIS) confirmaram tamanho, identidade e expressão do antígeno A2HIS-OZ (Figura 2). Parâmetros físico-químicos desta proteína também foram comparados com aqueles da proteína recombinante A2 (rA2) presente na vacina Leish-Tec® (Tabela 3).Tabela 3: Comparação de parâmetros físico-químicos de rA2 e A2HIS.

Immunodetection tests with specific antibodies for the histidine tail (anti-6xHIS) confirmed the size, identity and expression of the A2HIS-OZ antigen (Figure 2). Physicochemical parameters of this protein were also compared with those of the recombinant protein A2 (rA2) present in the Leish-Tec® vaccine (Table 3).Table 3: Comparison of physicochemical parameters of rA2 and A2HIS.

EXAMPLE 3: Purification of A2HIS-OZ protein

A purificação foi efetuada em duas etapas. Na primeira, devido à presença da cauda de histidina presente na porção C-terminal da proteína A2HIS-OZ, esta foi inicialmente purificada utilizando resina de níquel quelado em cromatografia líquida. Isso permitiu remover a maior parte das proteínas provenientes de E. coliPurification was carried out in two steps. In the first one, due to the presence of the histidine tag present in the C-terminal portion of the A2HIS-OZ protein, it was initially purified using chelated nickel resin in liquid chromatography. This allowed to remove most of the proteins from E. coli

O sobrenadante final obtido no Exemplo 2 foi injetado em uma coluna contendo resina de níquel quelado e a um fluxo constante igual à metade do fluxo máximo permitido pela coluna. Após a injeção comjDleta da amostra, a coluna foi lavada com três (3) volumes de coluna de tampão de ligação (20 mM Fosfato de sódio pH 7,5, 0,5 M NaCI, 5 mM Imidazol, 8 M Uréia), a um fluxo constante igual ao máximo permitido pela coluna. Após a lavagem, o tampão de eluição (20 mM Fosfato de sódio pH 7,5, 0,5 M NaCI, 0,5 M Imidazol, 8 M Uréia) foi injetado na coluna e a fração contendo o antígeno A2HIS-OZ (pico de absorbância em 280 nm) foi coletada.The final supernatant obtained in Example 2 was injected into a column containing chelated nickel resin and at a constant flow rate equal to half the maximum flow allowed by the column. After complete injection of the sample, the column was washed with three (3) column volumes of binding buffer (20 mM Sodium Phosphate pH 7.5, 0.5 M NaCl, 5 mM Imidazole, 8 M Urea), at a constant flow equal to the maximum allowed by the column. After washing, the elution buffer (20 mM Sodium Phosphate pH 7.5, 0.5 M NaCl, 0.5 M Imidazole, 8 M Urea) was injected into the column and the fraction containing the A2HIS-OZ antigen (peak absorbance at 280 nm) was collected.

Na segunda etapa de purificação, para a remoção dos contaminantes remanecentes, realizou-se cromatografia líquida em resina de troca aniônica cujo processo foi otimizado. A fração contendo o antígeno A2HIS-OZ proveniente da primeira etapa de purificação foi diafiltrado usando tampão de corrida (50 mM Tris-CI pH 8,0, 4 M Uréia). A amostra foi injetada na coluna contendo resina de troca aniônica. Pelo fato de a proteína A2HIS-OZ obtida ter ponto isoelétrico em pH 8,5 e o tampão ter pH em torno de 8,0, ela não interage com a coluna e as proteínas contaminantes remanescentes da primeira etapa de purificação se liguem à resina de troca aniônica. Portanto, a A2HIS é encontrada no flow through, que é a fração que não interage com a resina.In the second stage of purification, to remove the remaining contaminants, liquid chromatography was carried out on an anion exchange resin whose process was optimized. The fraction containing the A2HIS-OZ antigen from the first purification step was diafiltered using running buffer (50 mM Tris-CI pH 8.0, 4 M Urea). The sample was injected into the column containing anion exchange resin. Because the A2HIS-OZ protein obtained has an isoelectric point at pH 8.5 and the buffer has a pH around 8.0, it does not interact with the column and the remaining contaminating proteins from the first purification step bind to the resin of anion exchange. Therefore, A2HIS is found in the flow through, which is the fraction that does not interact with the resin.

Testes de eletroforese por SDS-PAGE confirmaram o grau de pureza da proteína A2HIS-OZ (A Figura 3).SDS-PAGE electrophoresis tests confirmed the purity of the A2HIS-OZ protein (Figure 3).

EXAMPLE 4: Stability of the A2HIS protein

Uma alíquota do antígeno A2HIS-OZ purificado foi congelado a -70°C e urrp outra alíquota de mesmo volume mantida a 4°C. Ambas foram mantidas nestas condições por um período de 3 meses. Após este período, as alíquotas foram analisadas por gel de poliacrilamida corado com coomassie. Este teste indicou claramente estabilidade do antígeno A2HIS-OZ na sua formulação atual e na condição de tamponamento (tampão de corrida - 50 mM Tris-CI pH 8,0, 4 M Uréia) em ambas as temperaturas testadas (Figura 4).An aliquot of the purified A2HIS-OZ antigen was frozen at -70°C and another aliquot of the same volume kept at 4°C. Both were kept under these conditions for a period of 3 months. After this period, the aliquots were analyzed by coomassie-stained polyacrylamide gel. This test clearly indicated stability of the A2HIS-OZ antigen in its current formulation and in the buffer condition (running buffer - 50 mM Tris-CI pH 8.0, 4 M Urea) at both temperatures tested (Figure 4).

Para comparação, os mesmos testes de estabilidade foram realizados com o antígeno rA2 (Leish-Tech) e eles mostraram a instabilidade e a degradação deste antígeno após um mês de armazenamento a 4°C (Dados não apresentados).For comparison, the same stability tests were performed with the rA2 antigen (Leish-Tech) and they showed the instability and degradation of this antigen after one month of storage at 4°C (Data not shown).

EXAMPLE 5: Assessment of A2HIS-OZ antigenicity a) In vitro test

A antigenicidade da proteína A2HIS-OZ obtida a partir do gene modificado (SEQ ID N°1), descrito no Exemplo 1, foi testada pela avaliação da reatividade de anticorpos induzidos pela vacinação de cães com a vacina Leish-Tec®. Amostras de soros de cães que receberam três doses da vacina foram empregadas em pool em análise por western blot. A proteína recombinante A2HIS-OZ (250-500 ng) foi submetida a eletroforese em gel SDS-Poliacrilamida - 12% (SDS-PAGE), aplicando-se uma voltagem de 80V para empilhamento das amostras e 120V para resolução.The antigenicity of the A2HIS-OZ protein obtained from the modified gene (SEQ ID NO:1) described in Example 1 was tested by evaluating the reactivity of antibodies induced by vaccination of dogs with the Leish-Tec® vaccine. Serum samples from dogs that received three doses of the vaccine were pooled for analysis by western blot. The recombinant protein A2HIS-OZ (250-500 ng) was subjected to electrophoresis in SDS-Polyacrylamide - 12% gel (SDS-PAGE), applying a voltage of 80V for stacking the samples and 120V for resolution.

Após o final do procedimento, o perfil eletroforético foi transferido em banho de gelo para uma membrana de nitrocelulose em tampão de transferência (25mM de Tris Base; 192mM de Glicina; Metanol 20%), aplicando-se 300mA de corrente durante 2 horas. A membrana pós- transferência foi incubada em tampão de bloqueio (5% leite em pó; 0,01% Tween 20) durante 2 horas. Após 3 etapas de lavagem com PBS Tween 0,05%, a membrana foi incubada ou com o pool de soros diluídos de cães (1:100) ou com anticorpo monoclonal anti-A2 diluído em tampão de bloqueio (1:2000).After the end of the procedure, the electrophoretic profile was transferred in an ice bath to a nitrocellulose membrane in transfer buffer (25mM Tris Base; 192mM Glycine; Methanol 20%), applying 300mA of current for 2 hours. The post-transfer membrane was incubated in blocking buffer (5% powdered milk; 0.01% Tween 20) for 2 hours. After 3 washing steps with 0.05% PBS Tween, the membrane was incubated with either the pool of diluted dog sera (1:100) or with anti-A2 monoclonal antibody diluted in blocking buffer (1:2000).

Após mais 3 etapas de lavagem, a exemplo das anteriores, a membrana foi incubada ou com anticorpo anti-lgG de cão ou anti-lgG de camundongo, í ambos acoplados à peroxidase humana (HRP) em diluição 1:2000, durante 1 hota. Após 3 etapas de lavagem com PBS Tween 0,05% e outras 3 com PBS puro, a membrana foi envolvida em material plástico, onde se aplicou solução reveladora Enhanced Chemiluminescense (ECL), deixando agir por 5 minutos na ausência de luz. Após exposição do filme fotográfico, ainda na ausência de luz, esse foi revelado em uma solução reveladora conforme instruções do fabricante (Carvalho et al., 2002, Diag. Microbiol. Inf. Dis. v. 43, 2002).After another 3 washing steps, as in the previous ones, the membrane was incubated with either anti-dog IgG or anti-mouse IgG antibodies, both coupled to human peroxidase (HRP) in a 1:2000 dilution, for 1 hour. After 3 washing steps with PBS Tween 0.05% and another 3 with pure PBS, the membrane was wrapped in plastic material, where Enhanced Chemiluminescense (ECL) developer solution was applied, leaving to act for 5 minutes in the absence of light. After exposure of the photographic film, still in the absence of light, it was developed in a developer solution according to the manufacturer's instructions (Carvalho et al., 2002, Diag. Microbiol. Inf. Dis. v. 43, 2002).

Em análises subsequentes, foram utilizados soros de cães vacinados com a vacina Leish-Tec® e com placebo e soros de pacientes humanos com leishmaniose visceral. Como demonstrado na Figura 5, a proteína A2HIS-OZ é reconhecida especificamente pelos soros dos cães vacinados com a A2HIS original, uma vez que as duas proteínas apresentam a mesma sequência de aminoácidos, a qual é reconhecida por anticorpos dos cães vacinados. Portanto, os soros de cães vacinados com a vacina, que contém a proteína recombinante A2 original, apresentaram reação cruzada com a proteína A2HIS- OZ, indicando que esta mantém as propriedades antigênicas associadas à primeira.In subsequent analyses, sera from dogs vaccinated with the Leish-Tec® vaccine and placebo and sera from human patients with visceral leishmaniasis were used. As shown in Figure 5, the A2HIS-OZ protein is specifically recognized by the sera of dogs vaccinated with the original A2HIS, as the two proteins have the same amino acid sequence, which is recognized by antibodies from the vaccinated dogs. Therefore, sera from dogs vaccinated with the vaccine, which contains the original A2 recombinant protein, showed cross-reaction with the A2HIS-OZ protein, indicating that it maintains the antigenic properties associated with the former.

Além disso, como demonstrado na Figura 6, um pool de soros de pacientes com leishmaniose visceral também reagiu especificamente com a proteína A2HIS-OZ (observa-se, na canaleta 2, a reatividade dos soros dos pacientes com LV com a proteína A2HIS-OZ, de 24 KDa, e ao contrário, na canaleta 1, a ausência de reatividade dos soros de indivíduos controle não infectados), indicando que a mesma, assim como a A2-HIS original, também pode ser empregada como antígeno em testes de diagnóstico sorológico.Furthermore, as shown in Figure 6, a pool of sera from patients with visceral leishmaniasis also reacted specifically with the A2HIS-OZ protein (in channel 2, the reactivity of the sera from VL patients with the A2HIS-OZ protein is observed , of 24 KDa, and on the contrary, in channel 1, the absence of reactivity of the sera of uninfected control individuals), indicating that it, as well as the original A2-HIS, can also be used as an antigen in serological diagnostic tests .

b) In vivo test

As propriedades antigênicas e imunogênicas da proteína A2HIS-OZ foram também avaliadas empregando o modelo animal. Camundongos fêmeas da linhagem BALB/c com 6-8 semanas de vida foram vacinados com a proteína recombinante associada a diferentes adjuvantes. Para esse teste, os camundongos foram separados em 3 grupos de 10 animais: no grupo 1 foram aplicados 100μL de PBS1X estéril; no grupo 2, administrou-se 10-20 μg de proteína A2HIS-OZ, 30% v/v de alúmen e 18μg de CpG; no grupo 3 foram t aplicados 10-20μg de proteína A2 HIS-OZ e 1-2 μg de MPLA (monophosphoryl lipitl A). Os 3 grupos foram inoculados por via subcutânea, na região dorso- posterior. Após 30 dias, todos os animais receberam nova dose homóloga pela mesma via.The antigenic and immunogenic properties of the A2HIS-OZ protein were also evaluated using the animal model. Female mice of the BALB/c strain aged 6-8 weeks were vaccinated with the recombinant protein associated with different adjuvants. For this test, the mice were separated into 3 groups of 10 animals: in group 1, 100μL of sterile PBS1X was applied; in group 2, 10-20 μg of A2HIS-OZ protein, 30% v/v alum and 18 μg of CpG were administered; in group 3, 10-20μg of protein A2 HIS-OZ and 1-2 μg of MPLA (monophosphoryl lipitl A) were applied. The 3 groups were inoculated subcutaneously, in the dorsoposterior region. After 30 days, all animals received a new homologous dose by the same route.

b.1) Assessment of humoral response

A resposta humoral foi avaliada pelo método ELISA de modo a determinar a indução de anticorpos anti-A2 pela vacinação. Ao 15° dia após a primeira dose, 4 animais de cada grupo foram sangrados pelo plexo orbital e o sangue foi centrifugado para extração do soro, o qual foi utilizado para o ELISA de anticorpos IgG em quadruplicate. Para realização dos testes ELISA, placas de 96 poços foram sensibilizadas com a proteína A2HIS-OZ (10μg/mL), diluída em tampão carbonato (0,1 M; pH 9,6). Para cada grupo foi feito um pool com as amostras de soro, que foram diluídas em tampão de bloqueio (1:50) e aplicadas na placa. Posteriormente, os anticorpos secundários anti-lgG total, anti-lgG1 e anti-lgG2a marcados com peroxidase humana (HRP) foram aplicados nos poços correspondentes, diluídos à 1:2000 em tampão de bloqueio. Após a incubação, adicionou-se a solução de substrato (3,3',5,5'- Tetrametilbenzidina (TMB) + H2O2 diluídos em tampão citrato-fosfato pH 5,0) ao sistema. A reação foi interrompida com solução de H2SO4 1:20 e a leitura da absorbância no comprimento de onda de 450nm foi realizada em espectrofotômetro de microplacas.The humoral response was evaluated by the ELISA method in order to determine the induction of anti-A2 antibodies by the vaccination. On the 15th day after the first dose, 4 animals from each group were bled from the orbital plexus and the blood was centrifuged to extract the serum, which was used for the ELISA of IgG antibodies in quadruplicate. To perform the ELISA tests, 96-well plates were sensitized with A2HIS-OZ protein (10μg/mL), diluted in carbonate buffer (0.1 M; pH 9.6). For each group, serum samples were pooled, diluted in blocking buffer (1:50) and applied to the plate. Subsequently, anti-total IgG, anti-IgG1 and anti-IgG2a labeled with human peroxidase (HRP) secondary antibodies were applied to the corresponding wells, diluted 1:2000 in blocking buffer. After incubation, the substrate solution (3,3',5,5'-Tetramethylbenzidine (TMB) + H2O2 diluted in citrate-phosphate buffer pH 5.0) was added to the system. The reaction was stopped with a 1:20 H2SO4 solution and the absorbance reading at a wavelength of 450nm was performed in a microplate spectrophotometer.

No 15° dia após a segunda dose, o mesmo procedimento foi feito para comparação dos valores (Figura 7). Observou-se que níveis elevados de anticorpos anti-A2 foram detectados após a primeira dose, nos grupos vacinados com proteína A2HIS-OZ (Alúmen + CpG + A2HIS-OZ e MPLA + A2HIS-OZ), em comparação com o grupo controle que recebeu apenas PBS (Figura 7).On the 15th day after the second dose, the same procedure was performed to compare the values (Figure 7). It was observed that high levels of anti-A2 antibodies were detected after the first dose, in the groups vaccinated with A2HIS-OZ protein (Alum + CpG + A2HIS-OZ and MPLA + A2HIS-OZ), compared to the control group that received only PBS (Figure 7).

b.2) Evaluation of cellular response

Células produtoras de IFN-gama foram quantificadas a partir dos esplenócitos dos camundongos vacinados. Para tal, placas de cultivo celular foram previamente sensibilizadas overnight a 4°C com solução de anticorpo de captura anti-IFN-y a 5μg/mL em PBS1X. No dia seguinte, as placas foram cuijladosamente lavadas com PBS estéril e incubadas com meio RPMI (suplementado com 5% de Soro Fetal Bovino) em estufa de CO2. As placas ficaram em incubação até o momento da semeadura, aproximadamente 2 horas, quando foi feita outra etapa de lavagem, antes da adição da cultura celular.IFN-gamma producing cells were quantified from the splenocytes of vaccinated mice. For this, cell culture plates were previously sensitized overnight at 4°C with a 5μg/mL anti-IFN-y capture antibody solution in PBS1X. The following day, plates were carefully washed with sterile PBS and incubated with RPMI medium (supplemented with 5% Fetal Bovine Serum) in a CO 2 oven. The plates were incubated until seeding, approximately 2 hours, when another washing step was performed, before the addition of the cell culture.

Ao 21° dia após a segunda dose, 4 animais de cada grupo foram sacrificados, tendo o seu baço removido e imediatamente transferido para meio de cultura RPMI suplementado com 5% de Soro Fetal Bovino (SFB) em banho de gelo. Os órgãos foram macerados com lâminas de vidro foscas e o conteúdo foi centrifugado a frio. Após o descarte do sobrenadante, o material macerado foi ressuspendido em tampão de lise de eritrócitos (0,15M de NH4CI; 0,1 M de KHCO3; 0,1 M de Na2EDTA) e incubado em gelo durante 5 minutos. Para neutralizar a lise, foram adicionados 3 mL de meio RPMI + 5% de SFB e o conteúdo foi, então, centrifugado a frio. O sobrenadante foi novamente descartado e o pellet de esplenócitos foi ressuspendido em 3 mL de meio completo. Após remoção dos sedimentos, nova etapa de centrifugação foi realizada e o novo pellet ressuspendido em 1mL de meio de plaqueamento (RPMI; SFB - 10%; IL-2 - 0,2%). As células em cultura foram quantificadas em contador automático e a concentração foi ajustada com a adição de meio de plaqueamento, de modo que 106 células foram aplicadas por poço.On the 21st day after the second dose, 4 animals from each group were sacrificed, their spleen removed and immediately transferred to RPMI culture medium supplemented with 5% Fetal Bovine Serum (FBS) in an ice bath. The organs were macerated with frosted glass slides and the contents were cold centrifuged. After discarding the supernatant, the macerated material was resuspended in erythrocyte lysis buffer (0.15M NH4Cl; 0.1M KHCO3; 0.1M Na2EDTA) and incubated on ice for 5 minutes. To neutralize the lysis, 3 ml of RPMI medium + 5% FBS was added and the contents were then cold centrifuged. The supernatant was discarded again and the splenocyte pellet was resuspended in 3 mL of complete medium. After removing the sediments, a new centrifugation step was performed and the new pellet was resuspended in 1mL of plating medium (RPMI; FBS - 10%; IL-2 - 0.2%). Cells in culture were quantified in an automatic counter and the concentration was adjusted with the addition of plating medium, so that 10 6 cells were applied per well.

Dentre os estímulos selecionados para a proliferação dos esplenócitos estão a Concanavalina A (controle positivo), o meio RPMI (controle negativo), a proteína recombinante A2HIS-OZ e os peptídeos CD-8, CD4-1 e CD4-2, obtidos sinteticamente com base em estudos de predição previamente realizados (RESENDE, D. M. et al., Epitope mapping and protective immunity elicited by adenovirus expressing the Leishmania amastigote specific A2 antigen: Correlation with IFN-y and cytolytic activity by CD8+ T cells. Vaccine, v. 26, p. 4585-4593 2008). Esses estímulos foram aplicados aos poços correspondentes sobre o meio de plaqueamento previamente adicionado, ficando diluídos às seguintes concentrações finais: Concanavalina A - 5μg/mL; Proteína A2HIS-OZ - 10μg/mL; Peptídeos CD8, CD4-1 e CD4-2 - 10μM. As placas foram então incubadas em estufa com 5% de CO2 por um período de 18 t horas.Among the stimuli selected for the proliferation of splenocytes are Concanavalin A (positive control), the RPMI medium (negative control), the recombinant protein A2HIS-OZ and the peptides CD-8, CD4-1 and CD4-2, obtained synthetically with based on previously performed prediction studies (RESENDE, D. M. et al., Epitope mapping and protective immunity elicited by adenovirus expressing the Leishmania amastigote specific A2 antigen: Correlation with IFN-y and cytolytic activity by CD8+ T cells. Vaccine, v. 26, p. 4585-4593 2008). These stimuli were applied to the corresponding wells on the previously added plating medium, being diluted to the following final concentrations: Concanavalin A - 5μg/mL; A2HIS-OZ protein - 10μg/mL; CD8, CD4-1 and CD4-2 peptides - 10μM. The plates were then incubated in an oven with 5% CO2 for a period of 18 t hours.

Após o período de incubação, o conteúdo das placas foi descartado e as mesmas foram lavadas, primeiro com PBS + 0,05% Tween 20 e depois apenas com PBS. As placas foram, então, incubadas com anticorpo biotinilado anti- IFN-y e, posteriormente, lavadas. O conjugado streptoavidina-peroxidase, diluído 1:2000 em PBS1X foi adicionado aos poços e após 1h de incubação à temperatura ambiente e protegida da luz, as placas foram submetidas a novas etapas de lavagem e reveladas com solução reveladora (1M de Tris-HCI pH 7,5; 10mg de 3,3'-Diaminobenzidina (DAB); 30μL H2O2 e H2O). A reação cromogênica foi interrompida com água corrente em abundância e a quantificação dos spots foi realizada em leitor de ELÍSPOT ImmunoSpot (CTL).After the incubation period, the contents of the plates were discarded and they were washed, first with PBS + 0.05% Tween 20 and then with PBS only. The plates were then incubated with biotinylated anti-IFN-γ antibody and subsequently washed. The streptoavidin-peroxidase conjugate, diluted 1:2000 in PBS1X was added to the wells and after 1h of incubation at room temperature and protected from light, the plates were submitted to new washing steps and developed with a developing solution (1M Tris-HCI pH 7.5; 10mg of 3,3'-Diaminobenzidine (DAB); 30μL H2O2 and H2O). The chromogenic reaction was interrupted with abundant running water and the quantification of the spots was performed in an ImmunoSpot ELÍSPOT reader (CTL).

A partir das mesmas culturas oriundas do processamento realizado para o ELISPOT, 106 células foram retiradas e cultivadas com os estímulos anteriormente citados, em placas de cultivo celular com 96 poços. As placas foram incubadas em estufa de CO2 durante 72h e, após esse período, foram centrifugadas. O sobrenadante de cada poço foi coletado e transferido para nova placa de Cultivo celular, de onde foram extraídas amostras para realização de ELISA Sanduíche para dosagem de IFN-y. As leituras de absorbância no comprimento de onda de 450nm foram feitas em espectrofotômetro de microplacas.From the same cultures from the processing carried out for the ELISPOT, 106 cells were removed and cultivated with the aforementioned stimuli, in 96-well cell culture plates. The plates were incubated in a CO2 oven for 72 hours and, after this period, they were centrifuged. The supernatant from each well was collected and transferred to a new Cell Culture plate, from which samples were extracted to perform a Sandwich ELISA for IFN-y measurement. Absorbance readings at a wavelength of 450nm were taken using a microplate spectrophotometer.

Através da contagem de spots, observa-se uma quantidade elevada de esplenócitos produtores de IFN-y após re-estimulação com A2HIS-OZ ou peptídeos derivados da proteína nos grupos imunizados com a proteína A2HIS- OZ (Figura 8). Além da proteína A2HIS-OZ, os peptídeos também estimularam a produção de IFN-y, indicando que uma resposta específica ao antígeno vacinai foi induzida pela vacinação (Figuras 8 e 9).By spot counting, a high amount of IFN-γ producing splenocytes is observed after restimulation with A2HIS-OZ or protein-derived peptides in groups immunized with A2HIS-OZ protein (Figure 8). In addition to the A2HIS-OZ protein, the peptides also stimulated the production of IFN-γ, indicating that a specific response to the vaccine antigen was induced by vaccination (Figures 8 and 9).

Em outro teste, a produção de IFN-y (Figura 10) foi avaliada em grupos de camundongos que receberam PBS (G1), 10 μg da proteína A2HIS-OZ (G2), alúmen, MPL e 10μg A2HIS-OZ (G3), alúmen, MPL (G4) e alúmen, MPL e 10μg rA2HIS original (G5). Os esplenócitos dos camundongos foram re- estimulados em cultura com as 2 duas proteínas. Observa-se que em doses similares (G3 e G5) as duas proteínas se equivalem sob o aspecto í imunogenicidade, medida pela produção de IFN- y.In another test, the production of IFN-y (Figure 10) was evaluated in groups of mice that received PBS (G1), 10 μg of A2HIS-OZ protein (G2), alum, MPL and 10 μg A2HIS-OZ (G3), alum, MPL (G4) and alum, MPL and 10μg original rA2HIS (G5). The splenocytes of the mice were restimulated in culture with the two proteins. It is observed that at similar doses (G3 and G5) the two proteins are equivalent in terms of immunogenicity, measured by the production of IFN-γ.

Ressalta-se que IFN-y constitui-se em citocina produzida tanto por células T CD4 quanto CD8 que é essencial para indução de resistência à infecção por Leishmania. Dada à especificidade dos peptídeos empregados, como determinado previamente, os resultados indicam que a vacinação levou à ativação de ambos os tipos celulares (RESENDE, D. M. et al., Epitope mapping and protective immunity elicited by adenovirus expressing the Leishmania amastigote specific A2 antigen: Correlation with IFN-y and cytolytic activity by CD8+ T cells. Vaccine, v. 26, p. 4585-4593 2008).It is noteworthy that IFN-y is a cytokine produced by both CD4 and CD8 T cells, which is essential for inducing resistance to Leishmania infection. Given the specificity of the peptides used, as previously determined, the results indicate that vaccination led to the activation of both cell types (RESENDE, D. M. et al., Epitope mapping and protective immunity elicited by adenovirus expressing the Leishmania amastigote specific A2 antigen: Correlation with IFN-y and cytolytic activity by CD8+ T cells. Vaccine, v. 26, p. 4585-4593 2008).

EXAMPLE 6: Vaccination test

Para avaliação da proteção conferida pela vacinação contra infecção por Leishmania infantum, foram utilizados 6 camundongos restantes após o sacrifício e coleta do baço. Ao 21° dia após a segunda dose vacinai, 6 animais de cada grupo foram desafiados subcutaneamente, pelo dorso da pata direita, com 1x107 promastigotas de L. L. infantum, em fase estacionária. A avaliação da carga parasitária foi feita no baço e fígado.To evaluate the protection conferred by vaccination against Leishmania infantum infection, 6 mice remaining after sacrifice and spleen collection were used. On the 21st day after the second vaccine dose, 6 animals from each group were subcutaneously challenged, through the dorsum of the right paw, with 1x107 L.L. infantum promastigotes, in stationary phase. The evaluation of the parasite load was carried out in the spleen and liver.

Trinta dias após o desafio, todos os animais foram sacrificados e tiveram o baço e o fígado removidos em ambiente estéril e imediatamente transferidos para recipientes separados. Para cada miligrama de tecido, adicionou-se 1 mL de meio Schneider completo (20% de SFB inativado; 200U/mL de Penicilina; 100μg/mL de Estreptomicina). Os órgãos foram, então, macerados com lâminas de vidro foscas e homogeneizados até formar uma suspensão de células. Dez microlitros de cada suspensão foram diluídos seriadamente em meio Schneider completo até completar as diluições 10'1, 10'2, 10’3, 10'4, 10’5, 10’6, 10'7 e 10’8. As placas de 96 poços foram revestidas com filme plástico de PVC e incubadas em estufa B.O.D. a 23-24°C durante 7-10 dias. Após o período de incubação, as placas foram lidas em microscópio óptico e o título de cada órgão foi determinado pela última diluição positiva para a presença de 5 parasitas viáveis.Thirty days after the challenge, all animals were sacrificed and the spleen and liver were removed in a sterile environment and immediately transferred to separate containers. For each milligram of tissue, 1 mL of complete Schneider medium (20% inactivated FBS; 200U/mL of Penicillin; 100μg/mL of Streptomycin) was added. The organs were then macerated with frosted glass slides and homogenized to form a cell suspension. Ten microliters of each suspension were serially diluted in complete Schneider medium to complete dilutions 10'1, 10'2, 10'3, 10'4, 10'5, 10'6, 10'7 and 10'8. The 96-well plates were coated with PVC plastic film and incubated in a B.O.D. at 23-24°C for 7-10 days. After the incubation period, the plates were read under an optical microscope and the titer of each organ was determined by the last positive dilution for the presence of 5 viable parasites.

Verifica-se uma redução significativa da carga parasitária no baço e fígado dos animais vacinados com A2HIS-OZ/MPLA e no fígado dos animais vacinados com A2HIS-OZ/CPG/Alumen (Figura 11). Esses dados demonstram que, além de imunogênica, a proteína A2HIS-OZ, quando associada a * adjbvantes, é capaz de induzir proteção contra a infecção por Leishmania infantum.There is a significant reduction in the parasite load in the spleen and liver of animals vaccinated with A2HIS-OZ/MPLA and in the liver of animals vaccinated with A2HIS-OZ/CPG/Alumen (Figure 11). These data demonstrate that, in addition to being immunogenic, the A2HIS-OZ protein, when associated with * adjuvants, is capable of inducing protection against Leishmania infantum infection.

Claims

1. Modified Leishmania ssp. characterized in that it is defined by SEQ ID N°1.

2. Process for obtaining protein using the gene defined in claim 1, characterized in that it comprises the following steps: a. Insertion of the gene defined by SEQ ID N°1 into an expression vector compatible with Escherichia coli, by enzymatic digestion with restriction enzymes; B. Transformation of E. coli with the recombinant DNA obtained in step “a”; ç. Cultivation of the transformed bacteria obtained in step “b” in a fermentation medium; d. Induction of the expression of the protein encoded by the gene defined by SEQ ID NO:1 by means of an IPTG (isopropyl-β-D-thiogalactopyranoside) concentration gradient ranging from 1.0 to 0.2 mM; and. Purification of the protein obtained in step “d”, after cell lysis, by affinity chromatography followed by ion exchange chromatography.

3. Process for obtaining protein, according to claim 2, characterized in that, in step "e", the affinity chromatography is with chelated nickel resin for retention of the protein by means of the histidine tail and by ion exchange chromatography be with anionic resin for retention of undesirable proteins.

4. Use of the modified Leishmania ssp. defined in claim 1, characterized by being in the production of antigen to prepare vaccine or immunodiagnostic kit against leishmaniasis in dogs and humans.