AU2020201779B2 - Method for using gene expression to determine prognosis of prostate cancer - Google Patents

Abstract

Molecular assays that involve measurement of expression levels of prognostic biomarkers, or co expressed biomarkers, from a biological sample obtained from a prostate cancer patient, and analysis of the measured expression levels to provide information concerning the likely prognosis for said patient, and likelihood that said patient will have a recurrence of prostate cancer, or to classify the tumor by likelihood of clinical outcome or TMPRSS2 fusion status, are provided herein.

Description

METHOD FOR USING GENE EXPRESSION TO DETERMINE PROGNOSIS OF PROSTATE CANCER

[0001] This is a divisional of Australian Patent Application No. 2017268510 which is a divisional of No. 2015227398 which is a divisional of No. 2011282892 which is the Australian phase of PCT/US2011/045253 which claims priority from United States patent application No. 31/368,217 filed 27 July 2010, United States patent application No. 61/414,310 filed 16 November 2010 and United States patent application No. 61/485,536 filed 15 May 2011. The contents of each application listed in this paragraph are fully incorporated by reference herein. TECHNICAL FIELD

[0002] The present disclosure relates to molecular diagnostic assays that provide information concerning methods to use gene expression profiles to determine prognostic information for cancer patients. Specifically, the present disclosure provides genes and microRNAs, the expression levels of which may be used to determine the likelihood that a prostate cancer patient will experience a local or distant cancer recurrence. INTRODUCTION

[0003] Prostate cancer is the most common solid malignancy in men and the second most common cause of cancer-related death in men in North America and the European Union (EU). In 2008, over 180,000 patients will be diagnosed with prostate cancer in the United States alone and nearly 30,000 will die of this disease. Age is the single most important risk factor for the development of prostate cancer, and applies across all racial groups that have been studied. With the aging of the U.S. population, it is projected that the annual incidence of prostate cancer will double by 2025 to nearly 400,000 cases per year.

[0004] Since the introduction of prostate-specific antigen (PSA) screening in the 1990's, the proportion of patients presenting with clinically evident disease has fallen dramatically such that patients categorized as "low risk" now constitute half of new diagnoses today. PSA is used as a tumor marker to determine the presence of prostate cancer as high PSA levels are associated with prostate cancer. Despite a growing proportion of localized prostate cancer patients presenting with low-risk features such as low stage (TI) disease, greater than 90% of patients in the US still undergo definitive therapy, including prostatectomy or radiation. Only about 15% of these patients would develop metastatic disease and die from their prostate cancer, even in the absence of definitive therapy. A. Bill-Axelson, et al., J Nat'l Cancer Inst. 100(16):1144-1154 (2008). Therefore, the majority of prostate cancer patients are being over-treated.

[0005] Estimates of recurrence risk and treatment decisions in prostate cancer are currently based primarily on PSA levels and/or tumor stage. Although tumor stage has been demonstrated to have significant association with outcome sufficient to be included in pathology reports, the College of American Pathologists Consensus Statement noted that variations in approach to the acquisition, interpretation, reporting, and analysis of this information exist. C. Compton, et al., Arch Pathol Lab Med 124:979-992 (2000). As a consequence, existing pathologic staging methods have been criticized as lacking reproducibility and therefore may provide imprecise estimates of individual patient risk. SUMMARY

[0006] This application discloses molecular assays that involve measurement of expression level(s) of one or more genes, gene subsets, microRNAs, or one or more microRNAs in combination with one or more genes or gene subsets, from a biological sample obtained from a prostate cancer patient, and analysis of the measured expression levels to provide information concerning the likelihood of cancer recurrence. For example, the likelihood of cancer recurrence could be described in terms of a score based on clinical or biochemical recurrence-free interval.

[0007] In addition, this application discloses molecular assays that involve measurement of expression level(s) of one or more genes, gene subsets, microRNAs, or one or more microRNAs in combination with one or more genes or gene subsets, from a biological sample obtained to identify a risk classification for a prostate cancer patient. For example, patients may be stratified using expression level(s) of one or more genes or microRNAs associated, positively or negatively, with cancer recurrence or death from cancer, or with a prognostic factor. In an exemplary embodiment, the prognostic factor is Gleason pattern.

[0008] The biological sample may be obtained from standard methods, including surgery, biopsy, or bodily fluids. It may comprise tumor tissue or cancer cells, and, in some cases, histologically normal tissue, e.g., histologically normal tissue adjacent the tumor tissue. In exemplary embodiments, the biological sample is positive or negative for a TMPRSS2 fusion.

[0009] In exemplary embodiments, expression level(s) of one or more genes and/or microRNAs that are associated, positively or negatively, with a particular clinical outcome in prostate cancer are used to determine prognosis and appropriate therapy. The genes disclosed herein may be used alone or arranged in functional gene subsets, such as cell adhesion/migration, immediate-early stress response, and extracellular matrix-associated. Each gene subset comprises the genes disclosed herein, as well as genes that are co-expressed with one or more of the disclosed genes. The calculation may be performed on a computer, programmed to execute the gene expression analysis. The microRNAs disclosed herein may also be used alone or in combination with any one or more of the microRNAs and/or genes disclosed.

[0010] In exemplary embodiments, the molecular assay may involve expression levels for at least two genes. The genes, or gene subsets, may be weighted according to strength of association with prognosis or tumor microenvironment. In another exemplary embodiment, the molecular assay may involve expression levels of at least one gene and at least one microRNA. The gene-microRNA combination may be selected based on the likelihood that the gene microRNA combination functionally interact.

BRIEF DESCRIPTION OF THE DRAWING

[0011] Figure 1 shows the distribution of clinical and pathology assessments of biopsy Gleason score, baseline PSA level, and clinical T-stage.

DEFINITIONS

[0012] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley

& Sons (New York, NY 1994), and March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, NY 1992), provide one skilled in the art with a general guide to many of the terms used in the present application.

[0013] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described herein. For purposes of the invention, the following terms are defined below.

[0014] The terms "tumor" and "lesion" as used herein, refer to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. Those skilled in the art will realize that a tumor tissue sample may comprise multiple biological elements, such as one or more cancer cells, partial or fragmented cells, tumors in various stages, surrounding histologically normal-appearing tissue, and/or macro or micro dissected tissue.

[0015] The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer in the present disclosure include cancer of the urogenital tract, such as prostate cancer.

[0016] The "pathology" of cancer includes all phenomena that compromise the well being of the patient. This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, neoplasia, premalignancy, malignancy, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc.

[0017] As used herein, the term "prostate cancer" is used interchangeably and in the broadest sense refers to all stages and all forms of cancer arising from the tissue of the prostate gland.

[0018] According to the tumor, node, metastasis (TNM) staging system of the American Joint Committee on Cancer (AJCC), AJCC Cancer Staging Manual (7th Ed., 2010), the various stages of prostate cancer are defined as follows: Tumor: Tl: clinically inapparent tumor not palpable or visible by imaging, Tla: tumor incidental histological finding in 5% or less of tissue resected, Tlb: tumor incidental histological finding in more than 5% of tissue resected, Tc: tumor identified by needle biopsy; T2: tumor confined within prostate, T2a: tumor involves one half of one lobe or less, T2b: tumor involves more than half of one lobe, but not both lobes, T2c: tumor involves both lobes; T3: tumor extends through the prostatic capsule, T3a: extracapsular extension (unilateral or bilateral), T3b: tumor invades seminal vesicle(s); T4: tumor is fixed or invades adjacent structures other than seminal vesicles (bladder neck, external sphincter, rectum, levator muscles, or pelvic wall). Node: NO: no regional lymph node metastasis; NI: metastasis in regional lymph nodes. Metastasis: MO: no distant metastasis; Ml: distant metastasis present.

[0019] The Gleason Grading system is used to help evaluate the prognosis of men with prostate cancer. Together with other parameters, it is incorporated into a strategy of prostate cancer staging, which predicts prognosis and helps guide therapy. A Gleason "score" or "grade" is given to prostate cancer based upon its microscopic appearance. Tumors with a low Gleason score typically grow slowly enough that they may not pose a significant threat to the patients in their lifetimes. These patients are monitored ("watchful waiting" or "active surveillance") over time. Cancers with a higher Gleason score are more aggressive and have a worse prognosis, and these patients are generally treated with surgery (e.g., radical prostectomy) and, in some cases, therapy (e.g., radiation, hormone, ultrasound, chemotherapy). Gleason scores (or sums) comprise grades of the two most common tumor patterns. These patterns are referred to as Gleason patterns 1-5, with pattern 1 being the most well-differentiated. Most have a mixture of patterns. To obtain a Gleason score or grade, the dominant pattern is added to the second most prevalent pattern to obtain a number between 2 and10. The Gleason Grades include: GI: well differentiated (slight anaplasia) (Gleason 2-4); G2: moderately differentiated (moderate anaplasia) (Gleason 5-6); G3-4: poorly differentiated/undifferentiated (marked anaplasia) (Gleason 7-10).

[0020] Stage groupings: Stage I: Tla NO MOG1; Stage II: (TIa NO MO G2-4) or ( Tlb, c, TI, T2, NO MO Any G); Stage III: T3 NO MO Any G; Stage IV: (T4 NO MO Any G) or (Any T NI MO Any G) or (Any T Any N Mi Any G).

[0021] As used herein, the term "tumor tissue" refers to a biological sample containing one or more cancer cells, or a fraction of one or more cancer cells. Those skilled in the art will recognize that such biological sample may additionally comprise other biological components, such as histologically appearing normal cells (e.g., adjacent the tumor), depending upon the method used to obtain the tumor tissue, such as surgical resection, biopsy, or bodily fluids.

[0022] As used herein, the term "AUA risk group" refers to the 2007 updated American Urological Association (AUA) guidelines for management of clinically localized prostate cancer, which clinicians use to determine whether a patient is at low, intermediate, or high risk of biochemical (PSA) relapse after local therapy.

[0023] As used herein, the term "adjacent tissue (AT)" refers to histologically "normal" cells that are adjacent a tumor. For example, the AT expression profile may be associated with disease recurrence and survival.

[0024] As used herein "non-tumor prostate tissue" refers to histologically normal appearing tissue adjacent a prostate tumor.

[0025] Prognostic factors are those variables related to the natural history of cancer, which influence the recurrence rates and outcome of patients once they have developed cancer. Clinical parameters that have been associated with a worse prognosis include, for example, increased tumor stage, PSA level at presentation, and Gleason grade or pattern. Prognostic factors are frequently used to categorize patients into subgroups with different baseline relapse risks.

[0026] The term "prognosis" is used herein to refer to the likelihood that a cancer patient will have a cancer-attributable death or progression, including recurrence, metastatic spread, and drug resistance, of a neoplastic disease, such as prostate cancer. For example, a "good prognosis" would include long term survival without recurrence and a "bad prognosis" would include cancer recurrence.

[0027] As used herein, the term "expression level" as applied to a gene refers to the normalized level of a gene product, e.g. the normalized value determined for the RNA expression level of a gene or for the polypeptide expression level of a gene.

[0028] The term "gene product" or "expression product" are used herein to refer to the RNA (ribonucleic acid) transcription products (transcripts) of the gene, including mRNA, and the polypeptide translation products of such RNA transcripts. A gene product can be, for example, an unspliced RNA, an mRNA, a splice variant mRNA, a microRNA, a fragmented RNA, a polypeptide, a post-translationally modified polypeptide, a splice variant polypeptide, etc.

[0029] The term "RNA transcript" as used herein refers to the RNA transcription products of a gene, including, for example, mRNA, an unspliced RNA, a splice variant mRNA, a microRNA, and a fragmented RNA.

[0030] The term "microRNA" is used herein to refer to a small, non-coding, single stranded RNA of -18 - 25 nucleotides that may regulate gene expression. For example, when associated with the RNA-induced silencing complex (RISC), the complex binds to specific mRNA targets and causes translation repression or cleavage of these mRNA sequences.

[0031] Unless indicated otherwise, each gene name used herein corresponds to the Official Symbol assigned to the gene and provided by Entrez Gene (URL: www.ncbi.nlm.nih.gov/sites/entrez) as of the filing date of this application.

[0032] The terms "correlated" and "associated" are used interchangeably herein to refer to the association between two measurements (or measured entities). The disclosure provides genes,gene subsets, microRNAs, or microRNAs in combination with genes or gene subsets, the expression levels of which are associated with tumor stage. For example, the increased expression level of a gene or microRNA may be positively correlated (positively associated) with a good or positive prognosis. Such a positive correlation may be demonstrated statistically in various ways, e.g. by a cancer recurrence hazard ratio less than one. In another example, the increased expression level of a gene or microRNA may be negatively correlated (negatively associated) with a good or positive prognosis. In that case, for example, the patient may experience a cancer recurrence.

[0033] The terms "good prognosis" or "positive prognosis" as used herein refer to a beneficial clinical outcome, such as long-term survival without recurrence. The terms "bad prognosis" or "negative prognosis" as used herein refer to a negative clinical outcome, such as cancer recurrence.

[0034] The term "risk classification" means a grouping of subjects by the level of risk (or likelihood) that the subject will experience a particular clinical outcome. A subject may be classified into a risk group or classified at a level of risk based on the methods of the present disclosure, e.g. high, medium, or low risk. A "risk group" is a group of subjects or individuals with a similar level of risk for a particular clinical outcome.

[0035] The term "long-term" survival is used herein to refer to survival for a particular time period, e.g., for at least 5 years, or for at least 10 years.

[0036] The term "recurrence" is used herein to refer to local or distant recurrence (i.e., metastasis) of cancer. For example, prostate cancer can recur locally in the tissue next to the prostate or in the seminal vesicles. The cancer may also affect the surrounding lymph nodes in the pelvis or lymph nodes outside this area. Prostate cancer can also spread to tissues next to the prostate, such as pelvic muscles, bones, or other organs. Recurrence can be determined by clinical recurrence detected by, for example, imaging study or biopsy, or biochemical recurrence detected by, for example, sustained follow-up prostate-specific antigen (PSA) levels > 0.4 ng/mL or the initiation of salvage therapy as a result of a rising PSA level.

[0037] The term "clinical recurrence-free interval (cRFI)" is used herein as time (in months) from surgery to first clinical recurrence or death due to clinical recurrence of prostate cancer. Losses due to incomplete follow-up, other primary cancers or death prior to clinical recurrence are considered censoring events; when these occur, the only information known is that up through the censoring time, clinical recurrence has not occurred in this subject. Biochemical recurrences are ignored for the purposes of calculating cRFI.

[0038] The term "biochemical recurrence-free interval (bRFI)" is used herein to mean the time (in months) from surgery to first biochemical recurrence of prostate cancer. Clinical recurrences, losses due to incomplete follow-up, other primary cancers, or death prior to biochemical recurrence are considered censoring events.

[0039] The term "Overall Survival (OS)" is used herein to refer to the time (in months) from surgery to death from any cause. Losses due to incomplete follow-up are considered censoring events. Biochemical recurrence and clinical recurrence are ignored for the purposes of calculating OS.

[0040] The term "Prostate Cancer-Specific Survival (PCSS)" is used herein to describe the time (in years) from surgery to death from prostate cancer. Losses due to incomplete follow up or deaths from other causes are considered censoring events. Clinical recurrence and biochemical recurrence are ignored for the purposes of calculating PCSS.

[0041] The term "upgrading" or "upstaging" as used herein refers to a change in Gleason grade from 3+3 at the time of biopsy to 3+4 or greater at the time of radical prostatectomy (RP), or Gleason grade 3+4 at the time of biopsy to 4+3 or greater at the time of RP, or seminal vessical involvement (SVI), or extracapsular involvement (ECE) at the time of RP.

[0042] In practice, the calculation of the measures listed above may vary from study to study depending on the definition of events to be considered censored.

[0043] The term "microarray" refers to an ordered arrangement of hybridizable array elements, e.g. oligonucleotide or polynucleotide probes, on a substrate.

[0044] The term "polynucleotide" generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. Thus, for instance, polynucleotides as defined herein include, without limitation, single- and double-stranded DNA, DNA including single- and double-stranded regions, single- and double stranded RNA, and RNA including single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions. In addition, the term "polynucleotide" as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple-helical region often is an oligonucleotide. The term "polynucleotide" specifically includes cDNAs. The term includes DNAs (including cDNAs) and RNAs that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons, are "polynucleotides" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritiated bases, are included within the term "polynucleotides" as defined herein. In general, the term "polynucleotide" embraces all chemically, enzymatically and/or metabolically modified forms of unmodified polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells.

[0045] The term "oligonucleotide" refers to a relatively short polynucleotide, including, without limitation, single-stranded deoxyribonucleotides, single- or double-stranded ribonucleotides, RNArDNA hybrids and double-stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms.

[0046] The term "Ct" as used herein refers to threshold cycle, the cycle number in quantitative polymerase chain reaction (qPCR) at which the fluorescence generated within a reaction well exceeds the defined threshold, i.e. the point during the reaction at which a sufficient number of amplicons have accumulated to meet the defined threshold.

[0047] The term "Cp" as used herein refers to "crossing point." The Cp value is calculated by determining the second derivatives of entire qPCR amplification curves and their maximum value. The Cp value represents the cycle at which the increase of fluorescence is highest and where the logarithmic phase of a PCR begins.

[0048] The terms "threshold" or "thresholding" refer to a procedure used to account for non-linear relationships between gene expression measurements and clinical response as well as to further reduce variation in reported patient scores. When thresholding is applied, all measurements below or above a threshold are set to that threshold value. Non-linear relationship between gene expression and outcome could be examined using smoothers or cubic splines to model gene expression in Cox PH regression on recurrence free interval or logistic regression on recurrence status. D. Cox, Journal of the Royal Statistical Society, Series B 34:187-220 (1972).

Variation in reported patient scores could be examined as a function of variability in gene expression at the limit of quantitation and/or detection for a particular gene.

[0049] As used herein, the term "amplicon," refers to pieces of DNA that have been synthesized using amplification techniques, such as polymerase chain reactions (PCR) and ligase chain reactions.

[0050] "Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to re-anneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology (Wiley Interscience Publishers, 1995).

[0051] "Stringent conditions" or "high stringency conditions", as defined herein, typically: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 jg/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55°C.

[0052] "Moderately stringent conditions" may be identified as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent that those described above. An example of moderately stringent conditions is overnight incubation at 37C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x

Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-500C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.

[0053] The terms "splicing" and "RNA splicing" are used interchangeably and refer to RNA processing that removes introns and joins exons to produce mature mRNA with continuous coding sequence that moves into the cytoplasm of an eukaryotic cell.

[0054] The terms "co-express" and "co-expressed", as used herein, refer to a statistical correlation between the amounts of different transcript sequences across a population of different patients. Pairwise co-expression may be calculated by various methods known in the art, e.g., by calculating Pearson correlation coefficients or Spearman correlation coefficients. Co-expressed gene cliques may also be identified using graph theory. An analysis of co-expression may be calculated using normalized expression data. A gene is said to be co-expressed with a particular disclosed gene when the expression level of the gene exhibits a Pearson correlation coefficient greater than or equal to 0.6.

[0055] A "computer-based system" refers to a system of hardware, software, and data storage medium used to analyze information. The minimum hardware of a patient computer based system comprises a central processing unit (CPU), and hardware for data input, data output (e.g., display), and data storage. An ordinarily skilled artisan can readily appreciate that any currently available computer-based systems and/or components thereof are suitable for use in connection with the methods of the present disclosure. The data storage medium may comprise any manufacture comprising a recording of the present information as described above, or a memory access device that can access such a manufacture.

[0056] To "record" data, programming or other information on a computer readable medium refers to a process for storing information, using any such methods as known in the art. Any convenient data storage structure may be chosen, based on the means used to access the stored information. A variety of data processor programs and formats can be used for storage, e.g. word processing text file, database format, etc.

[0057] A "processor" or "computing means" references any hardware and/or software combination that will perform the functions required of it. For example, a suitable processor may be a programmable digital microprocessor such as available in the form of an electronic controller, mainframe, server or personal computer (desktop or portable). Where the processor is programmable, suitable programming can be communicated from a remote location to the processor, or previously saved in a computer program product (such as a portable or fixed computer readable storage medium, whether magnetic, optical or solid state device based). For example, a magnetic medium or optical disk may carry the programming, and can be read by a suitable reader communicating with each processor at its corresponding station.

[0058] As used herein, the terms "active surveillance" and "watchful waiting" mean closely monitoring a patient's condition without giving any treatment until symptoms appear or change. For example, in prostate cancer, watchful waiting is usually used in older men with other medical problems and early-stage disease.

[0059] As used herein, the term "surgery" applies to surgical methods undertaken for removal of cancerous tissue, including pelvic lymphadenectomy, radical prostatectomy, transurethral resection of the prostate (TURP), excision, dissection, and tumor biopsy/removal. The tumor tissue or sections used for gene expression analysis may have been obtained from any of these methods.

[0060] As used herein, the term "therapy" includes radiation, hormonal therapy, cryosurgery, chemotherapy, biologic therapy, and high-intensity focused ultrasound.

[0061] As used herein, the term "TMPRSS fusion" and "TMPRSS2 fusion" are used interchangeably and refer to a fusion of the androgen-driven TMPRSS2 gene with the ERG oncogene, which has been demonstrated to have a significant association with prostate cancer. S. Perner, et al., Urologe A. 46(7):754-760 (2007); S.A. Narod, et al., Br J Cancer 99(6):847-851 (2008). As used herein, positive TMPRSS fusion status indicates that the TMPRSS fusion is present in a tissue sample, whereas negative TMPRSS fusion status indicates that the TMPRSS fusion is not present in a tissue sample. Experts skilled in the art will recognize that there are numerous ways to determine TMPRSS fusion status, such as real-time, quantitative PCR or high throughput sequencing. See, e.g., K. Mertz, et al., Neoplasis 9(3):200-206 (2007); C. Maher, Nature 458(7234):97-101 (2009).

GENE EXPRESSION METHODS USING GENES, GENE SUBSETS, AND MICRORNAS

[0062] The present disclosure provides molecular assays that involve measurement of expression level(s) of one or more genes, gene subsets, microRNAs, or one or more microRNAs in combination with one or more genes or gene subsets, from a biological sample obtained from a prostate cancer patient, and analysis of the measured expression levels to provide information concerning the likelihood of cancer recurrence.

[0063] The present disclosure further provides methods to classify a prostate tumor based on expression level(s) of one or more genes and/or microRNAs. The disclosure further provides genes and/or microRNAs that are associated, positively or negatively, with a particular prognostic outcome. In exemplary embodiments, the clinical outcomes include cRFI and bRFI. In another embodiment, patients may be classified in risk groups based on the expression level(s) of one or more genes and/or microRNAs that are associated, positively or negatively, with a prognostic factor. In an exemplary embodiment, that prognostic factor is Gleason pattern.

[0064] Various technological approaches for determination of expression levels of the disclosed genes and microRNAs are set forth in this specification, including, without limitation, RT-PCR, microarrays, high-throughput sequencing, serial analysis of gene expression (SAGE) and Digital Gene Expression (DGE), which will be discussed in detail below. In particular aspects, the expression level of each gene or microRNA may be determined in relation to various features of the expression products of the gene including exons, introns, protein epitopes and protein activity.

[0065] The expression level(s) of one or more genes and/or microRNAs may be measured in tumor tissue. For example, the tumor tissue may obtained upon surgical removal or resection of the tumor, or by tumor biopsy. The tumor tissue may be or include histologically "normal" tissue, for example histologically "normal" tissue adjacent to a tumor. The expression level of genes and/or microRNAs may also be measured in tumor cells recovered from sites distant from the tumor, for example circulating tumor cells, body fluid (e.g., urine, blood, blood fraction, etc.).

[0066] The expression product that is assayed can be, for example, RNA or a polypeptide. The expression product may be fragmented. For example, the assay may use primers that are complementary to target sequences of an expression product and could thus measure full transcripts as well as those fragmented expression products containing the target sequence. Further information is provided in Table A (inserted in specification prior to claims).

[0067] The RNA expression product may be assayed directly or by detection of a cDNA product resulting from a PCR-based amplification method, e.g., quantitative reverse transcription polymerase chain reaction (qRT-PCR). (See e.g., U.S. Patent No. 7,587,279). Polypeptide expression product may be assayed using immunohistochemistry (IHC). Further, both RNA and polypeptide expression products may also be is assayed using microarrays. CLINICAL UTILITY

[0068] Prostate cancer is currently diagnosed using a digital rectal exam (DRE) and Prostate-specific antigen (PSA) test. If PSA results are high, patients will generally undergo a prostate tissue biopsy. The pathologist will review the biopsy samples to check for cancer cells and determine a Gleason score. Based on the Gleason score, PSA, clinical stage, and other factors, the physician must make a decision whether to monitor the patient, or treat the patient with surgery and therapy.

[0069] At present, clinical decision-making in early stage prostate cancer is governed by certain histopathologic and clinical factors. These include: (1) tumor factors, such as clinical stage (e.g. TI, T2), PSA level at presentation, and Gleason grade, that are very strong prognostic factors in determining outcome; and (2) host factors, such as age at diagnosis and co-morbidity. Because of these factors, the most clinically useful means of stratifying patients with localized disease according to prognosis has been through multifactorial staging, using the clinical stage, the serum PSA level, and tumor grade (Gleason grade) together. In the 2007 updated American Urological Association (AUA) guidelines for management of clinically localized prostate cancer, these parameters have been grouped to determine whether a patient is at low, intermediate, or high risk of biochemical (PSA) relapse after local therapy. I. Thompson, et al., Guideline for the management of clinically localized prostate cancer, J Urol. 177(6):2106-31 (2007).

[0070] Although such classifications have proven to be helpful in distinguishing patients with localized disease who may need adjuvant therapy after surgery/radiation, they have less ability to discriminate between indolent cancers, which do not need to be treated with local therapy, and aggressive tumors, which require local therapy. In fact, these algorithms are of increasingly limited use for deciding between conservative management and definitive therapy because the bulk of prostate cancers diagnosed in the PSA screening era now present with clinical stage Tic and PSA <10 ng/mL.

[0071] Patients with TI prostate cancer have disease that is not clinically apparent but is discovered either at transurethral resection of the prostate (TURP, Tla, Tlb) or at biopsy performed because of an elevated PSA (> 4 ng/mL, Tic). Approximately 80% of the cases presenting in 2007 are clinical TI at diagnosis. In a Scandinavian trial, OS at 10 years was 85% for patients with early stage prostate cancer (Ti/T2) and Gleason score < 7, after radical prostatectomy.

[0072] Patients with T2 prostate cancer have disease that is clinically evident and is organ confined; patients with T3 tumors have disease that has penetrated the prostatic capsule and/or has invaded the seminal vesicles. It is known from surgical series that clinical staging underestimates pathological stage, so that about 20% of patients who are clinically T2 will be pT3 after prostatectomy. Most of patients with T2 or T3 prostate cancer are treated with local therapy, either prostatectomy or radiation. The data from the Scandinavian trial suggest that for T2 patients with Gleason grade <7, the effect of prostatectomy on survival is at most 5% at 10 years; the majority of patients do not benefit from surgical treatment at the time of diagnosis. For T2 patients with Gleason > 7 or for T3 patients, the treatment effect of prostatectomy is assumed to be significant but has not been determined in randomized trials. It is known that these patients have a significant risk (10-30%) of recurrence at 10 years after local treatment, however, there are no prospective randomized trials that define the optimal local treatment (radical prostatectomy, radiation) at diagnosis, which patients are likely to benefit from neo adjuvant/adjuvant androgen deprivation therapy, and whether treatment (androgen deprivation, chemotherapy) at the time of biochemical failure (elevated PSA) has any clinical benefit.

[0073] Accurately determining Gleason scores from needle biopsies presents several technical challenges. First, interpreting histology that is "borderline" between Gleason pattern is highly subjective, even for urologic pathologists. Second, incomplete biopsy sampling is yet another reason why the "predicted" Gleason score on biopsy does not always correlate with the actual "observed" Gleason score of the prostate cancer in the gland itself. Hence, the accuracy of Gleason scoring is dependent upon not only the expertise of the pathologist reading the slides, but also on the completeness and adequacy of the prostate biopsy sampling strategy. T. Stamey, Urology 45:2-12 (1995). The gene/microRNA expression assay and associated information provided by the practice of the methods disclosed herein provide a molecular assay method to facilitate optimal treatment decision-making in early stage prostate cancer. An exemplary embodiment provides genes and microRNAs, the expression levels of which are associated (positively or negatively) with prostate cancer recurrence. For example, such a clinical tool would enable physicians to identify T2/T3 patients who are likely to recur following definitive therapy and need adjuvant treatment.

[0074] In addition, the methods disclosed herein may allow physicians to classify tumors, at a molecular level, based on expression level(s) of one or more genes and/or microRNAs that are significantly associated with prognostic factors, such as Gleason pattern and TMPRSS fusion status. These methods would not be impacted by the technical difficulties of intra-patient variability, histologically determining Gleason pattern in biopsy samples, or inclusion of histologically normal appearing tissue adjacent to tumor tissue. Multi-analyte gene/microRNA expression tests can be used to measure the expression level of one or more genes and/or microRNAs involved in each of several relevant physiologic processes or component cellular characteristics. The methods disclosed herein may group the genes and/or microRNAs. The grouping of genes and microRNAs may be performed at least in part based on knowledge of the contribution of those genes and/or microRNAs according to physiologic functions or component cellular characteristics, such as in the groups discussed above. Furthermore, one or more microRNAs may be combined with one or moregenes. The gene-microRNA combination may be selected based on the likelihood that the gene-microRNA combination functionally interact. The formation of groups (or gene subsets), in addition, can facilitate the mathematical weighting of the contribution of various expression levels to cancer recurrence. The weighting of a gene/microRNA group representing a physiological process or component cellular characteristic can reflect the contribution of that process or characteristic to the pathology of the cancer and clinical outcome.

[0075] Optionally, the methods disclosed may be used to classify patients by risk, for example risk of recurrence. Patients can be partitioned into subgroups (e.g., tertiles or quartiles) and the values chosen will define subgroups of patients with respectively greater or lesser risk.

[0076] The utility of a disclosed gene marker in predicting prognosis may not be unique to that marker. An alternative marker having an expression pattern that is parallel to that of a disclosed gene may be substituted for, or used in addition to, that co-expressed gene or microRNA. Due to the co-expression of such genes or microRNAs, substitution of expression level values should have little impact on the overall utility of the test. The closely similar expression patterns of two genes or microRNAs may result from involvement of both genes or microRNAs in the same process and/or being under common regulatory control in prostate tumor cells. The present disclosure thus contemplates the use of such co-expressed genes,gene subsets, or microRNAs as substitutes for, or in addition to, genes of the present disclosure. METHODS OF ASSAYING EXPRESSION LEVELS OF A GENE PRODUCT

[0077] The methods and compositions of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Exemplary techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", 2nd edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (M.J. Gait, ed., 1984); "Animal Cell Culture" (R.I. Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology", 4th edition (D.M. Weir

& CC. Blackwell, eds., Blackwell Science Inc., 1987); "Gene Transfer Vectors for Mammalian Cells" (J.M. Miller & M.P. Calos, eds., 1987); "Current Protocols in Molecular Biology" (F.M. Ausubel et al., eds., 1987); and "PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994).

[0078] Methods of gene expression profiling include methods based on hybridization analysis of polynucleotides, methods based on sequencing of polynucleotides, and proteomics based methods. Exemplary methods known in the art for the quantification of RNA expression in a sample include northern blotting and in situ hybridization (Parker & Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNAse protection assays (Hod, Biotechniques 13:852 854 (1992)); and PCR-based methods, such as reverse transcription PCT (RT-PCR) (Weis et al., Trends in Genetics 8:263-264 (1992)). Antibodies may be employed that can recognize sequence-specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS).

Reverse Transcriptase PCR (RT-PCR)

[0079] Typically, mRNA or microRNA is isolated from a test sample. The starting material is typically total RNA isolated from a human tumor, usually from a primary tumor. Optionally, normal tissues from the same patient can be used as an internal control. Such normal tissue can be histologically-appearing normal tissue adjacent a tumor. mRNA or microRNA can be extracted from a tissue sample, e.g., from a sample that is fresh, frozen (e.g. fresh frozen), or paraffin-embedded and fixed (e.g. formalin-fixed).

[0080] General methods for mRNA and microRNA extraction are well known in the art and are disclosed in standard textbooks of molecular biology, including Ausubel et al., Current Protocols of Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, Lab Invest. 56:A67 (1987), and De Andr6s et al., BioTechniques 18:42044 (1995). In particular, RNA isolation can be performed using a purification kit, buffer set and protease from commercial manufacturers, such as Qiagen, according to the manufacturer's instructions. For example, total RNA from cells in culture can be isolated using Qiagen RNeasy mini-columns. Other commercially available RNA isolation kits include MasterPure TM Complete DNA and RNA Purification Kit

(EPICENTRE@, Madison, WI), and Paraffin Block RNA Isolation Kit (Ambion, Inc.). Total RNA from tissue samples can be isolated using RNA Stat-60 (Tel-Test). RNA prepared from tumor can be isolated, for example, by cesium chloride density gradient centrifugation.

[0081] The sample containing the RNA is then subjected to reverse transcription to produce cDNA from the RNA template, followed by exponential amplification in a PCR reaction. The two most commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukemia virus reverse transcriptase (MMLV-RT). The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling. For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, CA, USA), following the manufacturer's instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction.

[0082] PCR-based methods use a thermostable DNA-dependent DNA polymerase, such as a Taq DNA polymerase. For example, TaqMan@ PCR typically utilizes the 5'-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used. Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction product. A third oligonucleotide, or probe, can be designed to facilitate detection of a nucleotide sequence of the amplicon located between the hybridization sites the two PCR primers. The probe can be detectably labeled, e.g., with a reporter dye, and can further be provided with both a fluorescent dye, and a quencher fluorescent dye, as in a Taqman@ probe configuration. Where a Taqman@ probe is used, during the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.

[0083] TaqMan@ RT-PCR can be performed using commercially available equipment, such as, for example, high-throughput platforms such as the ABI PRISM 7700 Sequence Detection System@ (Perkin-Elmer-Applied Biosystems, Foster City, CA, USA), or Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany). In a preferred embodiment, the procedure is run on a LightCycler@ 480 (Roche Diagnostics) real-time PCR system, which is a microwell plate-based cycler platform.

[0084] 5'-Nuclease assay data are commonly initially expressed as a threshold cycle

("CT"). Fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction. The threshold cycle (CT) is generally described as the point when the fluorescent signal is first recorded as statistically significant. Alternatively, data may be expressed as a crossing point ( "Cp"). The Cp value is calculated by determining the second derivatives of entire qPCR amplification curves and their maximum value. The Cp value represents the cycle at which the increase of fluorescence is highest and where the logarithmic phase of a PCR begins.

[0085] To minimize errors and the effect of sample-to-sample variation, RT-PCR is usually performed using an internal standard. The ideal internal standard gene (also referred to as a reference gene) is expressed at a quite constant level among cancerous and non-cancerous tissue of the same origin (i.e., a level that is not significantly different among normal and cancerous tissues), and is not significantly affected by the experimental treatment (i.e., does not exhibit a significant difference in expression level in the relevant tissue as a result of exposure to chemotherapy), and expressed at a quite constant level among the same tissue taken from different patients. For example, reference genes useful in the methods disclosed herein should not exhibit significantly different expression levels in cancerous prostate as compared to normal prostate tissue. RNAs frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and -actin. Exemplary reference genes used for normalization comprise one or more of the following genes: AAMP, ARFI, ATP5E, CLTC, GPS1, and PGK1. Gene expression measurements can be normalized relative to the mean of one or more (e.g., 2, 3, 4, 5, or more) reference genes. Reference-normalized expression measurements can range from 2 to 15, where a one unit increase generally reflects a 2-fold increase in RNA quantity.

[0086] Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. For further details see, e.g. Held et al., Genome Research 6:986-994 (1996).

[0087] The steps of a representative protocol for use in the methods of the present disclosure use fixed, paraffin-embedded tissues as the RNA source. For example, mRNA isolation, purification, primer extension and amplification can be performed according to methods available in the art. (see, e.g., Godfrey et al. J. Molec. Diagnostics 2: 84-91 (2000); Specht et al., Am. J. Pathol. 158: 419-29 (2001)). Briefly, a representative process starts with cutting about 10 tm thick sections of paraffin-embedded tumor tissue samples. The RNA is then extracted, and protein and DNA depleted from the RNA-containing sample. After analysis of the RNA concentration, RNA is reverse transcribed using gene specific primers followed by RT PCR to provide for cDNA amplification products. Design of Intron-Based PCR Primers and Probes

[0088] PCR primers and probes can be designed based upon exon or intron sequences present in the mRNA transcript of the gene of interest. Primer/probe design can be performed using publicly available software, such as the DNA BLAT software developed by Kent, W.J., Genome Res. 12(4):656-64 (2002), or by the BLAST software including its variations.

[0089] Where necessary or desired, repetitive sequences of the target sequence can be masked to mitigate non-specific signals. Exemplary tools to accomplish this include the Repeat

Masker program available on-line through the Baylor College of Medicine, which screens DNA sequences against a library of repetitive elements and returns a query sequence in which the repetitive elements are masked. The masked intron sequences can then be used to design primer and probe sequences using any commercially or otherwise publicly available primer/probe design packages, such as Primer Express (Applied Biosystems); MGB assay-by-design (Applied Biosystems); Primer3 (Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. See S. Rrawetz, S. Misener, Bioinformatics Methods and Protocols: Methods in Molecular Biology, pp. 365-386 (Humana Press).

[0090] Other factors that can influence PCR primer design include primer length, melting temperature (Tm), and G/C content, specificity, complementary primer sequences, and 3 '-end sequence. In general, optimal PCR primers are generally 17-30 bases in length, and contain about 20-80%, such as, for example, about 50-60% G+C bases, and exhibit Tm's between 50 and OC, e.g. about 50 to 70 C.

[0091] For further guidelines for PCR primer and probe design see, e.g. Dieffenbach, CW. et al, "General Concepts for PCR Primer Design" in: PCR Primer, A Laboratory Manual, Cold Spring Harbor Laboratory Press,. New York, 1995, pp. 133-155; Innis and Gelfand, "Optimization of PCRs" in: PCR Protocols, A Guide to Methods and Applications, CRC Press, London, 1994, pp. 5-11; and Plasterer, T.N. Primerselect: Primer and probe design. Methods Mol. Biol. 70:520-527 (1997), the entire disclosures of which are hereby expressly incorporated by reference.

[0092] Table A provides further information concerning the primer, probe, and amplicon sequences associated with the Examples disclosed herein. MassARRAY@ System

[0093] In MassARRAY-based methods, such as the exemplary method developed by Sequenom, Inc. (San Diego, CA) following the isolation of RNA and reverse transcription, the obtained cDNA is spiked with a synthetic DNA molecule (competitor), which matches the targeted cDNA region in all positions, except a single base, and serves as an internal standard. The cDNA/competitor mixture is PCR amplified and is subjected to a post-PCR shrimp alkaline phosphatase (SAP) enzyme treatment, which results in the dephosphorylation of the remaining nucleotides. After inactivarion of the alkaline phosphatase, the PCR products from the competitor and cDNA are subjected to primer extension, which generates distinct mass signals for the competitor- and cDNA-derives PCR products. After purification, these products are dispensed on a chip array, which is pre-loaded with components needed for analysis with matrix assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) analysis. The cDNA present in the reaction is then quantified by analyzing the ratios of the peak areas in the mass spectrum generated. For further details see, e.g. Ding and Cantor, Proc. Natl. Acad. Sci. USA 100:3059-3064 (2003). Other PCR-based Methods

[0094] Further PCR-based techniques that can find use in the methods disclosed herein include, for example, BeadArray@ technology (Illumina, San Diego, CA; Oliphant et al., Discovery of Markers for Disease (Supplement to Biotechniques), June 2002; Ferguson et al., Analytical Chemistry 72:5618 (2000)); BeadsArray for Detection of Gene Expression@ (BADGE), using the commercially available LuminexlOO LabMAP@ system and multiple color-coded microspheres (Luminex Corp., Austin, TX) in a rapid assay for gene expression (Yang et al., Genome Res. 11:1888-1898 (2001)); and high coverage expression profiling (HiCEP) analysis (Fukumura et al., Nucl. Acids. Res. 31(16) e94 (2003). Microarrays

[0095] Expression levels of a gene or microArray of interest can also be assessed using the microarray technique. In this method, polynucleotide sequences of interest (including cDNAs and oligonucleotides) are arrayed on a substrate. The arrayed sequences are then contacted under conditions suitable for specific hybridization with detectably labeled cDNA generated from RNA of a test sample. As in the RT-PCR method, the source of RNA typically is total RNA isolated from a tumor sample, and optionally from normal tissue of the same patient as an internal control or cell lines. RNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples.

[0096] For example, PCR amplified inserts of cDNA clones of a gene to be assayed are applied to a substrate in a dense array. Usually at least 10,000 nucleotide sequences are applied to the substrate. For example, the microarrayed genes, immobilized on the microchip at 10,000 elements each, are suitable for hybridization under stringent conditions. Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from tissues of interest. Labeled cDNA probes applied to the chip hybridize with specificity to each spot of DNA on the array. After washing under stringent conditions to remove non-specifically bound probes, the chip is scanned by confocal laser microscopy or by another detection method, such as a CCD camera. Quantitation of hybridization of each arrayed element allows for assessment of corresponding RNA abundance.

[0097] With dual color fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized pair wise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously. The miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes. Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et at, Proc. Natl. Acad. ScL USA 93(2):106-149 (1996)). Microarray analysis can be performed by commercially available equipment, following manufacturer's protocols, such as by using the Affymetrix GenChip@ technology, or Incyte's microarray technology. Serial Analysis of Gene Expression (SAGE)

[0098] Serial analysis of gene expression (SAGE) is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript. First, a short sequence tag (about -14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript. Then, many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously. The expression pattern of any population of transcripts can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag. For more details see, e.g. Velculescu et al., Science 270:484-487 (1995); and Velculescu et al., Cell 88:243-51 (1997). Gene Expression Analysis by Nucleic Acid Sequencing

[0099] Nucleic acid sequencing technologies are suitable methods for analysis of gene expression. The principle underlying these methods is that the number of times a cDNA sequence is detected in a sample is directly related to the relative expression of the RNA corresponding to that sequence. These methods are sometimes referred to by the term Digital Gene Expression (DGE) to reflect the discrete numeric property of the resulting data. Early methods applying this principle were Serial Analysis of Gene Expression (SAGE) and Massively

Parallel Signature Sequencing (MPSS). See, e.g., S. Brenner, et al., Nature Biotechnology 18(6):630-634 (2000). More recently, the advent of "next-generation" sequencing technologies has made DGE simpler, higher throughput, and more affordable. As a result, more laboratories are able to utilize DGE to screen the expression of more genes in more individual patient samples than previously possible. See, e.g., J. Marioni, Genome Research 18(9):1509-1517 (2008); R. Morin, Genome Research 18(4):610-621 (2008); A. Mortazavi, Nature Methods (7):621-628 (2008); N. Cloonan, Nature Methods 5(7):613-619 (2008). Isolating RNA from Body Fluids

[00100] Methods of isolating RNA for expression analysis from blood, plasma and serum (see, e.g., K. Enders, et al., Clin Chem 48,1647-53 (2002) (and references cited therein) and from urine (see, e.g., R. Boom, et al., J Clin Microbiol. 28, 495-503 (1990) and references cited therein) have been described. Immunohistochemistrv

[00101] Immunohistochemistry methods are also suitable for detecting the expression levels of genes and applied to the method disclosed herein. Antibodies (e.g., monoclonal antibodies) that specifically bind a gene product of a gene of interest can be used in such methods. The antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten'labels such as, biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase. Alternatively, unlabeled primary antibody can be used in conjunction with a labeled secondary antibody specific for the primary antibody. Immunohistochemistry protocols and kits are well known in the art and are commercially available. Proteomics

[00102] The term "proteome" is defined as the totality of the proteins present in a sample (e.g. tissue, organism, or cell culture) at a certain point of time. Proteomics includes, among other things, study of the global changes of protein expression in a sample (also referred to as "expression proteomics"). Proteomics typically includes the following steps: (1) separation of individual proteins in a sample by 2-D gel electrophoresis (2-D PAGE); (2) identification of the individual proteins recovered from the gel, e.g. my mass spectrometry or N- terminal sequencing, and (3) analysis of the data using bioinformatics.

General Description of the mRNA/microRNA Isolation, Purification and Amplification

[00103] The steps of a representative protocol for profiling gene expression using fixed, paraffin-embedded tissues as the RNA source, including mRNA or microRNA isolation, purification, primer extension and amplification are provided in various published journal articles. (See, e.g., T.E. Godfrey, et al,. J. Molec. Diagnostics 2: 84-91 (2000); K. Specht et al., Am. J. Pathol. 158: 419-29 (2001), M. Cronin, et al., Am J Pathol 164:35-42 (2004)). Briefly, a representative process starts with cutting a tissue sample section (e.g.about 10 m thick sections of a paraffin-embedded tumor tissue sample). The RNA is then extracted, and protein and DNA are removed. After analysis of the RNA concentration, RNA repair is performed if desired. The sample can then be subjected to analysis, e.g., by reverse transcribed using gene specific promoters followed by RT-PCR. STATISTICAL ANALYSIS OF EXPRESSION LEVELS IN IDENTIFICATION OF GENES AND

MICRORNAS

[00104] One skilled in the art will recognize that there are many statistical methods that may be used to determine whether there is a significant relationship between a parameter of interest (e.g., recurrence) and expression levels of a marker gene/microRNA as described here. In an exemplary embodiment, the present invention provides a stratified cohort sampling design (a form of case-control sampling) using tissue and data from prostate cancer patients. Selection of specimens was stratified by T stage (TI, T2), year cohort (<1993, >1993), and prostatectomy Gleason Score (low/intermediate, high). All patients with clinical recurrence were selected and a sample of patients who did not experience a clinical recurrence was selected. For each patient, up to two enriched tumor specimens and one normal-appearing tissue sample was assayed.

[00105] All hypothesis tests were reported using two-sided p-values. To investigate if there is a significant relationship of outcomes (clinical recurrence-free interval (cRFI), biochemical recurrence-free interval (bRFI), prostate cancer-specific survival (PCSS), and overall survival (OS)) with individual genes and/or microRNAs, demographic or clinical covariates Cox Proportional Hazards (PH) models using maximum weighted pseudo partial likelihood estimators were used and p-values from Wald tests of the null hypothesis that the hazard ratio (HR) is one are reported. To investigate if there is a significant relationship between individual genes and/or microRNAs and Gleason pattern of a particular sample, ordinal logistic regression models using maximum weighted likelihood methods were used and p-values from Wald tests of the null hypothesis that the odds ratio (OR) is one are reported. COEXPRESSION ANALYSIS

[00106] The present disclosure provides a method to determine tumor stage based on the expression of staging genes, or genes that co-express with particular staging genes. To perform particular biological processes, genes often work together in a concerted way, i.e. they are co expressed. Co-expressed gene groups identified for a disease process like cancer can serve as biomarkers for tumor status and disease progression. Such co-expressed genes can be assayed in lieu of, or in addition to, assaying of the staging gene with which they are co-expressed.

[00107] In an exemplary embodiment, the joint correlation of gene expression levels among prostate cancer specimens under study may be assessed. For this purpose, the correlation structures among genes and specimens may be examined through hierarchical cluster methods. This information may be used to confirm that genes that are known to be highly correlated in prostate cancer specimens cluster together as expected. Only genes exhibiting a nominally significant (unadjusted p < 0.05) relationship with cRFI in the univariate Cox PH regression analysis will be included in these analyses.

[00108] One skilled in the art will recognize that many co-expression analysis methods now known or later developed will fall within the scope and spirit of the present invention. These methods may incorporate, for example, correlation coefficients, co-expression network analysis, clique analysis, etc., and may be based on expression data from RT-PCR, microarrays, sequencing, and other similar technologies. For example, gene expression clusters can be identified using pair-wise analysis of correlation based on Pearson or Spearman correlation coefficients. (See, e.g., Pearson K. and Lee A., Biometrika 2, 357 (1902); C. Spearman, Amer. J. Psychol 15:72-101 (1904); J. Myers, A. Well, Research Design and Statistical Analysis, p. 508 (2nd Ed., 2003).) NORMALIZATION OF EXPRESSION LEVELS

[00109] The expression data used in the methods disclosed herein can be normalized. Normalization refers to a process to correct for (normalize away), for example, differences in the amount of RNA assayed and variability in the quality of the RNA used, to remove unwanted sources of systematic variation in Ct or Cp measurements, and the like. With respect to RT-PCR experiments involving archived fixed paraffin embedded tissue samples, sources of systematic variation are known to include the degree of RNA degradation relative to the age of the patient sample and the type of fixative used to store the sample. Other sources of systematic variation are attributable to laboratory processing conditions.

[00110] Assays can provide for normalization by incorporating the expression of certain normalizing genes, which do not significantly differ in expression levels under the relevant conditions. Exemplary normalization genes disclosed herein include housekeeping genes. (See, e.g., E. Eisenberg, et al., Trends in Genetics 19(7):362-365 (2003).) Normalization can be based on the mean or median signal (Ct or Cp) of all of the assayed genes or a large subset thereof (global normalization approach). In general, the normalizing genes, also referred to as reference genes should be genes that are known not to exhibit significantly different expression in prostate cancer as compared to non-cancerous prostate tissue, and are not significantly affected by various sample and process conditions, thus provide for normalizing away extraneous effects.

[00111] In exemplary embodiments, one or more of the following genes are used as references by which the mRNA or microRNA expression data is normalized: AAMP, ARFI, ATP5E, CLTC, GPS1, and PGK1. In another exemplary embodiment, one or more of the following microRNAs are used as references by which the expression data of microRNAs are normalized: hsa-miR-106a; hsa-miR-146b-5p; hsa-miR-191; hsa-miR-19b; and hsa-miR-92a. The calibrated weighted average CT or Cp measurements for each of the prognostic and predictive genes or microRNAs may be normalized relative to the mean of five or more reference genes or microRNAs.

[00112] Those skilled in the art will recognize that normalization may be achieved in numerous ways, and the techniques described above are intended only to be exemplary, not exhaustive. STANDARDIZATION OF EXPRESSION LEVELS

[00113] The expression data used in the methods disclosed herein can be standardized. Standardization refers to a process to effectively put all the genes or microRNAs on a comparable scale. This is performed because some genes or microRNAs will exhibit more variation (a broader range of expression) than others. Standardization is performed by dividing each expression value by its standard deviation across all samples for that gene or microRNA. Hazard ratios are then interpreted as the relative risk of recurrence per 1 standard deviation increase in expression.

KITS OF THE INVENTION

[00114] The materials for use in the methods of the present invention are suited for preparation of kits produced in accordance with well-known procedures. The present disclosure thus provides kits comprising agents, which may include gene (or microRNA)-specific or gene (or microRNA)-selective probes and/or primers, for quantifying the expression of the disclosed genes or microRNAs for predicting prognostic outcome or response to treatment. Such kits may optionally contain reagents for the extraction of RNA from tumor samples, in particular fixed paraffin-embedded tissue samples and/or reagents for RNA amplification. In addition, the kits may optionally comprise the reagent(s) with an identifying description or label or instructions relating to their use in the methods of the present invention. The kits may comprise containers (including microliter plates suitable for use in an automated implementation of the method), each with one or more of the various materials or reagents (typically in concentrated form) utilized in the methods, including, for example, chromatographic columns, pre-fabricated microarrays, buffers, the appropriate nucleotide triphosphates (e.g., dATP, dCTP, dGTP and dTTP; or rATP, rCTP, rGTP and UTP), reverse transcriptase, DNA polymerase, RNA polymerase, and one or more probes and primers of the present invention (e.g., appropriate length poly(T) or random primers linked to a promoter reactive with the RNA polymerase). Mathematical algorithms used to estimate or quantify prognostic or predictive information are also properly potential components of kits. REPORTS

[00115] The methods of this invention, when practiced for commercial diagnostic purposes, generally produce a report or summary of information obtained from the herein described methods. For example, a report may include information concerning expression levels of one or more genes and /or microRNAs, classification of the tumor or the patient's risk of recurrence, the patient's likely prognosis or risk classification, clinical and pathologic factors, and/or other information. The methods and reports of this invention can further include storing the report in a database. The method can create a record in a database for the subject and populate the record with data. The report may be a paper report, an auditory report, or an electronic record. The report may be displayed and/or stored on a computing device (e.g., handheld device, desktop computer, smart device, website, etc.). It is contemplated that the report is provided to a physician and/or the patient. The receiving of the report can further include establishing a network connection to a server computer that includes the data and report and requesting the data and report from the server computer. COMPUTER PROGRAM

[00116] The values from the assays described above, such as expression data, can be calculated and stored manually. Alternatively, the above-described steps can be completely or partially performed by a computer program product. The present invention thus provides a computer program product including a computer readable storage medium having a computer program stored on it. The program can, when read by a computer, execute relevant calculations based on values obtained from analysis of one or more biological sample from an individual (e.g., gene expression levels, normalization, standardization, thresholding, and conversion of values from assays to a score and/or text or graphical depiction of tumor stage and related information). The computer program product has stored therein a computer program for performing the calculation.

[00117] The present disclosure provides systems for executing the program described above, which system generally includes: a) a central computing environment; b) an input device, operatively connected to the computing environment, to receive patient data, wherein the patient data can include, for example, expression level or other value obtained from an assay using a biological sample from the patient, or microarray data, as described in detail above; c) an output device, connected to the computing environment, to provide information to a user (e.g., medical personnel); and d) an algorithm executed by the central computing environment (e.g., a processor), where the algorithm is executed based on the data received by the input device, and wherein the algorithm calculates an expression score, thresholding, or other functions described herein. The methods provided by the present invention may also be automated in whole or in part.

[00118] All aspects of the present invention may also be practiced such that a limited number of additional genes and/or microRNAs that are co-expressed or functionally related with the disclosed genes, for example as evidenced by statistically meaningful Pearson and/or Spearman correlation coefficients, are included in a test in addition to and/or in place of disclosed genes.

[00119] Having described the invention, the same will be more readily understood through reference to the following Examples, which are provided by way of illustration, and are not intended to limit the invention in any way. EXAMPLES

EXAMPLE 1: RNA YIELD AND GENE EXPRESSION PROFILES IN PROSTATE CANCER BIOPSY CORES

[00120] Clinical tools based on prostate needle core biopsies are needed to guide treatment planning at diagnosis for men with localized prostate cancer. Limiting tissue in needle core biopsy specimens poses significant challenges to the development of molecular diagnostic tests. This study examined RNA extraction yields and gene expression profiles using an RT-PCR assay to characterize RNA from manually micro-dissected fixed paraffin embedded (FPE) prostate cancer needle biopsy cores. It also investigated the association of RNA yields and gene expression profiles with Gleason score in these specimens. Patients and Samples

[00121] This study determined the feasibility of gene expression profile analysis in prostate cancer needle core biopsies by evaluating the quantity and quality of RNA extracted from fixed paraffin-embedded (FPE) prostate cancer needle core biopsy specimens. Forty-eight (48) formalin-fixed blocks from prostate needle core biopsy specimens were used for this study. Classification of specimens was based on interpretation of the Gleason score (2005 Int'l Society of Urological Pathology Consensus Conference) and percentage tumor (<33%, 33-66%, >66%) involvement as assessed by pathologists. Table 1: Distribution of cases

Gleason score -<33% -33-66% ->66% Category Tumor Tumor Tumor Low (<6) 5 5 6 Intermediate (7) 5 5 6 High (8, 9, 10) 5 5 6 Total 15 15 18 Assay Methods

[00122] Fourteen (14) serial 5 m unstained sections from each FPE tissue block were included in the study. The first and last sections for each case were H&E stained and histologically reviewed to confirm the presence of tumor and for tumor enrichment by manual micro-dissection.

[00123] RNA from enriched tumor samples was extracted using a manual RNA extraction process. RNA was quantitated using the RiboGreen@ assay and tested for the presence of genomic DNA contamination. Samples with sufficient RNA yield and free of genomic DNA tested for gene expression levels of a 24-gene panel of reference and cancer-related genes using quantitative RT-PCR. The expression was normalized to the average of 6 reference genes (AAMP, ARF1, ATP5E, CLTC, EEF1A1, and GPX1). Statistical Methods

[00124] Descriptive statistics and graphical displays were used to summarize standard pathology metrics and gene expression, with stratification for Gleason Score category and percentage tumor involvement category. Ordinal logistic regression was used to evaluate the relationship between gene expression and Gleason Score category. Results

[00125] The RNA yield per unit surface area ranged from 16 to 2406 ng/mm2. Higher RNA yield was observed in samples with higher percent tumor involvement (p=0.02) and higher Gleason score (p=0.01). RNA yield was sufficient (> 200ng) in 71% of cases to permit 96-well RT-PCR, with 87% of cases having >100ng RNA yield. The study confirmed that gene expression from prostate biopsies, as measured by qRT-PCR, was comparable to FPET samples used in commercial molecular assays for breast cancer. In addition, it was observed that greater biopsy RNA yields are found with higher Gleason score and higher percent tumor involvement. Nine genes were identified as significantly associated with Gleason score (p < 0.05) and there was a large dynamic range observed for many test genes. EXAMPLE 2: GENE EXPRESSION ANALYSIS FOR GENES ASSOCIATED WITH PROGNOSIS IN PROSTATE CANCER

Patients and Samples

[00126] Approximately 2600 patients with clinical stage T1/T2 prostate cancer treated with radical prostatectomy (RP) at the Cleveland Clinic between 1987 and 2004 were identified. Patients were excluded from the study design if they received neo-adjuvant and/or adjuvant therapy, if pre-surgical PSA levels were missing, or if no tumor block was available from initial diagnosis. 127 patients with clinical recurrence and 374 patients without clinical recurrence after radical prostatectomy were randomly selected using a cohort sampling design. The specimens were stratified by T stage (TI, T2), year cohort (<1993, >1993), and prostatectomy Gleason score (low/intermediate, high). Of the 501 sampled patients, 51 were excluded for insufficient tumor; 7 were excluded due to clinical ineligibility; 2 were excluded due to poor quality of gene expression data; and 10 were excluded because primary Gleason pattern was unavailable. Thus, this gene expression study included tissue and data from 111 patients with clinical recurrence and 330 patients without clinical recurrence after radical prostatectomies performed between 1987 and 2004 for treatment of early stage (TI, T2) prostate cancer.

[00127] Two fixed paraffin embedded (FPE) tissue specimens were obtained from prostate tumor specimens in each patient. The sampling method (sampling method A or B) depended on whether the highest Gleason pattern is also the primary Gleason pattern. For each specimen selected, the invasive cancer cells were at least 5.0 mm in dimension, except in the instances of pattern 5, where 2.2 mm was accepted. Specimens were spatially distinct where possible. Table 2: Samplin2 Methods Sampling Method A Sampling Method B For patients whose prostatectomy primary For patients whose prostatectomy primary Gleason pattern is also the highest Gleason Gleason pattern is not the highest Gleason pattern pattern Specimen 1 (Al) = primary Gleason pattern Specimen 1 (B1) = highest Gleason pattern

Select and mark largest focus (greatest cross- Select highest Gleason pattern tissue from sectional area) of primary Gleason pattern spatially distinct area from specimen B2, if tissue. Invasive cancer area > 5.0 mm. possible. Invasive cancer area at least 5.0 mm if selecting secondary pattern, at least 2.2 mm if selecting Gleason pattern 5. Specimen 2 (A2) = secondary Gleason pattern Specimen 2 (B2) = primary Gleason pattern

Select and mark secondary Gleason pattern Select largest focus (greatest cross-sectional tissue from spatially distinct area from area) of primary Gleason pattern tissue. specimen Al. Invasive cancer area > 5.0 mm. Invasive cancer area > 5.0 mm.

[00128] Histologically normal appearing tissue (NAT) adjacent to the tumor specimen (also referred to in these Examples as "non-tumor tissue") was also evaluated. Adjacent tissue was collected 3 mm from the tumor to 3 mm from the edge of the FPET block. NAT was preferentially sampled adjacent to the primary Gleason pattern. In cases where there was insufficient NAT adjacent to the primary Gleason pattern, then NAT was sampled adjacent to the secondary or highest Gleason pattern (A2 or B1) per the method set forth in Table 2. Six (6) 10 pm sections with beginning H&E at 5 m and ending unstained slide at 5 m were prepared from each fixed paraffin-embedded tumor (FPET) block included in the study. All cases were histologically reviewed and manually micro-dissected to yield two enriched tumor samples and, where possible, one normal tissue sample adjacent to the tumor specimen. Assay Method

[00129] In this study, RT-PCR analysis was used to determine RNA expression levels for 738 genes and chromosomal rearrangements (e.g., TMPRSS2-ERG fusion or other ETS family genes) in prostate cancer tissue and surrounding NAT in patients with early-stage prostate cancer treated with radical prostatectomy.

[00130] The samples were quantified using the RiboGreen assay and a subset tested for presence of genomic DNA contamination. Samples were taken into reverse transcription (RT) and quantitative polymerase chain reaction (qPCR). All analyses were conducted on reference normalized gene expression levels using the average of the of replicate well crossing point (CP) values for the 6 reference genes (AAMP, ARF1, ATP5E, CLTC, GPS1, PGK1). Statistical Analysis and Results

[00131] Primary statistical analyses involved 111 patients with clinical recurrence and 330 patients without clinical recurrence after radical prostatectomy for early-stage prostate cancer stratified by T-stage (TI, T2), year cohort (<1993, >1993), and prostatectomy Gleason score (low/intermediate, high). Gleason score categories are defined as follows: low (Gleason score < 6), intermediate (Gleason score = 7), and high (Gleason score > 8). A patient was included in a specified analysis if at least one sample for that patient was evaluable. Unless otherwise stated, all hypothesis tests were reported using two-sided p-values. The method of Storey was applied to the resulting set of p-values to control the false discovery rate (FDR) at 20%. J. Storey, R. Tibshirani, Estimating the Positive False Discovery Rate Under Dependence, with Applications to DNA Microarrays, Dept. of Statistics, Stanford Univ. (2001).

[00132] Analysis of gene expression and recurrence-free interval was based on univariate Cox Proportional Hazards (PH) models using maximum weighted pseudo-partial-likelihood estimators for each evaluable gene in the gene list (727 test genes and 5 reference genes). P values were generated using Wald tests of the null hypothesis that the hazard ratio (HR) is one. Both unadjusted p-values and the q-value (smallest FDR at which the hypothesis test in question is rejected) were reported. Un-adjusted p-values <0.05 were considered statistically significant. Since two tumor specimens were selected for each patient, this analysis was performed using the

2 specimens from each patient as follows: (1) analysis using the primary Gleason pattern specimen from each patient (Specimens Al and B2 as described in Table 2); (2) analysis using the highest Gleason pattern specimen from each patient (Specimens Al and B Ias described in Table 2).

[00133] Analysis of gene expression and Gleason pattern (3, 4, 5) was based on univariate ordinal logistic regression models using weighted maximum likelihood estimators for each gene in the gene list (727 test genes and 5 reference genes). P-values were generated using a Wald test of the null hypothesis that the odds ratio (OR) is one. Both unadjusted p-values and the q-value (smallest FDR at which the hypothesis test in question is rejected) were reported. Un-adjusted p values <0.05 were considered statistically significant. Since two tumor specimens were selected for each patient, this analysis was performed using the 2 specimens from each patient as follows: (1) analysis using the primary Gleason pattern specimen from each patient (Specimens Al and B2 as described in Table 2); (2) analysis using the highest Gleason pattern specimen from each patient (Specimens Al and Bl as described in Table 2).

[00134] It was determined whether there is a significant relationship between cRFI and selected demographic, clinical, and pathology variables, including age, race, clinical tumor stage, pathologic tumor stage, location of selected tumor specimens within the prostate (peripheral versus transitional zone), PSA at the time of surgery, overall Gleason score from the radical prostatectomy, year of surgery, and specimen Gleason pattern. Separately for each demographic or clinical variable, the relationship between the clinical covariate and cRFI was modeled using univariate Cox PH regression using weighted pseudo partial-likelihood estimators and a p-value was generated using Wald's test of the null hypothesis that the hazard ratio (HR) is one. Covariates with unadjusted p-values <0.2 may have been included in the covariate-adjusted analyses.

[00135] It was determined whether there was a significant relationship between each of the individual cancer-related genes and cRFI after controlling for important demographic and clinical covariates. Separately for each gene, the relationship between gene expression and cRFI was modeled using multivariate Cox PH regression using weighted pseudo partial-likelihood estimators including important demographic and clinical variables as covariates. The independent contribution of gene expression to the prediction of cRFI was tested by generating a p-value from a Wald test using a model that included clinical covariates for each nodule

(specimens as defined in Table 2). Un-adjusted p-values <0.05 were considered statistically significant.

[00136] Tables 3A and 3B provide genes significantly associated (p<0.05), positively or negatively, with Gleason pattern in the primary and/or highest Gleason pattern. Increased expression of genes in Table 3A is positively associated with higher Gleason score, while increased expression of genes in Table 3B are negatively associated with higher Gleason score. Table 3A Gene significantly (p<0.05) associated with Gleason pattern for all specimens in the primary Gleason pattern or highest Gleason pattern odds ratio (OR) > 1.0 (Increased expression is positively associated with higher Gleason Score) Table 3A Primary Pattern Highest Pattern Official Symbol OR p-value OR p-value ALCAM 1.73 <.001 1.36 0.009 ANLN 1.35 0.027 APOCI 1.47 0.005 1.61 <.001 APOE 1.87 <.001 2.15 <.001 ASAP2 1.53 0.005 ASPN 2.62 <.001 2.13 <.001 ATP5E 1.35 0.035 AURKA 1.44 0.010 AURKB 1.59 <.001 1.56 <.001 BAX 1.43 0.006 BGN 2.58 <.001 2.82 <.001 BIRC5 1.45 0.003 1.79 <.001 BMP6 2.37 <.001 1.68 <.001 BMPR1B 1.58 0.002 BRCA2 1.45 0.013 BUBI 1.73 <.001 1.57 <.001 CACNAlD 1.31 0.045 1.31 0.033 CADPS 1.30 0.023 CCNB1 1.43 0.023 CCNE2 1.52 0.003 1.32 0.035 CD276 2.20 <.001 1.83 <.001 CD68 1.36 0.022 CDC20 1.69 <.001 1.95 <.001 CDC6 1.38 0.024 1.46 <.001 CDH11 1.30 0.029 CDKN2B 1.55 0.001 1.33 0.023 CDKN2C 1.62 <.001 1.52 <.001 CDKN3 1.39 0.010 1.50 0.002 CENPF 1.96 <.001 1.71 <.001 CHRACI 1.34 0.022 CLDN3 1.37 0.029

Table 3A Primary Pattern Highest Pattern Official Symbol OR p-value OR p-value COL1A1 2.23 <.001 2.22 <.001 COL1A2 1.42 0.005 COL3A1 1.90 <.001 2.13 <.001 COL8A1 1.88 <.001 2.35 <.001 CRISP3 1.33 0.040 1.26 0.050 CTHRC1 2.01 <.001 1.61 <.001 CTNND2 1.48 0.007 1.37 0.011 DAPK1 1.44 0.014 DIAPHI 1.34 0.032 1.79 <.001 D102 1.56 0.001 DLL4 1.38 0.026 1.53 <.001 ECE1 1.54 0.012 1.40 0.012 ENY2 1.35 0.046 1.35 0.012 EZH2 1.39 0.040 F2R 2.37 <.001 2.60 <.001 FAM49B 1.57 0.002 1.33 0.025 FAP 2.36 <.001 1.89 <.001 FCGR3A 2.10 <.001 1.83 <.001 GNPTAB 1.78 <.001 1.54 <.001 GSK3B 1.39 0.018 HRAS 1.62 0.003 HSD17B4 2.91 <.001 1.57 <.001 HSPA8 1.48 0.012 1.34 0.023 IF130 1.64 <.001 1.45 0.013 IGFBP3 1.29 0.037 ILI1 1.52 0.001 1.31 0.036 INHBA 2.55 <.001 2.30 <.001 ITGA4 1.35 0.028 JAGI 1.68 <.001 1.40 0.005 KCNN2 1.50 0.004 KCTD12 1.38 0.012 KHDRBS3 1.85 <.001 1.72 <.001 KIF4A 1.50 0.010 1.50 <.001 KLK14 1.49 0.001 1.35 <.001 KPNA2 1.68 0.004 1.65 0.001 KRT2 1.33 0.022 KRT75 1.27 0.028 LAMC1 1.44 0.029 LAPTM5 1.36 0.025 1.31 0.042 LTBP2 1.42 0.023 1.66 <.001 MANF 1.34 0.019 MAOA 1.55 0.003 1.50 <.001 MAP3K5 1.55 0.006 1.44 0.001 MDK 1.47 0.013 1.29 0.041

Table 3A Primary Pattern Highest Pattern Official Symbol OR p-value OR p-value MDM2 1.31 0.026 MELK 1.64 <.001 1.64 <.001 MMP11 2.33 <.001 1.66 <.001 MYBL2 1.41 0.007 1.54 <.001 MYO6 1.32 0.017 NETO2 1.36 0.018 NOX4 1.84 <.001 1.73 <.001 NPM1 1.68 0.001 NRIP3 1.36 0.009 NRP1 1.80 0.001 1.36 0.019 OSM 1.33 0.046 PATEl 1.38 0.032 PECAMI 1.38 0.021 1.31 0.035 PGD 1.56 0.010 PLK1 1.51 0.004 1.49 0.002 PLOD2 1.29 0.027 POSTN 1.70 0.047 1.55 0.006 PPP3CA 1.38 0.037 1.37 0.006 PTK6 1.45 0.007 1.53 <.001 PTTG1 1.51 <.001 RAB31 1.31 0.030 RAD21 2.05 <.001 1.38 0.020 RAD51 1.46 0.002 1.26 0.035 RAFI 1.46 0.017 RALBP1 1.37 0.043 RHOC 1.33 0.021 ROBO2 1.52 0.003 1.41 0.006 RRM2 1.77 <.001 1.50 <.001 SATI 1.67 0.002 1.61 <.001 SDC1 1.66 0.001 1.46 0.014 SEC14L1 1.53 0.003 1.62 <.001 SESN3 1.76 <.001 1.45 <.001 SFRP4 2.69 <.001 2.03 <.001 SHMT2 1.69 0.007 1.45 0.003 SKIL 1.46 0.005 SOX4 1.42 0.016 1.27 0.031 SPARC 1.40 0.024 1.55 <.001 SPINKI 1.29 0.002 SPP1 1.51 0.002 1.80 <.001 TFDP1 1.48 0.014 THBS2 1.87 <.001 1.65 <.001 THY1 1.58 0.003 1.64 <.001 TK1 1.79 <.001 1.42 0.001 TOP2A 2.30 <.001 2.01 <.001

Table 3A Primary Pattern Highest Pattern Official Symbol OR p-value OR p-value TPD52 1.95 <.001 1.30 0.037 TPX2 2.12 <.001 1.86 <.001 TYMP 1.36 0.020 TYMS 1.39 0.012 1.31 0.036 UBE2C 1.66 <.001 1.65 <.001 UBE2T 1.59 <.001 1.33 0.017 UGDH 1.28 0.049 UGT2B15 1.46 0.001 1.25 0.045 UHRF1 1.95 <.001 1.62 <.001 VDR 1.43 0.010 1.39 0.018 WNT5A 1.54 0.001 1.44 0.013

Table 3B. Gene significantly (p<0.05) associated with Gleason pattern for all specimens in the primary Gleason pattern or highest Gleason pattern odds ratio (OR) < 1.0 (Increased expression is negatively associated with higher Gleason score) Table 3B Primary Pattern Highest Pattern Official Symbol OR p-value OR p-value ABCA5 0.78 0.041 ABCG2 0.65 0.001 0.72 0.012 ACOX2 0.44 <.001 0.53 <.001 ADH5 0.45 <.001 0.42 <.001 AFAPI 0.79 0.038 AIGI 0.77 0.024 AKAPI 0.63 0.002 AKR1C1 0.66 0.003 0.63 <.001 AKT3 0.68 0.006 0.77 0.010 ALDH1A2 0.28 <.001 0.33 <.001 ALKBH3 0.77 0.040 0.77 0.029 AMPD3 0.67 0.007 ANPEP 0.68 0.008 0.59 <.001 ANXA2 0.72 0.018 APC 0.69 0.002 AXIN2 0.46 <.001 0.54 <.001 AZGP1 0.52 <.001 0.53 <.001 BIK 0.69 0.006 0.73 0.003 BINI 0.43 <.001 0.61 <.001 BTG3 0.79 0.030 BTRC 0.48 <.001 0.62 <.001 C7 0.37 <.001 0.55 <.001 CADMI 0.56 <.001 0.69 0.001 CAVI 0.58 0.002 0.70 0.009 CAV2 0.65 0.029

Table 3B Primary Pattern Highest Pattern Official Symbol OR p-value OR p-value CCNH 0.67 0.006 0.77 0.048 CD164 0.59 0.003 0.57 <.001 CDC25B 0.77 0.035 CDH1 0.66 <.001 CDK2 0.71 0.003 CDKN1C 0.58 <.001 0.57 <.001 CDS2 0.69 0.002 CHN1 0.66 0.002 COL6A1 0.44 <.001 0.66 <.001 COL6A3 0.66 0.006 CSRP1 0.42 0.006 CTGF 0.74 0.043 CTNNA1 0.70 <.001 0.83 0.018 CTNNB1 0.70 0.019 CTNND1 0.75 0.028 CUL1 0.74 0.011 CXCL12 0.54 <.001 0.74 0.006 CYP3A5 0.52 <.001 0.66 0.003 CYR61 0.64 0.004 0.68 0.005 DDR2 0.57 0.002 0.73 0.004 DES 0.34 <.001 0.58 <.001 DLGAP1 0.54 <.001 0.62 <.001 DNM3 0.67 0.004 DPP4 0.41 <.001 0.53 <.001 DPT 0.28 <.001 0.48 <.001 DUSPI 0.59 <.001 0.63 <.001 EDNRA 0.64 0.004 0.74 0.008 EGF 0.71 0.012 EGRI 0.59 <.001 0.67 0.009 EGR3 0.72 0.026 0.71 0.025 EIF5 0.76 0.025 ELK4 0.58 0.001 0.70 0.008 ENPP2 0.66 0.002 0.70 0.005 EPHA3 0.65 0.006 EPHB2 0.60 <.001 0.78 0.023 EPHB4 0.75 0.046 0.73 0.006 ERBB3 0.76 0.040 0.75 0.013 ERBB4 0.74 0.023 ERCC1 0.63 <.001 0.77 0.016 FAAH 0.67 0.003 0.71 0.010 FAM107A 0.35 <.001 0.59 <.001 FAM13C 0.37 <.001 0.48 <.001 FAS 0.73 0.019 0.72 0.008 FGF1O 0.53 <.001 0.58 <.001

Table 3B Primary Pattern Highest Pattern Official Symbol OR p-value OR p-value FGF7 0.52 <.001 0.59 <.001 FGFR2 0.60 <.001 0.59 <.001 FKBP5 0.70 0.039 0.68 0.003 FLNA 0.39 <.001 0.56 <.001 FLNC 0.33 <.001 0.52 <.001 FOS 0.58 <.001 0.66 0.005 FOXO1 0.57 <.001 0.67 <.001 FOXQ1 0.74 0.023 GADD45B 0.62 0.002 0.71 0.010 GHR 0.62 0.002 0.72 0.009 GNRH1 0.74 0.049 0.75 0.026 GPM6B 0.48 <.001 0.68 <.001 GPS1 0.68 0.003 GSN 0.46 <.001 0.77 0.027 GSTM1 0.44 <.001 0.62 <.001 GSTM2 0.29 <.001 0.49 <.001 HGD 0.77 0.020 HIRIP3 0.75 0.034 HK1 0.48 <.001 0.66 0.001 HLF 0.42 <.001 0.55 <.001 HNF1B 0.67 0.006 0.74 0.010 HPS1 0.66 0.001 0.65 <.001 HSP90AB1 0.75 0.042 HSPA5 0.70 0.011 HSPB2 0.52 <.001 0.70 0.004 IGF1 0.35 <.001 0.59 <.001 IGF2 0.48 <.001 0.70 0.005 IGFBP2 0.61 <.001 0.77 0.044 IGFBP5 0.63 <.001 IGFBP6 0.45 <.001 0.64 <.001 IL6ST 0.55 0.004 0.63 <.001 ILK 0.40 <.001 0.57 <.001 ING5 0.56 <.001 0.78 0.033 ITGA1 0.56 0.004 0.61 <.001 ITGA3 0.78 0.035 ITGA5 0.71 0.019 0.75 0.017 ITGA7 0.37 <.001 0.52 <.001 ITGB3 0.63 0.003 0.70 0.005 ITPR1 0.46 <.001 0.64 <.001 ITPR3 0.70 0.013 ITSN1 0.62 0.001 JUN 0.48 <.001 0.60 <.001 JUNB 0.72 0.025 KIT 0.51 <.001 0.68 0.007

Table 3B Primary Pattern Highest Pattern Official Symbol OR p-value OR p-value KLC1 0.58 <.001 KLK1 0.69 0.028 0.66 0.003 KLK2 0.60 <.001 KLK3 0.63 <.001 0.69 0.012 KRT15 0.56 <.001 0.60 <.001 KRT18 0.74 0.034 KRT5 0.64 <.001 0.62 <.001 LAMA4 0.47 <.001 0.73 0.010 LAMB3 0.73 0.018 0.69 0.003 LGALS3 0.59 0.003 0.54 <.001 LIG3 0.75 0.044 MAP3K7 0.66 0.003 0.79 0.031 MCM3 0.73 0.013 0.80 0.034 MGMT 0.61 0.001 0.71 0.007 MGSTl 0.75 0.017 MLXIP 0.70 0.013 MMP2 0.57 <.001 0.72 0.010 MMP7 0.69 0.009 MPPED2 0.70 0.009 0.59 <.001 MSH6 0.78 0.046 MTA1 0.69 0.007 MTSS1 0.55 <.001 0.54 <.001 MYBPC1 0.45 <.001 0.45 <.001 NCAM1 0.51 <.001 0.65 <.001 NCAPD3 0.42 <.001 0.53 <.001 NCOR2 0.68 0.002 NDUFS5 0.66 0.001 0.70 0.013 NEXN 0.48 <.001 0.62 <.001 NFAT5 0.55 <.001 0.67 0.001 NFKBIA 0.79 0.048 NRG1 0.58 0.001 0.62 0.001 OLFML3 0.42 <.001 0.58 <.001 OMD 0.67 0.004 0.71 0.004 OR51E2 0.65 <.001 0.76 0.007 PAGE4 0.27 <.001 0.46 <.001 PCA3 0.68 0.004 PCDHGB7 0.70 0.025 0.65 <.001 PGF 0.62 0.001 PGR 0.63 0.028 PHTF2 0.69 0.033 PLP2 0.54 <.001 0.71 0.003 PPAP2B 0.41 <.001 0.54 <.001 PPP1R12A 0.48 <.001 0.60 <.001 PRIMAl 0.62 0.003 0.65 <.001

Table 3B Primary Pattern Highest Pattern Official Symbol OR p-value OR p-value PRKAR1B 0.70 0.009 PRKAR2B 0.79 0.038 PRKCA 0.37 <.001 0.55 <.001 PRKCB 0.47 <.001 0.56 <.001 PTCH1 0.70 0.021 PTEN 0.66 0.010 0.64 <.001 PTGER3 0.76 0.015 PTGS2 0.70 0.013 0.68 0.005 PTH1R 0.48 <.001 PTK2B 0.67 0.014 0.69 0.002 PYCARD 0.72 0.023 RAB27A 0.76 0.017 RAGE 0.77 0.040 0.57 <.001 RARB 0.66 0.002 0.69 0.002 RECK 0.65 <.001 RHOA 0.73 0.043 RHOB 0.61 0.005 0.62 <.001 RND3 0.63 0.006 0.66 <.001 SDHC 0.69 0.002 SEC23A 0.61 <.001 0.74 0.010 SEMA3A 0.49 <.001 0.55 <.001 SERPINA3 0.70 0.034 0.75 0.020 SH3RF2 0.33 <.001 0.42 <.001 SLC22A3 0.23 <.001 0.37 <.001 SMAD4 0.33 <.001 0.39 <.001 SMARCC2 0.62 0.003 0.74 0.008 SMO 0.53 <.001 0.73 0.009 SORBS1 0.40 <.001 0.55 <.001 SPARCL1 0.42 <.001 0.63 <.001 SRD5A2 0.28 <.001 0.37 <.001 ST5 0.52 <.001 0.63 <.001 STAT5A 0.60 <.001 0.75 0.020 STAT5B 0.54 <.001 0.65 <.001 STS 0.78 0.035 SUMOl 0.75 0.017 0.71 0.002 SVIL 0.45 <.001 0.62 <.001 TARP 0.72 0.017 TGFB1Il 0.37 <.001 0.53 <.001 TGFB2 0.61 0.025 0.59 <.001 TGFB3 0.46 <.001 0.60 <.001 TIMP2 0.62 0.001 TIMP3 0.55 <.001 0.76 0.019 TMPRSS2 0.71 0.014 TNF 0.65 0.010

Table 3B Primary Pattern Highest Pattern Official Symbol OR p-value OR p-value TNFRSF1OA 0.71 0.014 0.74 0.010 TNFRSF1OB 0.74 0.030 0.73 0.016 TNFSF1O 0.69 0.004 TP53 0.73 0.011 TP63 0.62 <.001 0.68 0.003 TPM1 0.43 <.001 0.47 <.001 TPM2 0.30 <.001 0.47 <.001 TPP2 0.58 <.001 0.69 0.001 TRA2A 0.71 0.006 TRAF3IP2 0.50 <.001 0.63 <.001 TRO 0.40 <.001 0.59 <.001 TRPC6 0.73 0.030 TRPV6 0.80 0.047 VCL 0.44 <.001 0.55 <.001 VEGFB 0.73 0.029 VIM 0.72 0.013 VTI1B 0.78 0.046 WDR19 0.65 <.001 WFDC1 0.50 <.001 0.72 0.010 YY1 0.75 0.045 ZFHX3 0.52 <.001 0.54 <.001 ZFP36 0.65 0.004 0.69 0.012 ZNF827 0.59 <.001 0.69 0.004

[00137] To identify genes associated with recurrence (cRFI, bRFI) in the primary and the highest Gleason pattern, each of 727 genes were analyzed in univariate models using specimens Al and B2 (see Table 2, above). Tables 4A and 4B provide genes that were associated, positively or negatively, with cRFI and/or bRFI in the primary and/or highest Gleason pattern. Increased expression of genes in Table 4A is negatively associated with good prognosis, while increased expression of genes in Table 4B is positively associated with good prognosis. Table 4A. Genes significantly (p<0.05) associated with cRFIor bRFIin the primary Gleason pattern or highest Gleason pattern with hazard ratio (HR) > 1.0 (increased expression is negatively associated with good prognosis) Table 4A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value AKR1C3 1.304 0.022 1.312 0.013 ANLN 1.379 0.002 1.579 <.001 1.465 <.001 1.623 <.001 AQP2 1.184 0.027 1.276 <.001 ASAP2 1.442 0.006

Table 4A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value ASPN 2.272 <.001 2.106 <.001 1.861 <.001 1.895 <.001 ATP5E 1.414 0.013 1.538 <.001 BAG5 1.263 0.044 BAX 1.332 0.026 1.327 0.012 1.438 0.002 BGN 1.947 <.001 2.061 <.001 1.339 0.017 BIRC5 1.497 <.001 1.567 <.001 1.478 <.001 1.575 <.001 BMP6 1.705 <.001 2.016 <.001 1.418 0.004 1.541 <.001 BMPR1B 1.401 0.013 1.325 0.016 BRCA2 1.259 0.007 BUBI 1.411 <.001 1.435 <.001 1.352 <.001 1.242 0.002 CADPS 1.387 0.009 1.294 0.027 CCNB1 1.296 0.016 1.376 0.002 CCNE2 1.468 <.001 1.649 <.001 1.729 <.001 1.563 <.001 CD276 1.678 <.001 1.832 <.001 1.581 <.001 1.385 0.002 CDC20 1.547 <.001 1.671 <.001 1.446 <.001 1.540 <.001 CDC6 1.400 0.003 1.290 0.030 1.403 0.002 1.276 0.019 CDH7 1.403 0.003 1.413 0.002 CDKN2B 1.569 <.001 1.752 <.001 1.333 0.017 1.347 0.006 CDKN2C 1.612 <.001 1.780 <.001 1.323 0.005 1.335 0.004 CDKN3 1.384 <.001 1.255 0.024 1.285 0.003 1.216 0.028 CENPF 1.578 <.001 1.692 <.001 1.740 <.001 1.705 <.001 CKS2 1.390 0.007 1.418 0.005 1.291 0.018 CLTC 1.368 0.045 COL1A1 1.873 <.001 2.103 <.001 1.491 <.001 1.472 <.001 COL1A2 1.462 0.001 COL3A1 1.827 <.001 2.005 <.001 1.302 0.012 1.298 0.018 COL4A1 1.490 0.002 1.613 <.001 COL8A1 1.692 <.001 1.926 <.001 1.307 0.013 1.317 0.010 CRISP3 1.425 0.001 1.467 <.001 1.242 0.045 CTHRC1 1.505 0.002 2.025 <.001 1.425 0.003 1.369 0.005 CTNND2 1.412 0.003 CXCR4 1.312 0.023 1.355 0.008 DDIT4 1.543 <.001 1.763 <.001 DYNLL1 1.290 0.039 1.201 0.004 EIF3H 1.428 0.012 ENY2 1.361 0.014 1.392 0.008 1.371 0.001 EZH2 1.311 0.010 F2R 1.773 <.001 1.695 <.001 1.495 <.001 1.277 0.018 FADD 1.292 0.018 FAM171B 1.285 0.036 FAP 1.455 0.004 1.560 0.001 1.298 0.022 1.274 0.038 FASN 1.263 0.035

Table 4A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value FCGR3A 1.654 <.001 1.253 0.033 1.350 0.007 FGF5 1.219 0.030 GNPTAB 1.388 0.007 1.503 0.003 1.355 0.005 1.434 0.002 GPR68 1.361 0.008 GREMI 1.470 0.003 1.716 <.001 1.421 0.003 1.316 0.017 HDAC1 1.290 0.025 HDAC9 1.395 0.012 HRAS 1.424 0.006 1.447 0.020 HSD17B4 1.342 0.019 1.282 0.026 1.569 <.001 1.390 0.002 HSPA8 1.290 0.034 IGFBP3 1.333 0.022 1.442 0.003 1.253 0.040 1.323 0.005 INHBA 2.368 <.001 2.765 <.001 1.466 0.002 1.671 <.001 JAGI 1.359 0.006 1.367 0.005 1.259 0.024 KCNN2 1.361 0.011 1.413 0.005 1.312 0.017 1.281 0.030 KHDRBS3 1.387 0.006 1.601 <.001 1.573 <.001 1.353 0.006 KIAA0196 1.249 0.037 KIF4A 1.212 0.016 1.149 0.040 1.278 0.003 KLK14 1.167 0.023 1.180 0.007 KPNA2 1.425 0.009 1.353 0.005 1.305 0.019 KRT75 1.164 0.028 LAMA3 1.327 0.011 LAMBI 1.347 0.019 LAMC1 1.555 0.001 1.310 0.030 1.349 0.014 LIMS1 1.275 0.022 LOX 1.358 0.003 1.410 <.001 LTBP2 1.396 0.009 1.656 <.001 1.278 0.022 LUM 1.315 0.021 MANF 1.660 <.001 1.323 0.011 MCM2 1.345 0.011 1.387 0.014 MCM6 1.307 0.023 1.352 0.008 1.244 0.039 MELK 1.293 0.014 1.401 <.001 1.501 <.001 1.256 0.012 MMP11 1.680 <.001 1.474 <.001 1.489 <.001 1.257 0.030 MRPL13 1.260 0.025 MSH2 1.295 0.027 MYBL2 1.664 <.001 1.670 <.001 1.399 <.001 1.431 <.001 MYO6 1.301 0.033 NETO2 1.412 0.004 1.302 0.027 1.298 0.009 NFKB1 1.236 0.050 NOX4 1.492 <.001 1.507 0.001 1.555 <.001 1.262 0.019 NPM1 1.287 0.036 NRIP3 1.219 0.031 1.218 0.018 NRP1 1.482 0.002 1.245 0.041

Table 4A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value OLFML2B 1.362 0.015 OR51E1 1.531 <.001 1.488 0.003 PAK6 1.269 0.033 PATEl 1.308 <.001 1.332 <.001 1.164 0.044 PCNA 1.278 0.020 PEX1O 1.436 0.005 1.393 0.009 PGD 1.298 0.048 1.579 <.001 PGK1 1.274 0.023 1.262 0.009 PLA2G7 1.315 0.011 1.346 0.005 PLAU 1.319 0.010 PLK1 1.309 0.021 1.563 <.001 1.410 0.002 1.372 0.003 PLOD2 1.284 0.019 1.272 0.014 1.332 0.005 POSTN 1.599 <.001 1.514 0.002 1.391 0.005 PPP3CA 1.402 0.007 1.316 0.018 PSMD13 1.278 0.040 1.297 0.033 1.279 0.017 1.373 0.004 PTK6 1.640 <.001 1.932 <.001 1.369 0.001 1.406 <.001 PTTG1 1.409 <.001 1.510 <.001 1.347 0.001 1.558 <.001 RAD21 1.315 0.035 1.402 0.004 1.589 <.001 1.439 <.001 RAFI 1.503 0.002 RALA 1.521 0.004 1.403 0.007 1.563 <.001 1.229 0.040 RALBP1 1.277 0.033 RGS7 1.154 0.015 1.266 0.010 RRM1 1.570 0.001 1.602 <.001 RRM2 1.368 <.001 1.289 0.004 1.396 <.001 1.230 0.015 SATI 1.482 0.016 1.403 0.030 SDC1 1.340 0.018 1.396 0.018 SEC14L1 1.260 0.048 1.360 0.002 SESN3 1.485 <.001 1.631 <.001 1.232 0.047 1.292 0.014 SFRP4 1.800 <.001 1.814 <.001 1.496 <.001 1.289 0.027 SHMT2 1.807 <.001 1.658 <.001 1.673 <.001 1.548 <.001 SKIL 1.327 0.008 SLC25A21 1.398 0.001 1.285 0.018 SOX4 1.286 0.020 1.280 0.030 SPARC 1.539 <.001 1.842 <.001 1.269 0.026 SPP1 1.322 0.022 SQLE 1.359 0.020 1.270 0.036 STMN1 1.402 0.007 1.446 0.005 1.279 0.031 SULFI 1.587 <.001 TAF2 1.273 0.027 TFDP1 1.328 0.021 1.400 0.005 1.416 0.001 THBS2 1.812 <.001 1.960 <.001 1.320 0.012 1.256 0.038 THY1 1.362 0.020 1.662 <.001

Table 4A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value TK1 1.251 0.011 1.377 <.001 1.401 <.001 TOP2A 1.670 <.001 1.920 <.001 1.869 <.001 1.927 <.001 TPD52 1.324 0.011 1.366 0.002 1.351 0.005 TPX2 1.884 <.001 2.154 <.001 1.874 <.001 1.794 <.001 UAP1 1.244 0.044 UBE2C 1.403 <.001 1.541 <.001 1.306 0.002 1.323 <.001 UBE2T 1.667 <.001 1.282 0.023 1.502 <.001 1.298 0.005 UGT2B15 1.295 0.001 1.275 0.002 UGT2B17 1.294 0.025 UHRF1 1.454 <.001 1.531 <.001 1.257 0.029 VCPIP1 1.390 0.009 1.414 0.004 1.294 0.021 1.283 0.021 WNT5A 1.274 0.038 1.298 0.020 XIAP 1.464 0.006 ZMYND8 1.277 0.048 ZWINT 1.259 0.047

Table 4B. Genes significantly (p<0.05) associated with cRFI or bRFI in the primary Gleason pattern or highest Gleason pattern with hazard ratio (HR) < 1.0 (increased expression is positively associated with good prognosis) Table 4B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value AAMP 0.564 <.001 0.571 <.001 0.764 0.037 0.786 0.034 ABCA5 0.755 <.001 0.695 <.001 0.800 0.006 ABCB1 0.777 0.026 ABCG2 0.788 0.033 0.784 0.040 0.803 0.018 0.750 0.004 ABHD2 0.734 0.011 ACE 0.782 0.048 ACOX2 0.639 <.001 0.631 <.001 0.713 <.001 0.716 0.002 ADH5 0.625 <.001 0.637 <.001 0.753 0.026 AKAPI 0.764 0.006 0.800 0.005 0.837 0.046 AKR1C1 0.773 0.033 0.802 0.032 AKT1 0.714 0.005 AKT3 0.811 0.015 0.809 0.021 ALDH1A2 0.606 <.001 0.498 <.001 0.613 <.001 0.624 <.001 AMPD3 0.793 0.024 ANPEP 0.584 <.001 0.493 <.001 ANXA2 0.753 0.013 0.781 0.036 0.762 0.008 0.795 0.032 APRT 0.758 0.026 0.780 0.044 0.746 0.008 ATXN1 0.673 0.001 0.776 0.029 0.809 0.031 0.812 0.043 AXIN2 0.674 <.001 0.571 <.001 0.776 0.005 0.757 0.005 AZGP1 0.585 <.001 0.652 <.001 0.664 <.001 0.746 <.001 BAD 0.765 0.023 BCL2 0.788 0.033 0.778 0.036 BDKRB1 0.728 0.039 BIK 0.712 0.005 BINI 0.607 <.001 0.724 0.002 0.726 <.001 0.834 0.034 BTG3 0.847 0.034 BTRC 0.688 0.001 0.713 0.003 C7 0.589 <.001 0.639 <.001 0.629 <.001 0.691 <.001 CADMI 0.546 <.001 0.529 <.001 0.743 0.008 0.769 0.015 CASPI 0.769 0.014 0.799 0.028 0.799 0.010 0.815 0.018 CAVI 0.736 0.011 0.711 0.005 0.675 <.001 0.743 0.006 CAV2 0.636 0.010 0.648 0.012 0.685 0.012 CCL2 0.759 0.029 0.764 0.024 CCNH 0.689 <.001 0.700 <.001 CD164 0.664 <.001 0.651 <.001 CD1A 0.687 0.004 CD44 0.545 <.001 0.600 <.001 0.788 0.018 0.799 0.023 CD82 0.771 0.009 0.748 0.004

Table 4B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value CDC25B 0.755 0.006 0.817 0.025 CDK14 0.845 0.043 CDK2 0.819 0.032 CDK3 0.733 0.005 0.772 0.006 0.838 0.017 CDKN1A 0.766 0.041 CDKN1C 0.662 <.001 0.712 0.002 0.693 <.001 0.761 0.009 CHN1 0.788 0.036 COL6A1 0.608 <.001 0.767 0.013 0.706 <.001 0.775 0.007 CSF1 0.626 <.001 0.709 0.003 CSK 0.837 0.029 CSRP1 0.793 0.024 0.782 0.019 CTNNB1 0.898 0.042 0.885 <.001 CTSB 0.701 0.004 0.713 0.007 0.715 0.002 0.803 0.038 CTSK 0.815 0.042 CXCL12 0.652 <.001 0.802 0.044 0.711 0.001 CYP3A5 0.463 <.001 0.436 <.001 0.727 0.003 CYR61 0.652 0.002 0.676 0.002 DAP 0.761 0.026 0.775 0.025 0.802 0.048 DARC 0.725 0.005 0.792 0.032 DDR2 0.719 0.001 0.763 0.008 DES 0.619 <.001 0.737 0.005 0.638 <.001 0.793 0.017 DHRS9 0.642 0.003 DHX9 0.888 <.001 DLC1 0.710 0.007 0.715 0.009 DLGAP1 0.613 <.001 0.551 <.001 0.779 0.049 DNM3 0.679 <.001 0.812 0.037 DPP4 0.591 <.001 0.613 <.001 0.761 0.003 DPT 0.613 <.001 0.576 <.001 0.647 <.001 0.677 <.001 DUSPI 0.662 0.001 0.665 0.001 0.785 0.024 DUSP6 0.713 0.005 0.668 0.002 EDNRA 0.702 0.002 0.779 0.036 EGF 0.738 0.028 EGRI 0.569 <.001 0.577 <.001 0.782 0.022 EGR3 0.601 <.001 0.619 <.001 0.800 0.038 EIF2S3 0.756 0.015 EIF5 0.776 0.023 0.787 0.028 ELK4 0.628 <.001 0.658 <.001 EPHA2 0.720 0.011 0.663 0.004 EPHA3 0.727 0.003 0.772 0.005 ERBB2 0.786 0.019 0.738 0.003 0.815 0.041 ERBB3 0.728 0.002 0.711 0.002 0.828 0.043 0.813 0.023 ERCC1 0.771 0.023 0.725 0.007 0.806 0.049 0.704 0.002

Table 4B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value EREG 0.754 0.016 0.777 0.034 ESR2 0.731 0.026 FAAH 0.708 0.004 0.758 0.012 0.784 0.031 0.774 0.007 FAM107A 0.517 <.001 0.576 <.001 0.642 <.001 0.656 <.001 FAM13C 0.568 <.001 0.526 <.001 0.739 0.002 0.639 <.001 FAS 0.755 0.014 FASLG 0.706 0.021 FGF1O 0.653 <.001 0.685 <.001 0.766 0.022 FGF17 0.746 0.023 0.781 0.015 0.805 0.028 FGF7 0.794 0.030 0.820 0.037 0.811 0.040 FGFR2 0.683 <.001 0.686 <.001 0.674 <.001 0.703 <.001 FKBP5 0.676 0.001 FLNA 0.653 <.001 0.741 0.010 0.682 <.001 0.771 0.016 FLNC 0.751 0.029 0.779 0.047 0.663 <.001 0.725 <.001 FLT1 0.799 0.044 FOS 0.566 <.001 0.543 <.001 0.757 0.006 FOXO1 0.816 0.039 0.798 0.023 FOXQ1 0.753 0.017 0.757 0.024 0.804 0.018 FYN 0.779 0.031 GADD45B 0.590 <.001 0.619 <.001 GDF15 0.759 0.019 0.794 0.048 GHR 0.702 0.005 0.630 <.001 0.673 <.001 0.590 <.001 GNRH1 0.742 0.014 GPM6B 0.653 <.001 0.633 <.001 0.696 <.001 0.768 0.007 GSN 0.570 <.001 0.697 0.001 0.697 <.001 0.758 0.005 GSTM1 0.612 <.001 0.588 <.001 0.718 <.001 0.801 0.020 GSTM2 0.540 <.001 0.630 <.001 0.602 <.001 0.706 <.001 HGD 0.796 0.020 0.736 0.002 HIRIP3 0.753 0.011 0.824 0.050 HK1 0.684 <.001 0.683 <.001 0.799 0.011 0.804 0.014 HLA-G 0.726 0.022 HLF 0.555 <.001 0.582 <.001 0.703 <.001 0.702 <.001 HNF1B 0.690 <.001 0.585 <.001 HPS1 0.744 0.003 0.784 0.020 0.836 0.047 HSD3B2 0.733 0.016 HSP90AB1 0.801 0.036 HSPA5 0.776 0.034 HSPB1 0.813 0.020 HSPB2 0.762 0.037 0.699 0.002 0.783 0.034 HSPG2 0.794 0.044 ICAMI 0.743 0.024 0.768 0.040 IER3 0.686 0.002 0.663 <.001

Table 4B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value IFITI 0.649 <.001 0.761 0.026 IGF1 0.634 <.001 0.537 <.001 0.696 <.001 0.688 <.001 IGF2 0.732 0.004 IGFBP2 0.548 <.001 0.620 <.001 IGFBP5 0.681 <.001 IGFBP6 0.577 <.001 0.675 <.001 ILIB 0.712 0.005 0.742 0.009 IL6 0.763 0.028 IL6R 0.791 0.039 IL6ST 0.585 <.001 0.639 <.001 0.730 0.002 0.768 0.006 IL8 0.624 <.001 0.662 0.001 ILK 0.712 0.009 0.728 0.012 0.790 0.047 0.790 0.042 ING5 0.625 <.001 0.658 <.001 0.728 0.002 ITGA5 0.728 0.006 0.803 0.039 ITGA6 0.779 0.007 0.775 0.006 ITGA7 0.584 <.001 0.700 0.001 0.656 <.001 0.786 0.014 ITGAD 0.657 0.020 ITGB4 0.718 0.007 0.689 <.001 0.818 0.041 ITGB5 0.801 0.050 ITPR1 0.707 0.001 JUN 0.556 <.001 0.574 <.001 0.754 0.008 JUNB 0.730 0.017 0.715 0.010 KIT 0.644 0.004 0.705 0.019 0.605 <.001 0.659 0.001 KLC1 0.692 0.003 0.774 0.024 0.747 0.008 KLF6 0.770 0.032 0.776 0.039 KLK1 0.646 <.001 0.652 0.001 0.784 0.037 KLK1O 0.716 0.006 KLK2 0.647 <.001 0.628 <.001 0.786 0.009 KLK3 0.706 <.001 0.748 <.001 0.845 0.018 KRT1 0.734 0.024 KRT15 0.627 <.001 0.526 <.001 0.704 <.001 0.782 0.029 KRT18 0.624 <.001 0.617 <.001 0.738 0.005 0.760 0.005 KRT5 0.640 <.001 0.550 <.001 0.740 <.001 0.798 0.023 KRT8 0.716 0.006 0.744 0.008 LICAM 0.738 0.021 0.692 0.009 0.761 0.036 LAG3 0.741 0.013 0.729 0.011 LAMA4 0.686 0.011 0.592 0.003 LAMA5 0.786 0.025 LAMB3 0.661 <.001 0.617 <.001 0.734 <.001 LGALS3 0.618 <.001 0.702 0.001 0.734 0.001 0.793 0.012 LIG3 0.705 0.008 0.615 <.001 LRP1 0.786 0.050 0.795 0.023 0.770 0.009

Table 4B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value MAP3K7 0.789 0.003 MGMT 0.632 <.001 0.693 <.001 MICA 0.781 0.014 0.653 <.001 0.833 0.043 MPPED2 0.655 <.001 0.597 <.001 0.719 <.001 0.759 0.006 MSH6 0.793 0.015 MTSS1 0.613 <.001 0.746 0.008 MVP 0.792 0.028 0.795 0.045 0.819 0.023 MYBPCl 0.648 <.001 0.496 <.001 0.701 <.001 0.629 <.001 NCAM1 0.773 0.015 NCAPD3 0.574 <.001 0.463 <.001 0.679 <.001 0.640 <.001 NEXN 0.701 0.002 0.791 0.035 0.725 0.002 0.781 0.016 NFAT5 0.515 <.001 0.586 <.001 0.785 0.017 NFATC2 0.753 0.023 NFKBIA 0.778 0.037 NRG1 0.644 0.004 0.696 0.017 0.698 0.012 OAZ1 0.777 0.034 0.775 0.022 OLFML3 0.621 <.001 0.720 0.001 0.600 <.001 0.626 <.001 OMD 0.706 0.003 OR51E2 0.820 0.037 0.798 0.027 PAGE4 0.549 <.001 0.613 <.001 0.542 <.001 0.628 <.001 PCA3 0.684 <.001 0.635 <.001 PCDHGB7 0.790 0.045 0.725 0.002 0.664 <.001 PGF 0.753 0.017 PGR 0.740 0.021 0.728 0.018 PIK3CG 0.803 0.024 PLAUR 0.778 0.035 PLG 0.728 0.028 PPAP2B 0.575 <.001 0.629 <.001 0.643 <.001 0.699 <.001 PPP1R12A 0.647 <.001 0.683 0.002 0.782 0.023 0.784 0.030 PRIMAl 0.626 <.001 0.658 <.001 0.703 0.002 0.724 0.003 PRKCA 0.642 <.001 0.799 0.029 0.677 0.001 0.776 0.006 PRKCB 0.675 0.001 0.648 <.001 0.747 0.006 PROMI 0.603 0.018 0.659 0.014 0.493 0.008 PTCH1 0.680 0.001 0.753 0.010 0.789 0.018 PTEN 0.732 0.002 0.747 0.005 0.744 <.001 0.765 0.002 PTGS2 0.596 <.001 0.610 <.001 PTH1R 0.767 0.042 0.775 0.028 0.788 0.047 PTHLH 0.617 0.002 0.726 0.025 0.668 0.002 0.718 0.007 PTK2B 0.744 0.003 0.679 <.001 0.766 0.002 0.726 <.001 PTPN1 0.760 0.020 0.780 0.042 PYCARD 0.748 0.012 RAB27A 0.708 0.004

Table 4B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value RAB30 0.755 0.008 RAGE 0.817 0.048 RAPIB 0.818 0.050 RARB 0.757 0.007 0.677 <.001 0.789 0.007 0.746 0.003 RASSF1 0.816 0.035 RHOB 0.725 0.009 0.676 0.001 0.793 0.039 RLN1 0.742 0.033 0.762 0.040 RND3 0.636 <.001 0.647 <.001 RNF114 0.749 0.011 SDC2 0.721 0.004 SDHC 0.725 0.003 0.727 0.006 SEMA3A 0.757 0.024 0.721 0.010 SERPINA3 0.716 0.008 0.660 0.001 SERPINB5 0.747 0.031 0.616 0.002 SH3RF2 0.577 <.001 0.458 <.001 0.702 <.001 0.640 <.001 SLC22A3 0.565 <.001 0.540 <.001 0.747 0.004 0.756 0.007 SMAD4 0.546 <.001 0.573 <.001 0.636 <.001 0.627 <.001 SMARCD1 0.718 <.001 0.775 0.017 SMO 0.793 0.029 0.754 0.021 0.718 0.003 SODI 0.757 0.049 0.707 0.006 SORBS1 0.645 <.001 0.716 0.003 0.693 <.001 0.784 0.025 SPARCL1 0.821 0.028 0.829 0.014 0.781 0.030 SPDEF 0.778 <.001 SPINTI 0.732 0.009 0.842 0.026 SRC 0.647 <.001 0.632 <.001 SRD5A1 0.813 0.040 SRD5A2 0.489 <.001 0.533 <.001 0.544 <.001 0.611 <.001 ST5 0.713 0.002 0.783 0.011 0.725 <.001 0.827 0.025 STAT3 0.773 0.037 0.759 0.035 STAT5A 0.695 <.001 0.719 0.002 0.806 0.020 0.783 0.008 STAT5B 0.633 <.001 0.655 <.001 0.814 0.028 SUMO1 0.790 0.015 SVIL 0.659 <.001 0.713 0.002 0.711 0.002 0.779 0.010 TARP 0.800 0.040 TBP 0.761 0.010 TFF3 0.734 0.010 0.659 <.001 TGFB1Il 0.618 <.001 0.693 0.002 0.637 <.001 0.719 0.004 TGFB2 0.679 <.001 0.747 0.005 0.805 0.030 TGFB3 0.791 0.037 TGFBR2 0.778 0.035 TIMP3 0.751 0.011 TMPRSS2 0.745 0.003 0.708 <.001

Table 4B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value TNF 0.670 0.013 0.697 0.015 TNFRSF1OA 0.780 0.018 0.752 0.006 0.817 0.032 TNFRSF1OB 0.576 <.001 0.655 <.001 0.766 0.004 0.778 0.002 TNFRSF18 0.648 0.016 0.759 0.034 TNFSF1O 0.653 <.001 0.667 0.004 TP53 0.729 0.003 TP63 0.759 0.016 0.636 <.001 0.698 <.001 0.712 0.001 TPM1 0.778 0.048 0.743 0.012 0.783 0.032 0.811 0.046 TPM2 0.578 <.001 0.634 <.001 0.611 <.001 0.710 0.001 TPP2 0.775 0.037 TRAF3IP2 0.722 0.002 0.690 <.001 0.792 0.021 0.823 0.049 TRO 0.744 0.003 0.725 0.003 0.765 0.002 0.821 0.041 TUBB2A 0.639 <.001 0.625 <.001 TYMP 0.786 0.039 VCL 0.594 <.001 0.657 0.001 0.682 <.001 VEGFA 0.762 0.024 VEGFB 0.795 0.037 VIM 0.739 0.009 0.791 0.021 WDR19 0.776 0.015 WFDC1 0.746 <.001 YY1 0.683 0.001 0.728 0.002 ZFHX3 0.684 <.001 0.661 <.001 0.801 0.010 0.762 0.001 ZFP36 0.605 <.001 0.579 <.001 0.815 0.043 ZNF827 0.624 <.001 0.730 0.007 0.738 0.004 1

[00138] Tables 5A and 5B provide genes that were significantly associated (p<0.05), positively or negatively, with recurrence (cRFI, bRFI) after adjusting for AUA risk group in the primary and/or highest Gleason pattern. Increased expression of genes in Table 5A is negatively associated with good prognosis, while increased expression of genes in Table 5B is positively associated with good prognosis. Table 5A. Gene significantly (p<0.05) associated with cRFIor bRFI after adjustment for AUA risk group in the primary Gleason pattern or highest Gleason pattern with hazard ratio (HR) > 1.0 (increased expression negatively associated with good prognosis) Table 5A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value AKR1C3 1.315 0.018 1.283 0.024 ALOX12 1.198 0.024

Table 5A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value ANLN 1.406 <.001 1.519 <.001 1.485 <.001 1.632 <.001 AQP2 1.209 <.001 1.302 <.001 ASAP2 1.582 <.001 1.333 0.011 1.307 0.019 ASPN 1.872 <.001 1.741 <.001 1.638 <.001 1.691 <.001 ATP5E 1.309 0.042 1.369 0.012 BAG5 1.291 0.044 BAX 1.298 0.025 1.420 0.004 BGN 1.746 <.001 1.755 <.001 BIRC5 1.480 <.001 1.470 <.001 1.419 <.001 1.503 <.001 BMP6 1.536 <.001 1.815 <.001 1.294 0.033 1.429 0.001 BRCA2 1.184 0.037 BUBI 1.288 0.001 1.391 <.001 1.254 <.001 1.189 0.018 CACNAlD 1.313 0.029 CADPS 1.358 0.007 1.267 0.022 CASP3 1.251 0.037 CCNB1 1.261 0.033 1.318 0.005 CCNE2 1.345 0.005 1.438 <.001 1.606 <.001 1.426 <.001 CD276 1.482 0.002 1.668 <.001 1.451 <.001 1.302 0.011 CDC20 1.417 <.001 1.547 <.001 1.355 <.001 1.446 <.001 CDC6 1.340 0.011 1.265 0.046 1.367 0.002 1.272 0.025 CDH7 1.402 0.003 1.409 0.002 CDKN2B 1.553 <.001 1.746 <.001 1.340 0.014 1.369 0.006 CDKN2C 1.411 <.001 1.604 <.001 1.220 0.033 CDKN3 1.296 0.004 1.226 0.015 CENPF 1.434 0.002 1.570 <.001 1.633 <.001 1.610 <.001 CKS2 1.419 0.008 1.374 0.022 1.380 0.004 COL1A1 1.677 <.001 1.809 <.001 1.401 <.001 1.352 0.003 COL1A2 1.373 0.010 COL3A1 1.669 <.001 1.781 <.001 1.249 0.024 1.234 0.047 COL4A1 1.475 0.002 1.513 0.002 COL8A1 1.506 0.001 1.691 <.001 CRISP3 1.406 0.004 1.471 <.001 CTHRC1 1.426 0.009 1.793 <.001 1.311 0.019 CTNND2 1.462 <.001 DDIT4 1.478 0.003 1.783 <.001 1.236 0.039 DYNLL1 1.431 0.002 1.193 0.004 EIF3H 1.372 0.027 ENY2 1.325 0.023 1.270 0.017 ERG 1.303 0.041 EZH2 1.254 0.049 F2R 1.540 0.002 1.448 0.006 1.286 0.023 FADD 1.235 0.041 1.404 <.001

Table 5A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value FAP 1.386 0.015 1.440 0.008 1.253 0.048 FASN 1.303 0.028 FCGR3A 1.439 0.011 1.262 0.045 FGF5 1.289 0.006 GNPTAB 1.290 0.033 1.369 0.022 1.285 0.018 1.355 0.008 GPR68 1.396 0.005 GREMI 1.341 0.022 1.502 0.003 1.366 0.006 HDACl 1.329 0.016 HDAC9 1.378 0.012 HRAS 1.465 0.006 HSD17B4 1.442 <.001 1.245 0.028 IGFBP3 1.366 0.019 1.302 0.011 INHBA 2.000 <.001 2.336 <.001 1.486 0.002 JAGI 1.251 0.039 KCNN2 1.347 0.020 1.524 <.001 1.312 0.023 1.346 0.011 KHDRBS3 1.500 0.001 1.426 0.001 1.267 0.032 KIAA0196 1.272 0.028 KIF4A 1.199 0.022 1.262 0.004 KPNA2 1.252 0.016 LAMA3 1.332 0.004 1.356 0.010 LAMBI 1.317 0.028 LAMC1 1.516 0.003 1.302 0.040 1.397 0.007 LIMS1 1.261 0.027 LOX 1.265 0.016 1.372 0.001 LTBP2 1.477 0.002 LUM 1.321 0.020 MANF 1.647 <.001 1.284 0.027 MCM2 1.372 0.003 1.302 0.032 MCM3 1.269 0.047 MCM6 1.276 0.033 1.245 0.037 MELK 1.294 0.005 1.394 <.001 MK167 1.253 0.028 1.246 0.029 MMP11 1.557 <.001 1.290 0.035 1.357 0.005 MRPL13 1.275 0.003 MSH2 1.355 0.009 MYBL2 1.497 <.001 1.509 <.001 1.304 0.003 1.292 0.007 MYO6 1.367 0.010 NDRG1 1.270 0.042 1.314 0.025 NEK2 1.338 0.020 1.269 0.026 NETO2 1.434 0.004 1.303 0.033 1.283 0.012 NOX4 1.413 0.006 1.308 0.037 1.444 <.001 NRIP3 1.171 0.026

Table 5A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value NRP1 1.372 0.020 ODC1 1.450 <.001 OR51E1 1.559 <.001 1.413 0.008 PAK6 1.233 0.047 PATEl 1.262 <.001 1.375 <.001 1.143 0.034 1.191 0.036 PCNA 1.227 0.033 1.318 0.003 PEX1O 1.517 <.001 1.500 0.001 PGD 1.363 0.028 1.316 0.039 1.652 <.001 PGK1 1.224 0.034 1.206 0.024 PIM1 1.205 0.042 PLA2G7 1.298 0.018 1.358 0.005 PLAU 1.242 0.032 PLK1 1.464 0.001 1.299 0.018 1.275 0.031 PLOD2 1.206 0.039 1.261 0.025 POSTN 1.558 0.001 1.356 0.022 1.363 0.009 PPP3CA 1.445 0.002 PSMD13 1.301 0.017 1.411 0.003 PTK2 1.318 0.031 PTK6 1.582 <.001 1.894 <.001 1.290 0.011 1.354 0.003 PTTG1 1.319 0.004 1.430 <.001 1.271 0.006 1.492 <.001 RAD21 1.278 0.028 1.435 0.004 1.326 0.008 RAFI 1.504 <.001 RALA 1.374 0.028 1.459 0.001 RGS7 1.203 0.031 RRM1 1.535 0.001 1.525 <.001 RRM2 1.302 0.003 1.197 0.047 1.342 <.001 SATI 1.374 0.043 SDC1 1.344 0.011 1.473 0.008 SEC14L1 1.297 0.006 SESN3 1.337 0.002 1.495 <.001 1.223 0.038 SFRP4 1.610 <.001 1.542 0.002 1.370 0.009 SHMT2 1.567 0.001 1.522 <.001 1.485 0.001 1.370 <.001 SKIL 1.303 0.008 SLC25A21 1.287 0.020 1.306 0.017 SLC44A1 1.308 0.045 SNRPB2 1.304 0.018 SOX4 1.252 0.031 SPARC 1.445 0.004 1.706 <.001 1.269 0.026 SPP1 1.376 0.016 SQLE 1.417 0.007 1.262 0.035 STATI 1.209 0.029 STMN1 1.315 0.029

Table 5A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value SULFI 1.504 0.001 TAF2 1.252 0.048 1.301 0.019 TFDP1 1.395 0.010 1.424 0.002 THBS2 1.716 <.001 1.719 <.001 THY1 1.343 0.035 1.575 0.001 TK1 1.320 <.001 1.304 <.001 TOP2A 1.464 0.001 1.688 <.001 1.715 <.001 1.761 <.001 TPD52 1.286 0.006 1.258 0.023 TPX2 1.644 <.001 1.964 <.001 1.699 <.001 1.754 <.001 TYMS 1.315 0.014 UBE2C 1.270 0.019 1.558 <.001 1.205 0.027 1.333 <.001 UBE2G1 1.302 0.041 UBE2T 1.451 <.001 1.309 0.003 UGT2B15 1.222 0.025 UHRF1 1.370 0.003 1.520 <.001 1.247 0.020 VCPIP1 1.332 0.015 VTI1B 1.237 0.036 XIAP 1.486 0.008 ZMYND8 1.408 0.007 ZNF3 1.284 0.018 ZWINT 1.289 0.028 1 Table 5B. Genes significantly (p<0.05) associated with cRFI or bRFI after adjustment for AUA risk group in the primary Gleason pattern or highest Gleason pattern with hazard ratio (HR) < 1.0 (increased expression is positively associated with good prognosis) Table 5B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value AAMP 0.535 <.001 0.581 <.001 0.700 0.002 0.759 0.006 ABCA5 0.798 0.007 0.745 0.002 0.841 0.037 ABCC1 0.800 0.044 ABCC4 0.787 0.022 ABHD2 0.768 0.023 ACOX2 0.678 0.002 0.749 0.027 0.759 0.004 ADH5 0.645 <.001 0.672 0.001 AGTR1 0.780 0.030 AKAPI 0.815 0.045 0.758 <.001 AKT1 0.732 0.010 ALDH1A2 0.646 <.001 0.548 <.001 0.671 <.001 0.713 0.001 ANPEP 0.641 <.001 0.535 <.001

Table 5B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value ANXA2 0.772 0.035 0.804 0.046 ATXN1 0.654 <.001 0.754 0.020 0.797 0.017 AURKA 0.788 0.030 AXIN2 0.744 0.005 0.655 <.001 AZGP1 0.656 <.001 0.676 <.001 0.754 0.001 0.791 0.004 BAD 0.700 0.004 BINI 0.650 <.001 0.764 0.013 0.803 0.015 BTG3 0.836 0.025 BTRC 0.730 0.005 C7 0.617 <.001 0.680 <.001 0.667 <.001 0.755 0.005 CADMI 0.559 <.001 0.566 <.001 0.772 0.020 0.802 0.046 CASPI 0.781 0.030 0.779 0.021 0.818 0.027 0.828 0.036 CAVI 0.775 0.034 CAV2 0.677 0.019 CCL2 0.752 0.023 CCNH 0.679 <.001 0.682 <.001 CD164 0.721 0.002 0.724 0.005 CD1A 0.710 0.014 CD44 0.591 <.001 0.642 <.001 CD82 0.779 0.021 0.771 0.024 CDC25B 0.778 0.035 0.818 0.023 CDK14 0.788 0.011 CDK3 0.752 0.012 0.779 0.005 0.841 0.020 CDKN1A 0.770 0.049 0.712 0.014 CDKN1C 0.684 <.001 0.697 <.001 CHN1 0.772 0.031 COL6A1 0.648 <.001 0.807 0.046 0.768 0.004 CSF1 0.621 <.001 0.671 0.001 CTNNB1 0.905 0.008 CTSB 0.754 0.030 0.716 0.011 0.756 0.014 CXCL12 0.641 <.001 0.796 0.038 0.708 <.001 CYP3A5 0.503 <.001 0.528 <.001 0.791 0.028 CYR61 0.639 0.001 0.659 0.001 0.797 0.048 DARC 0.707 0.004 DDR2 0.750 0.011 DES 0.657 <.001 0.758 0.022 0.699 <.001 DHRS9 0.625 0.002 DHX9 0.846 <.001 DIAPHI 0.682 0.007 0.723 0.008 0.780 0.026 DLC1 0.703 0.005 0.702 0.008 DLGAP1 0.703 0.008 0.636 <.001 DNM3 0.701 0.001 0.817 0.042

Table 5B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value DPP4 0.686 <.001 0.716 0.001 DPT 0.636 <.001 0.633 <.001 0.709 0.006 0.773 0.024 DUSPI 0.683 0.006 0.679 0.003 DUSP6 0.694 0.003 0.605 <.001 EDNI 0.773 0.031 EDNRA 0.716 0.007 EGRI 0.575 <.001 0.575 <.001 0.771 0.014 EGR3 0.633 0.002 0.643 <.001 0.792 0.025 EIF4E 0.722 0.002 ELK4 0.710 0.009 0.759 0.027 ENPP2 0.786 0.039 EPHA2 0.593 0.001 EPHA3 0.739 0.006 0.802 0.020 ERBB2 0.753 0.007 ERBB3 0.753 0.009 0.753 0.015 ERCC1 0.727 0.001 EREG 0.722 0.012 0.769 0.040 ESRI 0.742 0.015 FABP5 0.756 0.032 FAM107A 0.524 <.001 0.579 <.001 0.688 <.001 0.699 0.001 FAM13C 0.639 <.001 0.601 <.001 0.810 0.019 0.709 <.001 FAS 0.770 0.033 FASLG 0.716 0.028 0.683 0.017 FGF10 0.798 0.045 FGF17 0.718 0.018 0.793 0.024 0.790 0.024 FGFR2 0.739 0.007 0.783 0.038 0.740 0.004 FGFR4 0.746 0.050 FKBP5 0.689 0.003 FLNA 0.701 0.006 0.766 0.029 0.768 0.037 FLNC 0.755 <.001 0.820 0.022 FLT1 0.729 0.008 FOS 0.572 <.001 0.536 <.001 0.750 0.005 FOXQ1 0.778 0.033 0.820 0.018 FYN 0.708 0.006 GADD45B 0.577 <.001 0.589 <.001 GDF15 0.757 0.013 0.743 0.006 GHR 0.712 0.004 0.679 0.001 GNRH1 0.791 0.048 GPM6B 0.675 <.001 0.660 <.001 0.735 <.001 0.823 0.049 GSK3B 0.783 0.042 GSN 0.587 <.001 0.705 0.002 0.745 0.004 0.796 0.021 GSTM1 0.686 0.001 0.631 <.001 0.807 0.018

Table 5B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value GSTM2 0.607 <.001 0.683 <.001 0.679 <.001 0.800 0.027 HIRIP3 0.692 <.001 0.782 0.007 HK1 0.724 0.002 0.718 0.002 HLF 0.580 <.001 0.571 <.001 0.759 0.008 0.750 0.004 HNF1B 0.669 <.001 HPS1 0.764 0.008 HSD17B1O 0.802 0.045 HSD17B2 0.723 0.048 HSD3B2 0.709 0.010 HSP90AB1 0.780 0.034 0.809 0.041 HSPA5 0.738 0.017 HSPB1 0.770 0.006 0.801 0.032 HSPB2 0.788 0.035 ICAMI 0.728 0.015 0.716 0.010 IER3 0.735 0.016 0.637 <.001 0.802 0.035 IFITI 0.647 <.001 0.755 0.029 IGF1 0.675 <.001 0.603 <.001 0.762 0.006 0.770 0.030 IGF2 0.761 0.011 IGFBP2 0.601 <.001 0.605 <.001 IGFBP5 0.702 <.001 IGFBP6 0.628 <.001 0.726 0.003 ILIB 0.676 0.002 0.716 0.004 IL6 0.688 0.005 0.766 0.044 IL6R 0.786 0.036 IL6ST 0.618 <.001 0.639 <.001 0.785 0.027 0.813 0.042 IL8 0.635 <.001 0.628 <.001 ILK 0.734 0.018 0.753 0.026 ING5 0.684 <.001 0.681 <.001 0.756 0.006 ITGA4 0.778 0.040 ITGA5 0.762 0.026 ITGA6 0.811 0.038 ITGA7 0.592 <.001 0.715 0.006 0.710 0.002 ITGAD 0.576 0.006 ITGB4 0.693 0.003 ITPR1 0.789 0.029 JUN 0.572 <.001 0.581 <.001 0.777 0.019 JUNB 0.732 0.030 0.707 0.016 KCTD12 0.758 0.036 KIT 0.691 0.009 0.738 0.028 KLC1 0.741 0.024 0.781 0.024 KLF6 0.733 0.018 0.727 0.014 KLK1 0.744 0.028

Table 5B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value KLK2 0.697 0.002 0.679 <.001 KLK3 0.725 <.001 0.715 <.001 0.841 0.023 KRT15 0.660 <.001 0.577 <.001 0.750 0.002 KRT18 0.623 <.001 0.642 <.001 0.702 <.001 0.760 0.006 KRT2 0.740 0.044 KRT5 0.674 <.001 0.588 <.001 0.769 0.005 KRT8 0.768 0.034 LICAM 0.737 0.036 LAG3 0.711 0.013 0.748 0.029 LAMA4 0.649 0.009 LAMB3 0.709 0.002 0.684 0.006 0.768 0.006 LGALS3 0.652 <.001 0.752 0.015 0.805 0.028 LIG3 0.728 0.016 0.667 <.001 LRP1 0.811 0.043 MDM2 0.788 0.033 MGMT 0.645 <.001 0.766 0.015 MICA 0.796 0.043 0.676 <.001 MPPED2 0.675 <.001 0.616 <.001 0.750 0.006 MRCl 0.788 0.028 MTSS1 0.654 <.001 0.793 0.036 MYBPC1 0.706 <.001 0.534 <.001 0.773 0.004 0.692 <.001 NCAPD3 0.658 <.001 0.566 <.001 0.753 0.011 0.733 0.009 NCOR1 0.838 0.045 NEXN 0.748 0.025 0.785 0.020 NFAT5 0.531 <.001 0.626 <.001 NFATC2 0.759 0.024 OAZ1 0.766 0.024 OLFML3 0.648 <.001 0.748 0.005 0.639 <.001 0.675 <.001 OR51E2 0.823 0.034 PAGE4 0.599 <.001 0.698 0.002 0.606 <.001 0.726 <.001 PCA3 0.705 <.001 0.647 <.001 PCDHGB7 0.712 <.001 PGF 0.790 0.039 PLG 0.764 0.048 PLP2 0.766 0.037 PPAP2B 0.589 <.001 0.647 <.001 0.691 <.001 0.765 0.013 PPP1R12A 0.673 0.001 0.677 0.001 0.807 0.045 PRIMAl 0.622 <.001 0.712 0.008 0.740 0.013 PRKCA 0.637 <.001 0.694 <.001 PRKCB 0.741 0.020 0.664 <.001 PROMI 0.599 0.017 0.527 0.042 0.610 0.006 0.420 0.002 PTCH1 0.752 0.027 0.762 0.011

Table 5B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value PTEN 0.779 0.011 0.802 0.030 0.788 0.009 PTGS2 0.639 <.001 0.606 <.001 PTHLH 0.632 0.007 0.739 0.043 0.654 0.002 0.740 0.015 PTK2B 0.775 0.019 0.831 0.028 0.810 0.017 PTPN1 0.721 0.012 0.737 0.024 PYCARD 0.702 0.005 RAB27A 0.736 0.008 RAB30 0.761 0.011 RARB 0.746 0.010 RASSF1 0.805 0.043 RHOB 0.755 0.029 0.672 0.001 RLN1 0.742 0.036 0.740 0.036 RND3 0.607 <.001 0.633 <.001 RNF114 0.782 0.041 0.747 0.013 SDC2 0.714 0.002 SDHC 0.698 <.001 0.762 0.029 SERPINA3 0.752 0.030 SERPINB5 0.669 0.014 SH3RF2 0.705 0.012 0.568 <.001 0.755 0.016 SLC22A3 0.650 <.001 0.582 <.001 SMAD4 0.636 <.001 0.684 0.002 0.741 0.007 0.738 0.007 SMARCD1 0.757 0.001 SMO 0.790 0.049 0.766 0.013 SODI 0.741 0.037 0.713 0.007 SORBS1 0.684 0.003 0.732 0.008 0.788 0.049 SPDEF 0.840 0.012 SPINTI 0.837 0.048 SRC 0.674 <.001 0.671 <.001 SRD5A2 0.553 <.001 0.588 <.001 0.618 <.001 0.701 <.001 ST5 0.747 0.012 0.761 0.010 0.780 0.016 0.832 0.041 STAT3 0.735 0.020 STAT5A 0.731 0.005 0.743 0.009 0.817 0.027 STAT5B 0.708 <.001 0.696 0.001 SUMO1 0.815 0.037 SVIL 0.689 0.003 0.739 0.008 0.761 0.011 TBP 0.792 0.037 TFF3 0.719 0.007 0.664 0.001 TGFB1Il 0.676 0.003 0.707 0.007 0.709 0.005 0.777 0.035 TGFB2 0.741 0.010 0.785 0.017 TGFBR2 0.759 0.022 TIMP3 0.785 0.037 TMPRSS2 0.780 0.012 0.742 <.001

Table 5B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value TNF 0.654 0.007 0.682 0.006 TNFRSF1O 0.623 <.001 0.681 <.001 0.801 0.018 0.815 0.019 B TNFSF1O 0.721 0.004 TP53 0.759 0.011 TP63 0.737 0.020 0.754 0.007 TPM2 0.609 <.001 0.671 <.001 0.673 <.001 0.789 0.031 TRAF3IP2 0.795 0.041 0.727 0.005 TRO 0.793 0.033 0.768 0.027 0.814 0.023 TUBB2A 0.626 <.001 0.590 <.001 VCL 0.613 <.001 0.701 0.011 VIM 0.716 0.005 0.792 0.025 WFDC1 0.824 0.029 YY1 0.668 <.001 0.787 0.014 0.716 0.001 0.819 0.011 ZFHX3 0.732 <.001 0.709 <.001 ZFP36 0.656 0.001 0.609 <.001 0.818 0.045 ZNF827 0.750 0.022 _ I 1 1

[00139] Tables 6A and 6B provide genes that were significantly associated (p<0.05), positively or negatively, with recurrence (cRFI, bRFI) after adjusting for Gleason pattern in the primary and/or highest Gleason pattern. Increased expression of genes in Table 6A is negatively associated with good prognosis, while increased expression of gene in Table 6B is positively associated with good prognosis. Table 6A. Genes significantly (p<0.05) associated with cRFIor bRFI after adjustment for Gleason pattern in the primary Gleason pattern or highest Gleason pattern with a hazard ratio (HR) > 1.0 (increased expression is negatively associated with good prognosis) Table 6A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value AKR1C3 1.258 0.039 ANLN 1.292 0.023 1.449 <.001 1.420 0.001 AQP2 1.178 0.008 1.287 <.001 ASAP2 1.396 0.015 ASPN 1.809 <.001 1.508 0.009 1.506 0.002 1.438 0.002 BAG5 1.367 0.012 BAX 1.234 0.044 BGN 1.465 0.009 1.342 0.046 BIRC5 1.338 0.008 1.364 0.004 1.279 0.006

Table 6A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value BMP6 1.369 0.015 1.518 0.002 BUBI 1.239 0.024 1.227 0.001 1.236 0.004 CACNAlD 1.337 0.025 CADPS 1.280 0.029 CCNE2 1.256 0.043 1.577 <.001 1.324 0.001 CD276 1.320 0.029 1.396 0.007 1.279 0.033 CDC20 1.298 0.016 1.334 0.002 1.257 0.032 1.279 0.003 CDH7 1.258 0.047 1.338 0.013 CDKN2B 1.342 0.032 1.488 0.009 CDKN2C 1.344 0.010 1.450 <.001 CDKN3 1.284 0.012 CENPF 1.289 0.048 1.498 0.001 1.344 0.010 COL1A1 1.481 0.003 1.506 0.002 COL3A1 1.459 0.004 1.430 0.013 COL4A1 1.396 0.015 COL8A1 1.413 0.008 CRISP3 1.346 0.012 1.310 0.025 CTHRC1 1.588 0.002 DDIT4 1.363 0.020 1.379 0.028 DICERI 1.294 0.008 ENY2 1.269 0.024 FADD 1.307 0.010 FAS 1.243 0.025 FGF5 1.328 0.002 GNPTAB 1.246 0.037 GREMI 1.332 0.024 1.377 0.013 1.373 0.011 HDACl 1.301 0.018 1.237 0.021 HSD17B4 1.277 0.011 IFN-y 1.219 0.048 IMMT 1.230 0.049 INHBA 1.866 <.001 1.944 <.001 JAGI 1.298 0.030 KCNN2 1.378 0.020 1.282 0.017 KHDRBS3 1.353 0.029 1.305 0.014 LAMA3 1.344 <.001 1.232 0.048 LAMC1 1.396 0.015 LIMS1 1.337 0.004 LOX 1.355 0.001 1.341 0.002 LTBP2 1.304 0.045 MAGEA4 1.215 0.024 MANF 1.460 <.001 MCM6 1.287 0.042 1.214 0.046

Table 6A cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value MELK 1.329 0.002 MMP11 1.281 0.050 MRPL13 1.266 0.021 MYBL2 1.453 <.001 1.274 0.019 MYC 1.265 0.037 MYO6 1.278 0.047 NETO2 1.322 0.022 NFKB1 1.255 0.032 NOX4 1.266 0.041 OR51E1 1.566 <.001 1.428 0.003 PATEl 1.242 <.001 1.347 <.001 1.177 0.011 PCNA 1.251 0.025 PEX1O 1.302 0.028 PGD 1.335 0.045 1.379 0.014 1.274 0.025 PIM1 1.254 0.019 PLA2G7 1.289 0.025 1.250 0.031 PLAU 1.267 0.031 PSMD13 1.333 0.005 PTK6 1.432 <.001 1.577 <.001 1.223 0.040 PTTG1 1.279 0.013 1.308 0.006 RAGE 1.329 0.011 RALA 1.363 0.044 1.471 0.003 RGS7 1.120 0.040 1.173 0.031 RRM1 1.490 0.004 1.527 <.001 SESN3 1.353 0.017 SFRP4 1.370 0.025 SHMT2 1.460 0.008 1.410 0.006 1.407 0.008 1.345 <.001 SKIL 1.307 0.025 SLC25A21 1.414 0.002 1.330 0.004 SMARCC2 1.219 0.049 SPARC 1.431 0.005 TFDP1 1.283 0.046 1.345 0.003 THBS2 1.456 0.005 1.431 0.012 TK1 1.214 0.015 1.222 0.006 TOP2A 1.367 0.018 1.518 0.001 1.480 <.001 TPX2 1.513 0.001 1.607 <.001 1.588 <.001 1.481 <.001 UBE2T 1.409 0.002 1.285 0.018 UGT2B15 1.216 0.009 1.182 0.021 XIAP 1.336 0.037 1.194 0.043

Table 6B. Genes significantly (p<0.05) associated with cRFI or bRFI after adjustment for Gleason pattern in the primary Gleason pattern or highest Gleason pattern with hazard ration (HR) < 1.0 (increased expression is positively associated with good prognosis) Table 6B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value AAMP 0.660 0.001 0.675 <.001 0.836 0.045 ABCA5 0.807 0.014 0.737 <.001 0.845 0.030 ABCC1 0.780 0.038 0.794 0.015 ABCG2 0.807 0.035 ABHD2 0.720 0.002 ADH5 0.750 0.034 AKAPI 0.721 <.001 ALDH1A2 0.735 0.009 0.592 <.001 0.756 0.007 0.781 0.021 ANGPT2 0.741 0.036 ANPEP 0.637 <.001 0.536 <.001 ANXA2 0.762 0.044 APOE 0.707 0.013 APRT 0.727 0.004 0.771 0.006 ATXN1 0.725 0.013 AURKA 0.784 0.037 0.735 0.003 AXIN2 0.744 0.004 0.630 <.001 AZGP1 0.672 <.001 0.720 <.001 0.764 0.001 BAD 0.687 <.001 BAKI 0.783 0.014 BCL2 0.777 0.033 0.772 0.036 BIK 0.768 0.040 BINI 0.691 <.001 BTRC 0.776 0.029 C7 0.707 0.004 0.791 0.024 CADMI 0.587 <.001 0.593 <.001 CASPI 0.773 0.023 0.820 0.025 CAVI 0.753 0.014 CAV2 0.627 0.009 0.682 0.003 CCL2 0.740 0.019 CCNH 0.736 0.003 CCR1 0.755 0.022 CD1A 0.740 0.025 CD44 0.590 <.001 0.637 <.001 CD68 0.757 0.026 CD82 0.778 0.012 0.759 0.016 CDC25B 0.760 0.021 CDK3 0.762 0.024 0.774 0.007 CDKN1A 0.714 0.015

Table 6B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value CDKN1C 0.738 0.014 0.768 0.021 COL6A1 0.690 <.001 0.805 0.048 CSF1 0.675 0.002 0.779 0.036 CSK 0.825 0.004 CTNNB1 0.884 0.045 0.888 0.027 CTSB 0.740 0.017 0.676 0.003 0.755 0.010 CTSD 0.673 0.031 0.722 0.009 CTSK 0.804 0.034 CTSL2 0.748 0.019 CXCL12 0.731 0.017 CYP3A5 0.523 <.001 0.518 <.001 CYR61 0.744 0.041 DAP 0.755 0.011 DARC 0.763 0.029 DDR2 0.813 0.041 DES 0.743 0.020 DHRS9 0.606 0.001 DHX9 0.916 0.021 DIAPHI 0.749 0.036 0.688 0.003 DLGAP1 0.758 0.042 0.676 0.002 DLL4 0.779 0.010 DNM3 0.732 0.007 DPP4 0.732 0.004 0.750 0.014 DPT 0.704 0.014 DUSP6 0.662 <.001 0.665 0.001 EBNA1BP2 0.828 0.019 EDNRA 0.782 0.048 EGF 0.712 0.023 EGRI 0.678 0.004 0.725 0.028 EGR3 0.680 0.006 0.738 0.027 EIF2C2 0.789 0.032 EIF2S3 0.759 0.012 ELK4 0.745 0.024 EPHA2 0.661 0.007 EPHA3 0.781 0.026 0.828 0.037 ERBB2 0.791 0.022 0.760 0.014 0.789 0.006 ERBB3 0.757 0.009 ERCC1 0.760 0.008 ESRI 0.742 0.014 ESR2 0.711 0.038 ETV4 0.714 0.035 FAM107A 0.619 <.001 0.710 0.011 0.781 0.019

Table 6B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value FAM13C 0.664 <.001 0.686 <.001 0.813 0.014 FAM49B 0.670 <.001 0.793 0.014 0.815 0.044 0.843 0.047 FASLG 0.616 0.004 0.813 0.038 FGF1O 0.751 0.028 0.766 0.019 FGF17 0.718 0.031 0.765 0.019 FGFR2 0.740 0.009 0.738 0.002 FKBP5 0.749 0.031 FLNC 0.826 0.029 FLT1 0.779 0.045 0.729 0.006 FLT4 0.815 0.024 FOS 0.657 0.003 0.656 0.004 FSD1 0.763 0.017 FYN 0.716 0.004 0.792 0.024 GADD45B 0.692 0.009 0.697 0.010 GDF15 0.767 0.016 GHR 0.701 0.002 0.704 0.002 0.640 <.001 GNRH1 0.778 0.039 GPM6B 0.749 0.010 0.750 0.010 0.827 0.037 GRB7 0.696 0.005 GSK3B 0.726 0.005 GSN 0.660 <.001 0.752 0.019 GSTM1 0.710 0.004 0.676 <.001 GSTM2 0.643 <.001 0.767 0.015 HK1 0.798 0.035 HLA-G 0.660 0.013 HLF 0.644 <.001 0.727 0.011 HNF1B 0.755 0.013 HPS1 0.756 0.006 0.791 0.043 HSD17B1O 0.737 0.006 HSD3B2 0.674 0.003 HSP90AB1 0.763 0.015 HSPB1 0.787 0.020 0.778 0.015 HSPE1 0.794 0.039 ICAMI 0.664 0.003 IER3 0.699 0.003 0.693 0.010 IFITI 0.621 <.001 0.733 0.027 IGF1 0.751 0.017 0.655 <.001 IGFBP2 0.599 <.001 0.605 <.001 IGFBP5 0.745 0.007 0.775 0.035 IGFBP6 0.671 0.005 ILIB 0.732 0.016 0.717 0.005 IL6 0.763 0.040

Table 6B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value IL6R 0.764 0.022 IL6ST 0.647 <.001 0.739 0.012 IL8 0.711 0.015 0.694 0.006 ING5 0.729 0.007 0.727 0.003 ITGA4 0.755 0.009 ITGA5 0.743 0.018 0.770 0.034 ITGA6 0.816 0.044 0.772 0.006 ITGA7 0.680 0.004 ITGAD 0.590 0.009 ITGB4 0.663 <.001 0.658 <.001 0.759 0.004 JUN 0.656 0.004 0.639 0.003 KIAA0196 0.737 0.011 KIT 0.730 0.021 0.724 0.008 KLC1 0.755 0.035 KLK1 0.706 0.008 KLK2 0.740 0.016 0.723 0.001 KLK3 0.765 0.006 0.740 0.002 KRT1 0.774 0.042 KRT15 0.658 <.001 0.632 <.001 0.764 0.008 KRT18 0.703 0.004 0.672 <.001 0.779 0.015 0.811 0.032 KRT5 0.686 <.001 0.629 <.001 0.802 0.023 KRT8 0.763 0.034 0.771 0.022 LICAM 0.748 0.041 LAG3 0.693 0.008 0.724 0.020 LAMA4 0.689 0.039 LAMB3 0.667 <.001 0.645 <.001 0.773 0.006 LGALS3 0.666 <.001 0.822 0.047 LIG3 0.723 0.008 LRP1 0.777 0.041 0.769 0.007 MDM2 0.688 <.001 MET 0.709 0.010 0.736 0.028 0.715 0.003 MGMT 0.751 0.031 MICA 0.705 0.002 MPPED2 0.690 0.001 0.657 <.001 0.708 <.001 MRCl 0.812 0.049 MSH6 0.860 0.049 MTSS1 0.686 0.001 MVP 0.798 0.034 0.761 0.033 MYBPC1 0.754 0.009 0.615 <.001 NCAPD3 0.739 0.021 0.664 0.005 NEXN 0.798 0.037 NFAT5 0.596 <.001 0.732 0.005

Table 6B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value NFATC2 0.743 0.016 0.792 0.047 NOS3 0.730 0.012 0.757 0.032 OAZ1 0.732 0.020 0.705 0.002 OCLN 0.746 0.043 0.784 0.025 OLFML3 0.711 0.002 0.709 <.001 0.720 0.001 OMD 0.729 0.011 0.762 0.033 OSM 0.813 0.028 PAGE4 0.668 0.003 0.725 0.004 0.688 <.001 0.766 0.005 PCA3 0.736 0.001 0.691 <.001 PCDHGB7 0.769 0.019 0.789 0.022 PIK3CA 0.768 0.010 PIK3CG 0.792 0.019 0.758 0.009 PLG 0.682 0.009 PPAP2B 0.688 0.005 0.815 0.046 PPP1R12A 0.731 0.026 0.775 0.042 PRIMAl 0.697 0.004 0.757 0.032 PRKCA 0.743 0.019 PRKCB 0.756 0.036 0.767 0.029 PROMI 0.640 0.027 0.699 0.034 0.503 0.013 PTCH1 0.730 0.018 PTEN 0.779 0.015 0.789 0.007 PTGS2 0.644 <.001 0.703 0.007 PTHLH 0.655 0.012 0.706 0.038 0.634 0.001 0.665 0.003 PTK2B 0.779 0.023 0.702 0.002 0.806 0.015 0.806 0.024 PYCARD 0.659 0.001 RAB30 0.779 0.033 0.754 0.014 RARB 0.787 0.043 0.742 0.009 RASSF1 0.754 0.005 RHOA 0.796 0.041 0.819 0.048 RND3 0.721 0.011 0.743 0.028 SDC1 0.707 0.011 SDC2 0.745 0.002 SDHC 0.750 0.013 SERPINA3 0.730 0.016 SERPINB5 0.715 0.041 SH3RF2 0.698 0.025 SIPA1LI 0.796 0.014 0.820 0.004 SLC22A3 0.724 0.014 0.700 0.008 SMAD4 0.668 0.002 0.771 0.016 SMARCD1 0.726 <.001 0.700 0.001 0.812 0.028 SMO 0.785 0.027 SODI 0.735 0.012

Table 6B cRFI cRFI bRFI bRFI Primary Pattern Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HR p-value SORBS1 0.785 0.039 SPDEF 0.818 0.002 SPINTI 0.761 0.024 0.773 0.006 SRC 0.709 <.001 0.690 <.001 SRD5A1 0.746 0.010 0.767 0.024 0.745 0.003 SRD5A2 0.575 <.001 0.669 0.001 0.674 <.001 0.781 0.018 ST5 0.774 0.027 STATI 0.694 0.004 STAT5A 0.719 0.004 0.765 0.006 0.834 0.049 STAT5B 0.704 0.001 0.744 0.012 SUMO1 0.777 0.014 SVIL 0.771 0.026 TBP 0.774 0.031 TFF3 0.742 0.015 0.719 0.024 TGFBIll 0.763 0.048 TGFB2 0.729 0.011 0.758 0.002 TMPRSS2 0.810 0.034 0.692 <.001 TNF 0.727 0.022 TNFRSF1OA 0.805 0.025 TNFRSF1OB 0.581 <.001 0.738 0.014 0.809 0.034 TNFSF1O 0.751 0.015 0.700 <.001 TP63 0.723 0.018 0.736 0.003 TPM2 0.708 0.010 0.734 0.014 TRAF3IP2 0.718 0.004 TRO 0.742 0.012 TSTA3 0.774 0.028 TUBB2A 0.659 <.001 0.650 <.001 TYMP 0.695 0.002 VCL 0.683 0.008 ViM 0.778 0.040 WDR19 0.775 0.014 XRCC5 0.793 0.042 YY1 0.751 0.025 0.810 0.008 ZFHX3 0.760 0.005 0.726 0.001 ZFP36 0.707 0.008 0.672 0.003 ZNF827 0.667 0.002 0.792 0.039

[00140] Tables 7A and 7B provide genes significantly associated (p<0.05), positively or negatively, with clinical recurrence (cRFI) in negative TMPRSS fusion specimens in the primary or highest Gleason pattern specimen. Increased expression of genes in Table 7A is negatively associated with good prognosis, while increased expression of genes in Table 7B is positively associated with good prognosis. Table 7A. Genes significantly (p<0.05) associated with cRFI for TMPRSS2-ERG fusion negative in the primary Gleason pattern or highest Gleason pattern with hazard ratio (HR) > 1.0 (increased expression is negatively associated with good prognosis) Table 7A Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value ANLN 1.42 0.012 1.36 0.004 AQP2 1.25 0.033 ASPN 2.48 <.001 1.65 <.001 BGN 2.04 <.001 1.45 0.007 BIRC5 1.59 <.001 1.37 0.005 BMP6 1.95 <.001 1.43 0.012 BMPR1B 1.93 0.002 BUBI 1.51 <.001 1.35 <.001 CCNE2 1.48 0.007 CD276 1.93 <.001 1.79 <.001 CDC20 1.49 0.004 1.47 <.001 CDC6 1.52 0.009 1.34 0.022 CDKN2B 1.54 0.008 1.55 0.003 CDKN2C 1.55 0.003 1.57 <.001 CDKN3 1.34 0.026 CENPF 1.63 0.002 1.33 0.018 CKS2 1.50 0.026 1.43 0.009 CLTC 1.46 0.014 COL1A1 1.98 <.001 1.50 0.002 COL3A1 2.03 <.001 1.42 0.007 COL4A1 1.81 0.002 COL8A1 1.63 0.004 1.60 0.001 CRISP3 1.31 0.016 CTHRC1 1.67 0.006 1.48 0.005 DDIT4 1.49 0.037 ENY2 1.29 0.039 EZH2 1.35 0.016 F2R 1.46 0.034 1.46 0.007 FAP 1.66 0.006 1.38 0.012 FGF5 1.46 0.001 GNPTAB 1.49 0.013 HSD17B4 1.34 0.039 1.44 0.002 INHBA 2.92 <.001 2.19 <.001 JAGI 1.38 0.042 KCNN2 1.71 0.002 1.73 <.001 KHDRBS3 1.46 0.015 KLK14 1.28 0.034

Table 7A Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value KPNA2 1.63 0.016 LAMC1 1.41 0.044 LOX 1.29 0.036 LTBP2 1.57 0.017 MELK 1.38 0.029 MMP11 1.69 0.002 1.42 0.004 MYBL2 1.78 <.001 1.49 <.001 NETO2 2.01 <.001 1.43 0.007 NME1 1.38 0.017 PATEl 1.43 <.001 1.24 0.005 PEX1O 1.46 0.030 PGD 1.77 0.002 POSTN 1.49 0.037 1.34 0.026 PPFIA3 1.51 0.012 PPP3CA 1.46 0.033 1.34 0.020 PTK6 1.69 <.001 1.56 <.001 PTTG1 1.35 0.028 RAD51 1.32 0.048 RALBP1 1.29 0.042 RGS7 1.18 0.012 1.32 0.009 RRM1 1.57 0.016 1.32 0.041 RRM2 1.30 0.039 SATI 1.61 0.007 SESN3 1.76 <.001 1.36 0.020 SFRP4 1.55 0.016 1.48 0.002 SHMT2 2.23 <.001 1.59 <.001 SPARC 1.54 0.014 SQLE 1.86 0.003 STMN1 2.14 <.001 THBS2 1.79 <.001 1.43 0.009 TK1 1.30 0.026 TOP2A 2.03 <.001 1.47 0.003 TPD52 1.63 0.003 TPX2 2.11 <.001 1.63 <.001 TRAPI 1.46 0.023 UBE2C 1.57 <.001 1.58 <.001 UBE2G1 1.56 0.008 UBE2T 1.75 <.001 UGT2B15 1.31 0.036 1.33 0.004 UHRF1 1.46 0.007 UTP23 1.52 0.017

Table 7B. Genes significantly (p<0.05) associated with cRFI for TMPRSS2-ERG fusion negative in the primary Gleason pattern or highest Gleason pattern with hazard ratio (HR) < 1.0 (increased expression is positively associated with good prognosis) Table 7B Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value AAMP 0.56 <.001 0.65 0.001 ABCA5 0.64 <.001 0.71 <.001 ABCB1 0.62 0.004 ABCC3 0.74 0.031 ABCG2 0.78 0.050 ABHD2 0.71 0.035 ACOX2 0.54 <.001 0.71 0.007 ADH5 0.49 <.001 0.61 <.001 AKAPI 0.77 0.031 0.76 0.013 AKR1C1 0.65 0.006 0.78 0.044 AKT1 0.72 0.020 AKT3 0.75 <.001 ALDH1A2 0.53 <.001 0.60 <.001 AMPD3 0.62 <.001 0.78 0.028 ANPEP 0.54 <.001 0.61 <.001 ANXA2 0.63 0.008 0.74 0.016 ARHGAP29 0.67 0.005 0.77 0.016 ARHGDIB 0.64 0.013 ATP5J 0.57 0.050 ATXN1 0.61 0.004 0.77 0.043 AXIN2 0.51 <.001 0.62 <.001 AZGP1 0.61 <.001 0.64 <.001 BCL2 0.64 0.004 0.75 0.029 BINI 0.52 <.001 0.74 0.010 BTG3 0.75 0.032 0.75 0.010 BTRC 0.69 0.011 C7 0.51 <.001 0.67 <.001 CADMI 0.49 <.001 0.76 0.034 CASPI 0.71 0.010 0.74 0.007 CAVI 0.73 0.015 CCL5 0.67 0.018 0.67 0.003 CCNH 0.63 <.001 0.75 0.004 CCR1 0.77 0.032 CD164 0.52 <.001 0.63 <.001 CD44 0.53 <.001 0.74 0.014 CDH1O 0.69 0.040 CDH18 0.40 0.011 CDK14 0.75 0.013 CDK2 0.81 0.031 CDK3 0.73 0.022

Table 7B Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value CDKN1A 0.68 0.038 CDKN1C 0.62 0.003 0.72 0.005 COL6A1 0.54 <.001 0.70 0.004 COL6A3 0.64 0.004 CSF1 0.56 <.001 0.78 0.047 CSRP1 0.40 <.001 0.66 0.002 CTGF 0.66 0.015 0.74 0.027 CTNNB1 0.69 0.043 CTSB 0.60 0.002 0.71 0.011 CTSS 0.67 0.013 CXCL12 0.56 <.001 0.77 0.026 CYP3A5 0.43 <.001 0.63 <.001 CYR61 0.43 <.001 0.58 <.001 DAGI 0.72 0.012 DARC 0.66 0.016 DDR2 0.65 0.007 DES 0.52 <.001 0.74 0.018 DHRS9 0.54 0.007 DICERI 0.70 0.044 DLC1 0.75 0.021 DLGAP1 0.55 <.001 0.72 0.005 DNM3 0.61 0.001 DPP4 0.55 <.001 0.77 0.024 DPT 0.48 <.001 0.61 <.001 DUSPI 0.47 <.001 0.59 <.001 DUSP6 0.65 0.009 0.65 0.002 DYNLL1 0.74 0.045 EDNRA 0.61 0.002 0.75 0.038 EFNB2 0.71 0.043 EGRI 0.43 <.001 0.58 <.001 EGR3 0.47 <.001 0.66 <.001 EIF5 0.77 0.028 ELK4 0.49 <.001 0.72 0.012 EPHA2 0.70 0.007 EPHA3 0.62 <.001 0.72 0.009 EPHB2 0.68 0.009 ERBB2 0.64 <.001 0.63 <.001 ERBB3 0.69 0.018 ERCC1 0.69 0.019 0.77 0.021 ESR2 0.61 0.020 FAAH 0.57 <.001 0.77 0.035 FABP5 0.67 0.035 FAM107A 0.42 <.001 0.59 <.001 FAM13C 0.53 <.001 0.59 <.001

Table 7B Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value FAS 0.71 0.035 FASLG 0.56 0.017 0.67 0.014 FGF10 0.57 0.002 FGF17 0.70 0.039 0.70 0.010 FGF7 0.63 0.005 0.70 0.004 FGFR2 0.63 0.003 0.71 0.003 FKBP5 0.72 0.020 FLNA 0.48 <.001 0.74 0.022 FOS 0.45 <.001 0.56 <.001 FOXO1 0.59 <.001 FOXQ1 0.57 <.001 0.69 0.008 FYN 0.62 0.001 0.74 0.013 G6PD 0.77 0.014 GADD45A 0.73 0.045 GADD45B 0.45 <.001 0.64 0.001 GDF15 0.58 <.001 GHR 0.62 0.008 0.68 0.002 GPM6B 0.60 <.001 0.70 0.003 GSK3B 0.71 0.016 0.71 0.006 GSN 0.46 <.001 0.66 <.001 GSTM1 0.56 <.001 0.62 <.001 GSTM2 0.47 <.001 0.67 <.001 HGD 0.72 0.002 HIRIP3 0.69 0.021 0.69 0.002 HK1 0.68 0.005 0.73 0.005 HLA-G 0.54 0.024 0.65 0.013 HLF 0.41 <.001 0.68 0.001 HNF1B 0.55 <.001 0.59 <.001 HPS1 0.74 0.015 0.76 0.025 HSD17B3 0.65 0.031 HSPB2 0.62 0.004 0.76 0.027 ICAMI 0.61 0.010 IER3 0.55 <.001 0.67 0.003 IFITI 0.57 <.001 0.70 0.008 IFNG 0.69 0.040 IGF1 0.63 <.001 0.59 <.001 IGF2 0.67 0.019 0.70 0.005 IGFBP2 0.53 <.001 0.63 <.001 IGFBP5 0.57 <.001 0.71 0.006 IGFBP6 0.41 <.001 0.71 0.012 IL1O 0.59 0.020 ILIB 0.53 <.001 0.70 0.005 IL6 0.55 0.001 IL6ST 0.45 <.001 0.68 <.001

Table 7B Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value IL8 0.60 0.005 0.70 0.008 ILK 0.68 0.029 0.76 0.036 ING5 0.54 <.001 0.82 0.033 ITGA1 0.66 0.017 ITGA3 0.70 0.020 ITGA5 0.64 0.011 ITGA6 0.66 0.003 0.74 0.006 ITGA7 0.50 <.001 0.71 0.010 ITGB4 0.63 0.014 0.73 0.010 ITPR1 0.55 <.001 ITPR3 0.76 0.007 JUN 0.37 <.001 0.54 <.001 JUNB 0.58 0.002 0.71 0.016 KCTD12 0.68 0.017 KIT 0.49 0.002 0.76 0.043 KLC1 0.61 0.005 0.77 0.045 KLF6 0.65 0.009 KLK1 0.68 0.036 KLK1O 0.76 0.037 KLK2 0.64 <.001 0.73 0.006 KLK3 0.65 <.001 0.76 0.021 KLRK1 0.63 0.005 KRT15 0.52 <.001 0.58 <.001 KRT18 0.46 <.001 KRT5 0.51 <.001 0.58 <.001 KRT8 0.53 <.001 LICAM 0.65 0.031 LAG3 0.58 0.002 0.76 0.033 LAMA4 0.52 0.018 LAMB3 0.60 0.002 0.65 0.003 LGALS3 0.52 <.001 0.71 0.002 LIG3 0.65 0.011 LRP1 0.61 0.001 0.75 0.040 MGMT 0.66 0.003 MICA 0.59 0.001 0.68 0.001 MLXIP 0.70 0.020 MMP2 0.68 0.022 MMP9 0.67 0.036 MPPED2 0.57 <.001 0.66 <.001 MRCl 0.69 0.028 MTSS1 0.63 0.005 0.79 0.037 MVP 0.62 <.001 MYBPC1 0.53 <.001 0.70 0.011 NCAM1 0.70 0.039 0.77 0.042

Table 7B Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value NCAPD3 0.52 <.001 0.59 <.001 NDRG1 0.69 0.008 NEXN 0.62 0.002 NFAT5 0.45 <.001 0.59 <.001 NFATC2 0.68 0.035 0.75 0.036 NFKBIA 0.70 0.030 NRG1 0.59 0.022 0.71 0.018 OAZ1 0.69 0.018 0.62 <.001 OLFML3 0.59 <.001 0.72 0.003 OR51E2 0.73 0.013 PAGE4 0.42 <.001 0.62 <.001 PCA3 0.53 <.001 PCDHGB7 0.70 0.032 PGF 0.68 0.027 0.71 0.013 PGR 0.76 0.041 PIK3C2A 0.80 <.001 PIK3CA 0.61 <.001 0.80 0.036 PIK3CG 0.67 0.001 0.76 0.018 PLP2 0.65 0.015 0.72 0.010 PPAP2B 0.45 <.001 0.69 0.003 PPP1R12A 0.61 0.007 0.73 0.017 PRIMAl 0.51 <.001 0.68 0.004 PRKCA 0.55 <.001 0.74 0.009 PRKCB 0.55 <.001 PROMI 0.67 0.042 PROS1 0.73 0.036 PTCH1 0.69 0.024 0.72 0.010 PTEN 0.54 <.001 0.64 <.001 PTGS2 0.48 <.001 0.55 <.001 PTH1R 0.57 0.003 0.77 0.050 PTHLH 0.55 0.010 PTK2B 0.56 <.001 0.70 0.001 PYCARD 0.73 0.009 RAB27A 0.65 0.009 0.71 0.014 RAB30 0.59 0.003 0.72 0.010 RAGE 0.76 0.011 RARB 0.59 <.001 0.63 <.001 RASSF1 0.67 0.003 RB1 0.67 0.006 RFX1 0.71 0.040 0.70 0.003 RHOA 0.71 0.038 0.65 <.001 RHOB 0.58 0.001 0.71 0.006 RND3 0.54 <.001 0.69 0.003 RNF114 0.59 0.004 0.68 0.003

Table 7B PrimaryPattern Highest Pattern Official Symbol HR p-value HR p-value SCUBE2 _______________ 0.77 0.046 SDHC 0.72 0.028 0.76 0.025 SEC23A ______________ 0.75 0.029 SEMA3A 0.61 0.004 0.72 0.011 SEPT9 0.66 0.013 0.76 0.036 SERPINB5 ______________ 0.75 0.039 SH3RF2 0.44 <001 0.48 <001 SHH ______________ 0.74 0.049 SLC22A3 0.42 <001 0.61 <001 SMAD4 0.45 <001 0.66 <001 SMARCD1 0.69 0.016 ______________

SODI 0.68 0.042 ______

SORBS1 0.51 <001 0.73 0.012 SPARCL1 0.58 <001 0.77 0.040 SPDEF 0.77 <001 _______

SPIINTI 0.65 0.004 0.79 0.038 SRC 0.61 <001 0.69 0.001 SRD5A2 0.39 <001 0.55 <001 ST5 0.61 <001 0.73 0.012 STATI 0.64 0.006 ______________

STAT3 0.63 0.010 ______

STAT5A 0.62 0.001 0.70 0.003 STAT5B 0.58 <001 0.73 0.009 SUMOl 0.66 <001 ______________

SVIL 0.57 0.001 0.74 0.022 TBP 0.65 0.002 ______________

TFF1 0.65 0.021 ______

TFF3 0.58 <001 ______________

TGFB1J1 0.51 <001 0.75 0.026 TGFB2 0.48 <001 0.62 <001 TGFBR2 0.61 0.003 ______

TIAMI 0.68 0.019 ______________

TIMP2 0.69 0.020 _______

TIMP3 0.58 0.002 _______

TNFRSF1OA 0.73 0.047 ______________

TNFRSF1OB 0.47 <001 0.70 0.003 TNFSF1O 0.56 0.001 ______________

TP63 _______________ 0.67 0.001 TPM1 0.58 0.004 0.73 0.017 TPM2 0.46 <001 0.70 0.005 TRA2A 0.68 0.013 ______________

TRAF3IP2 0.73 0.041 0.71 0.004 TRO 0.72 0.016 0.71 0.004 TUBB2A 0.53 <001 0.73 0.021

Table 7B Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value TYMP 0.70 0.011 VCAM1 0.69 0.041 VCL 0.46 <.001 VEGFA 0.77 0.039 VEGFB 0.71 0.035 VIM 0.60 0.001 XRCC5 0.75 0.026 YY1 0.62 0.008 0.77 0.039 ZFHX3 0.53 <.001 0.58 <.001 ZFP36 0.43 <.001 0.54 <.001 ZNF827 0.55 0.001

[00141] Tables 8A and 8B provide genes that were significantly associated (p<0.05), positively or negatively, with clinical recurrence (cRFI) in positive TMPRSS fusion specimens in the primary or highest Gleason pattern specimen. Increased expression of genes in Table 8A is negatively associated with good prognosis, while increased expression of genes in Table 8B is positively associated with good prognosis. Table 8A. Genes significantly (p<0.05) associated with cRFI for TMPRSS2-ERG fusion positive in the primary Gleason pattern or highest Gleason pattern with hazard ratio (HR) > 1.0 (increased expression is negatively associated with good prognosis) Table 8A Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value ACTR2 1.78 0.017 AKR1C3 1.44 0.013 ALCAM 1.44 0.022 ANLN 1.37 0.046 1.81 <.001 APOE 1.49 0.023 1.66 0.005 AQP2 1.30 0.013 ARHGDIB 1.55 0.021 ASPN 2.13 <.001 2.43 <.001 ATP5E 1.69 0.013 1.58 0.014 BGN 1.92 <.001 2.55 <.001 BIRC5 1.48 0.006 1.89 <.001 BMP6 1.51 0.010 1.96 <.001 BRCA2 1.41 0.007 BUBI 1.36 0.007 1.52 <.001 CCNE2 1.55 0.004 1.59 <.001 CD276 1.65 <.001 CDC20 1.68 <.001 1.74 <.001 CDH11 1.50 0.017 CDH18 1.36 <.001

Table 8A Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value CDH7 1.54 0.009 1.46 0.026 CDKN2B 1.68 0.008 1.93 0.001 CDKN2C 2.01 <.001 1.77 <.001 CDKN3 1.51 0.002 1.33 0.049 CENPF 1.51 0.007 2.04 <.001 CKS2 1.43 0.034 1.56 0.007 COL1A1 2.23 <.001 3.04 <.001 COL1A2 1.79 0.001 2.22 <.001 COL3A1 1.96 <.001 2.81 <.001 COL4A1 1.52 0.020 COL5A1 1.50 0.020 COL5A2 1.64 0.017 1.55 0.010 COL8A1 1.96 <.001 2.38 <.001 CRISP3 1.68 0.002 1.67 0.002 CTHRC1 2.06 <.001 CTNND2 1.42 0.046 1.50 0.025 CTSK 1.43 0.049 CXCR4 1.82 0.001 1.64 0.007 DDIT4 1.54 0.016 1.58 0.009 DLL4 1.51 0.007 DYNLL1 1.50 0.021 1.22 0.002 F2R 2.27 <.001 2.02 <.001 FAP 2.12 <.001 FCGR3A 1.94 0.002 FGF5 1.23 0.047 FOXP3 1.52 0.006 1.48 0.018 GNPTAB 1.44 0.042 GPR68 1.51 0.011 GREMI 1.91 <.001 2.38 <.001 HDACl 1.43 0.048 HDAC9 1.65 <.001 1.67 0.004 HRAS 1.65 0.005 1.58 0.021 IGFBP3 1.94 <.001 1.85 <.001 INHBA 2.03 <.001 2.64 <.001 JAGI 1.41 0.027 1.50 0.008 KCTD12 1.51 0.017 KHDRBS3 1.48 0.029 1.54 0.014 KPNA2 1.46 0.050 LAMA3 1.35 0.040 LAMC1 1.77 0.012 LTBP2 1.82 <.001 LUM 1.51 0.021 1.53 0.009 MELK 1.38 0.020 1.49 0.001 MK167 1.37 0.014

Table 8A Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value MMP11 1.73 <.001 1.69 <.001 MRPL13 1.30 0.046 MYBL2 1.56 <.001 1.72 <.001 MYLK3 1.17 0.007 NOX4 1.58 0.005 1.96 <.001 NRIP3 1.30 0.040 NRP1 1.53 0.021 OLFML2B 1.54 0.024 OSM 1.43 0.018 PATEl 1.20 <.001 1.33 <.001 PCNA 1.64 0.003 PEX1O 1.41 0.041 1.64 0.003 PIK3CA 1.38 0.037 PLK1 1.52 0.009 1.67 0.002 PLOD2 1.65 0.002 POSTN 1.79 <.001 2.06 <.001 PTK6 1.67 0.002 2.38 <.001 PTTG1 1.56 0.002 1.54 0.003 RAD21 1.61 0.036 1.53 0.005 RAD51 1.33 0.009 RALA 1.95 0.004 1.60 0.007 REG4 1.43 0.042 ROBO2 1.46 0.024 RRM1 1.44 0.033 RRM2 1.50 0.003 1.48 <.001 SATI 1.42 0.009 1.43 0.012 SEC14L1 1.64 0.002 SFRP4 2.07 <.001 2.40 <.001 SHMT2 1.52 0.030 1.60 0.001 SLC44A1 1.42 0.039 SPARC 1.93 <.001 2.21 <.001 SULF1 1.63 0.006 2.04 <.001 THBS2 1.95 <.001 2.26 <.001 THY1 1.69 0.016 1.95 0.002 TK1 1.43 0.003 TOP2A 1.57 0.002 2.11 <.001 TPX2 1.84 <.001 2.27 <.001 UBE2C 1.41 0.011 1.44 0.006 UBE2T 1.63 0.001 UHRF1 1.51 0.007 1.69 <.001 WISPI 1.47 0.045 WNT5A 1.35 0.027 1.63 0.001 ZWINT 1.36 0.045

Table 8B. Genes significantly (p<0.05) associated with cRFI for TMPRSS2-ERG fusion positive in the primary Gleason pattern or highest Gleason pattern with hazard ratio (HR) < 1.0 (increased expression is positively associated with good prognosis) Table 8B Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value AAMP 0.57 0.007 0.58 <.001 ABCA5 0.80 0.044 ACE 0.65 0.023 0.55 <.001 ACOX2 0.55 <.001 ADH5 0.68 0.022 AKAPI 0.81 0.043 ALDH1A2 0.72 0.036 0.43 <.001 ANPEP 0.66 0.022 0.46 <.001 APRT 0.73 0.040 AXIN2 0.60 <.001 AZGP1 0.57 <.001 0.65 <.001 BCL2 0.69 0.035 BIK 0.71 0.045 BINI 0.71 0.004 0.71 0.009 BTRC 0.66 0.003 0.58 <.001 C7 0.64 0.006 CADMI 0.61 <.001 0.47 <.001 CCL2 0.73 0.042 CCNH 0.69 0.022 CD44 0.56 <.001 0.58 <.001 CD82 0.72 0.033 CDC25B 0.74 0.028 CDH1 0.75 0.030 0.72 0.010 CDH19 0.56 0.015 CDK3 0.78 0.045 CDKN1C 0.74 0.045 0.70 0.014 CSF1 0.72 0.037 CTSB 0.69 0.048 CTSL2 0.58 0.005 CYP3A5 0.51 <.001 0.30 <.001 DHX9 0.89 0.006 0.87 0.012 DLC1 0.64 0.023 DLGAP1 0.69 0.010 0.49 <.001 DPP4 0.64 <.001 0.56 <.001 DPT 0.63 0.003 EGRI 0.69 0.035 EGR3 0.68 0.025 EIF2S3 0.70 0.021 EIF5 0.71 0.030 ELK4 0.71 0.041 0.60 0.003

Table 8B Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value EPHA2 0.72 0.036 0.66 0.011 EPHB4 0.65 0.007 ERCC1 0.68 0.023 ESR2 0.64 0.027 FAM107A 0.64 0.003 0.61 0.003 FAM13C 0.68 0.006 0.55 <.001 FGFR2 0.73 0.033 0.59 <.001 FKBP5 0.60 0.006 FLNC 0.68 0.024 0.65 0.012 FLT1 0.71 0.027 FOS 0.62 0.006 FOXO1 0.75 0.010 GADD45B 0.68 0.020 GHR 0.62 0.006 GPM6B 0.57 <.001 GSTM1 0.68 0.015 0.58 <.001 GSTM2 0.65 0.005 0.47 <.001 HGD 0.63 0.001 0.71 0.020 HK1 0.67 0.003 0.62 0.002 HLF 0.59 <.001 HNF1B 0.66 0.004 0.61 0.001 IER3 0.70 0.026 IGF1 0.63 0.005 0.55 <.001 IGF1R 0.76 0.049 IGFBP2 0.59 0.007 0.64 0.003 IL6ST 0.65 0.005 IL8 0.61 0.005 0.66 0.019 ILK 0.64 0.015 ING5 0.73 0.033 0.70 0.009 ITGA7 0.72 0.045 0.69 0.019 ITGB4 0.63 0.002 KLC1 0.74 0.045 KLK1 0.56 0.002 0.49 <.001 KLK1O 0.68 0.013 KLK11 0.66 0.003 KLK2 0.66 0.045 0.65 0.011 KLK3 0.75 0.048 0.77 0.014 KRT15 0.71 0.017 0.50 <.001 KRT5 0.73 0.031 0.54 <.001 LAMA5 0.70 0.044 LAMB3 0.70 0.005 0.58 <.001 LGALS3 0.69 0.025 LIG3 0.68 0.022 MDK 0.69 0.035

Table 8B Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value MGMT 0.59 0.017 0.60 <.001 MGST l_0.73 0.042 MICA 0.70 0.009 MPPED2 0.72 0.031 0.54 <.001 MTSS1 0.62 0.003 MYBPC1 0.50 <.001 NCAPD3 0.62 0.007 0.38 <.001 NCOR1 0.82 0.048 NFAT5 0.60 0.001 0.62 <.001 NRG1 0.66 0.040 0.61 0.029 NUP62 0.75 0.037 OMD 0.54 <.001 PAGE4 0.64 0.005 PCA3 0.66 0.012 PCDHGB7 0.68 0.018 PGR 0.60 0.012 PPAP2B 0.62 0.010 PPP1R12A 0.73 0.031 0.58 0.003 PRIMAl 0.65 0.013 PROMI 0.41 0.013 PTCH1 0.64 0.006 PTEN 0.75 0.047 PTGS2 0.67 0.011 PTK2B 0.66 0.005 PTPN1 0.71 0.026 RAGE 0.70 0.012 RARB 0.68 0.016 RGS1O 0.84 0.034 RHOB 0.66 0.016 RND3 0.63 0.004 SDHC 0.73 0.044 0.69 0.016 SERPINA3 0.67 0.011 0.51 <.001 SERPINB5 0.42 <.001 SH3RF2 0.66 0.012 0.51 <.001 SLC22A3 0.59 0.003 0.48 <.001 SMAD4 0.64 0.004 0.49 <.001 SMARCC2 0.73 0.042 SMARCD1 0.73 <.001 0.76 0.035 SMO 0.64 0.006 SNAIl 0.53 0.008 SODI 0.60 0.003 SRC 0.64 <.001 0.61 <.001 SRD5A2 0.63 0.004 0.59 <.001 STAT3 0.64 0.014

Table 8B Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value STAT5A 0.70 0.032 STAT5B 0.74 0.034 0.63 0.003 SVIL 0.71 0.028 TGFB1Il 0.68 0.036 TMPRSS2 0.72 0.015 0.67 <.001 TNFRSF1OA 0.69 0.010 TNFRSF1OB 0.67 0.007 0.64 0.001 TNFRSF18 0.38 0.003 TNFSF1O 0.71 0.025 TP53 0.68 0.004 0.57 <.001 TP63 0.75 0.049 0.52 <.001 TPM2 0.62 0.007 TRAF3IP2 0.71 0.017 0.68 0.005 TRO 0.72 0.033 TUBB2A 0.69 0.038 VCL 0.62 <.001 VEGFA 0.71 0.037 WWOX 0.65 0.004 ZFHX3 0.77 0.011 0.73 0.012 ZFP36 0.69 0.018 ZNF827 0.68 0.013 0.49 <.001

[00142] Tables 9A and 9B provide genes significantly associated (p<0.05), positively or negatively, with TMPRSS fusion status in the primary Gleason pattern. Increased expression of genes in Table 9A are positively associated with TMPRSS fusion positivity, while increased expression of genes in Table 10A are negatively associated with TMPRSS fusion positivity. Table 9A. Genes significantly (p<0.05) associated with TMPRSS fusion status in the primary Gleason pattern with odds ratio (OR) > 1.0 (increased expression is positively associated with TMPRSS fusion positivity Table 9A Official Symbol p-value Odds Ratio Official Symbol p-value Odds Ratio ABCC8 <.001 1.86 MAP3K5 <.001 2.06 ALDH18A1 0.005 1.49 MAP7 <.001 2.74 ALKBH3 0.043 1.30 MSH2 0.005 1.59 ALOX5 <.001 1.66 MSH3 0.006 1.45 AMPD3 <.001 3.92 MUCi 0.012 1.42 APEXI <.001 2.00 MYO6 <.001 3.79 ARHGDIB <.001 1.87 NCOR2 0.001 1.62 ASAP2 0.019 1.48 NDRG1 <.001 6.77 ATXN1 0.013 1.41 NETO2 <.001 2.63 BMPR1B <.001 2.37 ODC1 <.001 1.98 CACNAlD <.001 9.01 OR51E1 <.001 2.24

Table 9A Official Symbol p-value Odds Ratio Official Symbol p-value Odds Ratio CADPS 0.015 1.39 PDE9A <.001 2.21 CD276 0.003 2.25 PEX10 <.001 3.41 CDH1 0.016 1.37 PGK1 0.022 1.33 CDH7 <.001 2.22 PLA2G7 <.001 5.51 CDK7 0.025 1.43 PPP3CA 0.047 1.38 COL9A2 <.001 2.58 PSCA 0.013 1.43 CRISP3 <.001 2.60 PSMD13 0.004 1.51 CTNND1 0.033 1.48 PTCH1 0.022 1.38 ECE1 <.001 2.22 PTK2 0.014 1.38 EIF5 0.023 1.34 PTK6 <.001 2.29 EPHB4 0.005 1.51 PTK7 <.001 2.45 ERG <.001 14.5 PTPRK <.001 1.80 FAM171B 0.047 1.32 RAB30 0.001 1.60 FAM73A 0.008 1.45 REG4 0.018 1.58 FASN 0.004 1.50 RELA 0.001 1.62 GNPTAB <.001 1.60 RFX1 0.020 1.43 GPS1 0.006 1.45 RGS1O <.001 1.71 GRB7 0.023 1.38 SCUBE2 0.009 1.48 HDAC1 <.001 4.95 SEPT9 <.001 3.91 HGD <.001 1.64 SH3RF2 0.004 1.48 HIPI <.001 1.90 SH3YL1 <.001 1.87 HNF1B <.001 3.55 SHH <.001 2.45 HSPA8 0.041 1.32 SIM2 <.001 1.74 IGF1R 0.001 1.73 SIPA1LI 0.021 1.35 ILF3 <.001 1.91 SLC22A3 <.001 1.63 IMMT 0.025 1.36 SLC44A1 <.001 1.65 ITPR1 <.001 2.72 SPINTI 0.017 1.39 ITPR3 <.001 5.91 TFDP1 0.005 1.75 JAGI 0.007 1.42 TMPRSS2ERGA 0.002 14E5 KCNN2 <.001 2.80 TMPRSS2ERGB <.001 1.97 KHDRBS3 <.001 2.63 TRIM14 <.001 1.65 KIAA0247 0.019 1.38 TSTA3 0.018 1.38 KLK11 <.001 1.98 UAP1 0.046 1.39 LAMC1 0.008 1.56 UBE2G1 0.001 1.66 LAMC2 <.001 3.30 UGDH <.001 2.22 LOX 0.009 1.41 XRCC5 <.001 1.66 LRP1 0.044 1.30 ZMYND8 <.001 2.19

Table 9B. Genes significantly (p<0.05) associated with TMPRSS fusion status in the primary Gleason pattern with odds ratio (OR) < 1.0 (increased expression is negatively associated with TMPRSS fusion positivity) Table 9B Official Symbol p-value Odds Ratio ABCC4 0.045 0.77 ABHD2 <.001 0.38 ACTR2 0.027 0.73 ADAMTS1 0.024 0.58 ADH5 <.001 0.58 AGTR2 0.016 0.64 AKAPI 0.013 0.70 AKT2 0.015 0.71 ALCAM <.001 0.45 ALDH1A2 0.004 0.70 ANPEP <.001 0.43 ANXA2 0.010 0.71 APC 0.036 0.73 APOCI 0.002 0.56 APOE <.001 0.44 ARFI 0.041 0.77 ATM 0.036 0.74 AURKB <.001 0.62 AZGP1 <.001 0.54 BBC3 0.030 0.74 BCL2 0.012 0.70 BINI 0.021 0.74 BTG1 0.004 0.67 BTG3 0.003 0.63 C7 0.023 0.74 CADMI 0.007 0.69 CASPI 0.011 0.70 CAVI 0.011 0.71 CCND1 0.019 0.72 CCR1 0.022 0.73 CD44 <.001 0.57 CD68 <.001 0.54 CD82 0.002 0.66 CDH5 0.007 0.66 CDKN1A <.001 0.60 CDKN2B <.001 0.54 CDKN2C 0.012 0.72 CDKN3 0.037 0.77 CHN1 0.038 0.75 CKS2 <.001 0.48

Table 9B Official Symbol p-value Odds Ratio COL1IA1 0.017 0.72 COL1A1 <.001 0.59 COL1A2 0.001 0.62 COL3A1 0.027 0.73 COL4A1 0.043 0.76 COL5A1 0.039 0.74 COL5A2 0.026 0.73 COL6A1 0.008 0.66 COL6A3 <.001 0.59 COL8A1 0.022 0.74 CSF1 0.011 0.70 CTNNB1 0.021 0.69 CTSB <.001 0.62 CTSD 0.036 0.68 CTSK 0.007 0.70 CTSS 0.002 0.64 CXCL12 <.001 0.48 CXCR4 0.005 0.68 CXCR7 0.046 0.76 CYR61 0.004 0.65 DAP 0.002 0.64 DARC 0.021 0.73 DDR2 0.021 0.73 DHRS9 <.001 0.52 DIAPHI <.001 0.56 DICERI 0.029 0.75 DLC1 0.013 0.72 DLGAP1 <.001 0.60 DLL4 <.001 0.57 DPT 0.006 0.68 DUSPI 0.012 0.68 DUSP6 0.001 0.62 DVL1 0.037 0.75 EFNB2 <.001 0.32 EGRI 0.003 0.65 ELK4 <.001 0.60 ERBB2 <.001 0.61 ERBB3 0.045 0.76 ESR2 0.010 0.70 ETV1 0.042 0.74 FABP5 <.001 0.21 FAM13C 0.006 0.67 FCGR3A 0.018 0.72 FGF17 0.009 0.71

Table 9B Official Symbol p-value Odds Ratio FGF6 0.011 0.70 FGF7 0.003 0.63 FN1 0.006 0.69 FOS 0.035 0.74 FOXP3 0.010 0.71 GABRG2 0.029 0.74 GADD45B 0.003 0.63 GDF15 <.001 0.54 GPM6B 0.004 0.67 GPNMB 0.001 0.62 GSN 0.009 0.69 HLA-G 0.050 0.74 HLF 0.018 0.74 HPS1 <.001 0.48 HSD17B3 0.003 0.60 HSD17B4 <.001 0.56 HSPB1 <.001 0.38 HSPB2 0.002 0.62 IF130 0.049 0.75 IFNG 0.006 0.64 IGF1 0.016 0.73 IGF2 0.001 0.57 IGFBP2 <.001 0.51 IGFBP3 <.001 0.59 IGFBP6 <.001 0.57 IL1O <.001 0.62 IL17A 0.012 0.63 ILlA 0.011 0.59 IL2 0.001 0.63 IL6ST <.001 0.52 INSL4 0.014 0.71 ITGA1 0.009 0.69 ITGA4 0.007 0.68 JUN <.001 0.59 KIT <.001 0.64 KRT76 0.016 0.70 LAG3 0.002 0.63 LAPTM5 <.001 0.58 LGALS3 <.001 0.53 LTBP2 0.011 0.71 LUM 0.012 0.70 MAOA 0.020 0.73 MAP4K4 0.007 0.68 MGSTl <.001 0.54

Table 9B Official Symbol p-value Odds Ratio MMP2 <.001 0.61 MPPED2 <.001 0.45 MRCl 0.005 0.67 MTPN 0.002 0.56 MTSS1 <.001 0.53 MVP 0.009 0.72 MYBPC1 <.001 0.51 MYLK3 0.001 0.58 NCAM1 <.001 0.59 NCAPD3 <.001 0.40 NCOR1 0.004 0.69 NFKBIA <.001 0.63 NNMT 0.006 0.66 NPBWR1 0.027 0.67 OAZ1 0.049 0.64 OLFML3 <.001 0.56 OSM <.001 0.64 PAGEl 0.012 0.52 PDGFRB 0.016 0.73 PECAMI <.001 0.55 PGR 0.048 0.77 PIK3CA <.001 0.55 PIK3CG 0.008 0.71 PLAU 0.044 0.76 PLK1 0.006 0.68 PLOD2 0.013 0.71 PLP2 0.024 0.73 PNLIPRP2 0.009 0.70 PPAP2B <.001 0.62 PRKAR2B <.001 0.61 PRKCB 0.044 0.76 PROS1 0.005 0.67 PTEN <.001 0.47 PTGER3 0.007 0.69 PTH1R 0.011 0.70 PTK2B <.001 0.61 PTPN1 0.028 0.73 RAB27A <.001 0.21 RAD51 <.001 0.51 RAD9A 0.030 0.75 RARB <.001 0.62 RASSF1 0.038 0.76 RECK 0.009 0.62 RHOB 0.004 0.64

Table 9B Official Symbol p-value Odds Ratio RHOC <.001 0.56 RLN1 <.001 0.30 RND3 0.014 0.72 Sloop 0.002 0.66 SDC2 <.001 0.61 SEMA3A 0.001 0.64 SMAD4 <.001 0.64 SPARC <.001 0.59 SPARCL1 <.001 0.56 SPINKI <.001 0.26 SRD5A1 0.039 0.76 STATI 0.026 0.74 STS 0.006 0.64 SULF1 <.001 0.53 TFF3 <.001 0.19 TGFA 0.002 0.65 TGFB1Il 0.040 0.77 TGFB2 0.003 0.66 TGFB3 <.001 0.54 TGFBR2 <.001 0.61 THY1 <.001 0.63 TIMP2 0.004 0.66 TIMP3 <.001 0.60 TMPRSS2 <.001 0.40 TNFSF11 0.026 0.63 TPD52 0.002 0.64 TRAMI <.001 0.45 TRPC6 0.002 0.64 TUBB2A <.001 0.49 VCL <.001 0.57 VEGFB 0.033 0.73 VEGFC <.001 0.61 VIM 0.012 0.69 WISPI 0.030 0.75 WNT5A <.001 0.50

[00143] A molecular field effect was investigated, and determined that the expression levels of histologically normal-appearing cells adjacent to the tumor exhibited a molecular signature of prostate cancer. Tables 1OA and 1OB provide genes significantly associated (p<0.05), positively or negatively, with cRFI or bRFI in non-tumor samples. Table 1OA is negatively associated with good prognosis, while increased expression of genes in Table 1OB is positively associated with good prognosis.

Table 1OA Genes significantly (p<0.05) associated with cRFI or bRFI in Non-Tumor Samples with hazard ratio (HR) > 1.0 (increased expression is negatively associated with good prognosis) Table 1OA cRFI bRFI Official Symbol HR p-value HR p-value ALCAM 1.278 0.036 ASPN 1.309 0.032 BAG5 1.458 0.004 BRCA2 1.385 <.001 CACNAlD 1.329 0.035 CD164 1.339 0.020 CDKN2B 1.398 0.014 COL3A1 1.300 0.035 COL4A1 1.358 0.019 CTNND2 1.370 0.001 DARC 1.451 0.003 DICERI 1.345 <.001 DPP4 1.358 0.008 EFNB2 1.323 0.007 FASN 1.327 0.035 GHR 1.332 0.048 HSPA5 1.260 0.048 INHBA 1.558 <.001 KCNN2 1.264 0.045 KRT76 1.115 <.001 LAMC1 1.390 0.014 LAMC2 1.216 0.042 LIG3 1.313 0.030 MAOA 1.405 0.013 MCM6 1.307 0.036 MK167 1.271 0.008 NEK2 1.312 0.016 NPBWR1 1.278 0.035 ODC1 1.320 0.010 PEX1O 1.361 0.014 PGK1 1.488 0.004 PLA2G7 1.337 0.025 POSTN 1.306 0.043 PTK6 1.344 0.005 REG4 1.348 0.009 RGS7 1.144 0.047 SFRP4 1.394 0.009 TARP 1.412 0.011 TFF1 1.346 0.010 TGFBR2 1.310 0.035

Table 1OA cRFI bRFI Official Symbol HR p-value HR p-value THY1 1.300 0.038 TMPRSS2ERGA 1.333 <.001 TPD52 1.374 0.015 TRPC6 1.272 0.046 UBE2C 1.323 0.007 UHRF1 1.325 0.021

Table 1OB Genes significantly (p<0.05) associated with cRFI or bRFI in Non-Tumor Samples with hazard ratio (HR) < 1.0 (increased expression is positively associated with good prognosis) Table 1OB cRFI bRFI Official Symbol HR p-value HR p-value ABCA5 0.807 0.028 ABCC3 0.760 0.019 0.750 0.003 ABHD2 0.781 0.028 ADAM15 0.718 0.005 AKAPI 0.740 0.009 AMPD3 0.793 0.013 ANGPT2 0.752 0.027 ANXA2 0.776 0.035 APC 0.755 0.014 APRT 0.762 0.025 AR 0.752 0.015 ARHGDIB 0.753 <.001 BINI 0.738 0.016 CADMI 0.711 0.004 CCNH 0.820 0.041 CCR1 0.749 0.007 CDK14 0.772 0.014 CDK3 0.819 0.044 CDKN1C 0.808 0.038 CHAF1A 0.634 0.002 0.779 0.045 CHN1 0.803 0.034 CHRACI 0.751 0.014 0.779 0.021 COL5A1 0.736 0.012 COL5A2 0.762 0.013 COL6A1 0.757 0.032 COL6A3 0.757 0.019 CSK 0.663 <.001 0.698 <.001 CTSK 0.782 0.029 CXCL12 0.771 0.037 CXCR7 0.753 0.008

Table 1OB cRFI bRFI Official Symbol HR p-value HR p-value CYP3A5 0.790 0.035 DDIT4 0.725 0.017 DIAPHI 0.771 0.015 DLC1 0.744 0.004 0.807 0.015 DLGAP1 0.708 0.004 DUSPI 0.740 0.034 EDNI 0.742 0.010 EGRI 0.731 0.028 EIF3H 0.761 0.024 EIF4E 0.786 0.041 ERBB2 0.664 0.001 ERBB4 0.764 0.036 ERCC1 0.804 0.041 ESR2 0.757 0.025 EZH2 0.798 0.048 FAAH 0.798 0.042 FAM13C 0.764 0.012 FAM171B 0.755 0.005 FAM49B 0.811 0.043 FAM73A 0.778 0.015 FASLG 0.757 0.041 FGFR2 0.735 0.016 FOS 0.690 0.008 FYN 0.788 0.035 0.777 0.011 GPNMB 0.762 0.011 GSK3B 0.792 0.038 HGD 0.774 0.017 HIRIP3 0.802 0.033 HSP90AB1 0.753 0.013 HSPB1 0.764 0.021 HSPE1 0.668 0.001 IF130 0.732 0.002 IGF2 0.747 0.006 IGFBP5 0.691 0.006 IL6ST 0.748 0.010 IL8 0.785 0.028 IMMT 0.708 <.001 ITGA6 0.747 0.008 ITGAV 0.792 0.016 ITGB3 0.814 0.034 ITPR3 0.769 0.009 JUN 0.655 0.005 KHDRBS3 0.764 0.012 KLF6 0.714 <.001

Table 1OB cRFI bRFI Official Symbol HR p-value HR p-value KLK2 0.813 0.048 LAMA4 0.702 0.009 LAMA5 0.744 0.011 LAPTM5 0.740 0.009 LGALS3 0.773 0.036 0.788 0.024 LIMS1 0.807 0.012 MAP3K5 0.815 0.034 MAP3K7 0.809 0.032 MAP4K4 0.735 0.018 0.761 0.010 MAPKAPK3 0.754 0.014 MICA 0.785 0.019 MTA1 0.808 0.043 MVP 0.691 0.001 MYLK3 0.730 0.039 MYO6 0.780 0.037 NCOA1 0.787 0.040 NCOR1 0.876 0.020 NDRG1 0.761 <.001 NFAT5 0.770 0.032 NFKBIA 0.799 0.018 NME2 0.753 0.005 NUP62 0.842 0.032 OAZ1 0.803 0.043 OLFML2B 0.745 0.023 OLFML3 0.743 0.009 OSM 0.726 0.018 PCA3 0.714 0.019 PECAMI 0.774 0.023 PIK3C2A 0.768 0.001 PIM1 0.725 0.011 PLOD2 0.713 0.008 PPP3CA 0.768 0.040 PROMI 0.482 <.001 PTEN 0.807 0.012 PTGS2 0.726 0.011 PTTG1 0.729 0.006 PYCARD 0.783 0.012 RAB30 0.730 0.002 RAGE 0.792 0.012 RFX1 0.789 0.016 0.792 0.010 RGS1O 0.781 0.017 RUNX1 0.747 0.007 SDHC 0.827 0.036 SEC23A 0.752 0.010

Table 10B cRFI bRFI Official Symbol HR p-value HR p-value SEPT9 0.889 0.006 SERPINA3 0.738 0.013 SLC25A21 0.788 0.045 SMARCD1 0.788 0.010 0.733 0.007 SMO 0.813 0.035 SRC 0.758 0.026 SRD5A2 0.738 0.005 ST5 0.767 0.022 STAT5A 0.784 0.039 TGFB2 0.771 0.027 TGFB3 0.752 0.036 THBS2 0.751 0.015 TNFRSF1OB 0.739 0.010 TPX2 0.754 0.023 TRAF3IP2 0.774 0.015 TRAMI 0.868 <.001 0.880 <.001 TRIM14 0.785 0.047 TUBB2A 0.705 0.010 TYMP 0.778 0.024 UAP1 0.721 0.013 UTP23 0.763 0.007 0.826 0.018 VCL 0.837 0.040 VEGFA 0.755 0.009 WDR19 0.724 0.005 YBX1 0.786 0.027 ZFP36 0.744 0.032 ZNF827 0.770 0.043 1 1 1

[00144] Table 11 provides genes that are significantly associated (p<0.05) with cRFI or bRFI after adjustment for Gleason pattern or highest Gleason pattern. Table 11 Genes significantly (p<0.05) associated with cRFIor bRFI after adjustment for Gleason pattern in the primary Gleason pattern or highest Gleason pattern Some HR <= 1.0 and some HR > 1.0 Table 11 cRFI bRFI bRFI Highest Pattern Primary Pattern Highest Pattern Official Symbol HR p-value HR p-value HR p-value HSPA5 0.710 0.009 1.288 0.030 ODC1 0.741 0.026 1.343 0.004 1.261 0.046

[00145] Tables 12A and 12B provide genes that are significantly associated (p<0.05) with prostate cancer specific survival (PCSS) in the primary Gleason pattern. Increased expression of genes in Table 12A is negatively associated with good prognosis, while increased expression of genes in Table 12B is positively associated with good prognosis. Table 12A Genes significantly (p<0.05) associated with prostate cancer specific survival (PCSS) in the Primary Gleason Pattern HR > 1.0 (Increased expression is negatively associated with good prognosis) Table 12A Official Official Symbol HR p-value Symbol HR p-value AKR1C3 1.476 0.016 GREMI 1.942 <.001 ANLN 1.517 0.006 IF130 1.482 0.048 APOCI 1.285 0.016 IGFBP3 1.513 0.027 APOE 1.490 0.024 INHBA 3.060 <.001 ASPN 3.055 <.001 KIF4A 1.355 0.001 ATP5E 1.788 0.012 KLK14 1.187 0.004 AURKB 1.439 0.008 LAPTM5 1.613 0.006 BGN 2.640 <.001 LTBP2 2.018 <.001 BIRC5 1.611 <.001 MMP11 1.869 <.001 BMP6 1.490 0.021 MYBL2 1.737 0.013 BRCA1 1.418 0.036 NEK2 1.445 0.028 CCNB1 1.497 0.021 NOX4 2.049 <.001 CD276 1.668 0.005 OLFML2B 1.497 0.023 CDC20 1.730 <.001 PLK1 1.603 0.006 CDH11 1.565 0.017 POSTN 2.585 <.001 CDH7 1.553 0.007 PPFIA3 1.502 0.012 CDKN2B 1.751 0.003 PTK6 1.527 0.009 CDKN2C 1.993 0.013 PTTG1 1.382 0.029 CDKN3 1.404 0.008 RAD51 1.304 0.031 CENPF 2.031 <.001 RGS7 1.251 <.001 CHAF1A 1.376 0.011 RRM2 1.515 <.001 CKS2 1.499 0.031 SATI 1.607 0.004 COL1A1 2.574 <.001 SDC1 1.710 0.007 COL1A2 1.607 0.011 SESN3 1.399 0.045 COL3A1 2.382 <.001 SFRP4 2.384 <.001 COL4A1 1.970 <.001 SHMT2 1.949 0.003 COL5A2 1.938 0.002 SPARC 2.249 <.001 COL8A1 2.245 <.001 STMN1 1.748 0.021 CTHRC1 2.085 <.001 SULF1 1.803 0.004 CXCR4 1.783 0.007 THBS2 2.576 <.001 DDIT4 1.535 0.030 THY1 1.908 0.001 DYNLL1 1.719 0.001 TK1 1.394 0.004 F2R 2.169 <.001 TOP2A 2.119 <.001 FAM171B 1.430 0.044 TPX2 2.074 0.042 FAP 1.993 0.002 UBE2C 1.598 <.001

Table 12A Official Official Symbol HR p-value Symbol HR p-value FCGR3A 2.099 <.001 UGT2B15 1.363 0.016 FN1 1.537 0.024 UHRF1 1.642 0.001 GPR68 1.520 0.018 ZWINT 1.570 0.010

Table 12B Genes significantly (p<0.05) associated with prostate cancer specific survival (PCSS) in the Primary Gleason Pattern HR < 1.0 (Increased expression is positively associated with good prognosis) Table 12B Official Official Symbol HR p-value Symbol HR p-value AAMP 0.649 0.040 IGFBP6 0.578 0.003 ABCA5 0.777 0.015 IL2 0.528 0.010 ABCG2 0.715 0.037 IL6ST 0.574 <.001 ACOX2 0.673 0.016 IL8 0.540 0.001 ADH5 0.522 <.001 ING5 0.688 0.015 ALDH1A2 0.561 <.001 ITGA6 0.710 0.005 AMACR 0.693 0.029 ITGA7 0.676 0.033 AMPD3 0.750 0.049 JUN 0.506 0.001 ANPEP 0.531 <.001 KIT 0.628 0.047 ATXN1 0.640 0.011 KLK1 0.523 0.002 AXIN2 0.657 0.002 KLK2 0.581 <.001 AZGP1 0.617 <.001 KLK3 0.676 <.001 BDKRB1 0.553 0.032 KRT15 0.684 0.005 BINI 0.658 <.001 KRT18 0.536 <.001 BTRC 0.716 0.011 KRT5 0.673 0.004 C7 0.531 <.001 KRT8 0.613 0.006 CADMI 0.646 0.015 LAMB3 0.740 0.027 CASP7 0.538 0.029 LGALS3 0.678 0.007 CCNH 0.674 0.001 MGSTl 0.640 0.002 CD164 0.606 <.001 MPPED2 0.629 <.001 CD44 0.687 0.016 MTSS1 0.705 0.041 CDK3 0.733 0.039 MYBPC1 0.534 <.001 CHN1 0.653 0.014 NCAPD3 0.519 <.001 COL6A1 0.681 0.015 NFAT5 0.536 <.001 CSF1 0.675 0.019 NRG1 0.467 0.007 CSRP1 0.711 0.007 OLFML3 0.646 0.001 CXCL12 0.650 0.015 OMD 0.630 0.006 CYP3A5 0.507 <.001 OR51E2 0.762 0.017 CYR61 0.569 0.007 PAGE4 0.518 <.001 DLGAP1 0.654 0.004 PCA3 0.581 <.001 DNM3 0.692 0.010 PGF 0.705 0.038 DPP4 0.544 <.001 PPAP2B 0.568 <.001 DPT 0.543 <.001 PPP1R12A 0.694 0.017 DUSPI 0.660 0.050 PRIMAl 0.678 0.014

Table 12B Official Official Symbol HR p-value Symbol HR p-value DUSP6 0.699 0.033 PRKCA 0.632 0.001 EGRI 0.490 <.001 PRKCB 0.692 0.028 EGR3 0.561 <.001 PROMI 0.393 0.017 EIF5 0.720 0.035 PTEN 0.689 0.002 ERBB3 0.739 0.042 PTGS2 0.611 0.004 FAAH 0.636 0.010 PTH1R 0.629 0.031 FAM107A 0.541 <.001 RAB27A 0.721 0.046 FAM13C 0.526 <.001 RND3 0.678 0.029 FAS 0.689 0.030 RNF114 0.714 0.035 FGF1O 0.657 0.024 SDHC 0.590 <.001 FKBP5 0.699 0.040 SERPINA3 0.710 0.050 FLNC 0.742 0.036 SH3RF2 0.570 0.005 FOS 0.556 0.005 SLC22A3 0.517 <.001 FOXQ1 0.666 0.007 SMAD4 0.528 <.001 GADD45B 0.554 0.002 SMO 0.751 0.026 GDF15 0.659 0.009 SRC 0.667 0.004 GHR 0.683 0.027 SRD5A2 0.488 <.001 GPM6B 0.666 0.005 STAT5B 0.700 0.040 GSN 0.646 0.006 SVIL 0.694 0.024 GSTM1 0.672 0.006 TFF3 0.701 0.045 GSTM2 0.514 <.001 TGFB1Il 0.670 0.029 HGD 0.771 0.039 TGFB2 0.646 0.010 HIRIP3 0.730 0.013 TNFRSF1OB 0.685 0.014 HK1 0.778 0.048 TNFSF10 0.532 <.001 HLF 0.581 <.001 TPM2 0.623 0.005 HNF1B 0.643 0.013 TRO 0.767 0.049 HSD17B1O 0.742 0.029 TUBB2A 0.613 0.003 IER3 0.717 0.049 VEGFB 0.780 0.034 IGF1 0.612 <.001 ZFP36 0.576 0.001 ZNF827 0.644 0.014

[00146] Analysis of gene expression and upgrading/upstaging was based on univariate ordinal logistic regression models using weighted maximum likelihood estimators for each gene in the gene list (727 test genes and 5 reference genes). P-values were generated using a Wald test of the null hypothesis that the odds ratio (OR) is one. Both unadjusted p-values and the q value (smallest FDR at which the hypothesis test in question is rejected) were reported. Un adjusted p-values <0.05 were considered statistically significant. Since two tumor specimens were selected for each patient, this analysis was performed using the 2 specimens from each patient as follows: (1) analysis using the primary Gleason pattern specimen from each patient

(Specimens Al and B2 as described in Table 2); and (2) analysis using the highest Gleason pattern specimen from each patient (Specimens Al and B1 as described in Table 2). 200 genes were found to be significantly associated (p<0.05) with upgrading/upstaging in the primary Gleason pattern sample (PGP) and 203 genes were found to be significantly associated (p<0.05) with upgrading/upstaging in the highest Gleason pattern sample (HGP).

[00147] Tables 13A and 13B provide genes significantly associated (p<0.05), positively or negatively, with upgrading/upstaging in the primary and/or highest Gleason pattern. Increased expression of genes in Table 13A is positively associated with higher risk of upgrading/upstaging (poor prognosis), while increased expression of genes in Table 13B is negatively associated with risk of upgrading/upstaging (good prognosis).

TABLE 13A Genes significantly (p<0.05) associated with upgrading/upstaging in the Primary Gleason Pattern (PGP) and Highest Gleason Pattern (HGP) OR > 1.0 (Increased expression is positively associated with higher risk of upgrading/upstaging (poor prognosis))

Table 13A PGP HGP Gene OR p-value OR p-value ALCAM 1.52 0.0179 1.50 0.0184 ANLN 1.36 0.0451 APOE 1.42 0.0278 1.50 0.0140 ASPN 1.60 0.0027 2.06 0.0001 AURKA 1.47 0.0108 AURKB . . 1.52 0.0070 BAX . . 1.48 0.0095 BGN 1.58 0.0095 1.73 0.0034 BIRC5 1.38 0.0415 BMP6 1.51 0.0091 1.59 0.0071 BUBI 1.38 0.0471 1.59 0.0068 CACNAlD 1.36 0.0474 1.52 0.0078 CASP7 . . 1.32 0.0450 CCNE2 1.54 0.0042 .

CD276 . . 1.44 0.0265 CDC20 1.35 0.0445 1.39 0.0225 CDKN2B . . 1.36 0.0415 CENPF 1.43 0.0172 1.48 0.0102 CLTC 1.59 0.0031 1.57 0.0038

Table 13A PGP HGP Gene OR p-value OR p-value COL1A1 1.58 0.0045 1.75 0.0008 COL3A1 1.45 0.0143 1.47 0.0131 COL8A1 1.40 0.0292 1.43 0.0258 CRISP3 . . 1.40 0.0256 CTHRC1 . . 1.56 0.0092 DBN1 1.43 0.0323 1.45 0.0163 DIAPHI 1.51 0.0088 1.58 0.0025 DICERI . . 1.40 0.0293 D102 . . 1.49 0.0097 DVL1 . . 1.53 0.0160 F2R 1.46 0.0346 1.63 0.0024 FAP 1.47 0.0136 1.74 0.0005 FCGR3A . . 1.42 0.0221 HPN . . 1.36 0.0468 HSD17B4 . . 1.47 0.0151 HSPA8 1.65 0.0060 1.58 0.0074 ILI1 1.50 0.0100 1.48 0.0113 ILIB 1.41 0.0359 INHBA 1.56 0.0064 1.71 0.0042 KHDRBS3 1.43 0.0219 1.59 0.0045 KIF4A . . 1.50 0.0209 KPNA2 1.40 0.0366 KRT2 . . 1.37 0.0456 KRT75 . . 1.44 0.0389 MANF . . 1.39 0.0429 MELK 1.74 0.0016 MK167 1.35 0.0408 MMP11 . . 1.56 0.0057 NOX4 1.49 0.0105 1.49 0.0138 PLAUR 1.44 0.0185 PLK1 . . 1.41 0.0246 PTK6 . . 1.36 0.0391 RAD51 . . 1.39 0.0300 RAFI . . 1.58 0.0036 RRM2 1.57 0.0080 .

SESN3 1.33 0.0465 .

SFRP4 2.33 <0.0001 2.51 0.0015 SKIL 1.44 0.0288 1.40 0.0368 SOX4 1.50 0.0087 1.59 0.0022

Table 13A PGP HGP Gene OR p-value OR p-value SPINKI 1.52 0.0058

. SPP1 . . 1.42 0.0224 THBS2 . . 1.36 0.0461 TK1 . . 1.38 0.0283 TOP2A 1.85 0.0001 1.66 0.0011 TPD52 1.78 0.0003 1.64 0.0041 TPX2 1.70 0.0010 UBE2G1 1.38 0.0491 UBE2T 1.37 0.0425 1.46 0.0162 UHRF1 . . 1.43 0.0164 VCPIP1 . . 1.37 0.0458

TABLE 13B Genes significantly (p<0.05) associated with upgrading/upstaging in the Primary Gleason Pattern (PGP) and Highest Gleason Pattern (HGP) OR < 1.0 (Increased expression is negatively associated with higher risk of upgrading/upstaging (good prognosis))

Table 13B PGP HGP Gene OR p-value OR p-value ABCC3 . . 0.70 0.0216 ABCC8 0.66 0.0121 ABCG2 0.67 0.0208 0.61 0.0071 ACE . . 0.73 0.0442 ACOX2 0.46 0.0000 0.49 0.0001 ADH5 0.69 0.0284 0.59 0.0047 AIGI . . 0.60 0.0045 AKR1C1 . . 0.66 0.0095 ALDH1A2 0.36 <0.0001 0.36 <0.0001 ALKBH3 0.70 0.0281 0.61 0.0056 ANPEP . . 0.68 0.0109 ANXA2 0.73 0.0411 0.66 0.0080 APC . . 0.68 0.0223 ATXN1 . . 0.70 0.0188 AXIN2 0.60 0.0072 0.68 0.0204 AZGP1 0.66 0.0089 0.57 0.0028 BCL2 . . 0.71 0.0182 BINI 0.55 0.0005 .

BTRC 0.69 0.0397 0.70 0.0251 C7 0.53 0.0002 0.51 <0.0001

Table 13B PGP HGP Gene OR p-value OR p-value CADMI 0.57 0.0012 0.60 0.0032 CASPI 0.64 0.0035 0.72 0.0210 CAVI 0.64 0.0097 0.59 0.0032 CAV2 . . 0.58 0.0107 CD164 . . 0.69 0.0260 CD82 0.67 0.0157 0.69 0.0167 CDH1 0.61 0.0012 0.70 0.0210 CDK14 0.70 0.0354 CDK3 . . 0.72 0.0267 CDKN1C 0.61 0.0036 0.56 0.0003 CHN1 0.71 0.0214 COL6A1 0.62 0.0125 0.60 0.0050 COL6A3 0.65 0.0080 0.68 0.0181 CSRP1 0.43 0.0001 0.40 0.0002 CTSB 0.66 0.0042 0.67 0.0051 CTSD 0.64 0.0355 CTSK 0.69 0.0171 CTSL1 0.72 0.0402 CUL1 0.61 0.0024 0.70 0.0120 CXCL12 0.69 0.0287 0.63 0.0053 CYP3A5 0.68 0.0099 0.62 0.0026 DDR2 0.68 0.0324 0.62 0.0050 DES 0.54 0.0013 0.46 0.0002 DHX9 0.67 0.0164 DLGAP1 . . 0.66 0.0086 DPP4 0.69 0.0438 0.69 0.0132 DPT 0.59 0.0034 0.51 0.0005 DUSPI . . 0.67 0.0214 EDNI . . 0.66 0.0073 EDNRA 0.66 0.0148 0.54 0.0005 EIF2C2 . . 0.65 0.0087 ELK4 0.55 0.0003 0.58 0.0013 ENPP2 0.65 0.0128 0.59 0.0007 EPHA3 0.71 0.0397 0.73 0.0455 EPHB2 0.60 0.0014 .

EPHB4 0.73 0.0418 .

EPHX3 . . 0.71 0.0419 ERCC1 0.71 0.0325 .

FAM107A 0.56 0.0008 0.55 0.0011

Table 13B PGP HGP Gene OR p-value OR p-value FAM13C 0.68 0.0276 0.55 0.0001 FAS 0.72 0.0404 FBN1 0.72 0.0395 FBXW7 0.69 0.0417 FGF1O 0.59 0.0024 0.51 0.0001 FGF7 0.51 0.0002 0.56 0.0007 FGFR2 0.54 0.0004 0.47 <0.0001 FLNA 0.58 0.0036 0.50 0.0002 FLNC 0.45 0.0001 0.40 <0.0001 FLT4 0.61 0.0045 FOXO1 0.55 0.0005 0.53 0.0005 FOXP3 0.71 0.0275 0.72 0.0354 GHR 0.59 0.0074 0.53 0.0001 GNRH1 0.72 0.0386 GPM6B 0.59 0.0024 0.52 0.0002 GSN 0.65 0.0107 0.65 0.0098 GSTM1 0.44 <0.0001 0.43 <0.0001 GSTM2 0.42 <0.0001 0.39 <0.0001 HLF 0.46 <0.0001 0.47 0.0001 HPS1 0.64 0.0069 0.69 0.0134 HSPA5 0.68 0.0113 HSPB2 0.61 0.0061 0.55 0.0004 HSPG2 0.70 0.0359 ID3 . . 0.70 0.0245 IGF1 0.45 <0.0001 0.50 0.0005 IGF2 0.67 0.0200 0.68 0.0152 IGFBP2 0.59 0.0017 0.69 0.0250 IGFBP6 0.49 <0.0001 0.64 0.0092 IL6ST 0.56 0.0009 0.60 0.0012 ILK 0.51 0.0010 0.49 0.0004 ITGA1 0.58 0.0020 0.58 0.0016 ITGA3 0.71 0.0286 0.70 0.0221 ITGA5 . . 0.69 0.0183 ITGA7 0.56 0.0035 0.42 <0.0001 ITGB1 0.63 0.0095 0.68 0.0267 ITGB3 0.62 0.0043 0.62 0.0040 ITPR1 0.62 0.0032 .

JUN 0.73 0.0490 0.68 0.0152 KIT 0.55 0.0003 0.57 0.0005

Table 13B PGP HGP Gene OR p-value OR p-value KLC1 . . 0.70 0.0248 KLK1 . . 0.60 0.0059 KRT15 0.58 0.0009 0.45 <0.0001 KRT5 0.70 0.0262 0.59 0.0008 LAMA4 0.56 0.0359 0.68 0.0498 LAMB3 . . 0.60 0.0017 LGALS3 0.58 0.0007 0.56 0.0012 LRP1 0.69 0.0176 MAP3K7 0.70 0.0233 0.73 0.0392 MCM3 0.72 0.0320

. MMP2 0.66 0.0045 0.60 0.0009 MMP7 0.61 0.0015 0.65 0.0032 MMP9 0.64 0.0057 0.72 0.0399 MPPED2 0.72 0.0392 0.63 0.0042 MTA1 . . 0.68 0.0095 MTSS1 0.58 0.0007 0.71 0.0442 MVP 0.57 0.0003 0.70 0.0152 MYBPC1 . . 0.70 0.0359 NCAM1 0.63 0.0104 0.64 0.0080 NCAPD3 0.67 0.0145 0.64 0.0128 NEXN 0.54 0.0004 0.55 0.0003 NFAT5 0.72 0.0320 0.70 0.0177 NUDT6 0.66 0.0102 OLFML3 0.56 0.0035 0.51 0.0011 OMD 0.61 0.0011 0.73 0.0357 PAGE4 0.42 <0.0001 0.36 <0.0001 PAK6 0.72 0.0335 PCDHGB7 0.70 0.0262 0.55 0.0004 PGF 0.72 0.0358 0.71 0.0270 PLP2 0.66 0.0088 0.63 0.0041 PPAP2B 0.44 <0.0001 0.50 0.0001 PPP1R12A 0.45 0.0001 0.40 <0.0001 PRIMAl . . 0.63 0.0102 PRKAR2B 0.71 0.0226 .

PRKCA 0.34 <0.0001 0.42 <0.0001 PRKCB 0.66 0.0120 0.49 <0.0001 PROMI 0.61 0.0030 .

PTEN 0.59 0.0008 0.55 0.0001 PTGER3 0.67 0.0293 .

Table 13B PGP HGP Gene OR p-value OR p-value PTH1R 0.69 0.0259 0.71 0.0327 PTK2 0.75 0.0461 PTK2B 0.70 0.0244 0.74 0.0388 PYCARD 0.73 0.0339 0.67 0.0100 RAD9A 0.64 0.0124 RARB 0.67 0.0088 0.65 0.0116 RGS1O 0.70 0.0219 RHOB . . 0.72 0.0475 RND3 . . 0.67 0.0231 SDHC 0.72 0.0443 SEC23A 0.66 0.0101 0.53 0.0003 SEMA3A 0.51 0.0001 0.69 0.0222 SH3RF2 0.55 0.0002 0.54 0.0002 SLC22A3 0.48 0.0001 0.50 0.0058 SMAD4 0.49 0.0001 0.50 0.0003 SMARCC2 0.59 0.0028 0.65 0.0052 SMO 0.60 0.0048 0.52 <0.0001 SORBS1 0.56 0.0024 0.48 0.0002 SPARCL1 0.43 0.0001 0.50 0.0001 SRD5A2 0.26 <0.0001 0.31 <0.0001 ST5 0.63 0.0103 0.52 0.0006 STAT5A 0.60 0.0015 0.61 0.0037 STAT5B 0.54 0.0005 0.57 0.0008 SUMOl 0.65 0.0066 0.66 0.0320 SVIL 0.52 0.0067 0.46 0.0003 TGFB1Il 0.44 0.0001 0.43 0.0000 TGFB2 0.55 0.0007 0.58 0.0016 TGFB3 0.57 0.0010 0.53 0.0005 TIMP1 0.72 0.0224 TIMP2 0.68 0.0198 0.69 0.0206 TIMP3 0.67 0.0105 0.64 0.0065 TMPRSS2 . . 0.72 0.0366 TNFRSF1OA 0.71 0.0181 TNFSF1O 0.71 0.0284 .

TOP2B 0.73 0.0432 .

TP63 0.62 0.0014 0.50 <0.0001 TPM1 0.54 0.0007 0.52 0.0002 TPM2 0.41 <0.0001 0.40 <0.0001 TPP2 0.65 0.0122 .

Table 13B PGP HGP Gene OR p-value OR p-value TRA2A 0.72 0.0318 TRAF3IP2 0.62 0.0064 0.59 0.0053 TRO 0.57 0.0003 0.51 0.0001 VCL 0.52 0.0005 0.52 0.0004 VIM 0.65 0.0072 0.65 0.0045 WDR19 0.66 0.0097

. WFDC1 0.58 0.0023 0.60 0.0026 ZFHX3 0.69 0.0144 0.62 0.0046 ZNF827 0.62 0.0030 0.53 0.0001

EXAMPLE 3: IDENTIFICATION OF MICRoRNAs ASSOCIATED WITH CLINICAL RECURRENCE AND DEATH DUE TO PROSTATE CANCER

[00148] MicroRNAs function by binding to portions of messenger RNA (mRNA) and changing how frequently the mRNA is translated into protein. They can also influence the

turnover of mRNA and thus how long the mRNA remains intact in the cell. Since microRNAs

function primarily as an adjunct to mRNA, this study evaluated the joint prognostic value of

microRNA expression and gene (mRNA) expression. Since the expression of certain microRNAs

may be a surrogate for expression of genes that are not in the assessed panel, we also evaluated

the prognostic value of microRNA expression by itself.

Patients and Samples

[00149] Samples from the 127 patients with clinical recurrence and 374 patients without

clinical recurrence after radical prostatectomy described in Example 2 were used in this study.

The final analysis set comprised 416 samples from patients in which both gene expression and

microRNA expression were successfully assayed. Of these, 106 patients exhibited clinical

recurrence and 310 did not have clinical recurrence. Tissue samples were taken from each

prostate sample representing (1) the primary Gleason pattern in the sample, and (2) the highest

Gleason pattern in the sample. In addition, a sample of histologically normal-appearing tissue

adjacent to the tumor (NAT) was taken. The number of patients in the analysis set for each

tissue type and the number of them who experienced clinical recurrence or death due to prostate

cancer are shown in Table 14.

Table 14. Number of Patients and Events in Analysis Set

Deaths Due to Patients Clinical Recurrences Prostate Cancer Primary Gleason Pattern Tumor Tissue 416 106 36

Highest Gleason Pattern Tumor Tissue 405 102 36

Normal Adjacent 364 81 29 Tissue

Assay Method

[00150] Expression of 76 test microRNAs and 5 reference microRNAs were determined from RNA extracted from fixed paraffin-embedded (FPE) tissue. MicroRNA expression in all three tissue type was quantified by reverse transcriptase polymerase chain reaction (RT-PCR) using the crossing point (Cp) obtained from the Taqman@ MicroRNA Assay kit (Applied Biosystems, Inc., Carlsbad, CA).

Statistical Analysis

[00151] Using univariate proportional hazards regression (Cox DR, Journal of the Royal Statistical Society, Series B 34:187-220, 1972), applying the sampling weights from the cohort sampling design, and using variance estimation based on the Lin and Wei method (Lin and Wei, Journal of the American Statistical Association 84:1074-1078, 1989), microRNA expression, normalized by the average expression for the 5 reference microRNAs hsa-miR-106a, hsa-miR 146b-5p, hsa-miR-191, hsa-miR-19b, and hsa-miR-92a, and reference-normalized gene expression of the 733 genes (including the reference genes) discussed above, were assessed for association with clinical recurrence and death due to prostate cancer. Standardized hazard ratios (the proportional change in the hazard associated with a change of one standard deviation in the covariate value) were calculated.

[00152] This analysis included the following classes of predictors:

[00153] 1. MicroRNAs alone

[00154] 2. MicroRNA-gene pairs Tier 1

[00155] 3. MicroRNA-gene pairs Tier 2

[00156] 4. MicroRNA-gene pairs Tier 3

[00157] 5. All other microRNA-gene pairs Tier 4

[00158] The four tiers were pre-determined based on the likelihood (Tier1 representing the highest likelihood) that the gene-microRNA pair functionally interacted or that the microRNA was related to prostate cancer based on a review of the literature and existing microarray data sets.

[00159] False discovery rates (FDR) (Benjamini and Hochberg, Journal of the Royal Statistical Society, Series B 57:289-300, 1995) were assessed using Efron's separate class methodology (Efron, Annals of Applied Statistics 2:197-223., 2008). The false discovery rate is the expected proportion of the rejected null hypotheses that are rejected incorrectly (and thus are false discoveries). Efron's methodology allows separate FDR assessment (q-values) (Storey, Journal of the Royal Statistical Society, Series B 64:479-498, 2002) within each class while utilizing the data from all the classes to improve the accuracy of the calculation. In this analysis, the q-value for a microRNA or microRNA-gene pair can be interpreted as the empirical Bayes probability that the microRNA or microRNA-gene pair identified as being associated with clinical outcome is in fact a false discovery given the data. The separate class approach was applied to a true discovery rate degree of association (TDRDA) analysis (Crager, Statistics in Medicine 29:33-45, 2010) to determine sets of microRNAs or microRNA-gene pairs that have standardized hazard ratio for clinical recurrence or prostate cancer-specific death of at least a specified amount while controlling the FDR at 10%. For each microRNA or microRNA-gene pair, a maximum lower bound (MLB) standardized hazard ratio was computed, showing the highest lower bound for which the microRNA or microRNA-gene pair was included in a TDRDA set with 10% FDR. Also calculated was an estimate of the true standardized hazard ratio corrected for regression to the mean (RM) that occurs in subsequent studies when the best predictors are selected from a long list (Crager, 2010 above). The RM-corrected estimate of the standardized hazard ratio is a reasonable estimate of what could be expected if the selected microRNA or microRNA-gene pair were studied in a separate, subsequent study.

[00160] These analyses were repeated adjusting for clinical and pathology covariates available at the time of patient biopsy: biopsy Gleason score, baseline PSA level, and clinical T stage (T1-T2A vs. T2B or T2C) to assess whether the microRNAs or microRNA-gene pairs have predictive value independent of these clinical and pathology covariates. Results

[00161] The analysis identified 21 microRNAs assayed from primary Gleason pattern tumor tissue that were associated with clinical recurrence of prostate cancer after radical prostatectomy, allowing a false discovery rate of 10% (Table 15). Results were similar for microRNAs assessed from highest Gleason pattern tumor tissue (Table 16), suggesting that the association of microRNA expression with clinical recurrence does not change markedly depending on the location within a tumor tissue sample. No microRNA assayed from normal adjacent tissue was associated with the risk of clinical recurrence at a false discovery rate of %. The sequences of the microRNAs listed in Tables 15-21 are shown in Table B.

Table 15. MicroRNAs Associated with Clinical Recurrence of Prostate Cancer Primary Gleason Pattern Tumor Tissue Absolute Standardized Hazard Ratio

Direction Uncor- 95% Max. Lower RM q-valuea of Asso- rected Confidence Bound Corrected MicroRNA p-value (FDR) ciationb Estimate Interval @10% FDR Estimate° hsa-miR-93 <0.0001 0.0% (+) 1.79 (1.38, 2.32) 1.19 1.51

hsa-miR-106b <0.0001 0.1% (+) 1.80 (1.38, 2.34) 1.19 1.51

hsa-miR-30e-5p <0.0001 0.1% (-) 1.63 (1.30, 2.04) 1.18 1.46

hsa-miR-21 <0.0001 0.1% (+) 1.66 (1.31, 2.09) 1.18 1.46

hsa-miR-133a <0.0001 0.1% (-) 1.72 (1.33, 2.21) 1.18 1.48

hsa-miR-449a <0.0001 0.1% (+) 1.56 (1.26,1.92) 1.17 1.42

hsa-miR-30a 0.0001 0.1% (-) 1.56 (1.25,1.94) 1.16 1.41

hsa-miR-182 0.0001 0.2% (+) 1.74 (1.31, 2.31) 1.17 1.45

hsa-miR-27a 0.0002 0.2% (+) 1.65 (1.27, 2.14) 1.16 1.43

hsa-miR-222 0.0006 0.5% (-) 1.47 (1.18,1.84) 1.12 1.35

hsa-miR-103 0.0036 2.1% (+) 1.77 (1.21, 2.61) 1.12 1.36

hsa-miR-1 0.0037 2.2% (-) 1.32 (1.10,1.60) 1.07 1.26

hsa-miR-145 0.0053 2.9% (-) 1.34 (1.09, 1.65) 1.07 1.27

hsa-miR-141 0.0060 3.2% (+) 1.43 (1.11, 1.84) 1.07 1.29

hsa-miR-92a 0.0104 4.8% (+) 1.32 (1.07, 1.64) 1.05 1.25

hsa-miR-22 0.0204 7.7% (+) 1.31 (1.03,1.64) 1.03 1.23

hsa-miR-29b 0.0212 7.9% (+) 1.36 (1.03,1.76) 1.03 1.24

hsa-miR-210 0.0223 8.2% (+) 1.33 (1.03,1.70) 1.00 1.23

hsa-miR-486-5p 0.0267 9.4% (-) 1.25 (1.00,1.53) 1.00 1.20

hsa-miR-19b 0.0280 9.7% (-) 1.24 (1.00,1.50) 1.00 1.19

hsa-miR-205 0.0289 10.0% (-) 1.25 (1.00,1.53) 1.00 1.20 aThe q-value is the empirical Bayes probability that the microRNA's association with clinical recurrence is a false discovery, given the data. bDirection of association indicates where higher microRNA expression is associated with higher (+) or lower (-) risk of clinical recurrence. °RM: regression to the mean.

Table 16. MicroRNAs Associated with Clinical Recurrence of Prostate Cancer Highest Gleason Pattern Tumor Tissue

Absolute Standardized Hazard Ratio

Direction Uncor- 95% Max. Lower RM q-valuea of Asso- rected Confidence Bound Corrected MicroRNA p-value (FDR) ciationb Estimate Interval @10% FDR Estimatec hsa-miR-93 <0.0001 0.0% (+) 1.91 (1.48, 2.47) 1.24 1.59 hsa-miR-449a <0.0001 0.0% (+) 1.75 (1.40, 2.18) 1.23 1.54 hsa-miR-205 <0.0001 0.0% (-) 1.53 (1.29, 1.81) 1.20 1.43 hsa-miR-19b <0.0001 0.0% (-) 1.37 (1.19, 1.57) 1.15 1.32 hsa-miR-106b <0.0001 0.0% (+) 1.84 (1.39, 2.42) 1.22 1.51 hsa-miR-21 <0.0001 0.0% (+) 1.68 (1.32, 2.15) 1.19 1.46 hsa-miR-30a 0.0005 0.4% (-) 1.44 (1.17,1.76) 1.13 1.33 hsa-miR-30e-5p 0.0010 0.6% (-) 1.37 (1.14,1.66) 1.11 1.30 hsa-miR-133a 0.0015 0.8% (-) 1.57 (1.19, 2.07) 1.13 1.36 hsa-miR-1 0.0016 0.8% (-) 1.42 (1.14,1.77) 1.11 1.31 hsa-miR-103 0.0021 1.1% (+) 1.69 (1.21, 2.37) 1.13 1.37 hsa-miR-210 0.0024 1.2% (+) 1.43 (1.13,1.79) 1.11 1.31 hsa-miR-182 0.0040 1.7% (+) 1.48 (1.13,1.93) 1.11 1.31 hsa-miR-27a 0.0055 2.1% (+) 1.46 (1.12, 1.91) 1.09 1.30 hsa-miR-222 0.0093 3.2% (-) 1.38 (1.08, 1.77) 1.08 1.27 hsa-miR-331 0.0126 3.9% (+) 1.38 (1.07,1.77) 1.07 1.26 hsa-miR-191* 0.0143 4.3% (+) 1.38 (1.06,1.78) 1.07 1.26 hsa-miR-425 0.0151 4.5% (+) 1.40 (1.06,1.83) 1.07 1.26 hsa-miR-31 0.0176 5.1% (-) 1.29 (1.04,1.60) 1.05 1.22 hsa-miR-92a 0.0202 5.6% (+) 1.31 (1.03,1.65) 1.05 1.23 hsa-miR-155 0.0302 7.6% (-) 1.32 (1.00,1.69) 1.03 1.22 hsa-miR-22 0.0437 9.9% (+) 1.30 (1.00,1.67) 1.00 1.21 aThe q-value is the empirical Bayes probability that the microRNA's association with death due to prostate cancer is a false discovery, given the data. bDirection of association indicates where higher microRNA expression is associated with higher (+) or lower (-) risk of clinical recurrence. cRM: regression to the mean.

[00162] Table 17 shows microRNAs assayed from primary Gleason pattern tissue that were identified as being associated with the risk of prostate-cancer-specific death, with a false discovery rate of 10%. Table 18 shows the corresponding analysis for microRNAs assayed from highest Gleason pattern tissue. No microRNA assayed from normal adjacent tissue was associated with the risk of prostate-cancer-specific death at a false discovery rate of 10%.

Table 17. MicroRNAs Associated with Death Due to Prostate Cancer Primary Gleason Pattern Tumor Tissue

Absolute Standardized Hazard Ratio Max. Lower Direction Uncor- 95% Bound RM q-valuea of Asso- rected Confidence @10% Corrected MicroRNA p-value (FDR) ciationb Estimate Interval FDR Estimate° hsa-miR-30e-5p 0.0001 0.6% (-) 1.88 (1.37, 2.58) 1.15 1.46 hsa-miR-30a 0.0001 0.7% (-) 1.78 (1.33, 2.40) 1.14 1.44 hsa-miR-133a 0.0005 1.2% (-) 1.85 (1.31, 2.62) 1.13 1.41 hsa-miR-222 0.0006 1.4% (-) 1.65 (1.24, 2.20) 1.12 1.38 hsa-miR-106b 0.0024 2.7% (+) 1.85 (1.24, 2.75) 1.11 1.35 hsa-miR-1 0.0028 3.0% (-) 1.43 (1.13,1.81) 1.08 1.30 hsa-miR-21 0.0034 3.3% (+) 1.63 (1.17, 2.25) 1.09 1.33 hsa-miR-93 0.0044 3.9% (+) 1.87 (1.21, 2.87) 1.09 1.32 hsa-miR-26a 0.0072 5.3% (-) 1.47 (1.11, 1.94) 1.07 1.29 hsa-miR-152 0.0090 6.0% (-) 1.46 (1.10,1.95) 1.06 1.28 hsa-miR-331 0.0105 6.5% (+) 1.46 (1.09,1.96) 1.05 1.27 hsa-miR-150 0.0159 8.3% (+) 1.51 (1.07, 2.10) 1.03 1.27 hsa-miR-27b 0.0160 8.3% (+) 1.97 (1.12,3.42) 1.05 1.25 aThe q-value is the empirical Bayes probability that the microRNA's association with death due to prostate cancer endpoint is a false discovery, given the data. bDirection of association indicates where higher microRNA expression is associated with higher (+) or lower (-) risk of death due to prostate cancer. cRM: regression to the mean.

Table 18. MicroRNAs Associated with Death Due to Prostate Cancer Highest Gleason Pattern Tumor Tissue

Absolute Standardized Hazard Ratio Max. Lower Direction Uncor- Bound q-valuea of Asso- rected 95% Confidence @10% RM-Corrected MicroRNA p-value (FDR) ciation Estimate Interval FDR Estimate° hsa-miR-27b 0.0016 6.1% (+) 2.66 (1.45, 4.88) 1.07 1.32 hsa-miR-21 0.0020 6.4% (+) 1.66 (1.21, 2.30) 1.05 1.34 hsa-miR-10a 0.0024 6.7% (+) 1.78 (1.23, 2.59) 1.05 1.34 hsa-miR-93 0.0024 6.7% (+) 1.83 (1.24, 2.71) 1.05 1.34 hsa-miR-106b 0.0028 6.8% (+) 1.79 (1.22, 2.63) 1.05 1.33 hsa-miR-150 0.0035 7.1% (+) 1.61 (1.17, 2.22) 1.05 1.32 hsa-miR-1 0.0104 9.0% (-) 1.52 (1.10, 2.09) 1.00 1.28 aThe q-value is the empirical Bayes probability that the microRNA's association with clinical endpoint is a false discovery, given the data. bDirection of association indicates where higher microRNA expression is associated with higher (+) or lower (-) risk of death due to prostate cancer. °RM: regression to the mean.

[00163] Table 19 and Table 20 shows the microRNAs that can be identified as being associated with the risk of clinical recurrence while adjusting for the clinical and pathology

covariates of biopsy Gleason score, baseline PSA level, and clinical T-stage. The distributions

of these covariates are shown in Figure 1. Fifteen (15) of the microRNAs identified in Table 15

are also present in Table 19, indicating that these microRNAs have predictive value for clinical

recurrence that is independent of the Gleason score, baseline PSA, and clinical T-stage.

[00164] Two microRNAs assayed from primary Gleason pattern tumor tissue were found

that had predictive value for death due to prostate cancer independent of Gleason score, baseline

PSA, and clinical T-stage (Table 21).

Table 19. MicroRNAs Associated with Clinical Recurrence of Prostate Cancer Adjusting for Biopsy Gleason Score, Baseline PSA Level, and Clinical T-Stage Primary Gleason Pattern Tumor Tissue Absolute Standardized Hazard Ratio Max. Lower Direction Uncor- 95% Bound RM q-valuea of Asso- rected Confidence @10% Corrected MicroRNA p-value (FDR) ciation Estimate Interval FDR Estimate° hsa-miR-30e-5p <0.0001 0.0% (-) 1.80 (1.42, 2.27) 1.23 1.53 hsa-miR-30a <0.0001 0.0% (-) 1.75 (1.40, 2.19) 1.22 1.51 hsa-miR-93 <0.0001 0.1% (+) 1.70 (1.32, 2.20) 1.19 1.44 hsa-miR-449a 0.0001 0.1% (+) 1.54 (1.25,1.91) 1.17 1.39 hsa-miR-133a 0.0001 0.1% (-) 1.58 (1.25, 2.00) 1.17 1.39 hsa-miR-27a 0.0002 0.1% (+) 1.66 (1.28, 2.16) 1.17 1.41 hsa-miR-21 0.0003 0.2% (+) 1.58 (1.23, 2.02) 1.16 1.38 hsa-miR-182 0.0005 0.3% (+) 1.56 (1.22,1.99) 1.15 1.37 hsa-miR-106b 0.0008 0.5% (+) 1.57 (1.21, 2.05) 1.15 1.36 hsa-miR-222 0.0028 1.1% (-) 1.39 (1.12,1.73) 1.11 1.28 hsa-miR-103 0.0048 1.7% (+) 1.69 (1.17, 2.43) 1.13 1.32 hsa-miR-486-5p 0.0059 2.0% (-) 1.34 (1.09, 1.65) 1.09 1.25 hsa-miR-1 0.0083 2.7% (-) 1.29 (1.07, 1.57) 1.07 1.23 hsa-miR-141 0.0088 2.8% (+) 1.43 (1.09,1.87) 1.09 1.27 hsa-miR-200c 0.0116 3.4% (+) 1.39 (1.07,1.79) 1.07 1.25 hsa-miR-145 0.0201 5.1% (-) 1.27 (1.03,1.55) 1.05 1.20 hsa-miR-206 0.0329 7.2% (-) 1.40 (1.00,1.91) 1.05 1.23 hsa-miR-29b 0.0476 9.4% (+) 1.30 (1.00,1.69) 1.00 1.20 aThe q-value is the empirical Bayes probability that the microRNA's association with clinical recurrence is a false discovery, given the data. bDirection of association indicates where higher microRNA expression is associated with higher (+) or lower (-) risk of clinical recurrence. °RM: regression to the mean.

Table 20. MicroRNAs Associated with Clinical Recurrence of Prostate Cancer Adjusting for Biopsy Gleason Score, Baseline PSA Level, and Clinical T-Stage Highest Gleason Pattern Tumor Tissue Absolute Standardized Hazard Ratio Max. Lower Direction Uncor- 95% Bound RM q-valuea of Asso- rected Confidence @10% Corrected MicroRNA p-value (FDR) ciation Estimate Interval FDR Estimate° hsa-miR-30a <0.0001 0.0% (-) 1.62 (1.32,1.99) 1.20 1.43 hsa-miR-30e-5p <0.0001 0.0% (-) 1.53 (1.27,1.85) 1.19 1.39 hsa-miR-93 <0.0001 0.0% (+) 1.76 (1.37, 2.26) 1.20 1.45 hsa-miR-205 <0.0001 0.0% (-) 1.47 (1.23,1.74) 1.18 1.36 hsa-miR-449a 0.0001 0.1% (+) 1.62 (1.27, 2.07) 1.18 1.38 hsa-miR-106b 0.0003 0.2% (+) 1.65 (1.26, 2.16) 1.17 1.36 hsa-miR-133a 0.0005 0.2% (-) 1.51 (1.20,1.90) 1.16 1.33 hsa-miR-1 0.0007 0.3% (-) 1.38 (1.15,1.67) 1.13 1.28 hsa-miR-210 0.0045 1.2% (+) 1.35 (1.10,1.67) 1.11 1.25 hsa-miR-182 0.0052 1.3% (+) 1.40 (1.10,1.77) 1.11 1.26 hsa-miR-425 0.0066 1.6% (+) 1.48 (1.12,1.96) 1.12 1.26 hsa-miR-155 0.0073 1.8% (-) 1.36 (1.09,1.70) 1.10 1.24 hsa-miR-21 0.0091 2.1% (+) 1.42 (1.09,1.84) 1.10 1.25 hsa-miR-222 0.0125 2.7% (-) 1.34 (1.06,1.69) 1.09 1.23 hsa-miR-27a 0.0132 2.8% (+) 1.40 (1.07,1.84) 1.09 1.23 hsa-miR-191* 0.0150 3.0% (+) 1.37 (1.06,1.76) 1.09 1.23 hsa-miR-103 0.0180 3.4% (+) 1.45 (1.06,1.98) 1.09 1.23 hsa-miR-31 0.0252 4.3% (-) 1.27 (1.00,1.57) 1.07 1.19 hsa-miR-19b 0.0266 4.5% (-) 1.29 (1.00,1.63) 1.07 1.20 hsa-miR-99a 0.0310 5.0% (-) 1.26 (1.00,1.56) 1.06 1.18 hsa-miR-92a 0.0348 5.4% (+) 1.31 (1.00,1.69) 1.06 1.19 hsa-miR-146b-5p 0.0386 5.8% (-) 1.29 (1.00,1.65) 1.06 1.19 hsa-miR-145 0.0787 9.7% (-) 1.23 (1.00,1.55) 1.00 1.15 aThe q-value is the empirical Bayes probability that the microRNA's association with clinical clinical recurrence is a false discovery, given the data. bDirection of association indicates where higher microRNA expression is associated with higher (+) or lower (-) risk of clinical recurrence. cRM: regression to the mean.

Table 21. MicroRNAs Associated with Death Due to Prostate Cancer Adjusting for Biopsy Gleason Score, Baseline PSA Level, and Clinical T-Stage Primary Gleason Pattern Tumor Tissue

Absolute Standardized Hazard Ratio

Max. Lower Direction Uncor- 95% Bound RM q-valuea of Asso- rected Confidence @10% Corrected MicroRNA p-value (FDR) ciation Estimate Interval FDR Estimate° hsa-miR-30e-5p 0.0001 2.9% (-) 1.97 (1.40, 2.78) 1.09 1.39 hsa-miR-30a 0.0002 3.3% (-) 1.90 (1.36, 2.65) 1.08 1.38 aThe q-value is the empirical Bayes probability that the microRNA's association with clinical recurrence is a false discovery, given the data. bDirection of association indicates where higher microRNA expression is associated with higher (+) or lower (-) risk of clinical recurrence. cRM: regression to the mean.

[00165] Accordingly, the normalized expression levels of hsa-miR-93; hsa-miR-106b; hsa-miR-21; hsa-miR-449a; hsa-miR-182; hsa-miR-27a; hsa-miR-103; hsa-miR-141; hsa-miR 92a; hsa-miR-22; hsa-miR-29b; hsa-miR-210; hsa-miR-331; hsa-miR-191; hsa-miR-425; and hsa-miR-200c are positively associated with an increased risk of recurrence; and hsa-miR-30e

p; hsa-miR-133a; hsa-miR-30a; hsa-miR-222; hsa-miR-1; hsa-miR-145; hsa-miR-486-5p; hsa miR-19b; hsa-miR-205; hsa-miR-31; hsa-miR-155; hsa-miR-206; hsa-miR-99a; and hsa-miR 146b-5p are negatively associated with an increased risk of recurrence.

[00166] Furthermore, the normalized expression levels of hsa-miR-106b; hsa-miR-21;

hsa-miR-93; hsa-miR-331; hsa-miR-150; hsa-miR-27b; and hsa-miR-Oa are positively associated with an increased risk of prostate cancer specific death; and the normalized expression

levels of hsa-miR-30e-5p; hsa-miR-30a; hsa-miR-133a; hsa-miR-222; hsa-miR-1; hsa-miR-26a; and hsa-miR-152 are negatively associated with an increased risk of prostate cancer specific

death.

[00167] Table 22 shows the number of microRNA-gene pairs that were grouped in each

tier (Tiers 1-4) and the number and percentage of those that were predictive of clinical

recurrence at a false discovery rate of 10%.

Table 22. Tier Total Number of Number of Pairs Predictive of Clinical MicroRNA-Gene Pairs Recurrence at False Discovery Rate 10%(%) Tier 1 80 46(57.5%) Tier 2 719 591(82.2%) Tier 3 3,850 2,792 (72.5%) Tier 4 54,724 38,264 (69.9%)

.. U..........< 0........U O ~ rt 0 ~< oU 0 ~ ~ 0L U

0.. . . . . ~~~~~~- U ~ <0 C <-0PCS <CS½< o-o ~ U t ~ ' 0..........<~~

CUE

<0<5<0 0 qU

XX C5 C

C5 C5 ~OOU o~0< EC3

Pp U EU <- UC E-,O~ P0 < EOQ, E- Cc - EP - -u P

Fii 0. 0. QU P. UU P. P. P. 0. 81P. P

UX ~ ~ U U U

.......... ~~0, U0 U- rd U 0dd - U oo - Uo<~ U OO 0 UUO< <-< o ~~ 0 0..........< U O < U ~ U ... .. 0U.. . U0.. U....0....., ~ < UU 0 - E~ ~~~0< < ~ U C 0~

P- P- P. C5 P.l Pfl P-, P. P.b0 P.~NN0 U 0 C5 P. ~ U. 0- P-U P. 0 U U < U 0 .O< 0 0 0 0... U O < ~ U U ~~ C< U uL C0U C-1 U'oU UUN M~ U M0UEO PO PU.~< F5s u P P

0iig 0- U 0- UU ~ F50 U P.' P. uU P.P

~~P 0 IS U ~ ,<0 < < U< U 0 < ~c U- 07 Up 0- U7 0 U < 0 OU O O - <-~ O O U 0 ~-o< ~~~~~~~~~~C U 0 ~~ U 0 ~ U'0~fl-~<~'~ U U ~ 0 U 0 1 -, <~-l-' -U U U <~<- 0 o-U P~ CS< ~> <U U~0~ U ~-' 0 0 U0UU<~-U<<U0<0OU~'U< ~~U<O <UU-'

UUO~~~~~~~~~C ~-~<UUO C <0 0U000UN0 UUU0 0-~'<U0 ~UU0U E-'-' <0 0

U0U~-U~U~-121 t C3~ C~ gQ C

...... U u C

C C3

..... ..... Q5~

...... N0 tT~hT~ PON u C--N Nm CJt~ e C5~~ e O P N eU

CJ~ u ~ ~-~C-5 5 C- j P

O~ mN - ~ OmN ~ThC~lN ~ThC~N- ~ ~mN~Tc - - m - O N- O N ~~~~-C C C p-t pt7h T jO COO N 0 00 O ~ O ...........~ ~ ~ N~ C C ~~ ~~TN~~N 00 ~00 ~ ............ t 000t~Th - N000~h00 ~ ~Th h~h~ 000 0~ 00C - ~l~ - ~~t F5N C5~ u~l~ O N

~O~O~ ~~t~O00 00~O 00 m~O-~ LL

..... .....

..........- ~ ~ CS2

........ 122

F5 S .......... u o CJ C

.... ...... C... G~~ 000.... o~o 3o .. ..

............ .......... ~ 0- -0 ~ 'U 0.. ~< < -' 0< -0 < 0 U .......... ~ t0 l' t0 C ' 0 t0 CN '0 l00 t 0 l' ~~~~~~~~~~~~~~C ~

' m'' 0 OO NN P.~llUt~ O OO N - lll m~

mmmmmmmm~~~~~ F5 m m m m m m mtt' ttttttt ''

CSU C ...... ~ 0 L) Q*Q L)~o~ < 0 ,~ U O ....... < < uo o o0 0 o ............ U<UU~~ ~ ~uo~~U U U 00 ~ Q < ~ - 0~~ UuUUQ

. . .. ..

Miimmm mmm mmm C)m C)m mmm mt mmm mmt'

~ ~0 .......... 0 U U ~ 0 ..........- U uU u 0 U 0 0U ..........- ' 0 ~ u o 0 ~ ~ ..... 0 ~ 0O o U0 0u o cj <o<U< <U ~U0 Q0D QD:

2 ' ~~ -- Clclm m' wt uOON N c CD NOO -- C

tt l l l. qt 0~ mm m 0 m C m m m m 0 ~ m O t0C' mtt ~0C ''tttttt h0t P00 CD0ChOt 0C '' *<o<~Uo b-0-0 ~ F5 ~ UQ ~UU 0-~~0 ~ -'<Q. E~Q000CD

Z , I~ ~'< 0 W, I- Iuu 0 IOoIUtIm

C8 P 00'C

~~OO O NO 0S -- C-l lm 10 r-- cn cn cn '0'O1 N- CN 000 00 ONON 0 - MC~~ m m'

~±CNn 0 C-N1ONOm CO- 0~ l M ~ o0 00! ON ONW-1 m, 0 t ml -11 m1 4Thb4T 00 ClN )O O O

U- 00z O N n~ C-1 mNr

~CJ .... ... . cj~ C .........

j~N N Th ~ ~NNN000~~ l -- cjTC~ ~J ~ h ~~ O~ON N - ~ h~N - - T C5 UC5 NNOOOC~C~~~U

S u 1 8

C5 t J5 - 5 CJ-~

............ _ _ _ _

.... PP-N NN O O C ~ ~ ~ .......... r~ ~ ~ t0C h ~ T h~

Ij-- j 1 x i -c c c P r- ,C C t-4- ,O 00<<00~~-<~ _:I __ d____

.......... ~~~~~~~~~~ ~ ~ t~~h~~ m N I C m N -)~ni~ T C~l U O~ NO0 ~ N - ~ in - ~ i N Th ~ i .......... ........... N i 00 - in ~ - N0 ~ C C ~ r±)0 i C5 00 q~ ON~ii~ ~ nC ~ ~ ~ 00~i00i0000 N n~ O ~t ~ O inC O~~Th'tC5

2d d .......... ...... 124

-~ ~~~~~C Nu~m~ tT~T O~~N

..... .... .... .. .. .. p .. P.C

. ...... t. C .. ... .. .... ...... c C

00 CC C5 00C-J.O C

P. <

c c-...... - - ,C d -d d ~N~T .......... ~~~ ........... ~ - ~O~mN ~NNC~~~t~~ Th~m Th~l OO~N ............ N N N N N N N N N N

Pp p

C-

P.~~ - P. P-m CSP - .P

..... .

!l125

.. . .. . .. . . ..

.............. ... ~m ut C0O' 00Uh P.0 0.0 ~Ot 0~ ~~ 0 ~Ot0 0 000.000.00.0.0 ~~ ~ ~hThOO 0 00.00.00.0 ONN0 0 0000 ~ NO O N N O IC-) U ............ .......... ~ Q .... .... C3 C ...... ..... Il

......... C5 O C3 p--C F5m C-5 ut PQRT~T~ QON PN 00 00 Nu p P- P .. 0.0 0 0 00 0 0 00 0 0000.00 00.00.00.0...00O O N N O P. P CS - P

CJ F5 P

- t

C-) ... .. .

.......... 0~ ~ ~ 00 ~ ~ ~ t0 C ~ ~ ~ 00 ~ O ~ t 0

5 P5

C,0 ON ~-1 C C1 m m 't t `0ThT `0 `0 r-- N- N 0 00 ONN,

..... N 00000..00.0..0 0 0000 0 0 0 0 0 0 00000 N O O N O

~ ~ ~ ~ ~~~~~~~~~~P ............~C~~l~0 O t~tCN-~~ 00~ C5 C CO-hN ~ OC ~ -~ t t~h~ N~~l N~O~h~ OO OO~~ O

~Qt ON U~ CDt't utOO tO t~ 0~ t O~~~ ht0tO

.......... N ~ O 0 t

.......... ....... ON

uu Q

c~ ~ ~ N ON ~C-p C CD C- - CN C_ - C

..... o ..... uC5 C

u <0 uuoL~~Eu o hLsu~~ o$ fl0 <00 -- 0 H<U o 'u <<--UQ~~

uo < s 0 U00 OU <

....... << 0U<< HU5 ~ Qj Q -c <~~,~U 0OH0O 0u s < M G * N-''C- uu g << U u 0 0U0<0 u C u CSue U u~~~~~~C C- u ~.~ OOE< o 0 UUu O r<H O 0U~00~0 u o'Q <U u u u < F-<U 0U U0 HU >u <UO<L0< 0 0<<o<<0U U0< ~ 0U00 $U~UU 0 U <U0 00 Q UU<< UOUU< < U U<0 <O Q UU000O<<UH UUu U 0F-'E< u H< u <uoUF-'0<U C< -< U 5 F5 uF WV~0~0 N N000 HNONO 0 0 000 00 < C- 0 000000 C- uQQQ<0 C4 < u U

ONOONNONNO ONONONONONONO O

0 <0 <U0<GUe U<UU< -' UO 0 a 00 < sU C00OO

< <U0 u < - 00 00U< <O0F-U ~ U U < O0FF- O U < U0OU O - Ou U 0 H< 0< < < U<< U U <U U < O~,-U<OU<

~C~00t0C < < <~t~ 0 <0t0 0~ 0Ch0t0 W < H H 0NN N0<000ONONQO 0 0 0 00000 H 0 00H Q 0 0 00000000H QQ 0 ''-CNCN H fl Cfl CfH H t VWW H 0 HNNN<

.. U....0.P. C<U < U.< 0 *0o <u uU <<$ <F U<

~~ 0 0UU<Q 0<U< UUO<UUM<UF-'

~ >F-' U--UUOF-'< << F--< F-- U< <OUOaH <UU

o mN O0 NinO<N0inO u<0 < m m sr o-r c r<O H ra H u < Q < <0 0 ~~ONNONNO< <NOOOOOO ONONONONOO< <N 0 0 0 0 0 0 0 0 0 00 00 00

C'~t~l<tCU0 < - Ht~ 0 - Cfl< s C' 0 0 < 00 0W Cf<0ClO 0V h 0-m0100u/ O 0- 00 0 0 -0 < 0 0 0 < N 0000<<00000

2 u <U - H < -u- u Uu U uu < 2 cc u u < <00 < -f <

o000x0 eo c2 0 o 0 ~ 0 0

0..........' 'L

...... C5 C5 C3< U U ~ 0 ~ o .......... ~0U CJ<0 00 U0c ~~<00<~C U 0 c-j<0UU ........... C

C-0)~U0~U ~~U~o0- CO oEQ< ~<~< P0.~UuU~ F P.., uU0F5

Pl- C3l~~ u Cl

-.... U i

U~c <U C<S<<

...... U.U...0..U....0 U.... U0 ~ ~ ~ < ~ -' ~ 0~ U .... 0 U.0..0....U..~

< 4 . . .o 0 U.U.....U F5 0 0 U U U0 _ U U < U~U~ ~ <

.. U........O U.. 0. . .U. 0 UU ~ 0< < ~O U OU U E U o UO 0 U

.......... 0 ~ ~ ~ U U ~ U~- ~ ~ o -~< O U

0. 0<k,' ~~~~~~~~~~~~~ 0 U < 0~ 0C5 ~ ' U~ O UP.0 ~CD0 0U ~ U ~ ~ 0<U U U- ~ 0

00 0- Cl5 gllll

-3 u

U~~~1 ~ 10~0~U~ 0 U 0 0r-- UO U

0D OU Ol UOlUU 0 r-- 2 ,r CSU0 UCU UU<: 0S :x-m:< -, U U0 U U U ~ ~-~0<~'U ~ 00~~U~ UU<pl

.6 U :< 00 o~~ U 0 U< 0 0 ~ ~ E I UIO U ~~ U0 U <-U

~ ~ UUUUUUU00-00~~0 01280

.......... ~ 0..........U-~<<U 0

g E~U 0U~0 U ~-' ~ U ~~~ U0C5

C3 tU E-U U U0U <<< U<

<< <U C-), P. uU < U C50u uC3<0<uQU P UU U ,U P

.0........... 0........... > ~ - < U U 0 ~ UO 0 0 < < ~~ < o

< 0~~U 0UU U <U 5U 0 U 0 ........... 0 0 0 ............ < ~ 0 0 ~ U < ........... 0...........' ~< U0 0 0 U- << U U <<0 U U~0 o~~o U0U00 < U 0 U U U~~ U~ ~ Q Q,-< U 0 E- U U~< ~U ~ ~ ~ U~0 <UUU0~UU00U-U<0UUU0UUU

* CD<<U<0 u PU.~<< UUU~~ ~ UU0U. UEu <~UU0U

O~N in~nNViONn -W~ O~n-vnOr NViO~n-Vn Nfl - N- iOuN-i

U. U U- Cr- ozpC C 3 C

0 - U OU OUUOUP UU UU0 O 0 U0 ~0 OU <<tUC5 C P<U

<- C- LU U CO U U PoU%, oo < 0~ u~ C5 UC0< -00 oo~0o~

~ 000~~0U<<U~U0~~0U<OUUoU <E

~ <o<UUUU~~ E~<Uo UU<00~<U<01290

.. . .. . .... .... .. . .. . .. .. ...

............ t0 ~ h t0 C hO ~ 00 C ~ ~ 00 ~ O t 0 ~~~~~~~~~F Pf.~ N 000 ~ ~ - 'N~~

............ ~ o . E ~~~c ...........- ~ ~ ~ ~ 0 O -~ .. ... .. C3 P 0 5

~00 0~ 0~~ ~ ~~0- C3 * ~ ~ E-C~~<< ~~ Q

N ~ ~ ThCflN Cs O' '-~ ~ mN~Th ~ mN CSN00~C - ~TC~ N-~ ~C3

. t C5 P t CJ CS0 ... 0... cu C55 F ......... ........... .... ~ ....

.......... c

~C C5 P.

C-1 C- - t ' t` 0 r- - 1 lC lc t

' .......... __ __ _ __ _ 0 ~ 0 ~ E - E ............ ............ ~t0C~0~ 00 ~ C ~ t0 ~h~t0~N~ .. . .. .. .... ....

CD U T ~ N - 0 N m CC O C-h-N 0 - N C-0

Z.: Nl M r- r- cn r-- cptC r- r-- r- r-- 00 .......... ......... 0 C ~ ' m O ~~ l~lN C

..... C N... .......... N ~ C C- ~ Cm _ o .c

C- C_130

.... .... .. .... .

.......... ...........C- 0 UCU

........... ~~ ~00 ........... ............

, .... .... ......... .......... < < 0 OU 0 0 U0 U~ F5 l<O 5o~ 5~ooo E 0 U 00 ............ ~~c C005< 0 cU< *<0U~'U .......F '<-~Q, U <I-,00 ~-0 U F5 0 <~~00~-UC5~ 0 ............ ~0<0 <~~0~00OU ~U0 P.0E'0-<~0UU~~ u U~<< P__ F5 C50UC<p

P-0 F5O~ 0 C O 0 C O 0 ~ 0 l O t 0 l O ~ 0 l O~ 0 C 0

- Cfl1 M c 'fl 't V~f~ ' 'ON0 00 0

.......... ' ~ 'O O' 'O O O

U0 U5 U< 0, U ½ c -uU ~ c0 H ,<

* j<- < < U~~-~ ~ ~ F< U-O 0F ~t<~-U C5~ F 0 0 ~'< U~ 0

1U U<F-~~~~~~~~ UF 20 G< ol F-1 cn F- U < c - c 0 UFU 0F F -F-UU0U< ..... L.~< F-O0UF f

tF-<- F jd~~ 0o 0 00 U ~F 0 UF---UU-O OOU --

F-U U3 U F-0Q FU--0 UF -OU ~ U ti X0 O <F - <s ~~UF-<C - 0 U-< UUF- F-UCD-~-FF F< U U F0 F CD0 F U P UOUOF0F-0o P. U PO-< U P. F- <U <CD-FF<UU U UF-OP O U

*... <FU= FU F-0=<O 0 UU O U M- U< F-F- U<<c Mo oF-F-UU C8

.. N....N.... fN ~ O Cl V n N nN vnO m N Vi O m - iO

.... .... ..... ....

........ c CJ

3t ...... 00Ph.~0C Ot0 ~'~0Ch t 0Ch~~0C ....... ............ ~ ttT CJ~ u~m T~~~ N N N ~ N 0000 N N N ~ 0 0 ~ ~ 0 - 00 E 0 0 f~ 0 00 00 0

..... .... ........... ..... .. ..... .... ... .. .. ~F P.~~

.. .. . .. C ~C C C 3 C

. . . .n N-:O: ATC ni .ttT ...... i N Thkn 5 ~T CiN Th On N-TC nN hO N00 CC O - - r r in i i~

NN~F N3 NN NtN N NNNNNN 0000 000000

C- Q 0 0 ~0 Q.~ ~ 0j

C- cj

CS Q G ....... CO c p~ C- c

00~~r- C, 010 ~0 ~O~~ C-1O Ct0C1h cn cn0 't'~ '0Nt

.......... ThT~~O N N 00 0~ C ~ ~ ~ - C i fi~ N..N..N N N N N N NN.N NN...0.000.00 0 0 0 0

0. . . ..00. 00 0 CD0 C- - C QD Q P. 5 u

in - O~n N-~ ~ i N- O~inN ThC in N - ~ Oin - C in

- QD~i n~~ t"hf' O~ N000 ~O -- ~~ ~ii~ .......... N N N N N N N N 0 00 0 00 0 00 0 00 0

.... i......~~ n00~CQ 1 ~ ~00"N 0C0 N 00 M~ r-- N - in t- ini 00- m r- ii ~ Nn~ ~ ... 0....... ~ N Th N ~ - n ~ h ~ ' ~ ~~ 0 ~ O~t '

in..n in....n....m0 N N n N NN N .......... N n - ~

- in

0 01 N0 00

......... ... .. .. .. . .. .

.. .. ... C5~

....... 000000...0000000....... ~ ~~~~ ~ CO-O ~ ~ ~ ~~~ C -C5 ~ ~~ ~ h 0 F5 ~ ~ ~ ~CCC ~~O~O tt t0 ~0 ~ C Ct0- t 0 C~ N O 00 t 0Ch tN000 0C ....... 0...~ -

..... .~ ~~ ~~~00~ CP ~ 0 ~ 05 CJ 5 F5 ..... .... 0--E U F5 .......... ~ ~ 00~0~0E-~0 CJ o ~ o .... .... .......... _ _

....... ~~p ~ h ~ Nm ~~ - T~OO N NC-0 ~ h~ N - ~ O m ~ O m CTh-m uTCfN N ~~0000000u 00 000000050CC ~ OC ~~ O C3000C ~ CCC t C5-N~ 0

.. .. . SPC

0C30 ~ 00~ ~Q 0CJ~~E-0

0..... ..... ~0~0 ~ ~ -05 ........ CS ~ 0 ~t0C ~ 5 ~t0C~O~~t0ChO~t0ChO~ t0 ChO~ t 0Ch0~C00

In~~~~ In1 0cr-r- C l1 0r-r- O

-Tcm - - om-~T -~iN ~-~O - - -~ - N- I 1 N14

mZ. r---' m mm-- m 0 - ' ~ ~CJ~ ~0~N0~C ~ ~~IN ~ 00 rt-m 0 N 0 C W) 'Imn0 0- 0 0000 MID rN1Th M rNT'm 0C C im0 iC T~t~~~~N~

- -

...... 133

.......... t0~ 0 ~ O~ 0 ~ 0 C h O ~ t0 C ~ ~ 0 N..........O N 00 0 0 ~ ~ - N NN N t~~

C3 .. .... ..........

........ ..... .... t3 ...........

... ... ..

.......... Q5 5 S N h ~ ~ h ~ - T O N - T ~ N T C N

j CJ

X.~~ C5 t .M .. .TCN . .~ N N......-~ ~N- NTC~NN O N

C N-N cj~ ~ O ON000C NNC N t

........... C N~ ~ C~~~NN C ~ NNN ~~NNN C~~~NN C

t 0 T 00~ P. cj 'C-N COC

u~ Q5

......... X '

N Z: o m --l m r--m r- o m --l mr--c134-

.... U.. .

P- CJ C5 F5 P.~ ........... F

....... 5 F5 o~otCS ...........

.. <........ ~ ~0o~~ <<U QOQQ t'O0 QJ

cj P.r FU CUO UUU<5 C3~ 0U

CS C~ ll ll C ~~ .......... l~~ lClllll~~ t l~ lll lC C~ ll llC 0..... Jc ~~~c 0 - < ~ ~ ~ Uo 0 U O U U ~ ~ '' -o C

~~ U C5U< t <0U5- ~<~< ~~~~ 0 105U)~< 0.. . Q-<Q P- CS~U~E~ CS P- U~ C-0P. P. C

..... ~o ~ 0 ,U ~

Q 0Uu<. ULU

...... P<.0 U UU UU P P- P E E UU - E- Q, ,U P <Q P .E 00 PUU 0 - OUUl N 0 0 Z0.:E'0 <E'- U, M0~~A' UC- Un r0 C, << o U

..... E-'<~0U<U~UU U~UUUU<U0<0~0<~ U UU0U UUU ~ 0 ~ - ~ U 0 k

U~~~~~~~ oo U<<<E~ Uo UOO oO U -p ~U U C3 U-0 Q 0 U~ oUQo0 UU00U< 0 D00 U ~ 00 0

U O < UOP. U

U C- U Uo u UU Uo U 5 5 U U U tU U UU 0o 0U 0 c U <0 c U UU CU O CU U UUU 0- ~~U~O~UC U- <oQ0 < U~~ ~~0 o UU U -C U~0U0 P,< UU~ U 0 U O C- 0

UOO p- 1U U0 UU 0 0< P. po < P. Q 0 0UU 0<U UU~-~ 0U U 0< U<0 U0~-< < -UU 0U< U -0

00.. .t .0C . C~0ClO~ .0l' 0 .t0 0 .l' .~0 .l .C .' 00C . .. Vin' CO NN00O O No - Cr-lflf tt VnW- C ' N 0 0N O

---------------------..... lll..~~ C~ ll~ lC C~ ll llC

zO Pi~- UUIU

OU ~- < O 0 00 00~ U~ 00 0 ~'UU135>

.........

............ ........... U U 0 0 <~

........... ............ ...... ~~0~0U .. 0

............ 0 't 0 C ' O' 0 l' O t 0 l 0 O t 0 Cl ~ O~0 C ........... t t V W 00 ~ 0 N 00 0O N C C Cl l l ......ll~ cj cl~ Cl C l C l l l l C~~ cl C l C ll C l 'N N 'l

............ QQ~< ~0 00~ o UUE.. <~U~ o~ U 0 U U~-UC3 <

F5U 0P. ¾0 U P. 0_ U, c< U

U5 0 0 U ... 0C3U~ ~ U ~ U U~ ~ ~~~~~~c 00C 0- <0)UU ~ ~ 6U0S U ~ ~ ~ U 0 0 ~ 0 ~CO-5<~ ~ U <0-

w:O C - -- CI m m- m ' 'tt N0 00ON 0f'f1 ON OC C -C C0N cl m:mA m m m m m m m m m m m ' t~ t~C m l ICI C C~l Cl l l l C~ll~ C~l~~ll l~l Cl Cll l C N lOQb .U......0<.....U U F5< < - U

0.xxx:UUP - P U U E- U E- E - E-OU<P U UO UU Uu .UP . UOOU -0 <, 0= 0t `0 `0 Ut 0 U1

C-5~'<U~ Q 0D U <<0 U U

U EU P.U 0 C- U UUU<<U UU 0 0S U> P0 . U U U 0C' o0< P'-< PU'00 U0- ) U ' CUU - UC UUUP. U<<U U

mmm CI m mm mm m m m m' Cr 1 Cl C Cl'l C llC lC lCN~~ lll~~ llC llC lC~~~~

:::A:<- <U U- 0~-'U ~ ~ 0U ~ U ~< ~ ~U < 0 <N 0 0 Uo 0 U 0 0

0~~0 UUU U~ ~ ~ 0 UU~~UU <U U <136o

. . .. ..

~ .......... ~O~NN0 .......... t00~0 00 0C3 t0 '~00~O~~ -~mt~ 0 ~ 0~ O O

..... ..... ..... .... ............ 0 ...... Q5 P .....

...... P 0 - 0) 0- 5- C) u P. C5 g C P g -- C-- P

F5 U C P. u P- ~-,C m -~ C m -'h-)N ~ m P.~~T ......... P.~ 00C5C P.N~ P.O~NN U~ ~~-~ CN- P.~ m~t~'~~hO~NN P. P P 5 P. C0 U0 I-,0

C3 '- P- 0 P 0 0-0 0

C_ P_ C_ __ F5 5~00

~~~t00~~~~~P P.hO P.0~h~0 C5 P 0N.~0C~Ot0 C O~t0 ~ ~ ~ 0 P.~hOON .......... 00C~~C t ~ ~ NN0 ...... tN~ cjN~ P.N~ c~~~~

............ F5 c ~ ~ 0 ~0 ~ ~ 0

ut~ tt P. C P.N C ~ ~ ~ C NN C ~N~~ ~ C ~ ~ ~ C NN C

C~~~~~~~~~~~~~C otlO--~C ~OCJ~ 0m~.OO ~~~~N ........... 0 ~ N ~ N ~ nh ~ N ~ 0mm - N N N N C~0 N ~ 0 ....... .......... ..... .... 0....- 0 m- - N - - m c m . ~

........... ......

.......... to .... ....

.. . .. . .. . .. ..

t C5

.. .. ... ... .... .......... .......... O

C5 N N

.......... ~--N C5 F

CS138

TABLE B

nicroRNA sequence SEQ IDNO 1sa-miR-1 UGGAAUGUAAAGAAGUAUGUAU 2629 1sa-miR-103 GCAGCAUUGUACAGGGCUAUGA 2630 1sa-miR-106b JAAAGUGCUGACAGUGCAGAU 2631 1sa-miR-10a JACCCUGUAGAUCCGAAUUUGUG 2632 1sa-miR-133a JUUGGUCCCCUUCAACCAGCUG 2633 1sa-miR-141 JAACACUG UCUGGUAAAGAUGG 2634 1sa-miR-145 GUCCAG UU UUCCCAGGAAUCCCU 2635 1sa-miR-146b-5p UGAGAACUGAAUUCCAUAGGCU 2636 1sa-miR-150 UCUCCCAACCCU UG UACCAG UG 2637 1sa-miR-152 UCAG UGCAUGACAGAACUUGG 2638 1sa-miR-155 UUAAUGCUAAUCG UGAUAGGGG U 2639 1sa-miR-182 UUUGGCAAUGG UAGAACUCACACU 2640 1sa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 2641 1sa-miR-19b UG UAAACAUCCUCGACUGGAAG 2642 1sa-miR-200c UAAUACUGCCGGGUAAUGAUGGA 2643 1sa-miR-205 UCCUUCAUUCCACCGGAGUCUG 2644 1sa-miR-206 UGGAAUGUAAGGAAGUGUGUGG 2645 1sa-miR-21 UAGCUUAUCAGACUGAUGUUGA 2646 1sa-miR-210 CUGUGCGUGUGACAGCGGCUGA 2647 1sa-miR-22 AAGCUGCCAGUUGAAGAACUGU 2648 1sa-miR-222 AGCUACAUCUGGCUACUGGGU 2649 1sa-miR-26a UUCAAGUAAUCCAGGAUAGGCU 2650 1sa-miR-27a UUCACAGUGGCUAAGUUCCGC 2651 1sa-miR-27b UUCACAGUGGCUAAGUUCUGC 2652 1sa-miR-29b UAGCACCAUUUGAAAUCAGUGUU 2653 1sa-miR-30a CUUUCAGUCGGAUGUUUGCAGC 2654 1sa-miR-30e-5p CUUUCAGUCGGAUGUUUACAGC 2655 1sa-miR-31 AGGCAAGAUGCUGGCAUAGCU 2656 1sa-miR-331 GCCCCUGGGCCUAUCCUAGAA 2657 1sa-miR-425 AAUGACACGAUCACUCCCGUUGA 2658 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU 2659 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG 2660 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU 2661 hsa-miR-93 CAAAGUGCUGUUCGUGCAGGUAG 2662 hsa-miR-99a AACCCGUAGAUCCGAUCUUGUG 2663

13 9

[001681 Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers.

[00169] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each of the appended claims.

139a

GHDX‐046_SEQLIST.TXT 11 Mar 2020

SEQUENCE LISTING

<110> Genomic Health, Inc. Shak, Steven Baehner, Frederick L. Maddala, Tara LEE, MARK Pelham, Robert J. Cowens, Wayne 2020201779

Cherbavaz, Diana

<120> Method For Using Gene Expression To Determine Prognosis of Prostate Cancer

<130> GHDX‐046

<150> US 61/485,536 <151> 2011‐05‐12

<150> US 61/414,310 <151> 2010‐11‐16

<150> US 61/368,217 <151> 2010‐07‐27

<160> 2663

<170> FastSEQ for Windows Version 4.0

<210> 1 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1 gtgtggcagg tggacactaa 20

<210> 2 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2 Page 1

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ctccatccac tccaggtctc 20

<210> 3 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 3 cgcttcaaag gaccagacct cctc 24

<210> 4 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 4 gtgtggcagg tggacactaa ggaggaggtc tggtcctttg aagcgggaga cctggagtgg 60 atggag 66

<210> 5 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 5 ggtatggatc ccaaagcca 19

<210> 6 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 6 cagcccgctt tctgttttta 20

<210> 7 <211> 24 <212> DNA <213> Artificial Sequence

Page 2

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 7 cacatgtggc gagcaattcg aact 24

<210> 8 <211> 73 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 8 ggtatggatc ccaaagccaa acagcacatg tggcgagcaa ttcgaactgc atttaaaaac 60 agaaagcggg ctg 73

<210> 9 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 9 aaacaccact ggagcattga 20

<210> 10 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 10 caagcctgga acctatagcc 20

<210> 11 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 11 caagcctgga acctatagcc 20

<210> 12 Page 3

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 12 aaacaccact ggagcattga ctaccaggct cgccaatgat gctgctcaag ttaaaggggc 60 tataggttcc aggcttg 77 2020201779

<210> 13 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 13 tcatggtgcc cgtcaatg 18

<210> 14 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 14 cgattgtctt tgctcttcat gtg 23

<210> 15 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 15 acctgatacg tcttggtctt catcgccat 29

<210> 16 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 4

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 16 tcatggtgcc cgtcaatgct gtgatggcga tgaagaccaa gacgtatcag gtggcccaca 60 tgaagagcaa agacaatcg 79

<210> 17 <211> 22 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 17 tcatcctggc gatctacttc ct 22

<210> 18 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 18 ccgttgagtg gaatcagcaa 20

<210> 19 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 19 tctgtcctgg ctggagtcgc tttcat 26

<210> 20 <211> 91 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 20 tcatcctggc gatctacttc ctctggcaga acctaggtcc ctctgtcctg gctggagtcg 60 ctttcatggt cttgctgatt ccactcaacg g 91

<210> 21 <211> 20 <212> DNA Page 5

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 21 agcgcctgga atctacaact 20

<210> 22 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 22 agagcccctg gagagaagat 20

<210> 23 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 23 cggagtccag tgttttccca ctta 24

<210> 24 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 24 agcgcctgga atctacaact cggagtccag tgttttccca cttatcatct tctctccagg 60 ggctct 66

<210> 25 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 25 cgtctgtcac tgtggagtgg 20 Page 6

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 26 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 26 2020201779

tgatccggtt tagcaggc 18

<210> 27 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 27 agtctcttgg ccaccttcag ccct 24

<210> 28 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 28 cgtctgtcac tgtggagtgg acagggctga aggtggccaa gagactgcac cgcagcctgc 60 taaaccggat ca 72

<210> 29 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 29 ggtctcaacg ccatcctg 18

<210> 30 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 7

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 30 cttggatctt tccttgcagc 20

<210> 31 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 31 acgaagattt gcctccacct gtgg 24

<210> 32 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 32 ggtctcaacg ccatcctggg acccacaggt ggaggcaaat cttcgttatt agatgtctta 60 gctgcaagga aagatccaag 80

<210> 33 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 33 gtagtgggtc tgcatggatg t 21

<210> 34 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 34 tgagggttgg cactcagg 18

<210> 35 <211> 23 Page 8

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 35 caggtggctc ctttgatccc tga 23

<210> 36 2020201779

<211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 36 gtagtgggtc tgcatggatg tttcagggat caaaggagcc acctgggcgc ctgagtgcca 60 accctca 67

<210> 37 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 37 ccgctgtacg aggatttca 19

<210> 38 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 38 ccgtgtctgt gaagccgt 18

<210> 39 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 39 Page 9

GHDX‐046_SEQLIST.TXT 11 Mar 2020

tgccctcagc aatgaagcct acaa 24

<210> 40 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 40 ccgctgtacg aggatttcac tgccctcagc aatgaagcct acaagcagga cggcttcaca 60 gacacgg 67

<210> 41 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 41 atggaggtgc ccagaacac 19

<210> 42 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 42 actccgggta actgtggatg 20

<210> 43 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 43 tgctctcaac tttcctgcgg agtg 24

<210> 44 <211> 66 <212> DNA <213> Artificial Sequence

Page 10

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 44 atggaggtgc ccagaacact gcactccgca ggaaagttga gagcatcatc cacagttacc 60 cggagt 66

<210> 45 <211> 18 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 45 atccgcattg aagaccca 18

<210> 46 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 46 atccgctaga actgcaccac 20

<210> 47 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 47 cccgcagaaa gcacatggta ttcc 24

<210> 48 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 48 atccgcattg aagacccacc ccgcagaaag cacatggtat tcctgggtgg tgcagttcta 60 gcggat 66

Page 11

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 49 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 49 ggcgggatgt ggtaacag 18 2020201779

<210> 50 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 50 atttctgggc ctccgagt 18

<210> 51 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 51 tcagccacaa tcaccaactc caca 24

<210> 52 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 52 ggcgggatgt ggtaacagag accaagactg tggagttggt gattgtggct gatcactcgg 60 aggcccagaa at 72

<210> 53 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 12

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 53 ggacaggtgc aagctcatct g 21

<210> 54 <211> 21 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 54 atctacaacc ttgggctgca a 21

<210> 55 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 55 caagccaaag gcattggcta cttcttcg 28

<210> 56 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 56 ggacaggtgc aagctcatct gccaagccaa aggcattggc tacttcttcg ttttgcagcc 60 caaggttgta gat 73

<210> 57 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 57 atgctgtcat cattgtcacg 20

<210> 58 <211> 19 <212> DNA Page 13

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 58 ctgcttcctt tccctttcc 19

<210> 59 <211> 27 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 59 tgtctgccca ttatcttcat tctgcaa 27

<210> 60 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 60 atgctgtcat cattgtcacg gtttgtctgc ccattatctt cattctgcaa gggaaaggga 60 aaggaagcag 70

<210> 61 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 61 gatgtccatc cttgaaacag c 21

<210> 62 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 62 caaccctgat gcctggag 18 Page 14

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 63 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 63 2020201779

cctccagtgc tgtgttccca gaag 24

<210> 64 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 64 gatgtccatc cttgaaacag cctcttctgg gaacacagca ctggaggtct ccaggcatca 60 gggttg 66

<210> 65 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 65 agcattgatc gatacctggc 20

<210> 66 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 66 ctacaagcat tgtgcgtcg 19

<210> 67 <211> 24 <212> DNA <213> Artificial Sequence

<220> Page 15

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 67 attgttcacc caatgaagtc ccgc 24

<210> 68 <211> 67 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 68 agcattgatc gatacctggc tattgttcac ccaatgaagt cccgccttcg acgcacaatg 60 cttgtag 67

<210> 69 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 69 actggcatag gaaatggtat cc 22

<210> 70 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 70 attgactggg tctctttgcc 20

<210> 71 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 71 ccacccagac cccatgtagc aaaa 24

<210> 72 <211> 76 Page 16

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 72 actggcatag gaaatggtat ccagaatgga attttgctac atggggtctg ggtgggggca 60 aagagaccca gtcaat 76 2020201779

<210> 73 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 73 cgacggttct gccctttat 19

<210> 74 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 74 tgctcctgct gggatactg 19

<210> 75 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 75 aatcgagatg aggacatcgc acca 24

<210> 76 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 76 Page 17

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cgacggttct gccctttata ttaatcgaga tgaggacatc gcaccatcag tatcccagca 60 ggagca 66

<210> 77 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 77 tgtggttgga gatgaagtgg 20

<210> 78 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 78 gtctacccac tgggcaagg 19

<210> 79 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 79 ctccaccagg gaccggttta tcaa 24

<210> 80 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 80 tgtggttgga gatgaagtgg tgttgataaa ccggtccctg gtggagcgag gccttgccca 60 gtgggtagac 70

<210> 81 <211> 21 <212> DNA <213> Artificial Sequence Page 18

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 81 gtgtgtgaag ctgaatgatg g 21

<210> 82 <211> 18 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 82 ctctgcaggc gcataggt 18

<210> 83 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 83 ccaaatccca ggacaggcat gaag 24

<210> 84 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 84 gtgtgtgaag ctgaatgatg gtcacttcat gcctgtcctg ggatttggca cctatgcgcc 60 tgcagag 67

<210> 85 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 85 gctttgcctg atgtctacca gaa 23

Page 19

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 86 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 86 gtccagtcac cggcatagag a 21 2020201779

<210> 87 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 87 tgcgtcacca tccacacaca ggg 23

<210> 88 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 88 gctttgcctg atgtctacca gaagccctgt gtgtggatgg tgacgcagag gacgtctcta 60 tgccggtgac tggac 75

<210> 89 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 89 cgcttctatg gcgctgagat 20

<210> 90 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 20

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 90 tcccggtaca ccacgttctt 20

<210> 91 <211> 24 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 91 cagccctgga ctacctgcac tcgg 24

<210> 92 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 92 cgcttctatg gcgctgagat tgtgtcagcc ctggactacc tgcactcgga gaagaacgtg 60 gtgtaccggg a 71

<210> 93 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 93 tcctgccacc cttcaaacc 19

<210> 94 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 94 ggcggtaaat tcatcatcga a 21

<210> 95 <211> 24 <212> DNA Page 21

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 95 caggtcacgt ccgaggtcga caca 24

<210> 96 <211> 71 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 96 tcctgccacc cttcaaacct caggtcacgt ccgaggtcga cacaaggtac ttcgatgatg 60 aatttaccgc c 71

<210> 97 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 97 ttgtctctgc cttggactat ctaca 25

<210> 98 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 98 ccagcattag attctccaac ttga 24

<210> 99 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 99 tcacggtaca caatctttcc gga 23 Page 22

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 100 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 100 2020201779

ttgtctctgc cttggactat ctacattccg gaaagattgt gtaccgtgat ctcaagttgg 60 agaatctaat gctgg 75

<210> 101 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 101 gaggaatatg gaatccaagg g 21

<210> 102 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 102 gtggcggaga tcaagagg 18

<210> 103 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 103 ccagttcctg ccgtctgctc ttct 24

<210> 104 <211> 66 <212> DNA <213> Artificial Sequence

<220> Page 23

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 104 gaggaatatg gaatccaagg gggccagttc ctgccgtctg ctcttctgcc tcttgatctc 60 cgccac 66

<210> 105 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 105 gatgcagctg gaacccaa 18

<210> 106 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 106 ctccagctca gtggggaa 18

<210> 107 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 107 cctgaaactt gcatctcctg ctgc 24

<210> 108 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 108 gatgcagctg gaacccaagc tgcagcagga gatgcaagtt tcaggatgtt ccccactgag 60 ctggag 66

<210> 109 Page 24

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 109 cacgtctgtc cctctctgct 20 2020201779

<210> 110 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 110 gaccgtggct caactttgta t 21

<210> 111 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 111 tctctgtagg gcccagctct cagg 24

<210> 112 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 112 cacgtctgtc cctctctgct ttctctgtag ggcccagctc tcaggaatac aaagttgagc 60 cacggtc 67

<210> 113 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 25

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 113 tcgcttagtc tgcacctcaa c 21

<210> 114 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 114 tctgagcccc agtttttcc 19

<210> 115 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 115 taaacagggc agtcactttc cgca 24

<210> 116 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 116 tcgcttagtc tgcacctcaa ccgtgcggaa agtgactgcc ctgtttactg aggaaaaact 60 ggggctcaga 70

<210> 117 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 117 agttcctcaa tggtgccaac 20

<210> 118 <211> 18 <212> DNA <213> Artificial Sequence Page 26

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 118 agcactagcc tggagggc 18

<210> 119 <211> 24 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 119 catgctgttg agacgctcga cctc 24

<210> 120 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 120 agttcctcaa tggtgccaac cccatgctgt tgagacgctc gacctctctg ccctccaggc 60 tagtgct 67

<210> 121 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 121 gagctgcagg acttcgtga 19

<210> 122 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 122 gaagcctgag gacttgcg 18

Page 27

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 123 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 123 ccgcatgccg tacacgtaga catc 24 2020201779

<210> 124 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 124 gagctgcagg acttcgtgaa cgatgtctac gtgtacggca tgcggggccg caagtcctca 60 ggcttc 66

<210> 125 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 125 gtctctgggc tgtcagcttt 20

<210> 126 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 126 tgggtataag atccagaact tgc 23

<210> 127 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 28

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 127 tccatgtgtt tgatttctcc tcaggc 26

<210> 128 <211> 80 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 128 gtctctgggc tgtcagcttt cctttctcca tgtgtttgat ttctcctcag gctggtagca 60 agttctggat cttataccca 80

<210> 129 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 129 tggttcatcc agcacaagg 19

<210> 130 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 130 cataaatccg gggcacct 18

<210> 131 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 131 tactctccca acatgcgctg gatc 24

<210> 132 <211> 67 <212> DNA Page 29

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 132 tggttcatcc agcacaaggt ctactctccc aacatgcgct ggatcatcca ggtgccccgg 60 atttatg 67

<210> 133 2020201779

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 133 ccgtgaaagc tgctctgtaa 20

<210> 134 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 134 ttgcagtggg aagaacagtc 20

<210> 135 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 135 aagctgacac agccctccca agtg 24

<210> 136 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 136 ccgtgaaagc tgctctgtaa aagctgacac agccctccca agtgagcagg actgttcttc 60 Page 30

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ccactgcaa 69

<210> 137 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 137 tgaaagtcca aaaccaggaa 20

<210> 138 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 138 cagaaccaag gctatcacca 20

<210> 139 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 139 ccaaagaact cgtgtccctc gagc 24

<210> 140 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 140 tgaaagtcca aaaccaggaa aattccaaag aactcgtgtc cctcgagctg aatctggtga 60 tagccttggt tctg 74

<210> 141 <211> 22 <212> DNA <213> Artificial Sequence

Page 31

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 141 ccaccttgga ccaaagtaaa gc 22

<210> 142 <211> 21 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 142 tctcagcgtc acctggtagg a 21

<210> 143 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 143 ctccccaaca cgctgaaacc cg 22

<210> 144 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 144 ccaccttgga ccaaagtaaa gcgtggaatc gttaccgcct ccccaacacg ctgaaacccg 60 attcctaccg ggtgacgctg aga 83

<210> 145 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 145 caagacacta agggcgacta cca 23

<210> 146 Page 32

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 146 cgtgtcgggc ttcagtcat 19 2020201779

<210> 147 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 147 ccaccacaca ggtacagcag cgct 24

<210> 148 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 148 caagacacta agggcgacta ccagaaagcg ctgctgtacc tgtgtggtgg agatgactga 60 agcccgacac g 71

<210> 149 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 149 ggacagcagg aatgtgtttc 20

<210> 150 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 33

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 150 acccactcga tttgtttctg 20

<210> 151 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 151 cattggctcc ccgtgacctg ta 22

<210> 152 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 152 ggacagcagg aatgtgtttc tccatacagg tcacggggag ccaatggttc agaaacaaat 60 cgagtgggt 69

<210> 153 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 153 gatgaagcct ttcgcaagtt 20

<210> 154 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 154 aggtctccac acagcacaag 20

<210> 155 <211> 21 <212> DNA <213> Artificial Sequence Page 34

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 155 ctttcgggaa gccaggccct t 21

<210> 156 <211> 68 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 156 gatgaagcct ttcgcaagtt cctgaagggc ctggcttccc gaaagcccct tgtgctgtgt 60 ggagacct 68

<210> 157 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 157 ccagcctgat aaaggtcctg 20

<210> 158 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 158 cactctgaat ccttgctgga 20

<210> 159 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 159 aggacaggac ctcccaacca agc 23

Page 35

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 160 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 160 ccagcctgat aaaggtcctg cgggcaggac aggacctccc aaccaagccc tccagcaagg 60 2020201779

attcagagtg 70

<210> 161 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 161 gcctcaagag ctggttcg 18

<210> 162 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 162 cctgcacctt ctccacca 18

<210> 163 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 163 actggcgctg catgtcttcc ac 22

<210> 164 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 36

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 164 gcctcaagag ctggttcgag cccctggtgg aagacatgca gcgccagtgg gccgggctgg 60 tggagaaggt gcagg 75

<210> 165 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 165 gaggtcctgg agtgcgtg 18

<210> 166 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 166 aggtgccagc ttctccct 18

<210> 167 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 167 ccttaagcga ggtcagctcc acca 24

<210> 168 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 168 gaggtcctgg agtgcgtgag cctggtggag ctgacctcgc ttaagggcag ggagaagctg 60 gcacct 66

<210> 169 <211> 18 Page 37

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 169 gtgtgggtgc cagtcctc 18

<210> 170 2020201779

<211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 170 cccttcagcc ctctcaaag 19

<210> 171 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 171 ctccttccct tccccttctc ctga 24

<210> 172 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 172 gtgtgggtgc cagtcctcct caggagaagg ggaagggaag gaggccactt tgagagggct 60 gaaggg 66

<210> 173 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 173 Page 38

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cgacttcacc gcacctgat 19

<210> 174 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 174 tgacacaagt gggactggga ta 22

<210> 175 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 175 accatgccgc cagggtacca ca 22

<210> 176 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 176 cgacttcacc gcacctgatg tgtggtaccc tggcggcatg gtgagcagag tgccctatcc 60 cagtcccact tgtgtca 77

<210> 177 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 177 cagtagagat ccccgcaact 20

<210> 178 <211> 20 <212> DNA <213> Artificial Sequence

Page 39

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 178 acaagcacat ggctatggaa 20

<210> 179 <211> 22 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 179 cttgtccttg ggtcaccctg ca 22

<210> 180 <211> 64 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 180 cagtagagat ccccgcaact cgcttgtcct tgggtcaccc tgcattccat agccatgtgc 60 ttgt 64

<210> 181 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 181 cacggtctcg tggtgaagt 19

<210> 182 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 182 cagttgcttg cccaggac 18

<210> 183 Page 40

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 183 atgccagacc cagacaaagc atca 24 2020201779

<210> 184 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 184 cacggtctcg tggtgaagtc aatgccagac ccagacaaag catcagcttg tcctgggcaa 60 gcaactg 67

<210> 185 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 185 tggtccctag aacaagaggc 20

<210> 186 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 186 tgatggagga tcagagggag 20

<210> 187 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 41

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 187 taaaaccggg ctttcaccca acct 24

<210> 188 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 188 tggtccctag aacaagaggc ttaaaaccgg gctttcaccc aacctgctcc ctctgatcct 60 ccatca 66

<210> 189 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 189 cggcccatca gcttctac 18

<210> 190 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 190 ctctggccaa agatacagcg 20

<210> 191 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 191 ctgggctcca accagcttca gtct 24

<210> 192 <211> 67 <212> DNA <213> Artificial Sequence Page 42

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 192 cggcccatca gcttctacca gctgggctcc aaccagcttc agtctaacgc tgtatctttg 60 gccagag 67

<210> 193 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 193 tggactaatc tgtgggagca 20

<210> 194 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 194 aaacaccctt caacacagtc c 21

<210> 195 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 195 agtatcaccc agggtgcagc cac 23

<210> 196 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 196 tggactaatc tgtgggagca gtttattcca gtatcaccca gggtgcagcc acaccaggac 60 tgtgttgaag ggtgttt 77 Page 43

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 197 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 197 2020201779

tgctttctac acatgttcag gg 22

<210> 198 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 198 gttgtggatc ggctcgtt 18

<210> 199 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 199 ccagctgtct tcgacacttc tcgc 24

<210> 200 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 200 tgctttctac acatgttcag ggatttttca ccagctgtct tcgacacttc tcgcaaacga 60 gccgatccac aac 73

<210> 201 <211> 18 <212> DNA <213> Artificial Sequence

<220> Page 44

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 201 ccgctttcgc tacagcat 18

<210> 202 <211> 21 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 202 tgggagtatc ggatgtagct g 21

<210> 203 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 203 tccagcctgt ctccagtagg ccac 24

<210> 204 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 204 ccgctttcgc tacagcatgg tggcctactg gagacaggct ggactcagct acatccgata 60 ctccca 66

<210> 205 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 205 gtcgaccgac tgaaacgg 18

<210> 206 <211> 18 Page 45

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 206 ctctacttcc ggccctgg 18

<210> 207 2020201779

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 207 ctacccgcca tcgcaatgca ttat 24

<210> 208 <211> 82 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 208 gtcgaccgac tgaaacggcg gcccataatg cattgcgatg gcgggtaggc gtgtgggggc 60 ggagccaggg ccggaagtag ag 82

<210> 209 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 209 gatcgactcc agcaccgtag 20

<210> 210 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 210 Page 46

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gaactgtatc acggccacg 19

<210> 211 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 211 cgggctatgg ctgtcttcaa tcct 24

<210> 212 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 212 gatcgactcc agcaccgtag agaggattga agacagccat agcccgggcg tggccgtgat 60 acagttc 67

<210> 213 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 213 catcttccag gaggaccact 20

<210> 214 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 214 tccgaccttc aatcatttca 20

<210> 215 <211> 24 <212> DNA <213> Artificial Sequence

Page 47

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 215 ctctgtggca ccctggacta cctg 24

<210> 216 <211> 69 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 216 catcttccag gaggaccact ctctgtggca ccctggacta cctgccccct gaaatgattg 60 aaggtcgga 69

<210> 217 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 217 agctgcagaa gagctgcaca t 21

<210> 218 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 218 gcatctgcca actcctccat 20

<210> 219 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 219 tgacgagcag cgaacagcca cg 22

<210> 220 Page 48

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 220 agctgcagaa gagctgcaca tttgacgagc agcgaacagc cacgatcatg gaggagttgg 60 cagatgc 67 2020201779

<210> 221 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 221 ggctatgtct ttgcaccagc 20

<210> 222 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 222 atccgtcagc gcatcact 18

<210> 223 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 223 accagcgcca acgacagtga gata 24

<210> 224 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 49

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 224 ggctatgtct ttgcaccagc caccagcgcc aacgacagtg agatatccag tgatgcgctg 60 acggat 66

<210> 225 <211> 19 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 225 gaggccagct aggaagcaa 19

<210> 226 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 226 caggaagggc agctactgg 19

<210> 227 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 227 tctgagatcc cacattgcct ccaa 24

<210> 228 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 228 gaggccagct aggaagcaag ggttggaggc aatgtgggat ctcagaccca gtagctgccc 60 ttcctg 66

<210> 229 <211> 19 <212> DNA Page 50

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 229 gggtcagggg cctcgagat 19

<210> 230 <211> 21 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 230 ctgctcactc ggctcaaact c 21

<210> 231 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 231 tgggcccaga gcatgttcca gatc 24

<210> 232 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 232 gggtcagggg cctcgagatc gggcttgggc ccagagcatg ttccagatcc cagagtttga 60 gccgagtgag cag 73

<210> 233 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 233 actcctgcaa tgaaccctgt 20 Page 51

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 234 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 234 2020201779

acaaacagct ccccacga 18

<210> 235 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 235 acaccggatt tagctcttgt cggc 24

<210> 236 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 236 actcctgcaa tgaaccctgt tgacaccgga tttagctctt gtcggccttc gtggggagct 60 gtttgt 66

<210> 237 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 237 ccattcccac cattctacct 20

<210> 238 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 52

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 238 gggaacatag acccaccaat 20

<210> 239 <211> 21 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 239 acaccccaga cgtcctggcc t 21

<210> 240 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 240 ccattcccac cattctacct gaggccagga cgtctggggt gtggggattg gtgggtctat 60 gttccc 66

<210> 241 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 241 ccgccgtgga cacagact 18

<210> 242 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 242 ttgccgtcag aaaacatgtc a 21

<210> 243 <211> 25 Page 53

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 243 tgccactcgg aaaaagacct ctcgg 25

<210> 244 2020201779

<211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 244 ccgccgtgga cacagactcc ccccgagagg tctttttccg agtggcagct gacatgtttt 60 ctgacggcaa 70

<210> 245 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 245 cctggagggt cctgtacaat 20

<210> 246 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 246 ctaattgggc tccatctcg 19

<210> 247 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 247 Page 54

GHDX‐046_SEQLIST.TXT 11 Mar 2020

catcatggga ctcctgccct tacc 24

<210> 248 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 248 cctggagggt cctgtacaat ctcatcatgg gactcctgcc cttacccagg ggccacagag 60 cccccgagat ggagcccaat tag 83

<210> 249 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 249 cagatggacc tagtacccac tgaga 25

<210> 250 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 250 cctatgattt aagggcattt ttcc 24

<210> 251 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 251 ttccacgccg aaggacagcg at 22

<210> 252 <211> 73 <212> DNA <213> Artificial Sequence

Page 55

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 252 cagatggacc tagtacccac tgagatttcc acgccgaagg acagcgatgg gaaaaatgcc 60 cttaaatcat agg 73

<210> 253 <211> 20 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 253 gtggcagaaa tctacctggc 20

<210> 254 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 254 gaagggcaag cccaagac 18

<210> 255 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 255 acctggcagc ctctgatctg gtgt 24

<210> 256 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 256 gtggcagaaa tctacctggc caacctggca gcctctgatc tggtgtttgt cttgggcttg 60 cccttc 66

Page 56

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 257 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 257 gagctccgca aggatgac 18 2020201779

<210> 258 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 258 cttgttgttc accaggacga 20

<210> 259 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 259 caagggtctc cagcacctct acgc 24

<210> 260 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 260 gagctccgca aggatgactt caagggtctc cagcacctct acgccctcgt cctggtgaac 60 aacaag 66

<210> 261 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 57

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 261 attcctatgg ctctgcaatt gtc 23

<210> 262 <211> 21 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 262 ggcaggagtg aatggctctt c 21

<210> 263 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 263 ccggttaact gtggcctgtg ccc 23

<210> 264 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 264 attcctatgg ctctgcaatt gtcaccggtt aactgtggcc tgtgcccagg aagagccatt 60 cactcctgcc 70

<210> 265 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 265 cctgcaaaag ggaacaagag 20

<210> 266 <211> 20 <212> DNA Page 58

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 266 cgtggttgac tctgatctcg 20

<210> 267 <211> 21 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 267 cttcgcctcc agatggctcc c 21

<210> 268 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 268 cctgcaaaag ggaacaagag cccttcgcct ccagatggct cccctgccgc cacccccgag 60 atcagagtca accacg 76

<210> 269 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 269 ttcaggtgga tgaggagaca 20

<210> 270 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 270 cacacagcag tggcaaaag 19 Page 59

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 271 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 271 2020201779

tctgccagac gcttcctatc actctattc 29

<210> 272 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 272 ttcaggtgga tgaggagaca gaatagagtg ataggaagcg tctggcagat actccttttg 60 ccactgctgt gtg 73

<210> 273 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 273 gtgcagacct tggttcacct 20

<210> 274 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 274 cttagttggc gcacagcac 19

<210> 275 <211> 24 <212> DNA <213> Artificial Sequence

<220> Page 60

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 275 tgaaccccga gtatgtcccc aaac 24

<210> 276 <211> 66 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 276 gtgcagacct tggttcacct tatgaacccc gagtatgtcc ccaaaccgtg ctgtgcgcca 60 actaag 66

<210> 277 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 277 accactttgg ccatccct 18

<210> 278 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 278 gcggtgtttg tacccagtg 19

<210> 279 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 279 attcacatta ccatagcggc ccca 24

<210> 280 <211> 67 Page 61

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 280 accactttgg ccatccctgc atttggggcc gctatggtaa tgtgaatgca ctgggtacaa 60 acaccgc 67 2020201779

<210> 281 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 281 tcagggggct agaaatctgt 20

<210> 282 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 282 ccattccagt tgatctgtgg 20

<210> 283 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 283 ctatgggccc ttcaccaaca tgc 23

<210> 284 <211> 65 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 284 Page 62

GHDX‐046_SEQLIST.TXT 11 Mar 2020

tcagggggct agaaatctgt tgctatgggc ccttcaccaa catgcccaca gatcaactgg 60 aatgg 65

<210> 285 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 285 agttcgtgct ttgcaagatg 20

<210> 286 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 286 aaggtaagct gggtctgctg 20

<210> 287 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 287 cattcttcac tgcttcataa agctctgca 29

<210> 288 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 288 agttcgtgct ttgcaagatg gtgcagagct ttatgaagca gtgaagaatg cagcagaccc 60 agcttacctt 70

<210> 289 <211> 18 <212> DNA <213> Artificial Sequence Page 63

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 289 gaggtccgag cgatgtga 18

<210> 290 <211> 22 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 290 agttattttc gagacaggag gc 22

<210> 291 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 291 cgctcgtctc ttcctctctc ctgc 24

<210> 292 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 292 gaggtccgag cgatgtgacc aggccgccat cgctcgtctc ttcctctctc ctgccgcctc 60 ctgtctcgaa aataact 77

<210> 293 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 293 ccatatcgcc caattcca 18

Page 64

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 294 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 294 ccagtgattc cggtcacaa 19 2020201779

<210> 295 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 295 catgggtacc tcctcctgga atgc 24

<210> 296 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 296 ccatatcgcc caattccagt gacatgggta cctcctcctg gaatgcattg tgaccggaat 60 cactgg 66

<210> 297 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 297 gttgggacac agttggtctg 20

<210> 298 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 65

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 298 tgaagcagtc agttgtgctg 20

<210> 299 <211> 23 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 299 cagtcggccc aggacggtct act 23

<210> 300 <211> 63 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 300 gttgggacac agttggtctg cagtcggccc aggacggtct actcagcaca actgactgct 60 tca 63

<210> 301 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 301 ccgaggttaa tccagcacgt a 21

<210> 302 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 302 aagacatggc gctctcagtt c 21

<210> 303 <211> 23 <212> DNA Page 66

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 303 tgctgggagc ctacacttgg ccc 23

<210> 304 <211> 68 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 304 ccgaggttaa tccagcacgt atggggccaa gtgtaggctc ccagcaggaa ctgagagcgc 60 catgtctt 68

<210> 305 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 305 atgtctgagt gtgaggcgg 19

<210> 306 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 306 aggccttatg ctggtgacag 20

<210> 307 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 307 atgctctgcc ctctgcatct caga 24 Page 67

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 308 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 308 2020201779

atgtctgagt gtgaggcggg cgctctgaga tgcagagggc agagcatctc tgtcaccagc 60 ataaggcct 69

<210> 309 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 309 aggacccagc tccatgtg 18

<210> 310 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 310 cctacattcc gtgccattg 19

<210> 311 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 311 cagtacactg gcgtccattc cctg 24

<210> 312 <211> 68 <212> DNA <213> Artificial Sequence

<220> Page 68

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 312 aggacccagc tccatgtgcg ttctcaggga atggacgcca gtgtactgcc aatggcacgg 60 aatgtagg 68

<210> 313 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 313 ccaccaccat ccttaccatc 20

<210> 314 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 314 gatccactgc cctgatcg 18

<210> 315 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 315 tcttcacctg ctcgggaatc tgtg 24

<210> 316 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 316 ccaccaccat ccttaccatc atcacagatt cccgagcagg tgaagaaggc tcgatcaggg 60 cagtggatc 69

<210> 317 Page 69

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 317 cagcaaggag actgtgctga 20 2020201779

<210> 318 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 318 ggtcctcttc tccacggtag at 22

<210> 319 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 319 ctcctggatg gccaaatttg atgc 24

<210> 320 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 320 cagcaaggag actgtgctga gctcctggat ggccaaattt gatgccatct accgtggaga 60 agaggacc 68

<210> 321 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 70

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 321 aactggagct gaggttgaca 20

<210> 322 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 322 catctacgct gtaccccaga 20

<210> 323 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 323 tcacaggcat gacaatgctg ctaca 25

<210> 324 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 324 aactggagct gaggttgaca tcacaggcat gacaatgctg ctacaaaatc tggggtacag 60 cgtagatg 68

<210> 325 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 325 tgagcctgag cagagacatg a 21

<210> 326 <211> 18 <212> DNA <213> Artificial Sequence Page 71

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 326 ccttcctgcg tggtccat 18

<210> 327 <211> 25 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 327 tcagcctgtt ccatgaaggc agagc 25

<210> 328 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 328 tgagcctgag cagagacatg actcagcctg ttccatgaag gcagagccat ggaccacgca 60 ggaagg 66

<210> 329 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 329 gcagcgccga gactttta 18

<210> 330 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 330 agtctctctc cgtcgctcc 19

Page 72

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 331 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 331 ctttcgctaa aggggcccca gac 23 2020201779

<210> 332 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 332 gcagcgccga gacttttagt ttcgctttcg ctaaaggggc cccagaccct tgctgcggag 60 cgacggagag agact 75

<210> 333 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 333 gtggctcaac attgtgttcc 20

<210> 334 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 334 caatggcctc cattttacag 20

<210> 335 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 73

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 335 atttcagctg atcagtgggc ctcc 24

<210> 336 <211> 74 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 336 gtggctcaac attgtgttcc catttcagct gatcagtggg cctccaagga ggggctgtaa 60 aatggaggcc attg 74

<210> 337 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 337 cttccctggg acgacttg 18

<210> 338 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 338 ctcctggtca cccttctgg 19

<210> 339 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 339 cccgtactgt catgcctcag agct 24

<210> 340 <211> 66 <212> DNA Page 74

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 340 cttccctggg acgacttgcc agctctgagg catgacagta cgggccccca gaagggtgac 60 caggag 66

<210> 341 2020201779

<211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 341 cgctcagcca gatgcaatc 19

<210> 342 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 342 gcactgagat cttcctattg gtgaa 25

<210> 343 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 343 tgccccagtc acctgctgtt a 21

<210> 344 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 344 cgctcagcca gatgcaatca atgccccagt cacctgctgt tataacttca ccaataggaa 60 Page 75

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gatctcagtg c 71

<210> 345 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 345 aggttctgag ctctggcttt 20

<210> 346 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 346 atgctgactt ccttcctggt 20

<210> 347 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 347 acagagccct ggcaaagcca ag 22

<210> 348 <211> 65 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 348 aggttctgag ctctggcttt gccttggctt tgccagggct ctgtgaccag gaaggaagtc 60 agcat 65

<210> 349 <211> 20 <212> DNA <213> Artificial Sequence

Page 76

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 349 ttcaggttgt tgcaggagac 20

<210> 350 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 350 catcttcttg ggcacacaat 20

<210> 351 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 351 tgtctccatt attgatcggt tcatgca 27

<210> 352 <211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 352 ttcaggttgt tgcaggagac catgtacatg actgtctcca ttattgatcg gttcatgcag 60 aataattgtg tgcccaagaa gatg 84

<210> 353 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 353 gcatgttcgt ggcctctaag a 21

<210> 354 Page 77

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 354 cggtgtagat gcacagcttc tc 22 2020201779

<210> 355 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 355 aaggagacca tccccctgac ggc 23

<210> 356 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 356 gcatgttcgt ggcctctaag atgaaggaga ccatccccct gacggccgag aagctgtgca 60 tctacaccg 69

<210> 357 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 357 atgctgtggc tccttcctaa ct 22

<210> 358 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 78

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 358 acccaaattg tgatatacaa aaaggtt 27

<210> 359 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 359 taccaagcaa cctacatgtc aagaaagccc 30

<210> 360 <211> 82 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 360 atgctgtggc tccttcctaa ctggggcttt cttgacatgt aggttgcttg gtaataacct 60 ttttgtatat cacaatttgg gt 82

<210> 361 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 361 gagatcttcg gtgggggta 19

<210> 362 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 362 ctgcagacga gaacccaaac 20

<210> 363 <211> 24 <212> DNA <213> Artificial Sequence Page 79

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 363 catcagcgtc ctggcgtaaa acac 24

<210> 364 <211> 67 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 364 gagatcttcg gtgggggtac gggtgtttta cgccaggacg ctgatgcgtt tgggttctcg 60 tctgcag 67

<210> 365 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 365 tccaagaccc aatgggaa 18

<210> 366 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 366 tcgtaggctt tcgtgagga 19

<210> 367 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 367 actcaccaca cctgcagcct tcac 24

Page 80

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 368 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 368 tccaagaccc aatgggaatt cactcaccac acctgcagcc ttcactttcc tcacgaaagc 60 2020201779

ctacga 66

<210> 369 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 369 caacctgtgc gaaagtctac c 21

<210> 370 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 370 acacccaaga ccaggacaat 20

<210> 371 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 371 cctccaatga aactggctgc atca 24

<210> 372 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 81

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 372 caacctgtgc gaaagtctac ctttgatgca gccagtttca ttggaggaat tgtcctggtc 60 ttgggtgt 68

<210> 373 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 373 ggagtggaag gaactggaaa 20

<210> 374 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 374 tcatgggcgt atctacgaat 20

<210> 375 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 375 cgcaccattc ggtcatttga gg 22

<210> 376 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 376 ggagtggaag gaactggaaa cattattccg tatacgcacc attcggtcat ttgagggaat 60 tcgtagatac gcccatga 78

<210> 377 <211> 20 Page 82

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 377 ccaaaggatg cgatacacag 20

<210> 378 2020201779

<211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 378 ggatgacttg ggaatcatgt c 21

<210> 379 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 379 ccactgtgca gccttatttc tccaatg 27

<210> 380 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 380 ccaaaggatg cgatacacag accactgtgc agccttattt ctccaatgga catgattccc 60 aagtcatcc 69

<210> 381 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 381 Page 83

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ggcaccactg cttatgaagg 20

<210> 382 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 382 gatgctcatg gtgaatgagg 20

<210> 383 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 383 actggaaccc agaagcacac cctc 24

<210> 384 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 384 ggcaccactg cttatgaagg aaactggaac ccagaagcac accctcccct cattcaccat 60 gagcatc 67

<210> 385 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 385 tggttcccag ccctgtgt 18

<210> 386 <211> 19 <212> DNA <213> Artificial Sequence

Page 84

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 386 ctcctccacc ctgggttgt 19

<210> 387 <211> 28 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 387 ctccaagccc agattcagat tcgagtca 28

<210> 388 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 388 tggttcccag ccctgtgtcc acctccaagc ccagattcag attcgagtca tgtacacaac 60 ccagggtgga ggag 74

<210> 389 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 389 gtgcaggctc aggtgaagtg 20

<210> 390 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 390 gacctcaggg cgattcatga 20

<210> 391 Page 85

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 391 tcagcttcta caactggaca gacaacgctg 30 2020201779

<210> 392 <211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 392 gtgcaggctc aggtgaagtg ctgcggctgg gtcagcttct acaactggac agacaacgct 60 gagctcatga atcgccctga ggtc 84

<210> 393 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 393 tggattggag ttctgggaat g 21

<210> 394 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 394 gcttgcactc cacaggtaca ca 22

<210> 395 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 86

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 395 actggccgtg gcactggaca aca 23

<210> 396 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 396 tggattggag ttctgggaat gtactggccg tggcactgga caacagtgtg tacctgtgga 60 gtgcaagc 68

<210> 397 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 397 gctgcaggac cagtgagg 18

<210> 398 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 398 tagggcagct ggcttcag 18

<210> 399 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 399 ctgctacctc ccttgccttt cgag 24

<210> 400 <211> 76 <212> DNA <213> Artificial Sequence Page 87

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 400 gctgcaggac cagtgagggg cctgcgccag tcctgctacc tcccttgcct ttcgaggcct 60 gaagccagct gcccta 76

<210> 401 <211> 21 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 401 gcaacactcc ccatttacct c 21

<210> 402 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 402 tgagggggac cattctcttt 20

<210> 403 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 403 ttgttctcca ccaaagcaag gcaa 24

<210> 404 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 404 gcaacactcc ccatttacct ccttgttctc caccaaagca aggcaagaaa gagaatggtc 60 cccctca 67 Page 88

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 405 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 405 2020201779

tgagtgtccc ccggtatctt c 21

<210> 406 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 406 cagccgcttt cagattttca t 21

<210> 407 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 407 tgccaatccc gatgaaattg gaaattt 27

<210> 408 <211> 81 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 408 tgagtgtccc ccggtatctt ccccgccctg ccaatcccga tgaaattgga aattttattg 60 atgaaaatct gaaagcggct g 81

<210> 409 <211> 21 <212> DNA <213> Artificial Sequence

<220> Page 89

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 409 tgtggtgcaa gtcacagcta c 21

<210> 410 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 410 tgtaaatgac tctggcgctg 20

<210> 411 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 411 atgccgatga cccttcatat ggga 24

<210> 412 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 412 tgtggtgcaa gtcacagcta cagatgccga tgacccttca tatgggaaca gcgccagagt 60 catttaca 68

<210> 413 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 413 gtcggcagaa gcaggact 18

<210> 414 <211> 18 Page 90

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 414 ctactcatgg gcgggatg 18

<210> 415 2020201779

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 415 ccttctgccc atagtgatca gcga 24

<210> 416 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 416 gtcggcagaa gcaggacttg taccttctgc ccatagtgat cagcgatggc ggcatcccgc 60 ccatgagtag 70

<210> 417 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 417 agtaccataa tgcgggaacg 20

<210> 418 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 418 Page 91

GHDX‐046_SEQLIST.TXT 11 Mar 2020

agactgcctg tataggctcc tg 22

<210> 419 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 419 actcggaaaa ccacaagcgc tgag 24

<210> 420 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 420 agtaccataa tgcgggaacg caagactcgg aaaaccacaa gcgctgagat caggagccta 60 tacaggcagt ct 72

<210> 421 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 421 acaggagacg tgttcgcc 18

<210> 422 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 422 cagcagtgag gtggtactct ga 22

<210> 423 <211> 24 <212> DNA <213> Artificial Sequence

Page 92

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 423 tattctcccg gtccagcctc tcaa 24

<210> 424 <211> 67 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 424 acaggagacg tgttcgccat tgagaggctg gaccgggaga atatctcaga gtaccacctc 60 actgctg 67

<210> 425 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 425 gtttgacatg gctgcactga 20

<210> 426 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 426 agtcacatcc ctccgggt 18

<210> 427 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 427 acctcaacgt catccgagac acca 24

<210> 428 Page 93

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 428 gtttgacatg gctgcactga gaaacctcaa cgtcatccga gacaccaaga cccggaggga 60 tgtgact 67 2020201779

<210> 429 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 429 gcaaggtaaa tgggaagttg g 21

<210> 430 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 430 gatagctgtg aaaggtgtcc ct 22

<210> 431 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 431 cttcctgcag cctgatcacc ttca 24

<210> 432 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 94

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 432 gcaaggtaaa tgggaagttg gtagctctga aggtgatcag gctgcaggaa gaagaaggga 60 cacctttcac agctatc 77

<210> 433 <211> 20 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 433 aatgctgcac tacgacccta 20

<210> 434 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 434 ttggtcacat cctggaagaa 20

<210> 435 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 435 ccttggccga aatccgcttg t 21

<210> 436 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 436 aatgctgcac tacgacccta acaagcggat ttcggccaag gcagccctgg ctcacccttt 60 cttccaggat gtgaccaa 78

<210> 437 <211> 19 <212> DNA Page 95

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 437 ccaggaaggg actggaaga 19

<210> 438 <211> 18 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 438 gttgcatgag caggtccc 18

<210> 439 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 439 ctctggctcc agattgggca caat 24

<210> 440 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 440 ccaggaaggg actggaagag attgtgccca atctggagcc agagggcagg gacctgctca 60 tgcaac 66

<210> 441 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 441 gtctcgggca aagcgttat 19 Page 96

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 442 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 442 2020201779

ctctggcctt gtaaacggtg 20

<210> 443 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 443 cctccccaag gaagtccagc ttct 24

<210> 444 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 444 gtctcgggca aagcgttatg agaagctgga cttccttggg gagggacagt ttgccaccgt 60 ttacaaggcc agag 74

<210> 445 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 445 tggagactct cagggtcgaa a 21

<210> 446 <211> 22 <212> DNA <213> Artificial Sequence

<220> Page 97

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 446 ggcgtttgga gtggtagaaa tc 22

<210> 447 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 447 cggcggcaga ccagcatgac 20

<210> 448 <211> 65 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 448 tggagactct cagggtcgaa aacggcggca gaccagcatg acagatttct accactccaa 60 acgcc 65

<210> 449 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 449 cggcgatcaa gaagctgt 18

<210> 450 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 450 caggcgctga tctcttgc 18

<210> 451 <211> 24 Page 98

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 451 cgggcctctg atctccgatt tctt 24

<210> 452 2020201779

<211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 452 cggcgatcaa gaagctgtcc gggcctctga tctccgattt cttcgccaag cgcaagagat 60 cagcgcctg 69

<210> 453 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 453 gacgctgcag agcacctt 18

<210> 454 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 454 gcgggaatct ctcctcagt 19

<210> 455 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 455 Page 99

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cacaggatgc tggcctttgc tctt 24

<210> 456 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 456 gacgctgcag agcacctttg cacaggatgc tggcctttgc tcttactaca ctgaggagag 60 attcccgc 68

<210> 457 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 457 gagcactggg caatcgttac 20

<210> 458 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 458 caaaggcgaa cgggagtag 19

<210> 459 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 459 cctgtaactt gagggccacc gaac 24

<210> 460 <211> 67 <212> DNA <213> Artificial Sequence

Page 100

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 460 gagcactggg caatcgttac gacctgtaac ttgagggcca ccgaactgct actcccgttc 60 gcctttg 67

<210> 461 <211> 21 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 461 tggatctcta ccagcaatgt g 21

<210> 462 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 462 atgtcaggag tccctccatc 20

<210> 463 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 463 atcacccatc atcatccaat cgca 24

<210> 464 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 464 tggatctcta ccagcaatgt ggaattatca cccatcatca tccaatcgca gatggaggga 60 ctcctgacat 70

Page 101

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 465 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 465 gggcttcttt gctactgtgg 20 2020201779

<210> 466 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 466 acagggcaga caaagcatct 20

<210> 467 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 467 cccggacatc acataggaca gcag 24

<210> 468 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 468 gggcttcttt gctactgtgg tgtttggcct tctgctgtcc tatgtgatgt ccgggtacag 60 atgctttgtc tgccctgt 78

<210> 469 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 102

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 469 ctcccgtcaa cagcgttc 18

<210> 470 <211> 18 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 470 gggtgagtct ggccttca 18

<210> 471 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 471 acactggacc aggagtgcat ccag 24

<210> 472 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 472 ctcccgtcaa cagcgttctt tccaaacact ggaccaggag tgcatccaga tgaaggccag 60 actcaccc 68

<210> 473 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 473 gaactcagtg tatgagaagc gg 22

<210> 474 <211> 18 <212> DNA Page 103

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 474 gctctgtagc acctgcgg 18

<210> 475 <211> 24 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 475 tgcacgtacc agcacatcct gaag 24

<210> 476 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 476 gaactcagtg tatgagaagc ggcctgactt caggatgtgc tggtacgtgc acccgcaggt 60 gctacagagc 70

<210> 477 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 477 ttacgacgct cgtgaaagc 19

<210> 478 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 478 tctccctgat gcacatgtct 20 Page 104

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 479 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 479 2020201779

ccaccattgg ccgcttagtg gtat 24

<210> 480 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 480 ttacgacgct cgtgaaagca cataccacta agcggccaat ggtggtagac atgtgcatca 60 gggaga 66

<210> 481 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 481 tctcgctgcc tctatccc 18

<210> 482 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 482 cctggttgat gctggaca 18

<210> 483 <211> 24 <212> DNA <213> Artificial Sequence

<220> Page 105

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 483 atccgggtca tcatgaagag ctcc 24

<210> 484 <211> 69 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 484 tctcgctgcc tctatcccgc atccgggtca tcatgaagag ctcccccgag gtgtccagca 60 tcaaccagg 69

<210> 485 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 485 ggctggacgt ggttttgtct 20

<210> 486 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 486 cgctgcagaa aatgaaacga 20

<210> 487 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 487 ctgcgcccgc tcttcgcg 18

<210> 488 <211> 62 Page 106

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 488 ggctggacgt ggttttgtct gctgcgcccg ctcttcgcgc tctcgtttca ttttctgcag 60 cg 62 2020201779

<210> 489 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 489 accaactgcg tgcaggac 18

<210> 490 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 490 ggcgagaagg aacagcac 18

<210> 491 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 491 caaggccaag atcaccatcg tgg 23

<210> 492 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 492 Page 107

GHDX‐046_SEQLIST.TXT 11 Mar 2020

accaactgcg tgcaggacga cacggccaag gccaagatca ccatcgtggc aggcgtgctg 60 ttccttctcg cc 72

<210> 493 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 493 accgtatgga cagccacag 19

<210> 494 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 494 tgactacagg atcagcgctt c 21

<210> 495 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 495 tctcacatgc tgtacccaaa gcca 24

<210> 496 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 496 accgtatgga cagccacagc ctggctttgg gtacagcatg tgagatgaag cgctgatcct 60 gtagtca 67

<210> 497 <211> 18 <212> DNA <213> Artificial Sequence Page 108

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 497 gcccaagagg ggaagatg 18

<210> 498 <211> 19 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 498 ggacctgggt ctccagttg 19

<210> 499 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 499 ctgctcgacc tttgggtcct tcag 24

<210> 500 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 500 gcccaagagg ggaagatggc cctgaaggac ccaaaggtcg agcaggccca actggagacc 60 caggtcc 67

<210> 501 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 501 gtggccatcc agctgacc 18

Page 109

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 502 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 502 cagtggtagg tgatgttctg gga 23 2020201779

<210> 503 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 503 tcctgcgcct gatgtccacc g 21

<210> 504 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 504 gtggccatcc agctgacctt cctgcgcctg atgtccaccg aggcctccca gaacatcacc 60 taccactg 68

<210> 505 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 505 cagccaagaa ctggtatagg agct 24

<210> 506 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 110

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 506 aaactggctg ccagcattg 19

<210> 507 <211> 30 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 507 tctcctagcc agacgtgttt cttgtccttg 30

<210> 508 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 508 cagccaagaa ctggtatagg agctccaagg acaagaaaca cgtctggcta ggagaaacta 60 tcaatgctgg cagccagttt 80

<210> 509 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 509 ggaggttctg gacctgctg 19

<210> 510 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 510 accaggactg ccacgttc 18

<210> 511 <211> 24 <212> DNA Page 111

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 511 ctcctggtcc ccaaggtgtc aaag 24

<210> 512 <211> 66 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 512 ggaggttctg gacctgctgg tcctcctggt ccccaaggtg tcaaaggtga acgtggcagt 60 cctggt 66

<210> 513 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 513 acaaaggcct cccaggat 18

<210> 514 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 514 gagtcccagg aagacctgct 20

<210> 515 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 515 ctcctttgac accagggatg ccat 24 Page 112

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 516 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 516 2020201779

acaaaggcct cccaggattg gatggcatcc ctggtgtcaa aggagaagca ggtcttcctg 60 ggactc 66

<210> 517 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 517 ctccctggga aagatggc 18

<210> 518 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 518 ctggaccagg aagccctc 18

<210> 519 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 519 ccagggaaac cacgtaatcc tgga 24

<210> 520 <211> 67 <212> DNA <213> Artificial Sequence

<220> Page 113

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 520 ctccctggga aagatggccc tccaggatta cgtggtttcc ctggggaccg agggcttcct 60 ggtccag 67

<210> 521 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 521 ggtcgaggaa cccaaggt 18

<210> 522 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 522 gcctggaggt ccaactctg 19

<210> 523 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 523 ccaggaaatc ctgtagcacc aggc 24

<210> 524 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 524 ggtcgaggaa cccaaggtcc gcctggtgct acaggatttc ctggttctgc gggcagagtt 60 ggacctccag gc 72

<210> 525 Page 114

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 525 ggagaccctg gtgaagctg 19 2020201779

<210> 526 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 526 tctccaggga caccaacg 18

<210> 527 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 527 cttctcttcc ctgatcaccc tgcg 24

<210> 528 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 528 ggagaccctg gtgaagctgg cccgcagggt gatcagggaa gagaaggccc cgttggtgtc 60 cctggaga 68

<210> 529 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 115

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 529 gagagcaagc gagacattct g 21

<210> 530 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 530 aacagggaac tggcccac 18

<210> 531 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 531 cctctttgac ggctcagcca atct 24

<210> 532 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 532 gagagcaagc gagacattct gttcctcttt gacggctcag ccaatcttgt gggccagttc 60 cctgtt 66

<210> 533 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 533 tggtgttcca gggcttct 18

<210> 534 <211> 19 <212> DNA <213> Artificial Sequence Page 116

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 534 ccctgtaaac cctgatccc 19

<210> 535 <211> 24 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 535 cctaagggag agccaggaat ccca 24

<210> 536 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 536 tggtgttcca gggcttctcg gacctaaggg agagccagga atcccagggg atcagggttt 60 acaggg 66

<210> 537 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 537 gggaaccatc cagggtct 18

<210> 538 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 538 attccgggtg gacagttg 18

Page 117

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 539 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 539 acacaggaaa tccgcactgc cttc 24 2020201779

<210> 540 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 540 gggaaccatc cagggtctgg aaggcagtgc ggatttcctg tgtccaacca actgtccacc 60 cggaat 66

<210> 541 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 541 tcccttatga acaaggagca c 21

<210> 542 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 542 aaccattggt gcatagtcca t 21

<210> 543 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 118

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 543 tgccagttgc ccagataact gtga 24

<210> 544 <211> 72 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 544 tcccttatga acaaggagca ccttgtgcca gttgcccaga taactgtgac gatggactat 60 gcaccaatgg tt 72

<210> 545 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 545 tgcagcggct gattgaca 18

<210> 546 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 546 caactgttcc tggtctacaa actca 25

<210> 547 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 547 tcagatggag acctcgtgcc aaattaca 28

<210> 548 <211> 74 <212> DNA Page 119

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 548 tgcagcggct gattgacagt cagatggaga cctcgtgcca aattacattt gagtttgtag 60 accaggaaca gttg 74

<210> 549 2020201779

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 549 cctgaacatg aaggagctga 20

<210> 550 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 550 catcacgtct ccgaactcc 19

<210> 551 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 551 tcccgatggt ctgcagcagc t 21

<210> 552 <211> 64 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 552 cctgaacatg aaggagctga agctgctgca gaccatcggg aagggggagt tcggagacgt 60 Page 120

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gatg 64

<210> 553 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 553 acccaagacc ctgcctct 18

<210> 554 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 554 gcaggggtgg agtgatgt 18

<210> 555 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 555 ccacccttct ccagggaccc ttag 24

<210> 556 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 556 acccaagacc ctgcctcttc cactccaccc ttctccaggg acccttagat cacatcactc 60 cacccctgc 69

<210> 557 <211> 19 <212> DNA <213> Artificial Sequence

Page 121

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 557 gagttcaagt gccctgacg 19

<210> 558 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 558 agttgtaatg gcaggcacag 20

<210> 559 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 559 aacatcatgt tcttcttcat gacctcgc 28

<210> 560 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 560 gagttcaagt gccctgacgg cgaggtcatg aagaagaaca tgatgttcat caagacctgt 60 gcctgccatt acaact 76

<210> 561 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 561 tggctcactt cggctaaaat 20

<210> 562 Page 122

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 562 tcagctccat tgaatgtgaa a 21 2020201779

<210> 563 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 563 caacgctgac agcatgcatt tctg 24

<210> 564 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 564 tggctcactt cggctaaaat gcagaaatgc atgctgtcag cgttggtatt tcacattcaa 60 tggagctga 69

<210> 565 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 565 cgttccgatc ctctatactg cat 23

<210> 566 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 123

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 566 aggtccctgt tggccttata gg 22

<210> 567 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 567 atgcctacag caccctgatg tcgca 25

<210> 568 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 568 cgttccgatc ctctatactg catcccaggc atgcctacag caccctgatg tcgcagccta 60 taaggccaac agggacct 78

<210> 569 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 569 ggctcttgtg cgtactgtcc tt 22

<210> 570 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 570 tcagatgacg aagagcacag atg 23

<210> 571 <211> 29 <212> DNA <213> Artificial Sequence Page 124

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 571 aggctcagtg atgtcttccc tgtcaccag 29

<210> 572 <211> 80 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 572 ggctcttgtg cgtactgtcc ttcgggctgg tgacagggaa gacatcactg agcctgccat 60 ctgtgctctt cgtcatctga 80

<210> 573 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 573 cggaaacttc gggaatgtga 20

<210> 574 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 574 ctgaatcctt ctgcccaatc tc 22

<210> 575 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 575 ttgatgccct cattttcatt gttcaggc 28

Page 125

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 576 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 576 cggaaacttc gggaatgtga tggtttagtt gatgccctca ttttcattgt tcaggctgag 60 2020201779

attgggcaga aggattcag 79

<210> 577 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 577 gcccgtccct acagtgaac 19

<210> 578 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 578 ctcacaccca ggagtcgg 18

<210> 579 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 579 ctatgaaacg agccactacc cggc 24

<210> 580 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 126

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 580 gcccgtccct acagtgaact gaactatgaa acgagccact acccggcctc ccccgactcc 60 tgggtgtgag 70

<210> 581 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 581 ggccgagatc tacaaaaacg 20

<210> 582 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 582 gcaggaagtc cgaatacaca 20

<210> 583 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 583 ccccgtggag ggagctttct c 21

<210> 584 <211> 62 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 584 ggccgagatc tacaaaaacg gccccgtgga gggagctttc tctgtgtatt cggacttcct 60 gc 62

<210> 585 <211> 24 Page 127

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 585 gtacatgatc ccctgtgaga aggt 24

<210> 586 2020201779

<211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 586 gggacagctt gtagcctttg c 21

<210> 587 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 587 accctgcccg cgatcacact ga 22

<210> 588 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 588 gtacatgatc ccctgtgaga aggtgtccac cctgcccgcg atcacactga agctgggagg 60 caaaggctac aagctgtccc 80

<210> 589 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 589 Page 128

GHDX‐046_SEQLIST.TXT 11 Mar 2020

aggcttctct tggtgtccat ac 22

<210> 590 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 590 ccacctcttc actggtcatg t 21

<210> 591 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 591 ccccaggtgg ttcatagcca gttc 24

<210> 592 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 592 aggcttctct tggtgtccat acatatgaac tggctatgaa ccacctgggg gacatgacca 60 gtgaagaggt gg 72

<210> 593 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 593 tgtctcactg agcgagcaga a 21

<210> 594 <211> 19 <212> DNA <213> Artificial Sequence

Page 129

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 594 accattgcag ccctgattg 19

<210> 595 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 595 cttgaggacg cgaacagtcc acca 24

<210> 596 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 596 tgtctcactg agcgagcaga atctggtgga ctgttcgcgt cctcaaggca atcagggctg 60 caatggt 67

<210> 597 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 597 tgacaacggc tttccagtac at 22

<210> 598 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 598 tccatggctt tgtagggata gg 22

<210> 599 Page 130

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 599 tgataacaag ggcatcgact cagacgct 28 2020201779

<210> 600 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 600 tgacaacggc tttccagtac atcattgata acaagggcat cgactcagac gcttcctatc 60 cctacaaagc catgga 76

<210> 601 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 601 atgccctggt aatgtctgca t 21

<210> 602 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 602 gcgaccacaa gccttatcaa g 21

<210> 603 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 131

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 603 cagccacaaa gccagcgtca ttgt 24

<210> 604 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 604 atgccctggt aatgtctgca ttcaacaatg acgctggctt tgtggctgct cttgataagg 60 cttgtggtcg c 71

<210> 605 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 605 gagctacaga tgcccatgc 19

<210> 606 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 606 tttgagatgc ttgacgttgg 20

<210> 607 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 607 ttcttcgaaa gccatgttgc caga 24

<210> 608 <211> 67 <212> DNA <213> Artificial Sequence Page 132

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 608 gagctacaga tgcccatgcc gattcttcga aagccatgtt gccagagcca acgtcaagca 60 tctcaaa 67

<210> 609 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 609 tgaccgcttc taccccaatg 20

<210> 610 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 610 aggataaggc caaccatgat gt 22

<210> 611 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 611 ctgaaactgg aacacaacca cccacaag 28

<210> 612 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 612 tgaccgcttc taccccaatg acttgtgggt ggttgtgttc cagtttcagc acatcatggt 60 tggccttatc ct 72 Page 133

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 613 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 613 2020201779

cgcctcagaa cgatggat 18

<210> 614 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 614 gttgcatggc cagctgat 18

<210> 615 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 615 ctcagagcca gggaacttct cgga 24

<210> 616 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 616 cgcctcagaa cgatggatct gcatctcttc gactactcag agccagggaa cttctcggac 60 atcagctggc catgcaac 78

<210> 617 <211> 21 <212> DNA <213> Artificial Sequence

<220> Page 134

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 617 tcattgccca gtatggagat g 21

<210> 618 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 618 gacaggcttg cctttctctg 20

<210> 619 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 619 tcccgcctca agtttctcac caat 24

<210> 620 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 620 tcattgccca gtatggagat gtattggtga gaaacttgag gcgggaagca gagaaaggca 60 agcctgtc 68

<210> 621 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 621 tgctcattct tgaggagcat 20

<210> 622 <211> 20 Page 135

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 622 gtggctgcat tagtgtccat 20

<210> 623 2020201779

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 623 cagcaccctt ggcagtttcg aaat 24

<210> 624 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 624 tgctcattct tgaggagcat taaggtattt cgaaactgcc aagggtgctg gtgcggatgg 60 acactaatgc agccac 76

<210> 625 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 625 gtgactgggc tcatgcct 18

<210> 626 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 626 Page 136

GHDX‐046_SEQLIST.TXT 11 Mar 2020

atcccacttg tgctcctgtc 20

<210> 627 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 627 caagtcagag tttccctggt gccc 24

<210> 628 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 628 gtgactgggc tcatgcctcc aagtcagagt ttccctggtg ccccagagac aggagcacaa 60 gtgggat 67

<210> 629 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 629 ccagcctttc tggtgctg 18

<210> 630 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 630 gaccaggtct gcctctgc 18

<210> 631 <211> 24 <212> DNA <213> Artificial Sequence

Page 137

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 631 ctcaccagct ggcagacgtg aact 24

<210> 632 <211> 67 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 632 ccagcctttc tggtgctgtt ctccagttca cgtctgccag ctggtgaggg cagaggcaga 60 cctggtc 67

<210> 633 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 633 cgctgacatc atgaatgttc ct 22

<210> 634 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 634 tctctttcag caacgatgtg tctt 24

<210> 635 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 635 tcatatccaa actcgcctcc agccg 25

<210> 636 Page 138

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 636 cgctgacatc atgaatgttc ctcgaccggc tggaggcgag tttggatatg acaaagacac 60 atcgttgctg aaagaga 77 2020201779

<210> 637 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 637 gccctcatta gtccttggct 20

<210> 638 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 638 cagacagaag ggctgggac 19

<210> 639 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 639 tcagcgcctg tgcttccaag ataa 24

<210> 640 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 139

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 640 gccctcatta gtccttggct cttatcttgg aagcacaggc gctgacagcc gtcccagccc 60 ttctgtctg 69

<210> 641 <211> 18 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 641 cctggcgtct gtcctcac 18

<210> 642 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 642 cgaagaggag gtggacga 18

<210> 643 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 643 ctagcctttg ggaccgcttc tcgt 24

<210> 644 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 644 cctggcgtct gtcctcacca tgcctagcct ttgggaccgc ttctcgtcgt cgtccacctc 60 ctcttcg 67

<210> 645 <211> 19 <212> DNA Page 140

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 645 ctattaccgg atccagggc 19

<210> 646 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 646 cccagcaaga tactctccca 20

<210> 647 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 647 agtgctccct atccgctgga tgtc 24

<210> 648 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 648 ctattaccgg atccagggcc gggcagtgct ccctatccgc tggatgtctt gggagagtat 60 cttgctggg 69

<210> 649 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 649 acttctcact ggccgacg 18 Page 141

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 650 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 650 2020201779

gctccacctt ctcgttggt 19

<210> 651 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 651 tgaaccagga gtttctgacc acgc 24

<210> 652 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 652 acttctcact ggccgacgcg gtgaaccagg agtttctgac cacgcgcacc aacgagaagg 60 tggagc 66

<210> 653 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 653 ggagaaaggt ctctggggtc 20

<210> 654 <211> 18 <212> DNA <213> Artificial Sequence

<220> Page 142

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 654 cagtcagtgg gagccagc 18

<210> 655 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 655 atcaataatg ctggtgttcc cggc 24

<210> 656 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 656 ggagaaaggt ctctggggtc tgatcaataa tgctggtgtt cccggcgtgc tggctcccac 60 tgactg 66

<210> 657 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 657 gttcgaacca tctcagcgac 20

<210> 658 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 658 tccagttgga ttgtggaggt 20

<210> 659 <211> 24 Page 143

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 659 ccaaggaacc acacccactt ggtt 24

<210> 660 2020201779

<211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 660 gttcgaacca tctcagcgac aaaaccaagt gggtgtggtt ccttggtcac ctccacaatc 60 caactgga 68

<210> 661 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 661 caagcagtca aggagaacca 20

<210> 662 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 662 agttttgctc gcctcatctt 20

<210> 663 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 663 Page 144

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ttcttctgtc tcccgccgct tc 22

<210> 664 <211> 62 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 664 caagcagtca aggagaacca gaagcggcgg gagacagaag aaaagatgag gcgagcaaaa 60 ct 62

<210> 665 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 665 tccaattcca gcatcactgt 20

<210> 666 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 666 ggcagtgaag gcgataaagt 20

<210> 667 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 667 agaaaagctg tttgtctccc cagca 25

<210> 668 <211> 68 <212> DNA <213> Artificial Sequence

Page 145

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 668 tccaattcca gcatcactgt ggagaaaagc tgtttgtctc cccagcatac tttatcgcct 60 tcactgcc 68

<210> 669 <211> 18 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 669 ctcctttcac gagccagc 18

<210> 670 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 670 aggaagtcag ccactgagga 20

<210> 671 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 671 actcttccac cagtttgcgg aagg 24

<210> 672 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 672 ctcctttcac gagccagctg ccagccttcc gcaaactggt ggaagagttc tcctcagtgg 60 ctgacttcct 70

Page 146

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 673 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 673 gattcagacg aggatgagcc 20 2020201779

<210> 674 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 674 cacctcttgc tgtccctttg 20

<210> 675 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 675 aaagtccatt tgccactgat ggca 24

<210> 676 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 676 gattcagacg aggatgagcc ttgtgccatc agtggcaaat ggactttcca aagggacagc 60 aagaggtg 68

<210> 677 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 147

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 677 ctgctgagcc cagtggag 18

<210> 678 <211> 18 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 678 agcctggaag gagttccg 18

<210> 679 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 679 cgcagaccac ccatactaca ccca 24

<210> 680 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 680 ctgctgagcc cagtggagca ccaccccgca gaccacccat actacaccca gcggaactcc 60 ttccaggct 69

<210> 681 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 681 cacggaggta taaggcagga g 21

<210> 682 <211> 18 <212> DNA Page 148

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 682 agaaggaagg tccagccg 18

<210> 683 <211> 24 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 683 ctacctggac atccctgctc agcc 24

<210> 684 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 684 cacggaggta taaggcagga gcctacctgg acatccctgc tcagccccgc ggctggacct 60 tccttct 67

<210> 685 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 685 ctttcccacc cggcttac 18

<210> 686 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 686 aaggaccttc tgcaggtgtg 20 Page 149

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 687 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 687 2020201779

catatcgctg accgaatggg aacc 24

<210> 688 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 688 ctttcccacc cggcttacag acatatcgct gaccgaatgg gaaccccaca cctgcagaag 60 gtcctt 66

<210> 689 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 689 gtcctgggat cgggaagt 18

<210> 690 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 690 gtactcccac cgggatacag 20

<210> 691 <211> 24 <212> DNA <213> Artificial Sequence

<220> Page 150

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 691 cggctattcc acacttgaac acgc 24

<210> 692 <211> 69 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 692 gtcctgggat cgggaagtgg cgtgttcaag tgtggaatag ccgtggcgcc tgtatcccgg 60 tgggagtac 69

<210> 693 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 693 cacctagaag cctgcccac 19

<210> 694 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 694 cagtagctcc ccagggttc 19

<210> 695 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 695 ttcctaggaa ggctggcaga cacc 24

<210> 696 <211> 67 Page 151

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 696 cacctagaag cctgcccacg attcctagga aggctggcag acaccctgga accctgggga 60 gctactg 67 2020201779

<210> 697 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 697 agacatcagc tcctggttca 20

<210> 698 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 698 gacaaacacc cttcctccag 20

<210> 699 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 699 cgaggccatt gacttcatag actcca 26

<210> 700 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 700 Page 152

GHDX‐046_SEQLIST.TXT 11 Mar 2020

agacatcagc tcctggttca acgaggccat tgacttcata gactccatca agaatgctgg 60 aggaagggtg tttgtc 76

<210> 701 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 701 catgcaggga ctgggatt 18

<210> 702 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 702 tgctcctacc ctatcatttg g 21

<210> 703 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 703 tctaccctat gcgcctggaa gtcc 24

<210> 704 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 704 catgcaggga ctgggattcg aggacttcca ggcgcatagg gtagaaccaa atgatagggt 60 aggagca 67

<210> 705 <211> 18 <212> DNA <213> Artificial Sequence Page 153

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 705 tctgtcccac ctgctgct 18

<210> 706 <211> 18 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 706 tcagactgtt gccggatg 18

<210> 707 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 707 cttggagcag cctgcacctt ctct 24

<210> 708 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 708 tctgtcccac ctgctgctgc cccttggagc agcctgcacc ttctctcctc ccatccggca 60 acagtctga 69

<210> 709 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 709 gccgcctacc tcacagac 18

Page 154

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 710 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 710 gcctgactcc agctctcct 19 2020201779

<210> 711 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 711 acccacgtca gtgagtgctc acaa 24

<210> 712 <211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 712 gccgcctacc tcacagactt gtgagcactc actgacgtgg gtagcgccca gggcctgcgg 60 ggcgcaggag agctggagtc aggc 84

<210> 713 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 713 tgcggcgaga tggacact 18

<210> 714 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 155

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 714 gtgacaaggg attcatcgga tt 22

<210> 715 <211> 22 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 715 cccgctctcg gattcggagt cg 22

<210> 716 <211> 65 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 716 tgcggcgaga tggacactcc cccgctctcg gattcggagt cggaatccga tgaatccctt 60 gtcac 65

<210> 717 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 717 accttgggat ctgcctcc 18

<210> 718 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 718 ggaccaggac ctccatctg 19

<210> 719 <211> 24 <212> DNA Page 156

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 719 tccactctcg ataccctgca ccag 24

<210> 720 <211> 67 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 720 accttgggat ctgcctccaa gctggtgcag ggtatcgaga gtggattcca gatggaggtc 60 ctggtcc 67

<210> 721 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 721 tgccacctgg acatcatttg 20

<210> 722 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 722 tggacctagg gcttccaagt c 21

<210> 723 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 723 cactcccgag cacgttgttc cgt 23 Page 157

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 724 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 724 2020201779

tgccacctgg acatcatttg ggtcaacact cccgagcacg ttgttccgta tggacttgga 60 agccctaggt cca 73

<210> 725 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 725 tttcctcaaa tttgcctcaa g 21

<210> 726 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 726 ttacacatcc aaccagtgcc 20

<210> 727 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 727 cctttgcctc agggcatcct ttt 23

<210> 728 <211> 76 <212> DNA <213> Artificial Sequence

<220> Page 158

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 728 tttcctcaaa tttgcctcaa gatggaaacc ctttgcctca gggcatcctt ttggctggca 60 ctggttggat gtgtaa 76

<210> 729 <211> 23 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 729 tgacattatc atcccgctaa gga 23

<210> 730 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 730 gtagtccccg ctgaccttct c 21

<210> 731 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 731 cggacagcgt cttctgccct cact 24

<210> 732 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 732 tgacattatc atcccgctaa ggactgcgga cagcgtcttc tgccctcact acgagaaggt 60 cagcggggac tac 73

<210> 733 Page 159

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 733 ctttgccttg ctctgtcaca gt 22 2020201779

<210> 734 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 734 aaatacctga cacccttatg acaaatt 27

<210> 735 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 735 agagtttaac agccctgctc tggctgactt 30

<210> 736 <211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 736 ctttgccttg ctctgtcaca gtgaagtcag ccagagcagg gctgttaaac tctgtgaaat 60 ttgtcataag ggtgtcaggt attt 84

<210> 737 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 160

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 737 gtccccgctg cagatctct 19

<210> 738 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 738 ctccagctta gggtagttgt ccat 24

<210> 739 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 739 cggatccttt cctcactcgc cca 23

<210> 740 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 740 gtccccgctg cagatctctg acccgttcgg atcctttcct cactcgccca ccatggacaa 60 ctaccctaag ctggag 76

<210> 741 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 741 ccatgtggat gaatgaggtg 20

<210> 742 <211> 20 <212> DNA <213> Artificial Sequence Page 161

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 742 tgcctgagaa gaggtgaggt 20

<210> 743 <211> 24 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 743 acccagtctc accttctccc cacc 24

<210> 744 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 744 ccatgtggat gaatgaggtg tctcctttcc atacccagtc tcaccttctc cccaccctac 60 ctcacctctt ctcaggca 78

<210> 745 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 745 gcactgtggg cagatgaa 18

<210> 746 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 746 atgtttggtg actggcgg 18

Page 162

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 747 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 747 cgggtcacat tgcagacacg gtac 24 2020201779

<210> 748 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 748 gcactgtggg cagatgaaga ggaagtaccg cgtctgcaat gtgacccggc ggcccgccag 60 tcaccaaaca t 71

<210> 749 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 749 ctgcctccct gattcaagtg 20

<210> 750 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 750 ggtggcaagt gcctgtaata tc 22

<210> 751 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 163

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 751 tctcgtgctt cagcctccca tgta 24

<210> 752 <211> 71 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 752 ctgcctccct gattcaagtg attctcgtgc ttcagcctcc catgtagctg atattacagg 60 cacttgccac c 71

<210> 753 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 753 ctcattgcag gccagataaa 20

<210> 754 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 754 gccatgaaga gcttgccta 19

<210> 755 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 755 cagaacatca aggagttcac tgccca 26

<210> 756 <211> 80 <212> DNA Page 164

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 756 ctcattgcag gccagataaa cacttactgc cagaacatca aggagttcac tgcccaaaac 60 ttaggcaagc tcttcatggc 80

<210> 757 2020201779

<211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 757 gatctaagat ggcgactgtc gaa 23

<210> 758 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 758 ttagattccg ttttctcctc ttctg 25

<210> 759 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 759 accaccccta ctcctaatcc cccgact 27

<210> 760 <211> 82 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 760 gatctaagat ggcgactgtc gaaccggaaa ccacccctac tcctaatccc ccgactacag 60 Page 165

GHDX‐046_SEQLIST.TXT 11 Mar 2020

aagaggagaa aacggaatct aa 82

<210> 761 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 761 gaattggtct ccagctgcc 19

<210> 762 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 762 tccaggtata tggctcctgc 20

<210> 763 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 763 ccacttgcac ccgaatcttg atca 24

<210> 764 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 764 gaattggtct ccagctgcct ttgatcaaga ttcgggtgca agtggagcag gagccatata 60 cctgga 66

<210> 765 <211> 20 <212> DNA <213> Artificial Sequence

Page 166

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 765 gatgtggaga atggagggaa 20

<210> 766 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 766 agtcattgcg gctagaggtc 20

<210> 767 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 767 ataaaccacc tcagcctggt gcca 24

<210> 768 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 768 gatgtggaga atggagggaa agataaacca cctcagcctg gtgccaagac ctctagccgc 60 aatgact 67

<210> 769 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 769 ctcctgcgca ctaatacctt c 21

<210> 770 Page 167

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 770 tccctggata attgggtctg 20 2020201779

<210> 771 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 771 taacttcctc tggcatggtt ggcc 24

<210> 772 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 772 ctcctgcgca ctaatacctt caggccaacc atgccagagg aagttaccag acccaattat 60 ccaggga 67

<210> 773 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 773 cctcaaagag ttgctgagag c 21

<210> 774 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 168

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 774 cctctttaca gtgtgccttc a 21

<210> 775 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 775 ctgatccttc cagccacatt caattaattt 30

<210> 776 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 776 cctcaaagag ttgctgagag ctaaattaat tgaatgtggc tggaaggatc agttgaaggc 60 acactgtaaa gagg 74

<210> 777 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 777 cgcctgttca ccaagattga c 21

<210> 778 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 778 gtggcgtgcc tcgaagtc 18

<210> 779 <211> 20 <212> DNA <213> Artificial Sequence Page 169

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 779 tgcgcccgat gagatcaccg 20

<210> 780 <211> 72 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 780 cgcctgttca ccaagattga caccattgcg cccgatgaga tcaccgtcag cagcgacttc 60 gaggcacgcc ac 72

<210> 781 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 781 cagtagcctc aagcctgaca 20

<210> 782 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 782 ttcgtcccat atccagcg 18

<210> 783 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 783 tattccaaat ccgagcccga acag 24

Page 170

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 784 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 784 cagtagcctc aagcctgaca ctatatacgt attccaaatc cgagcccgaa cagccgctgg 60 2020201779

atatgggacg aa 72

<210> 785 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 785 caaccaggca gctccatc 18

<210> 786 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 786 gtaatgctgt ccacggtgc 19

<210> 787 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 787 cacctgatgc atgatggaca ctgc 24

<210> 788 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 171

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 788 caaccaggca gctccatcgg cagtgtccat catgcatcag gtgagccgca ccgtggacag 60 cattac 66

<210> 789 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 789 tgaacggggt atcctcctta 20

<210> 790 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 790 aggtacctct cggtcagtgg 20

<210> 791 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 791 cgtcccattt gagcctgtca atgt 24

<210> 792 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 792 tgaacggggt atcctcctta gccacggggc ccgtcccatt tgagcctgtc aatgtcacca 60 ctgaccgaga ggtacct 77

<210> 793 <211> 20 Page 172

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 793 cggtgtgaga agtgcagcaa 20

<210> 794 2020201779

<211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 794 cctctcgcaa gtgctccat 19

<210> 795 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 795 ccagaccata gcacactcgg gcac 24

<210> 796 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 796 cggtgtgaga agtgcagcaa gccctgtgcc cgagtgtgct atggtctggg catggagcac 60 ttgcgagagg 70

<210> 797 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 797 Page 173

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cggttatgtc atgccagata cac 23

<210> 798 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 798 gaactgagac ccactgaaga aagg 24

<210> 799 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 799 cctcaaaggt actccctcct cccgg 25

<210> 800 <211> 81 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 800 cggttatgtc atgccagata cacacctcaa aggtactccc tcctcccggg aaggcaccct 60 ttcttcagtg ggtctcagtt c 81

<210> 801 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 801 tggctcttaa tcagtttcgt tacct 25

<210> 802 <211> 25 <212> DNA <213> Artificial Sequence

Page 174

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 802 caaggcatat cgatcctcat aaagt 25

<210> 803 <211> 30 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 803 tgtcccacga ataatgcgta aattctccag 30

<210> 804 <211> 86 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 804 tggctcttaa tcagtttcgt tacctgcctc tggagaattt acgcattatt cgtgggacaa 60 aactttatga ggatcgatat gccttg 86

<210> 805 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 805 gtccaggtgg atgtgaaaga 20

<210> 806 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 806 cggccaggat acacatctta 20

<210> 807 Page 175

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 807 cagcaggccc tcaaggagct g 21 2020201779

<210> 808 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 808 gtccaggtgg atgtgaaaga tccccagcag gccctcaagg agctggctaa gatgtgtatc 60 ctggccg 67

<210> 809 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 809 tgctagggta aacgaaggca 20

<210> 810 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 810 tggagacaag tcctggcac 19

<210> 811 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 176

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 811 taagccatgg ctgacctctg gagc 24

<210> 812 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 812 tgctagggta aacgaaggca taataagcca tggctgacct ctggagcacc aggtgccagg 60 acttgtctcc a 71

<210> 813 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 813 ccaacactag gctcccca 18

<210> 814 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 814 cctccgccag gtctttagt 19

<210> 815 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 815 agccatatgc cttctcatct gggc 24

<210> 816 <211> 70 <212> DNA <213> Artificial Sequence Page 177

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 816 ccaacactag gctccccacc agccatatgc cttctcatct gggcacttac tactaaagac 60 ctggcggagg 70

<210> 817 <211> 19 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 817 cgtggtgccc ctctatgac 19

<210> 818 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 818 ggctagtggg cgcatgtag 19

<210> 819 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 819 ctggagatgc tggacgccc 19

<210> 820 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 820 cgtggtgccc ctctatgacc tgctgctgga gatgctggac gcccaccgcc tacatgcgcc 60 cactagcc 68 Page 178

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 821 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 821 2020201779

tggtccatcg ccagttatca 20

<210> 822 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 822 tgttctagcg atcttgcttc aca 23

<210> 823 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 823 atctgtatgc ggaacctcaa aagagtccct 30

<210> 824 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 824 tggtccatcg ccagttatca catctgtatg cggaacctca aaagagtccc tggtgtgaag 60 caagatcgct agaaca 76

<210> 825 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 179

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 825 tcaaacaaga gccaggaatg 20

<210> 826 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 826 aactgccaga gctgaagtga 20

<210> 827 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 827 atcgggaagg acccacatac caac 24

<210> 828 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 828 tcaaacaaga gccaggaatg tatcgggaag gacccacata ccaacggcga ggatcacttc 60 agctctggca gtt 73

<210> 829 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 829 tccagtgcct atgacccc 18

<210> 830 <211> 18 Page 180

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 830 actgtccaag ggcaccag 18

<210> 831 2020201779

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 831 cagacaaatc gccatcaagt cccc 24

<210> 832 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 832 tccagtgcct atgacccccc cagacaaatc gccatcaagt cccctgcccc tggtgccctt 60 ggacagt 67

<210> 833 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 833 tggaaacagc gaaggataca 20

<210> 834 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 834 Page 181

GHDX‐046_SEQLIST.TXT 11 Mar 2020

caccgaacac tccctagtcc 20

<210> 835 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 835 tcctgacttc tgtgagctca ttgcg 25

<210> 836 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 836 tggaaacagc gaaggataca gcctgtgcac atcctgactt ctgtgagctc attgcgcggg 60 actagggagt gttcggtg 78

<210> 837 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 837 aaggagcaaa ccatccagg 19

<210> 838 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 838 gcagggtttc attgagcac 19

<210> 839 <211> 24 <212> DNA <213> Artificial Sequence

Page 182

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 839 cccgggctca acatcactac ctgt 24

<210> 840 <211> 70 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 840 aaggagcaaa ccatccaggt gcccgggctc aacatcacta cctgtcatga tgtgctcaat 60 gaaaccctgc 70

<210> 841 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 841 gacagcgtag tggtgcatgt 20

<210> 842 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 842 agctgaacat ggactgtgga 20

<210> 843 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 843 tgcccttcgt gcacaccaat g 21

<210> 844 Page 183

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 82 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 844 gacagcgtag tggtgcatgt gctgaagctg cagggtgccg tgcccttcgt gcacaccaat 60 gttccacagt ccatgttcag ct 82 2020201779

<210> 845 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 845 gctgatggca gaaaaactca 20

<210> 846 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 846 ctttccttcc catcccact 19

<210> 847 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 847 cctgatgctg aaccaatgca ccat 24

<210> 848 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 184

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 848 gctgatggca gaaaaactca gactgtctgc aactttacag atggtgcatt ggttcagcat 60 caggagtggg atgggaagga aag 83

<210> 849 <211> 20 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 849 gttttcgcga gataacggtc 20

<210> 850 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 850 ctccggtgcc tgattcac 18

<210> 851 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 851 aacgcgctct tgtcgatttc ctgt 24

<210> 852 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 852 gttttcgcga gataacggtc gaaaacgcgc tcttgtcgat ttcctgtagt gaatcaggca 60 ccggag 66

<210> 853 <211> 19 <212> DNA Page 185

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 853 aagtcaggga aaacctgcg 19

<210> 854 <211> 19 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 854 gctggcccta cagctctct 19

<210> 855 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 855 aattgccaca ctgaccagcg aaga 24

<210> 856 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 856 aagtcaggga aaacctgcgg agaattgcca cactgaccag cgaagagaga gagctgtagg 60 gccagc 66

<210> 857 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 857 atcttcaaag cggagagcg 19 Page 186

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 858 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 858 2020201779

gctggatacc acatgctctg 20

<210> 859 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 859 tcctgacttt ctccgtggct cctc 24

<210> 860 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 860 atcttcaaag cggagagcgg gaggagccac ggagaaagtc aggagacaga gcatgtggta 60 tccagc 66

<210> 861 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 861 ccaggaagga aaagcactgt 20

<210> 862 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 187

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 862 gtggtctgcc ccttctttta 20

<210> 863 <211> 30 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 863 tgaagatttt gaagctaata catcccccac 30

<210> 864 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 864 ccaggaagga aaagcactgt tgaagatttt gaagctaata catcccccac taaaagaagg 60 ggcagaccac 70

<210> 865 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 865 agatgcagaa ggcatcttgg 20

<210> 866 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 866 gctggattgc ctctcgtatt 20

<210> 867 <211> 24 Page 188

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 867 tggccagctc ctctgtatga ctgc 24

<210> 868 2020201779

<211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 868 agatgcagaa ggcatcttgg aggacttgca gtcatacaga ggagctggcc acgaaatacg 60 agaggcaatc cagc 74

<210> 869 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 869 tgagaaggtg cgctattcaa 20

<210> 870 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 870 ggccattaaa agctcagtgc 20

<210> 871 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 871 Page 189

GHDX‐046_SEQLIST.TXT 11 Mar 2020

aagacctcat gcagttactc attcgcc 27

<210> 872 <211> 85 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 872 tgagaaggtg cgctattcaa gtacagagac tttagctgaa gacctcatgc agttactcat 60 tcgccgcact gagcttttaa tggcc 85

<210> 873 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 873 gttggctcac gtgggttac 19

<210> 874 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 874 gacaggaccg aaacattctg 20

<210> 875 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 875 agccactgca aacatactcg ttcatca 27

<210> 876 <211> 76 <212> DNA <213> Artificial Sequence

Page 190

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 876 gttggctcac gtgggttact gatgaacgag tatgtttgca gtggctaaaa agagtccaga 60 atgtttcggt cctgtc 76

<210> 877 <211> 21 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 877 ggattgctca acaaccatgc t 21

<210> 878 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 878 ggcattaaca cttttggacg ataa 24

<210> 879 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 879 tctggaccct cctacctctg gttcttacgt 30

<210> 880 <211> 91 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 880 ggattgctca acaaccatgc tgggcatctg gaccctccta cctctggttc ttacgtctgt 60 tgctagatta tcgtccaaaa gtgttaatgc c 91

Page 191

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 881 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 881 gcactttggg attctttcca ttat 24 2020201779

<210> 882 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 882 gcatgtaaga agaccctcac tgaa 24

<210> 883 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 883 acaacattct cggtgcctgt aacaaagaa 29

<210> 884 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 884 gcactttggg attctttcca ttatgattct ttgttacagg caccgagaat gttgtattca 60 gtgagggtct tcttacatgc 80

<210> 885 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 192

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 885 gcctcttcct gttcgacg 18

<210> 886 <211> 18 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 886 gctttgcccg gtagctct 18

<210> 887 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 887 tcgcccacct acgtactggc ctac 24

<210> 888 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 888 gcctcttcct gttcgacggc tcgcccacct acgtactggc ctacacccag agctaccggg 60 caaagc 66

<210> 889 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 889 gtctccagtg gaagggaaaa 20

<210> 890 <211> 21 <212> DNA Page 193

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 890 aggaatgcag ctactcactg g 21

<210> 891 <211> 24 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 891 cccatgatct tcaagcaggg aagc 24

<210> 892 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 892 gtctccagtg gaagggaaaa gcccatgatc ttcaagcagg gaagccccag tgagtagctg 60 cattcct 67

<210> 893 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 893 tcttccgtcc ctgtcacct 19

<210> 894 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 894 agagttggtg gcctctggt 19 Page 194

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 895 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 895 2020201779

acaccatgtc ctgaccaagg gctt 24

<210> 896 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 896 tcttccgtcc ctgtcacctg ccaagccctt ggtcaggaca tggtgtcacc agaggccacc 60 aactct 66

<210> 897 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 897 ggtggctgtc ctcaaaatct 20

<210> 898 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 898 tctagccagg aggagtttgg 20

<210> 899 <211> 24 <212> DNA <213> Artificial Sequence

<220> Page 195

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 899 ttctcggatc tccctcagtc tgcc 24

<210> 900 <211> 74 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 900 ggtggctgtc ctcaaaatct gcttctcgga tctccctcag tctgccccca gcccccaaac 60 tcctcctggc taga 74

<210> 901 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 901 gcatcggttt ccatctgc 18

<210> 902 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 902 aacatattgg cttcgtggga 20

<210> 903 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 903 ccattgactt tgccatccgg gtag 24

<210> 904 <211> 67 Page 196

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 904 gcatcggttt ccatctgcag atctacccgg atggcaaagt caatggatcc cacgaagcca 60 atatgtt 67 2020201779

<210> 905 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 905 gggccattaa ttctgaccac 20

<210> 906 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 906 cccgggacat agtgatgaa 19

<210> 907 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 907 catccacctt gcctctcagg cac 23

<210> 908 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 908 Page 197

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gggccattaa ttctgaccac gtgcctgaga ggcaaggtgg atggccctgg gacagaaact 60 gttcatcact atgtcccggg 80

<210> 909 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 909 ccagagcaaa tggctacaaa 20

<210> 910 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 910 tcccctcctt ccatgtaatc 20

<210> 911 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 911 cagccctgag cgacacacaa gaag 24

<210> 912 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 912 ccagagcaaa tggctacaaa tgtgaactgt tccagccctg agcgacacac aagaagttat 60 gattacatgg aaggagggga 80

<210> 913 <211> 19 <212> DNA <213> Artificial Sequence Page 198

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 913 gagggactgt tggcatgca 19

<210> 914 <211> 25 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 914 gagtgagaat tcgatccaag tcttc 25

<210> 915 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 915 tcccagagac caacgttcaa gcagttg 27

<210> 916 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 916 gagggactgt tggcatgcag tgccctccca gagaccaacg ttcaagcagt tggtagaaga 60 cttggatcga attctcactc 80

<210> 917 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 917 ctggcttaag gatggacagg 20

Page 199

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 918 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 918 acgagactcc agtgctgatg 20 2020201779

<210> 919 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 919 cctttcatgg ggagaaccgc att 23

<210> 920 <211> 81 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 920 ctggcttaag gatggacagg cctttcatgg ggagaaccgc attggaggca ttcggctgcg 60 ccatcagcac tggagtctcg t 81

<210> 921 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 921 cccacagtag aggggtctca 20

<210> 922 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 200

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 922 ggttctggct ttcacgtctg 20

<210> 923 <211> 24 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 923 tctccccagt tccacagcag tgtc 24

<210> 924 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 924 cccacagtag aggggtctca tgtctcccca gttccacagc agtgtcacag acgtgaaagc 60 cagaacc 67

<210> 925 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 925 gaacctgcgg tggacact 18

<210> 926 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 926 gaagacaccc tggccctc 18

<210> 927 <211> 24 <212> DNA Page 201

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 927 taccaggccc atagcactgg acac 24

<210> 928 <211> 66 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 928 gaacctgcgg tggacacttc cggtgtccag tgctatgggc ctggtattga gggccagggt 60 gtcttc 66

<210> 929 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 929 caggacaatg gtgatggct 19

<210> 930 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 930 tgatggtgta ctcgccagg 19

<210> 931 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 931 atgtgctgtc agctacctgc ccac 24 Page 202

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 932 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 932 2020201779

caggacaatg gtgatggctc atgtgctgtc agctacctgc ccacggagcc tggcgagtac 60 accatca 67

<210> 933 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 933 ggctcctgaa tctatctttg 20

<210> 934 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 934 tcccacagca atactccgta 20

<210> 935 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 935 ctacagcacc aagagcgacg tgtg 24

<210> 936 <211> 75 <212> DNA <213> Artificial Sequence

<220> Page 203

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 936 ggctcctgaa tctatctttg acaaaatcta cagcaccaag agcgacgtgt ggtcttacgg 60 agtattgctg tggga 75

<210> 937 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 937 accaagaagc tgaggacctg 20

<210> 938 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 938 cctggaagct gtagcagaca 20

<210> 939 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 939 agcccgctga ccatggaaga tct 23

<210> 940 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 940 accaagaagc tgaggacctg tggctgagcc cgctgaccat ggaagatctt gtctgctaca 60 gcttccagg 69

<210> 941 Page 204

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 941 ggaagtgaca gacgtgaagg t 21 2020201779

<210> 942 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 942 acacggtagc cggtcact 18

<210> 943 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 943 actctcaggc ggtgtccaca tgat 24

<210> 944 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 944 ggaagtgaca gacgtgaagg tcaccatcat gtggacaccg cctgagagtg cagtgaccgg 60 ctaccgtgt 69

<210> 945 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 205

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 945 cgagcccttt gatgacttcc t 21

<210> 946 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 946 ggagcgggct gtctcaga 18

<210> 947 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 947 tcccagcatc atccaggccc ag 22

<210> 948 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 948 cgagcccttt gatgacttcc tgttcccagc atcatccagg cccagtggct ctgagacagc 60 ccgctcc 67

<210> 949 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 949 gtaagcacca tgccccac 18

<210> 950 <211> 18 <212> DNA <213> Artificial Sequence Page 206

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 950 ggggcagagg cacttgta 18

<210> 951 <211> 24 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 951 tatgaaccgc ctgacccaag tgaa 24

<210> 952 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 952 gtaagcacca tgccccacac ctcgggtatg aaccgcctga cccaagtgaa gacacctgta 60 caagtgcctc tgcccc 76

<210> 953 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 953 ctgtttgctg tccggagg 18

<210> 954 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 954 gtggaggaac tctgggaatg 20

Page 207

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 955 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 955 tgtttccatg gctaccccac aggt 24 2020201779

<210> 956 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 956 ctgtttgctg tccggaggca cctgtggggt agccatggaa acagcacatt cccagagttc 60 ctccac 66

<210> 957 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 957 tgtttttgtc gcaacttcca 20

<210> 958 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 958 tggaaaggtt ccctgatgta ct 22

<210> 959 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 208

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 959 tgatttatgt cccttccctc cccc 24

<210> 960 <211> 70 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 960 tgtttttgtc gcaacttcca ttgatttatg tcccttccct cccccctaag tacatcaggg 60 aacctttcca 70

<210> 961 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 961 aggcctcctg tccttctaca 20

<210> 962 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 962 tgtgtgaacc tggtcttgaa a 21

<210> 963 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 963 cgcaccaaac aagtgctgca ca 22

<210> 964 <211> 69 <212> DNA Page 209

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 964 aggcctcctg tccttctaca atgcccgcac caaacaagtg ctgcacactt tcaagaccag 60 gttcacaca 69

<210> 965 2020201779

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 965 gaagcgcaga tcatgaagaa 20

<210> 966 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 966 ctcctcagac accactgcat 20

<210> 967 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 967 ctgaagcacg acaagctggt ccag 24

<210> 968 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 968 gaagcgcaga tcatgaagaa gctgaagcac gacaagctgg tccagctcta tgcagtggtg 60 Page 210

GHDX‐046_SEQLIST.TXT 11 Mar 2020

tctgaggag 69

<210> 969 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 969 aatctgcctg tggccttg 18

<210> 970 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 970 cgagatgttg ctggtgaca 19

<210> 971 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 971 ccagcctcag tgccacttga catt 24

<210> 972 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 972 aatctgcctg tggccttgcc cgccagcctc agtgccactt gacattcctt gtcaccagca 60 acatctcg 68

<210> 973 <211> 20 <212> DNA <213> Artificial Sequence

Page 211

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 973 ccactgtcct gacaatgacc 20

<210> 974 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 974 gagatccatc gctgtgacat 20

<210> 975 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 975 ctcagcacca ttgcccggaa at 22

<210> 976 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 976 ccactgtcct gacaatgacc accctcagca ccattgcccg gaaatcgctc cccaaggtct 60 cctatgtcac agcgatggat ctc 83

<210> 977 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 977 gtgctggtga cgaatcca 18

<210> 978 Page 212

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 978 cccggcaaaa acaaataagt 20 2020201779

<210> 979 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 979 ttcatctcaa tggaaggatc ctgcc 25

<210> 980 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 980 gtgctggtga cgaatccaca ttcatctcaa tggaaggatc ctgccttaag tcaacttatt 60 tgtttttgcc ggg 73

<210> 981 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 981 accctcgaca agaccacact 20

<210> 982 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 213

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 982 tgggagttca tgggtacaga 20

<210> 983 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 983 tgggagttca tgggtacaga 20

<210> 984 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 984 accctcgaca agaccacact ttgggacttg ggagctgggg ctgaagttgc tctgtaccca 60 tgaactccca 70

<210> 985 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 985 cgctccagac ctatgatgac t 21

<210> 986 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 986 acagtggaag gaccaggact 20

<210> 987 <211> 24 <212> DNA <213> Artificial Sequence Page 214

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 987 tgttagccaa agactgccac tgca 24

<210> 988 <211> 72 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 988 cgctccagac ctatgatgac ttgttagcca aagactgcca ctgcatatga gcagtcctgg 60 tccttccact gt 72

<210> 989 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 989 ccacctccca caggttca 18

<210> 990 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 990 ggtgcgtgcc tgtagtcc 18

<210> 991 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 991 cgtgcctcag cctcctgagt agct 24

Page 215

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 992 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 992 ccacctccca caggttcagg cgattcccgt gcctcagcct cctgagtagc tgggactaca 60 2020201779

ggcacgcacc 70

<210> 993 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 993 ggattcacat cgcggaaa 18

<210> 994 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 994 gttcttgcat aacaatccgg tc 22

<210> 995 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 995 ccctgctcac atgcctcaca tgat 24

<210> 996 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 216

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 996 ggattcacat cgcggaaagt ccctgctcac atgcctcaca tgattgaccg gattgttatg 60 caagaac 67

<210> 997 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 997 aagggctaaa tccaggtgtg 20

<210> 998 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 998 ctggatctct gtggctggt 19

<210> 999 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 999 tcctgtcctt cactgtcctt gcca 24

<210> 1000 <211> 81 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1000 aagggctaaa tccaggtgtg acggtatcta atgatgtcct gtccttcact gtccttgcca 60 tcaccagcca cagagatcca g 81

<210> 1001 <211> 18 Page 217

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1001 atgtgcttgg agtggcct 18

<210> 1002 2020201779

<211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1002 tgtagaacat aaacacgggc a 21

<210> 1003 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1003 cgctgagaaa ccaaacacac ccag 24

<210> 1004 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1004 atgtgcttgg agtggcctgg ctgggtgtgt ttggtttctc agcggtgccc gtgtttatgt 60 tctaca 66

<210> 1005 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1005 Page 218

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cagcctcgcc tttaaggat 19

<210> 1006 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1006 tgacaaatat ggccaagcag 20

<210> 1007 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1007 caaacagtgc cctgatctcc gttg 24

<210> 1008 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1008 cagcctcgcc tttaaggatg gcaaacagtg ccctgatctc cgttggctgc ttggccatat 60 ttgtca 66

<210> 1009 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1009 caaggaccag atccagcg 18

<210> 1010 <211> 18 <212> DNA <213> Artificial Sequence

Page 219

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1010 ggtagggcag gaagcagg 18

<210> 1011 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1011 ctcagcaccg tggtcatctt cctg 24

<210> 1012 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1012 caaggaccag atccagcggc tggtgctcag caccgtggtc atcttcctgg cctgcttcct 60 gccctacc 68

<210> 1013 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1013 agtacaagca ggctgccaag 20

<210> 1014 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1014 gcagctcagg gaagtcaca 19

<210> 1015 Page 220

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1015 cctcctgctg gcttcctttg atca 24 2020201779

<210> 1016 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1016 agtacaagca ggctgccaag tgcctcctgc tggcttcctt tgatcactgt gacttccctg 60 agctgc 66

<210> 1017 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1017 ccatctgcat ccatcttgtt 20

<210> 1018 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1018 ggccaccagg gtattatctg 20

<210> 1019 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 221

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1019 ctccccaccc ttgagaagtg cct 23

<210> 1020 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1020 ccatctgcat ccatcttgtt tgggctcccc acccttgaga agtgcctcag ataataccct 60 ggtggcc 67

<210> 1021 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1021 gtgtgggcaa ggacaagc 18

<210> 1022 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1022 gacctgattt ggcctcacc 19

<210> 1023 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1023 tccaccctcc ctttctcact ccac 24

<210> 1024 <211> 68 <212> DNA <213> Artificial Sequence Page 222

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1024 gtgtgggcaa ggacaagcag gatagtggag tgagaaaggg agggtggagg gtgaggccaa 60 atcaggtc 68

<210> 1025 <211> 18 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1025 gacaaggacg gcagcaag 18

<210> 1026 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1026 ttgtggcctg tctggacc 18

<210> 1027 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1027 ccaggagttg ccaccactgt tgtc 24

<210> 1028 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1028 gacaaggacg gcagcaaggt gacaacagtg gtggcaactc ctgggcaggg tccagacagg 60 ccacaa 66 Page 223

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1029 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1029 2020201779

cttctgctaa gcggtacatc ga 22

<210> 1030 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1030 ggctcaaagc cttgcttcac 20

<210> 1031 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1031 acccagccaa tcgggatcgg c 21

<210> 1032 <211> 85 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1032 cttctgctaa gcggtacatc gagacggacc cagccaatcg ggatcggcgg acgcccatca 60 ccgtggtgaa gcaaggcttt gagcc 85

<210> 1033 <211> 27 <212> DNA <213> Artificial Sequence

<220> Page 224

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1033 aagctatgag gaaaagaagt acacgat 27

<210> 1034 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1034 ggcccagctt gaatttttca 20

<210> 1035 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1035 tcagccactg gcttctgtca taatcaggag 30

<210> 1036 <211> 86 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1036 aagctatgag gaaaagaagt acacgatggg ggacgctcct gattatgaca gaagccagtg 60 gctgaatgaa aaattcaagc tgggcc 86

<210> 1037 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1037 ctgcaggcac tccctgaaat 20

<210> 1038 <211> 20 Page 225

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1038 ccaagaaacc atggctgctt 20

<210> 1039 2020201779

<211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1039 ctgaagctct actcacagtt tctggg 26

<210> 1040 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1040 ctgcaggcac tccctgaaat gctgaagctc tactcacagt ttctggggaa gcagccatgg 60 tttcttgg 68

<210> 1041 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1041 caagtaccac agcgatgact acattaa 27

<210> 1042 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1042 Page 226

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gcttgctgta ctccgacatg tt 22

<210> 1043 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1043 ttcttgcgct ccatccgtcc aga 23

<210> 1044 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1044 caagtaccac agcgatgact acattaaatt cttgcgctcc atccgtccag ataacatgtc 60 ggagtacagc aagc 74

<210> 1045 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1045 aaccaggcag tcaccttgag 20

<210> 1046 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1046 ctctgtcttc ctgcatcgc 19

<210> 1047 <211> 24 <212> DNA <213> Artificial Sequence

Page 227

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1047 ccccctgaag ctcttcctct gctt 24

<210> 1048 <211> 69 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1048 aaccaggcag tcaccttgag gaagcagagg aagagcttca gggggaccag gcgatgcagg 60 aagacagag 69

<210> 1049 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1049 ctcaggtctg cccctacaat 20

<210> 1050 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1050 ttattggtgc tccgtggac 19

<210> 1051 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1051 ctgagcagct ctcaggatcg gctt 24

<210> 1052 Page 228

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1052 ctcaggtctg cccctacaat ctctatgctg agcagctctc aggatcggct ttcacttgtc 60 cacggagcac caataa 76 2020201779

<210> 1053 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1053 ctcagagccc cacctgag 18

<210> 1054 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1054 gggtttccct gccatactg 19

<210> 1055 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1055 cgactcactg accgaggcct gtaa 24

<210> 1056 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 229

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1056 ctcagagccc cacctgagcc tgccgactca ctgaccgagg cctgtaagca gtatggcagg 60 gaaaccc 67

<210> 1057 <211> 19 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1057 ggatgaggaa aagggggat 19

<210> 1058 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1058 tccctagctg actttctccg 20

<210> 1059 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1059 ccattgctcc tggttctggg tttc 24

<210> 1060 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1060 ggatgaggaa aagggggatt ggaaacccag aaccaggagc aatggccgga gaaagtcagc 60 taggga 66

<210> 1061 <211> 18 <212> DNA Page 230

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1061 tacgcacaga ggcaagca 18

<210> 1062 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1062 gagagaagtg ctggagaggc 20

<210> 1063 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1063 taagagtccg ggatccccag ccta 24

<210> 1064 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1064 tacgcacaga ggcaagcagc taagagtccg ggatccccag cctactgcct ctccagcact 60 tctctc 66

<210> 1065 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1065 ccatccccat catgggtatc 20 Page 231

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1066 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1066 2020201779

ccgcagctcc agtgactaca 20

<210> 1067 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1067 ctgcaaggac aaccaggcca gcaa 24

<210> 1068 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1068 cctgcgcggc tactacaacc agagcgaggc cagttctcac accctccagt ggatgattgg 60 ctgcgacctg 70

<210> 1069 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1069 caccctgcag gtgtctgag 19

<210> 1070 <211> 22 <212> DNA <213> Artificial Sequence

<220> Page 232

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1070 ggtacctagg agcagaaggt ga 22

<210> 1071 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1071 taagtgatct gccctccagg tggc 24

<210> 1072 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1072 caccctgcag gtgtctgaga ctaagtgatc tgccctccag gtggcgatca ccttctgctc 60 ctaggtacc 69

<210> 1073 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1073 tcccagcatc tcaacaagg 19

<210> 1074 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1074 cgtaccaggt gtacagagcg 20

<210> 1075 <211> 24 Page 233

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1075 cccctatgaa gacccagaag cgtg 24

<210> 1076 2020201779

<211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1076 tcccagcatc tcaacaaggg cacccctatg aagacccaga agcgtgccgc tctgtacacc 60 tggtacg 67

<210> 1077 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1077 gcggaagctg tatgtgctc 19

<210> 1078 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1078 ttcggataag atgaccgtcc 20

<210> 1079 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1079 Page 234

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cagtcaccag cccaaagtgc actt 24

<210> 1080 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1080 gcggaagctg tatgtgctca agtacctgtt tgaagtgcac tttgggctgg tgactgtgga 60 cggtcatctt atccgaa 77

<210> 1081 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1081 ggacgaatac gaccccact 19

<210> 1082 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1082 gcacgtctcc ccatcaat 18

<210> 1083 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1083 accacctgct tccggtagga atcc 24

<210> 1084 <211> 67 <212> DNA <213> Artificial Sequence

Page 235

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1084 ggacgaatac gaccccacta tagaggattc ctaccggaag caggtggtca ttgatgggga 60 gacgtgc 67

<210> 1085 <211> 20 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1085 ccagcgagtt cttgatgtga 20

<210> 1086 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1086 atctcaccag ccaccagg 18

<210> 1087 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1087 tcatgggcac cttcaatgtg atcc 24

<210> 1088 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1088 ccaccagaca agaccgattc gctggcctcc atttcttcaa cccagtgcct gtcatgaaac 60 ttgtgg 66

Page 236

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1089 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1089 gctttccaag tggggaatta 20 2020201779

<210> 1090 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1090 tgcctgcgat atttgttagg 20

<210> 1091 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1091 agttgcttcc atccaacctg gagg 24

<210> 1092 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1092 gctttccaag tggggaatta aagttgcttc catccaacct ggaggcttcc taacaaatat 60 cgcaggca 68

<210> 1093 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 237

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1093 gggacgtcct ggaacagt 18

<210> 1094 <211> 20 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1094 tggagaatct cacgcacttc 20

<210> 1095 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1095 cttcatcctc acagggctgc tggt 24

<210> 1096 <211> 81 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1096 gggacgtcct ggaacagttc ttcatcctca cagggctgct ggtgtgcctg gcctgcctgg 60 cgaagtgcgt gagattctcc a 81

<210> 1097 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1097 cgggaagctt cagagtacct t 21

<210> 1098 <211> 20 <212> DNA Page 238

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1098 acctcaggcc caatatcctt 20

<210> 1099 <211> 24 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1099 aggcggcgtc ctatttcctc aaat 24

<210> 1100 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1100 cgggaagctt cagagtacct ttgtatttga ggaaatagga cgccgcctaa aggatattgg 60 gcctgaggt 69

<210> 1101 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1101 gccttccttt aaccctgatg 20

<210> 1102 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1102 ggagtaaatt gggctgagta gg 22 Page 239

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1103 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1103 2020201779

acttccagca ggaagccaat ccag 24

<210> 1104 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1104 gccttccttt aaccctgatg tactggattg gcttcctgct ggaagtagtg agcttcctac 60 tcagcccaat ttactcc 77

<210> 1105 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1105 gcattgtgac cagcacctac 20

<210> 1106 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1106 gaagtgcctg ggctttcat 19

<210> 1107 <211> 24 <212> DNA <213> Artificial Sequence

<220> Page 240

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1107 atccgctcca tattggctgt ccag 24

<210> 1108 <211> 66 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1108 gcattgtgac cagcacctac ggctggacag ccaatatgga gcggatcatg aaagcccagg 60 cacttc 66

<210> 1109 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1109 ggctagtaga actggatccc aaca 24

<210> 1110 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1110 ggtctgccca aatgcttttc 20

<210> 1111 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1111 taattagacc taggcctcag ctgcactgcc 30

<210> 1112 <211> 84 Page 241

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1112 ggctagtaga actggatccc aacaccaaac tcttaattag acctaggcct cagctgcact 60 gcccgaaaag catttgggca gacc 84 2020201779

<210> 1113 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1113 cctccctctg gtggtgctt 19

<210> 1114 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1114 gctacatcta cacttggttg gcttaa 26

<210> 1115 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1115 ctcagggccc accattgaag aggttg 26

<210> 1116 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1116 Page 242

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cctccctctg gtggtgcttc ctcagggccc accattgaag aggttgatta agccaaccaa 60 gtgtagatgt agc 73

<210> 1117 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1117 ccgactggag gagcataaa 19

<210> 1118 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1118 atgctggctg actctgctc 19

<210> 1119 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1119 cgcacttttc tgagcagacg tcca 24

<210> 1120 <211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1120 ccgactggag gagcataaaa gcgcagccga gcccagcgcc ccgcactttt ctgagcagac 60 gtccagagca gagtcagcca gcat 84

<210> 1121 <211> 20 <212> DNA <213> Artificial Sequence Page 243

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1121 caccactcca gaggtagcag 20

<210> 1122 <211> 20 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1122 tgggaccaaa ccatacattg 20

<210> 1123 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1123 cacctttccc ttcccccaag gat 23

<210> 1124 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1124 caccactcca gaggtagcag catccttggg ggaagggaaa ggtgcatggt ccacaatgta 60 tggtttggtc cca 73

<210> 1125 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1125 gcaagcaaca gtagtcgctg 20

Page 244

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1126 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1126 ccaactttca cgctaactgg t 21 2020201779

<210> 1127 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1127 tctccaccct ttcctttaga acccg 25

<210> 1128 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1128 gcaagcaaca gtagtcgctg ttggatcggg ttctaaagga aagggtggag agattcaacc 60 agttagcgtg aaagttgg 78

<210> 1129 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1129 gagtacgtgt gccgagtgtt 20

<210> 1130 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 245

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1130 ctcaatggtg accaggaca 19

<210> 1131 <211> 23 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1131 cagctccgtg cctctagagg cct 23

<210> 1132 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1132 gagtacgtgt gccgagtgtt gggcagctcc gtgcctctag aggcctctgt cctggtcacc 60 attgag 66

<210> 1133 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1133 gcagacagtg accatctaca gctt 24

<210> 1134 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1134 cttctgagac ctctggcttc gt 22

<210> 1135 <211> 20 <212> DNA Page 246

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1135 ccggcgccca acgtgattct 20

<210> 1136 <211> 68 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1136 gcagacagtg accatctaca gctttccggc gcccaacgtg attctgacga agccagaggt 60 ctcagaag 68

<210> 1137 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1137 gtacctggtg cgcgagag 18

<210> 1138 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1138 gcgtctccgc tgtagtgtt 19

<210> 1139 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1139 tcaagttgcc tcggaagtcc cagt 24 Page 247

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1140 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1140 2020201779

gtacctggtg cgcgagagcg tatccccaac tgggacttcc gaggcaactt gaactcagaa 60 cactacagcg gagacgc 77

<210> 1141 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1141 atcccatgaa gcccagatac 20

<210> 1142 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1142 gcaccattct tagtggagca 20

<210> 1143 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1143 aaaattccac cccatgatca agaatcc 27

<210> 1144 <211> 69 <212> DNA <213> Artificial Sequence

<220> Page 248

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1144 atcccatgaa gcccagatac acaaaattcc accccatgat caagaatcct gctccactaa 60 gaatggtgc 69

<210> 1145 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1145 tgacaaccaa gcaaatgtga 20

<210> 1146 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1146 cagtctgccc atgtggtaat 20

<210> 1147 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1147 aagttgcccc aggtcaccag actc 24

<210> 1148 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1148 tgacaaccaa gcaaatgtga ggagtctggt gacctggggc aactttgcct ggatgtatta 60 ccacatgggc agactg 76

<210> 1149 Page 249

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1149 gctaaaacag ggaagcgaaa 20 2020201779

<210> 1150 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1150 caaccattac tgggatgctc 20

<210> 1151 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1151 tcgacctcga aacagcatct gactcc 26

<210> 1152 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1152 gctaaaacag ggaagcgaaa aaggagtcag atgctgtttc gaggtcgaag agcatcccag 60 taatggttg 69

<210> 1153 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 250

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1153 tccggagctg tgatctaagg a 21

<210> 1154 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1154 cggacagagc gagctgactt 20

<210> 1155 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1155 tgtattgcgc acccctcaag cctg 24

<210> 1156 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1156 tccggagctg tgatctaagg aggctggaga tgtattgcgc acccctcaag cctgccaagt 60 cagctcgctc tgtccg 76

<210> 1157 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1157 gcatggtagc cgaagatttc a 21

<210> 1158 <211> 30 <212> DNA <213> Artificial Sequence Page 251

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1158 tttccggtaa tagtctgtct catagatatc 30

<210> 1159 <211> 28 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1159 cgcgtcatac caaaatctcc gattttga 28

<210> 1160 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1160 gcatggtagc cgaagatttc acagtcaaaa tcggagattt tggtatgacg cgagatatct 60 atgagacaga ctattaccgg aaa 83

<210> 1161 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1161 ccgtgcttcc ggacaactt 19

<210> 1162 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1162 tggactgctt ccaggtgtca 20

Page 252

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1163 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1163 taccccgtgg gcaagttctt ccaa 24 2020201779

<210> 1164 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1164 ccgtgcttcc ggacaacttc cccagatacc ccgtgggcaa gttcttccaa tatgacacct 60 ggaagcagtc ca 72

<210> 1165 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1165 gtggacagca ccatgaaca 19

<210> 1166 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1166 ccttcatacc cgacttgagg 20

<210> 1167 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 253

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1167 cttccggcca gcactgcctc 20

<210> 1168 <211> 73 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1168 gtggacagca ccatgaacat gttgggcggg ggaggcagtg ctggccggaa gcccctcaag 60 tcgggtatga agg 73

<210> 1169 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1169 acatcccaac gcatgctc 18

<210> 1170 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1170 ccacgccctt gtttcaga 18

<210> 1171 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1171 acaccacaga aggctgtgag ctcc 24

<210> 1172 <211> 66 <212> DNA Page 254

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1172 acatcccaac gcatgctcct ggagctcaca gccttctgtg gtgtcatttc tgaaacaagg 60 gcgtgg 66

<210> 1173 2020201779

<211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1173 tggacaagta cgggatgaag ct 22

<210> 1174 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1174 cgaaggtgtg gcactgaaag t 21

<210> 1175 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1175 cccgtcaacg tactccatgc ctgg 24

<210> 1176 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1176 tggacaagta cgggatgaag ctgccaggca tggagtacgt tgacggggac tttcagtgcc 60 Page 255

GHDX‐046_SEQLIST.TXT 11 Mar 2020

acaccttcg 69

<210> 1177 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1177 tgaaccgcag agaccaacag 20

<210> 1178 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1178 gtcttggaca cccgcagaat 20

<210> 1179 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1179 atccaggcac ctctaccacg ccctc 25

<210> 1180 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1180 tgaaccgcag agaccaacag aggaatccag gcacctctac cacgccctcc cagcccaatt 60 ctgcgggtgt ccaagac 77

<210> 1181 <211> 20 <212> DNA <213> Artificial Sequence

Page 256

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1181 ctgaccacgc tttctagctg 20

<210> 1182 <211> 21 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1182 ccaagcccag agacaagata a 21

<210> 1183 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1183 ttgagctgtt ttccctgacc tccc 24

<210> 1184 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1184 ctgaccacgc tttctagctg ttgagctgtt ttccctgacc tccctctaat ttatcttgtc 60 tctgggcttg g 71

<210> 1185 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1185 tggaaggttc cacaagtcac 20

<210> 1186 Page 257

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1186 tcttgacctt gcagctttgt 20 2020201779

<210> 1187 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1187 cctgtgatca acagtacccg tatggg 26

<210> 1188 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1188 tggaaggttc cacaagtcac cctgtgatca acagtacccg tatgggacaa agctgcaagg 60 tcaaga 66

<210> 1189 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1189 tcaagcaaca ctcctagggc 20

<210> 1190 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 258

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1190 cagctccttt ctgggttgtg 20

<210> 1191 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1191 tggcttctgt ctgatcaagg cacc 24

<210> 1192 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1192 tcaagcaaca ctcctagggc ctggcttctg tctgatcaag gcaccacaca acccagaaag 60 gagctg 66

<210> 1193 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1193 ggtccttggt agagggctac tt 22

<210> 1194 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1194 ggatggagct tcaggagaga 20

<210> 1195 <211> 24 <212> DNA <213> Artificial Sequence Page 259

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1195 tctccaccct ggccctgtta cagt 24

<210> 1196 <211> 69 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1196 ggtccttggt agagggctac tttactgtaa cagggccagg gtggagagtt ctctcctgaa 60 gctccatcc 69

<210> 1197 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1197 agctgaggaa gatgctggtt 20

<210> 1198 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1198 ggaaagaagg tgctcaggtc 20

<210> 1199 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1199 tgcccacaga ccttccagga gaat 24

Page 260

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1200 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1200 agctgaggaa gatgctggtt ccctgcccac agaccttcca ggagaatgac ctgagcacct 60 2020201779

tctttcc 67

<210> 1201 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1201 acctcaactc ctgccacaat 20

<210> 1202 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1202 cactgtttgt gacaagtgca ag 22

<210> 1203 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1203 tgcaactcct gtcttgcatt gcac 24

<210> 1204 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 261

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1204 acctcaactc ctgccacaat gtacaggatg caactcctgt cttgcattgc actaagtctt 60 gcacttgtca caaacagtg 79

<210> 1205 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1205 cctgaacctt ccaaagatgg 20

<210> 1206 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1206 accaggcaag tctcctcatt 20

<210> 1207 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1207 ccagattgga agcatccatc tttttca 27

<210> 1208 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1208 cctgaacctt ccaaagatgg ctgaaaaaga tggatgcttc caatctggat tcaatgagga 60 gacttgcctg gt 72

<210> 1209 <211> 20 Page 262

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1209 ccagcttatc tcaggggtgt 20

<210> 1210 2020201779

<211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1210 ctggcgtaga accttccg 18

<210> 1211 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1211 cctttggctt cacggaagag cctt 24

<210> 1212 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1212 ccagcttatc tcaggggtgt gcggcctttg gcttcacgga agagccttgc ggaaggttct 60 acgccag 67

<210> 1213 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1213 Page 263

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ggcctaatgt tccagatcct 20

<210> 1214 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1214 aaaattgtgc cttggaggag 20

<210> 1215 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1215 catattgccc agtggtcacc tcaca 25

<210> 1216 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1216 ggcctaatgt tccagatcct tcaaagagtc atattgccca gtggtcacct cacactcctc 60 caaggcacaa tttt 74

<210> 1217 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1217 aaggaaccat ctcactgtgt gtaaac 26

<210> 1218 <211> 20 <212> DNA <213> Artificial Sequence

Page 264

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1218 atcaggaagg ctgccaagag 20

<210> 1219 <211> 22 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1219 tgacttccaa gctggccgtg gc 22

<210> 1220 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1220 aaggaaccat ctcactgtgt gtaaacatga cttccaagct ggccgtggct ctcttggcag 60 ccttcctgat 70

<210> 1221 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1221 gacacgccaa gtggttcc 18

<210> 1222 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1222 ctcaagaccc ggatcacaa 19

<210> 1223 Page 265

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1223 acacaagact tcagcccgtt ggct 24 2020201779

<210> 1224 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1224 gacacgccaa gtggttccag gccagagcca acgggctgaa gtcttgtgtc attgtgatcc 60 gggtcttgag 70

<210> 1225 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1225 ctcaggattt tctcgcatcc 20

<210> 1226 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1226 aggagcaggt ggagactgg 19

<210> 1227 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 266

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1227 atgtgctccc agtgctaggt gcct 24

<210> 1228 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1228 ctcaggattt tctcgcatcc aaatgtgctc ccagtgctag gtgcctgcca gtctccacct 60 gctcct 66

<210> 1229 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1229 ctgcctatgc cagactcaga 20

<210> 1230 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1230 gcttttctgg cttcctcttc 20

<210> 1231 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1231 caactgcatg gctctgaaca gcct 24

<210> 1232 <211> 76 <212> DNA <213> Artificial Sequence Page 267

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1232 ctgcctatgc cagactcaga ggaatcgaac aggctgttca gagccatgca gttgctgaag 60 aggaagccag aaaagc 76

<210> 1233 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1233 cctacagcaa gtgcaaggaa 20

<210> 1234 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1234 catctcgtag gtctgcatgg 20

<210> 1235 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1235 ccagctgcac tttgtcgtca ctgt 24

<210> 1236 <211> 65 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1236 cctacagcaa gtgcaaggaa tacagtgacg acaaagtgca gctggccatg cagacctacg 60 agatg 65 Page 268

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1237 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1237 2020201779

gtgcccgagc catatagca 19

<210> 1238 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1238 cggtagtggt tgatgactgt tga 23

<210> 1239 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1239 acgtccgggt cctcactgtc cttcc 25

<210> 1240 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1240 gtgcccgagc catatagcag gcacgtccgg gtcctcactg tccttccact caacagtcat 60 caaccactac cg 72

<210> 1241 <211> 19 <212> DNA <213> Artificial Sequence

<220> Page 269

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1241 ctgtcatatt gccccatgc 19

<210> 1242 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1242 cagattccag cagccacc 18

<210> 1243 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1243 tgagaagaca ttcaccacca cccc 24

<210> 1244 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1244 ctgtcatatt gccccatgcc tgagaagaca ttcaccacca ccccaggagg gtggctgctg 60 gaatctg 67

<210> 1245 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1245 gcttcttctg gagatgtgct ct 22

<210> 1246 <211> 22 Page 270

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1246 cctgtagata atgacctggc ct 22

<210> 1247 2020201779

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1247 ttgctggaca gcctcggtac aatc 24

<210> 1248 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1248 gcttcttctg gagatgtgct ctatattgct ggacagcctc ggtacaatca tacaggccag 60 gtcattatct acagg 75

<210> 1249 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1249 ccatgatcct cactctgctg 20

<210> 1250 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1250 Page 271

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gaagctttgt agccggtgat 20

<210> 1251 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1251 cactccagac ctcgcttagc atgg 24

<210> 1252 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1252 ccatgatcct cactctgctg gtggactata cactccagac ctcgcttagc atggtaaatc 60 accggctaca aagcttc 77

<210> 1253 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1253 caacgcttca gtgatcaatc c 21

<210> 1254 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1254 gtctggccgg gattcttt 18

<210> 1255 <211> 24 <212> DNA <213> Artificial Sequence

Page 272

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1255 cgatcctgca tctgtaaatc gccc 24

<210> 1256 <211> 66 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1256 caacgcttca gtgatcaatc ccggggcgat ttacagatgc aggatcggaa agaatcccgg 60 ccagac 66

<210> 1257 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1257 aggccagccc tacattatca 20

<210> 1258 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1258 gtcttctcca cagtccagca 20

<210> 1259 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1259 tctgagcctt gtcctctatc cggc 24

<210> 1260 Page 273

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1260 aggccagccc tacattatca gagcaagagc cggatagagg acaaggctca gatcttgctg 60 gactgtggag aagac 75 2020201779

<210> 1261 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1261 cagtgacaaa cagcccttcc 20

<210> 1262 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1262 gtttagcctc atgggcgtc 19

<210> 1263 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1263 tcgccatctt ttgtgggatt cctt 24

<210> 1264 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 274

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1264 cagtgacaaa cagcccttcc aacccaagga atcccacaaa agatggcgat gacgcccatg 60 aggctaaac 69

<210> 1265 <211> 22 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1265 gatatgattg gtcgctgctt tg 22

<210> 1266 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1266 agaacttcca ttccccacca t 21

<210> 1267 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1267 cagccaggac ctggccatcc g 21

<210> 1268 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1268 gatatgattg gtcgctgctt tgtgctcagc caggacctgg ccatccggga tgagttggat 60 ggtggggaat ggaagttct 79

<210> 1269 <211> 18 <212> DNA Page 275

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1269 gagcctggtg gatcccat 18

<210> 1270 <211> 18 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1270 actgtcagga tgcccgtg 18

<210> 1271 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1271 caactgaaag gcctgacgtt cacg 24

<210> 1272 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1272 gagcctggtg gatcccatcg tccaactgaa aggcctgacg ttcacggcca cgggcatcct 60 gacagt 66

<210> 1273 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1273 accgggagcc ctacatgac 19 Page 276

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1274 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1274 2020201779

ccttaagctc tttcactgac tcaatct 27

<210> 1275 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1275 aaatacctgc aaccgttact gccgtgac 28

<210> 1276 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1276 accggggagc cctacatgac gaaaatacct gcaaccgtta ctgccgtgac gagattgagt 60 cagtgaaaga gcttaagg 78

<210> 1277 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1277 caaggtgccc tcagtgga 18

<210> 1278 <211> 19 <212> DNA <213> Artificial Sequence

<220> Page 277

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1278 gcgcacacct tcatctcat 19

<210> 1279 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1279 caccaacctg tacccgtatt gcga 24

<210> 1280 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1280 caaggtgccc tcagtggagc tcaccaacct gtacccgtat tgcgactatg agatgaaggt 60 gtgcgc 66

<210> 1281 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1281 tcgtgaaaga tgaccaggag 20

<210> 1282 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1282 ggtgaacatc atgacgcagt 20

<210> 1283 <211> 27 Page 278

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1283 tgctatgttt ctacaaaacc gccaagg 27

<210> 1284 2020201779

<211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1284 tcgtgaaaga tgaccaggag gctgtgctat gtttctacaa aaccgccaag gactgcgtca 60 tgatgttcac c 71

<210> 1285 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1285 gaggaggtgt gggtgttcc 19

<210> 1286 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1286 gtaatcccat gtccgcga 18

<210> 1287 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1287 Page 279

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ccatcctaac ggaacgagct ccct 24

<210> 1288 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1288 gaggaggtgt gggtgttccg cttccatcct aacggaacga gctccctctt cgcggacatg 60 ggattac 67

<210> 1289 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1289 ttgccatcgt gtcagtgc 18

<210> 1290 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1290 atggagctgg cgtcattg 18

<210> 1291 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1291 tccaggtctc ggatctcaga cacg 24

<210> 1292 <211> 67 <212> DNA <213> Artificial Sequence

Page 280

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1292 ttgccatcgt gtcagtgccc gtgtctgaga tccgagacct ggactttgcc aatgacgcca 60 gctccat 67

<210> 1293 <211> 18 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1293 taactgggat gcatgggc 18

<210> 1294 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1294 ctctgcctta actggccg 18

<210> 1295 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1295 agccctctct caccgttcca agtg 24

<210> 1296 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1296 taactgggat gcatgggcag cccagccctc tctcaccgtt ccaagtgccg gccagttaag 60 gcagag 66

Page 281

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1297 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1297 tggcttacac tggcaatgg 19 2020201779

<210> 1298 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1298 gcatagctgt gagatgcgg 19

<210> 1299 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1299 actcgatttc ccagccaacc acag 24

<210> 1300 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1300 tggcttacac tggcaatggt agtttctgtg gttggctggg aaatcgagtg ccgcatctca 60 cagctatgc 69

<210> 1301 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 282

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1301 gactgcaaag atggaaacga 20

<210> 1302 <211> 20 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1302 tagccataag gtccgctctc 20

<210> 1303 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1303 ctatgacgat gccctcaacg cctc 24

<210> 1304 <211> 81 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1304 gactgcaaag atggaaacga ccttctatga cgatgccctc aacgcctcgt tcctcccgtc 60 cgagagcgga ccttatggct a 81

<210> 1305 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1305 ctgtcagctg ctgcttgg 18

<210> 1306 <211> 18 <212> DNA Page 283

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1306 agggggtgtc cgtaaagg 18

<210> 1307 <211> 23 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1307 caagggacac gccttctgaa cgt 23

<210> 1308 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1308 ctgtcagctg ctgcttgggg tcaagggaca cgccttctga acgtcccctg cccctttacg 60 gacaccccct 70

<210> 1309 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1309 tgtgctattc atcccatacc tg 22

<210> 1310 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1310 gggcatagga gaaggcaag 19 Page 284

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1311 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1311 2020201779

ttatacattc acatggacgg cccg 24

<210> 1312 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1312 tgtgctattc atcccatacc tgggaattat acattcacat ggacggcccg gcttgccttc 60 tcctatgccc 70

<210> 1313 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1313 agcagttact ggcaagaggg 20

<210> 1314 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1314 tggagacctg agcagcct 18

<210> 1315 <211> 24 <212> DNA <213> Artificial Sequence

<220> Page 285

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1315 actcttaggc ggcagcgtcc tttc 24

<210> 1316 <211> 66 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1316 agcagttact ggcaagaggg agaaaggacg ctgccgccta agagtgcaag gctgctcagg 60 tctcca 66

<210> 1317 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1317 cgggcaagaa gagtggac 18

<210> 1318 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1318 ctgtagacgc cctttgctgt 20

<210> 1319 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1319 caagacacaa ggcaccttca gcga 24

<210> 1320 <211> 69 Page 286

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1320 cgggcaagaa gagtggacta actcaagaca caaggcacct tcagcgagga cagcaaaggg 60 cgtctacag 69 2020201779

<210> 1321 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1321 cagacaccag ctctgaggc 19

<210> 1322 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1322 aacattgtga ggcggacc 18

<210> 1323 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1323 tccccagtgt ccaggcacag agta 24

<210> 1324 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1324 Page 287

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cagacaccag ctctgaggcc agttaatcat ccccagtgtc caggcacaga gtagtcggtc 60 cgcctcacaa tgtt 74

<210> 1325 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1325 ccgtgggaca tggagtgt 18

<210> 1326 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1326 gaagcaagtc cgtctccaag 20

<210> 1327 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1327 tccgctagtg atcctttgca ccct 24

<210> 1328 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1328 ccgtgggaca tggagtgttc cttccgctag tgatcctttg caccctgctt ggagacggac 60 ttgcttc 67

<210> 1329 <211> 20 <212> DNA <213> Artificial Sequence Page 288

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1329 agagctggtc tcctccaaaa 20

<210> 1330 <211> 20 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1330 gctggtcttg ctctgtttca 20

<210> 1331 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1331 caggtcagca aacttgaaag cagcc 25

<210> 1332 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1332 agagctggtc tcctccaaaa tacaggtcag caaacttgaa agcagcctga aacagagcaa 60 gaccagc 67

<210> 1333 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1333 gaggcaactg cttatggctt aatta 25

Page 289

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1334 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1334 ggcactcggc ttgagcat 18 2020201779

<210> 1335 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1335 ttacagcgac agtcatggcc gcat 24

<210> 1336 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1336 gaggcaactg cttatggctt aattaagtca gatgcggcca tgactgtcgc tgtaaagatg 60 ctcaagccga gtgcc 75

<210> 1337 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1337 agtggctacg ggatgaactg 20

<210> 1338 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 290

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1338 tgagccacag actgctcact 20

<210> 1339 <211> 24 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1339 caacacgcag cagaaactgc agaa 24

<210> 1340 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1340 agtggctacg ggatgaactg gccaacacgc agcagaaact gcagaagagt gagcagtctg 60 tggctca 67

<210> 1341 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1341 cacgagaccg gctacttctc 20

<210> 1342 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1342 gctctaggca ggtctgttgc 20

<210> 1343 <211> 24 <212> DNA Page 291

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1343 agtactcctc cagagacggc agcg 24

<210> 1344 <211> 67 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1344 cacgagaccg gctacttctc ggcgctgccg tctctggagg agtactggca acagacctgc 60 ctagagc 67

<210> 1345 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1345 aacacagccc agtttgttca 20

<210> 1346 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1346 ccaggaggct catgttgaag 20

<210> 1347 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1347 tcagtgagag cttcccacac cctg 24 Page 292

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1348 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1348 2020201779

aacacagccc agtttgttca tgtcagtgag agcttcccac accctggctt caacatgagc 60 ctcctgg 67

<210> 1349 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1349 gcccagaggc tccatcgt 18

<210> 1350 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1350 cagaggtttg aacagtgcag aca 23

<210> 1351 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1351 cctcttcctc cccagtcggc tga 23

<210> 1352 <211> 78 <212> DNA <213> Artificial Sequence

<220> Page 293

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1352 gcccagaggc tccatcgtcc atcctcttcc tccccagtcg gctgaactct ccccttgtct 60 gcactgttca aacctctg 78

<210> 1353 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1353 caccccggct tcaacaac 18

<210> 1354 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1354 catcttcacc agcatgatgt ca 22

<210> 1355 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1355 cctccccaac aaagaccacc gca 23

<210> 1356 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1356 caccccggct tcaacaacag cctccccaac aaagaccacc gcaatgacat catgctggtg 60 aagatg 66

<210> 1357 Page 294

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1357 cccctaaaat gttcctcctg 20 2020201779

<210> 1358 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1358 ctcatcctct tggctctgtg 20

<210> 1359 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1359 cagcacttca agtcctggct atagcca 27

<210> 1360 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1360 cccctaaaat gttcctcctg ctgacagcac ttcaagtcct ggctatagcc atgacacaga 60 gccaagagga tgag 74

<210> 1361 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 295

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1361 agtctcggat tgtgggagg 19

<210> 1362 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1362 tgtacacagc cacctgcc 18

<210> 1363 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1363 ttgggaatgc ttctcacact ccca 24

<210> 1364 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1364 agtctcggat tgtgggaggc tgggagtgtg agaagcattc ccaaccctgg caggtggctg 60 tgtaca 66

<210> 1365 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1365 ccaagcttac cacctgcac 19

<210> 1366 <211> 19 <212> DNA <213> Artificial Sequence Page 296

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1366 agggtgagga agacaaccg 19

<210> 1367 <211> 24 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1367 acccacatgg tgacacagct ctcc 24

<210> 1368 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1368 ccaagcttac cacctgcacc cggagagctg tgtcaccatg tgggtcccgg ttgtcttcct 60 caccct 66

<210> 1369 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1369 tgagagccag gcttcttgta 20

<210> 1370 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1370 atcctggtcc tctttgctgt 20

Page 297

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1371 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1371 tgtctcaaaa tgccagcctt ctgaa 25 2020201779

<210> 1372 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1372 tgagagccag gcttcttgta tgtctcaaaa tgccagcctt ctgaaagtat acagcaaaga 60 ggaccaggat 70

<210> 1373 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1373 tgatggtcca aatgaacgaa 20

<210> 1374 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1374 aagcttcaca agttggggc 19

<210> 1375 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 298

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1375 actcctgttt tcaccaccat gcca 24

<210> 1376 <211> 67 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1376 tgatggtcca aatgaacgaa ttggcatggt ggtgaaaaca ggagttgtgc cccaacttgt 60 gaagctt 67

<210> 1377 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1377 tggacaacaa ccgcagtc 18

<210> 1378 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1378 tatcctcgta ctgggccttg 20

<210> 1379 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1379 cctcagcaat gatgctgtcc aggt 24

<210> 1380 <211> 66 <212> DNA Page 299

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1380 tggacaacaa ccgcagtctc gacctggaca gcatcattgc tgaggtcaag gcccagtacg 60 aggata 66

<210> 1381 2020201779

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1381 gcctggttct tcagcaagac 20

<210> 1382 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1382 cttgctggtc tggatcattt c 21

<210> 1383 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1383 tgaacaaaga ggtggcctcc aaca 24

<210> 1384 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1384 gcctggttct tcagcaagac tgaggagctg aacaaagagg tggcctccaa cacagaaatg 60 Page 300

GHDX‐046_SEQLIST.TXT 11 Mar 2020

atccagacca gcaag 75

<210> 1385 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1385 agagatcgag gctctcaagg 20

<210> 1386 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1386 ggccttttac ttcctcttcg 20

<210> 1387 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1387 tggttcttct tcatgaagag cagctcc 27

<210> 1388 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1388 agagatcgag gctctcaagg aggagctgct cttcatgaag aagaaccacg aagaggaagt 60 aaaaggcc 68

<210> 1389 <211> 19 <212> DNA <213> Artificial Sequence

Page 301

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1389 ccagtgacgc ctctgtgtt 19

<210> 1390 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1390 gggcatggct agaagcac 18

<210> 1391 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1391 acctagacag cacagattcc gccc 24

<210> 1392 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1392 ccagtgacgc ctctgtgttc tggggcggaa tctgtgctgt ctaggtttgt gcttctagcc 60 atgccc 66

<210> 1393 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1393 tcagtggaga aggagttgga 20

<210> 1394 Page 302

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1394 tgccatatcc agaggaaaca 20 2020201779

<210> 1395 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1395 ccagtcaaca tctctgttgt cacaagca 28

<210> 1396 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1396 tcagtggaga aggagttgga ccagtcaaca tctctgttgt cacaagcagt gtttcctctg 60 gatatggca 69

<210> 1397 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1397 tcaaagtcag gtacgaagat gaaatt 26

<210> 1398 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 303

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1398 acgtcctttt tcagggctac aa 22

<210> 1399 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1399 ttcattctca gcagctgtgc gcttgt 26

<210> 1400 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1400 tcaaagtcag gtacgaagat gaaattaaca agcgcacagc tgctgagaat gaatttgtag 60 ccctgaaaaa ggacgt 76

<210> 1401 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1401 atctccagac tgctggttcc 20

<210> 1402 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1402 tcagggaatt aggggacaga 20

<210> 1403 <211> 24 <212> DNA <213> Artificial Sequence Page 304

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1403 tctgggcttc agatcctgac tccc 24

<210> 1404 <211> 83 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1404 atctccagac tgctggttcc cagggaaccc tccctacatc tgggcttcag atcctgactc 60 ccttctgtcc cctaattccc tga 83

<210> 1405 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1405 ggatgaagct tacatgaaca aggtaga 27

<210> 1406 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1406 catatagctg cctgaggaag ttgat 25

<210> 1407 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1407 cgtcggtcag cccttccagg c 21

Page 305

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1408 <211> 86 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1408 ggatgaagct tacatgaaca aggtagagct ggagtctcgc ctggaagggc tgaccgacga 60 2020201779

gatcaacttc ctcaggcagc tatatg 86

<210> 1409 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1409 cttgctggcc aatgccta 18

<210> 1410 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1410 tgattgtccg cagtcagg 18

<210> 1411 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1411 atctacgttg tccagctgcc agcc 24

<210> 1412 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 306

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1412 cttgctggcc aatgcctaca tctacgttgt ccagctgcca gccaagatcc tgactgcgga 60 caatca 66

<210> 1413 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1413 gccttagagc aagggattca 20

<210> 1414 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1414 cggttcttgc tccagctc 18

<210> 1415 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1415 tctatcttgc tctgagcctg cgga 24

<210> 1416 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1416 gccttagagc aagggattca ccctccgcag gctcagagca agatagagga gctggagcaa 60 gaaccg 66

<210> 1417 <211> 19 Page 307

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1417 cctgtcactg aagccttgg 19

<210> 1418 2020201779

<211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1418 tgggttactg gtcaggacaa c 21

<210> 1419 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1419 attcagactg acaggcccct ggac 24

<210> 1420 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1420 cctgtcactg aagccttgga agtccagggg cctgtcagtc tgaatggttg tcctgaccag 60 taaccca 67

<210> 1421 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1421 Page 308

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gatgcactgc ggttagcag 19

<210> 1422 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1422 cagaggatac gctcagcacc 20

<210> 1423 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1423 ctctccatcg aggaaggcaa atcc 24

<210> 1424 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1424 gatgcactgc ggttagcagc gctctccatc gaggaaggca aatccggggt gctgagcgta 60 tcctctg 67

<210> 1425 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1425 ctcctggcca acagcact 18

<210> 1426 <211> 18 <212> DNA <213> Artificial Sequence

Page 309

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1426 acacaaggcc cagcctct 18

<210> 1427 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1427 ctgttcctgg agcatggcct cttc 24

<210> 1428 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1428 ctcctggcca acagcactgc actagaagag gccatgctcc aggaacagca gaggctgggc 60 cttgtgt 67

<210> 1429 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1429 caaggagact gggaggtgtc 20

<210> 1430 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1430 cggcagaact gacagtgttc 20

<210> 1431 Page 310

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1431 caagtgcctg taccacacgg aagg 24 2020201779

<210> 1432 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1432 caaggagact gggaggtgtc tcaagtgcct gtaccacacg gaaggggaac actgtcagtt 60 ctgccg 66

<210> 1433 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1433 actgaccaag cctgagacct 20

<210> 1434 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1434 gtcacacttg cagcatttca 20

<210> 1435 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 311

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1435 ccactcgcca tactgggtgc agt 23

<210> 1436 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1436 actgaccaag cctgagacct actgcaccca gtatggcgag tggcagatga aatgctgcaa 60 gtgtgac 67

<210> 1437 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1437 gccgtgatct cagacagcta c 21

<210> 1438 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1438 acctgcttgc ccaagaact 19

<210> 1439 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1439 cctcggtact tcattgctcc tgca 24

<210> 1440 <211> 68 <212> DNA <213> Artificial Sequence Page 312

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1440 gccgtgatct cagacagcta ctttcctcgg tacttcattg ctcctgcaaa gttcttgggc 60 aagcaggt 68

<210> 1441 <211> 21 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1441 actcaagcgg aaattgaagc a 21

<210> 1442 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1442 actccctgaa gccgagacac t 21

<210> 1443 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1443 aggtcttatc agcacagtct ccgcctcc 28

<210> 1444 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1444 actcaagcgg aaattgaagc agataggtct tatcagcaca gtctccgcct cctggattca 60 gtgtctcggc ttcagggagt 80 Page 313

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1445 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1445 2020201779

tgctggactt ctgcctgag 19

<210> 1446 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1446 tgagataggt gggcacttcc 20

<210> 1447 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1447 tcctgaccct ctgcagctcc taca 24

<210> 1448 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1448 tgctggactt ctgcctgagc atcctgaccc tctgcagctc ctacatggaa gtgcccacct 60 atctca 66

<210> 1449 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 314

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1449 agcggaaaat ggcagacaat 20

<210> 1450 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1450 cttgagggtt tgggtttcca 20

<210> 1451 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1451 acccagataa cgcatcatgg agcga 25

<210> 1452 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1452 agcggaaaat ggcagacaat ttttcgctcc atgatgcgtt atctgggtct ggaaacccaa 60 accctcaag 69

<210> 1453 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1453 ggaggtggag aaggagcc 18

<210> 1454 <211> 19 Page 315

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1454 acaggtgtca tcagcgagg 19

<210> 1455 2020201779

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1455 ctggacgctc agagctcgtc tctg 24

<210> 1456 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1456 ggaggtggag aaggagccgg gccagagacg agctctgagc gtccaggcct cgctgatgac 60 acctgt 66

<210> 1457 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1457 tgaacagtaa tggggagctg 20

<210> 1458 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1458 Page 316

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ttctgggaac tgctggaag 19

<210> 1459 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1459 actgagcgca cacgaaacac tgct 24

<210> 1460 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1460 tgaacagtaa tggggagctg taccatgagc agtgtttcgt gtgcgctcag tgcttccagc 60 agttcccaga a 71

<210> 1461 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1461 ccaatgggag aacaacgg 18

<210> 1462 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1462 cgctgaggct ggtactgtg 19

<210> 1463 <211> 24 <212> DNA <213> Artificial Sequence

Page 317

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1463 caggctcagc aagctgaaca cctg 24

<210> 1464 <211> 66 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1464 ccaatgggag aacaacgggc aggtgttcag cttgctgagc ctgggctcac agtaccagcc 60 tcagcg 66

<210> 1465 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1465 tttggcccaa tgggctaag 19

<210> 1466 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1466 gtctcgatgc ggtcgtagaa g 21

<210> 1467 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1467 tcccggctgg gcgcctctac t 21

<210> 1468 Page 318

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1468 tttggcccaa tgggctaagc ctggacatcc cggctgggcg cctctactgg gtggatgcct 60 tctacgaccg catcgagac 79 2020201779

<210> 1469 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1469 gcacacccat ccttgagtct 20

<210> 1470 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1470 gatggctggc cacgtagt 18

<210> 1471 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1471 ctttgcagcc ctcagaactc cagc 24

<210> 1472 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 319

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1472 gcacacccat ccttgagtct cctttgcagc cctcagaact ccagccccac tacgtggcca 60 gccatc 66

<210> 1473 <211> 22 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1473 ggctcttttg aaggattggt aa 22

<210> 1474 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1474 aaaagcagct gaaacagcat c 21

<210> 1475 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1475 cctgaccttc atccatctcc agca 24

<210> 1476 <211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1476 ggctcttttg aaggattggt aaacctgacc ttcatccatc tccagcacaa tcggctgaaa 60 gaggatgctg tttcagctgc tttt 84

<210> 1477 <211> 19 <212> DNA Page 320

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1477 gcatctaaca gccctgtgc 19

<210> 1478 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1478 cagagtgaag aatgggcctc 20

<210> 1479 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1479 cagcttccct tgcctcgtgt aaca 24

<210> 1480 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1480 gcatctaaca gccctgtgca gcagcttccc ttgcctcgtg taacatgagg cccattcttc 60 actctg 66

<210> 1481 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1481 cagatgtgaa gcctggagc 19 Page 321

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1482 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1482 2020201779

aagggaatcc cctcatgg 18

<210> 1483 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1483 ttcctgatga tgctggccct acag 24

<210> 1484 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1484 cagatgtgaa gcctggagct ttcctgatga tgctggccct acagtacccc catgagggga 60 ttccctt 67

<210> 1485 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1485 gtgtcagcca aagcatgga 19

<210> 1486 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 322

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1486 cgactacgtc gaacatgtgg 20

<210> 1487 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1487 ccgcgatact cgccttctct tgat 24

<210> 1488 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1488 gtgtcagcca aagcatggag aatcaagaga aggcgagtat cgcgggccac atgttcgacg 60 tagtcg 66

<210> 1489 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1489 aggaccaaga ggctacgga 19

<210> 1490 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1490 cctgtggcca tttcaatgat 20

<210> 1491 <211> 24 Page 323

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1491 cagcccagag accagatgtc tgct 24

<210> 1492 2020201779

<211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1492 aggaccaaga ggctacggaa aagcagcaga catctggtct ctgggctgta caatcattga 60 aatggccaca gg 72

<210> 1493 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1493 caggcaagaa ctagttgcag aa 22

<210> 1494 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1494 cctgtaccag gcgagatgta t 21

<210> 1495 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1495 Page 324

GHDX‐046_SEQLIST.TXT 11 Mar 2020

tgctggtcct tttcatcctg gtcc 24

<210> 1496 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1496 caggcaagaa ctagttgcag aactggacca ggatgaaaag gaccagcaaa atacatctcg 60 cctggtacag g 71

<210> 1497 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1497 tcgccgagat ttcctgag 18

<210> 1498 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1498 ctgttgtctc cgaagagcct 20

<210> 1499 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1499 aacgttcctt gttctcctgc tgca 24

<210> 1500 <211> 67 <212> DNA <213> Artificial Sequence

Page 325

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1500 tcgccgagat ttcctgagac tgcagcagga gaacaaggaa cgttccgagg ctcttcggag 60 acaacag 67

<210> 1501 <211> 21 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1501 gaggaacaga ggtgtctgca c 21

<210> 1502 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1502 ctgccaactg gctttcca 18

<210> 1503 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1503 catgtacaac aaacgctccg ggaa 24

<210> 1504 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1504 gaggaacaga ggtgtctgca cttccatgta caacaaacgc tccgggaaat ggaaagccag 60 ttggcag 67

Page 326

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1505 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1505 aagctgcaga gataatgcgg 20 2020201779

<210> 1506 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1506 gtgggcaatg ttatggctg 19

<210> 1507 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1507 attggcactg ccatccagtt tctg 24

<210> 1508 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1508 aagctgcaga gataatgcgg gatattggca ctgccatcca gtttctgcac agccataaca 60 ttgcccac 68

<210> 1509 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 327

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1509 gacttttgcc cgctaccttt c 21

<210> 1510 <211> 26 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1510 gccactaact gcttcagtat gaagag 26

<210> 1511 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1511 acagctcatt gttgtcacgc cgga 24

<210> 1512 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1512 gacttttgcc cgctaccttt cattccggcg tgacaacaat gagctgttgc tcttcatact 60 gaagcagtta gtggc 75

<210> 1513 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1513 ggagaacaat ccccttgaga 20

<210> 1514 <211> 20 <212> DNA Page 328

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1514 atctcctgga tggtgatggt 20

<210> 1515 <211> 27 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1515 tggcctttct gtctacaagg atcacca 27

<210> 1516 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1516 ggagaacaat ccccttgaga cagaatatgg cctttctgtc tacaaggatc accagaccat 60 caccatccag gagat 75

<210> 1517 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1517 tgatggtcct atgtgtcaca ttca 24

<210> 1518 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1518 tgggacagga aacacaccaa 20 Page 329

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1519 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1519 2020201779

caggtttcat accaacacag gcttcagcac 30

<210> 1520 <211> 82 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1520 tgatggtcct atgtgtcaca ttcatcacag gtttcatacc aacacaggct tcagcacttc 60 ctttggtgtg tttcctgtcc ca 82

<210> 1521 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1521 ggagccgact gcaagtaca 19

<210> 1522 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1522 gactttggtg cctgtgcc 18

<210> 1523 <211> 24 <212> DNA <213> Artificial Sequence

<220> Page 330

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1523 atcacacgca ccccagttct caaa 24

<210> 1524 <211> 66 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1524 ggagccgact gcaagtacaa gtttgagaac tggggtgcgt gtgatggggg cacaggcacc 60 aaagtc 66

<210> 1525 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1525 ctacagggac gccatcgaa 19

<210> 1526 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1526 atccaaccaa tcacctgaat gtt 23

<210> 1527 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1527 cttacaccag catcaagatc cgg 23

<210> 1528 <211> 68 Page 331

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1528 ctacagggac gccatcgaat ccggatcttg atgctggtgt aagtgaacat tcaggtgatt 60 ggttggat 68 2020201779

<210> 1529 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1529 aggatcgcct gtcagaagag 20

<210> 1530 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1530 tgcacataag caacagcaga 20

<210> 1531 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1531 cccgggttgt cttccgtcag atag 24

<210> 1532 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1532 Page 332

GHDX‐046_SEQLIST.TXT 11 Mar 2020

aggatcgcct gtcagaagag gagacccggg ttgtcttccg tcagatagta tctgctgttg 60 cttatgtgca 70

<210> 1533 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1533 gacatttcca gtcctgcagt ca 22

<210> 1534 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1534 ctccgatcgc acacatttgt 20

<210> 1535 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1535 tgcctctctg ccccaccctt tgt 23

<210> 1536 <211> 86 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1536 gacatttcca gtcctgcagt caatgcctct ctgccccacc ctttgttcag tgtggctggt 60 gccacgacaa atgtgtgcga tcggag 86

<210> 1537 <211> 20 <212> DNA <213> Artificial Sequence Page 333

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1537 gtgaaatgaa acgcaccaca 20

<210> 1538 <211> 20 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1538 gaccctgctc acaaccagac 20

<210> 1539 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1539 cagccctttg gggaagctgg 20

<210> 1540 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1540 gtgaaatgaa acgcaccaca ctggacagcc ctttggggaa gctggagctg tctggttgtg 60 agcagggtc 69

<210> 1541 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1541 acggatctac cacaccattg c 21

Page 334

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1542 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1542 tccatatcca acaaaaaaac tcaaag 26 2020201779

<210> 1543 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1543 tttgacaccc cttccccagc ca 22

<210> 1544 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1544 acggatctac cacaccattg catatttgac accccttccc cagccaaata gagctttgag 60 tttttttgtt ggatatgga 79

<210> 1545 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1545 atggtgaatg tcacccgc 18

<210> 1546 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 335

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1546 aagccagaag ccctgcat 18

<210> 1547 <211> 24 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1547 cgaggcctca gagggcaaca ttac 24

<210> 1548 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1548 atggtgaatg tcacccgcag cgaggcctca gagggcaaca ttaccgtgac atgcagggct 60 tctggctt 68

<210> 1549 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1549 gattgcacca gggcagaa 18

<210> 1550 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1550 tccaaagtgc ctctgctaag a 21

<210> 1551 <211> 24 <212> DNA Page 336

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1551 ccactcttcc ttgaacaccc tccc 24

<210> 1552 <211> 67 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1552 gattgcacca gggcagaaca ggggagggtg ttcaaggaag agtggctctt agcagaggca 60 ctttgga 67

<210> 1553 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1553 tgcttagctg gcatgtgg 18

<210> 1554 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1554 cagcctactc tccatgggc 19

<210> 1555 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1555 catgagatgc caggagaccc ttcc 24 Page 337

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1556 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1556 2020201779

tgcttagctg gcatgtggcc gcatgagatg ccaggagacc cttccctgcc catggagagt 60 aggctg 66

<210> 1557 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1557 cctggaggct gcaacatacc 20

<210> 1558 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1558 tacaatggct ttggaggata gca 23

<210> 1559 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1559 atcctcctga agcccttttc gcagc 25

<210> 1560 <211> 90 <212> DNA <213> Artificial Sequence

<220> Page 338

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1560 cctggaggct gcaacatacc tcaatcctgt cccaggccgg atcctcctga agcccttttc 60 gcagcactgc tatcctccaa agccattgta 90

<210> 1561 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1561 cagccagaag cggaaactta 20

<210> 1562 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1562 agacaccatc acctgtgcc 19

<210> 1563 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1563 aagtccgaat ctctgctccc tgca 24

<210> 1564 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1564 cagccagaag cggaaactta aaaagtccga atctctgctc cctgcagggc acaggtgatg 60 gtgtct 66

<210> 1565 Page 339

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1565 ggatggtagc agtctaggga ttaact 26 2020201779

<210> 1566 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1566 ggaatgtccc atacccaaag aa 22

<210> 1567 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1567 cctgtatgct gcaactcatg aacttggc 28

<210> 1568 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1568 ggatggtagc agtctaggga ttaacttcct gtatgctgca actcatgaac ttggccattc 60 tttgggtatg ggacattcc 79

<210> 1569 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 340

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1569 gagaaccaat ctcaccgaca 20

<210> 1570 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1570 cacccgagtg taaccatagc 20

<210> 1571 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1571 acaggtattc ctctgccagc tgcc 24

<210> 1572 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1572 gagaaccaat ctcaccgaca ggcagctggc agaggaatac ctgtaccgct atggttacac 60 tcgggtg 67

<210> 1573 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1573 ccgaccaacc ctccaatta 19

<210> 1574 <211> 21 <212> DNA <213> Artificial Sequence Page 341

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1574 agggcattta gagcttcagg a 21

<210> 1575 <211> 24 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1575 atttgacctt ccaaacccac aggg 24

<210> 1576 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1576 ccgaccaacc ctccaattat atttgacctt ccaaacccac agggttcctg aagctctaaa 60 tgccct 66

<210> 1577 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1577 cttgacctca ggactctgga tt 22

<210> 1578 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1578 ggactgcggt cactccac 18

Page 342

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1579 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1579 ccaaccgctg ttgaagctca gact 24 2020201779

<210> 1580 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1580 cttgacctca ggactctgga ttggacttaa cagtctgagc ttcaacagcg gttggcagtg 60 gagtgaccgc agtcc 75

<210> 1581 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1581 tccggttccc ttcgtttag 19

<210> 1582 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1582 gtggaaaaac tgcggaaaac 20

<210> 1583 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 343

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1583 cggctggaaa ttatgtcctc cgtc 24

<210> 1584 <211> 66 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1584 tccggttccc ttcgtttagg tcggctggaa attatgtcct ccgtcggttt tccgcagttt 60 ttccac 66

<210> 1585 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1585 gatgcagaat tgaggcagac 20

<210> 1586 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1586 tcttggcaag tcggttaaga 20

<210> 1587 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1587 caagaagatt tacttcgtcg attcccaga 29

<210> 1588 <211> 73 <212> DNA Page 344

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1588 gatgcagaat tgaggcagac tttacaagaa gatttacttc gtcgattccc agatcttaac 60 cgacttgcca aga 73

<210> 1589 2020201779

<211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1589 tgattaccat catggctcag a 21

<210> 1590 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1590 cttgtgaaaa tgccatccac 20

<210> 1591 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1591 tcccaattgt cgcttcttct gcag 24

<210> 1592 <211> 82 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1592 tgattaccat catggctcag attggctcct atgttcctgc agaagaagcg acaattggga 60 Page 345

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ttgtggatgg cattttcaca ag 82

<210> 1593 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1593 tctattgggg gattggtagg 20

<210> 1594 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1594 caaattgcga gtggtgaaat 20

<210> 1595 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1595 ccgttaccag ctggaaattc ctgaga 26

<210> 1596 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1596 tctattgggg gattggtagg aaccgttacc agctggaaat tcctgagaat ttcaccactc 60 gcaatttg 68

<210> 1597 <211> 19 <212> DNA <213> Artificial Sequence

Page 346

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1597 ccgccctcac ctgaagaga 19

<210> 1598 <211> 22 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1598 ggaataagtt agccgcgctt ct 22

<210> 1599 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1599 cccagtgtcc gccaaggagc g 21

<210> 1600 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1600 ccgccctcac ctgcagagaa acgcgctcct tggcggacac tgggggagga gaggaagaag 60 cgcggctaac ttattcc 77

<210> 1601 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1601 ggtggaagga aacctcttca 20

<210> 1602 Page 347

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1602 cagcagcaga aattccagg 19 2020201779

<210> 1603 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1603 aagctgccca caatctgctg cata 24

<210> 1604 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1604 ggtggaagga aacctcttca ttatgcagca gattgtgggc agcttgaaat cctggaattt 60 ctgctgctg 69

<210> 1605 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1605 ttcgacaagt cctccaccat 20

<210> 1606 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 348

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1606 cttggaacat ccgtcggtag 20

<210> 1607 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1607 ccaagaaaca gcgacatcag ccag 24

<210> 1608 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1608 ttcgacaagt cctccaccat tccaagaaac agcgacatca gccagtccta ccgacggatg 60 ttccaag 67

<210> 1609 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1609 ggccaggatc tgtggtggta 20

<210> 1610 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1610 ctccacgtcg tggacattga 20

<210> 1611 <211> 23 <212> DNA <213> Artificial Sequence Page 349

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1611 ctctggcctt ccgagaaggt acc 23

<210> 1612 <211> 71 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1612 ggccaggatc tgtggtggta caattgactc tggccttccg agaaggtacc atcaatgtcc 60 acgacgtgga g 71

<210> 1613 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1613 acgagaacga gggcatctat gt 22

<210> 1614 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1614 gcatgtaggt gcttccaatc ac 22

<210> 1615 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1615 cgcacctttc cggtcttgac atcct 25

Page 350

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1616 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1616 acgagaacga gggcatctat gtgcaggatg tcaagaccgg aaaggtgcgc gctgtgattg 60 2020201779

gaagcaccta catgc 75

<210> 1617 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1617 gccgagatcg ccaagatg 18

<210> 1618 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1618 cttttgatgg tagagttcca gtgattc 27

<210> 1619 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1619 cagcattgtc tgtcctccct ggca 24

<210> 1620 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 351

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1620 gccgagatcg ccaagatgtt gccagggagg acagacaatg ctgtgaagaa tcactggaac 60 tctaccatca aaag 74

<210> 1621 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1621 cagcaaccag ggagtctgta 20

<210> 1622 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1622 cagcagtaag tgcctccatc 20

<210> 1623 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1623 aaattcgcaa gcccagcccc tat 23

<210> 1624 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1624 cagcaaccag ggagtctgta ccctggaaat tcgcaagccc agcccctatg atggaggcac 60 ttactgctg 69

<210> 1625 <211> 21 Page 352

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1625 tccctccact cggaaggact a 21

<210> 1626 2020201779

<211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1626 cggttgttgc tgatctgtct ca 22

<210> 1627 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1627 tctgacactg tccaacttga ccctctt 27

<210> 1628 <211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1628 tccctccact cggaaggact atcctgctgc caagagggtc aagttggaca gtgtcagagt 60 cctgagacag atcagcaaca accg 84

<210> 1629 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1629 Page 353

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cacctgactg agctggatgt 20

<210> 1630 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1630 gatgtagtgc tggtgcaggt 20

<210> 1631 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1631 cacaccctca cagatctgcc tggt 24

<210> 1632 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1632 cacctgactg agctggatgt ggtcctgttc accaggcaga tctgtgaggg tgtgcattac 60 ctgcaccagc actacatc 78

<210> 1633 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1633 aagcagttct ggagcaggag 20

<210> 1634 <211> 20 <212> DNA <213> Artificial Sequence

Page 354

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1634 gatgagctcg gcttcactct 20

<210> 1635 <211> 21 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1635 caatcctcag ggccagctcc c 21

<210> 1636 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1636 aagcagttct ggagcaggag cgcagggacc gggagctggc cctgaggatt gcccagagtg 60 aagccgagct catc 74

<210> 1637 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1637 tagttcccag ctgaccatca 20

<210> 1638 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1638 cagccttgtt ctcagcaatg 20

<210> 1639 Page 355

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1639 ctcagcctcg tcgttcttat ccacc 25 2020201779

<210> 1640 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1640 tagttcccag ctgaccatca aaaaggtgga taagaacgac gaggctgagt acatctgcat 60 tgctgagaac aaggctg 77

<210> 1641 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1641 tcgttgctta gacaaggcg 19

<210> 1642 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1642 ctccagacag tgtgcaaagc 20

<210> 1643 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 356

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1643 ctactgtccg cagcaaggca ctgt 24

<210> 1644 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1644 tcgttgctta gacaaggcgc ctactgtccg cagcaaggca ctgtccagct ttgcacactg 60 tctggag 67

<210> 1645 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1645 aaccgttaca gcccagaatc 20

<210> 1646 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1646 tctggagaga cccttgaacc 20

<210> 1647 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1647 ccaggctcag tctgtccatc atca 24

<210> 1648 <211> 71 <212> DNA <213> Artificial Sequence Page 357

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1648 aaccgttaca gcccagaatc ccaggctcag tctgtccatc atcaaagacc aggttcaagg 60 gtctctccag a 71

<210> 1649 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1649 cgtcatctac gaaggcaaga 20

<210> 1650 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1650 gagcactggg tcacagacat 20

<210> 1651 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1651 cctcatagga caagacgtgg ccct 24

<210> 1652 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1652 cgtcatctac gaaggcaaga agggccacgt cttgtcctat gagggtggca tgtctgtgac 60 ccagtgctc 69 Page 358

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1653 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1653 2020201779

agggcaacat tccacagc 18

<210> 1654 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1654 cagtgctcct actccggc 18

<210> 1655 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1655 ctgcaaggac actcatcaca gcca 24

<210> 1656 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1656 agggcaacat tccacagctg ccctggctgt gatgagtgtc cttgcagggg ccggagtagg 60 agcactg 67

<210> 1657 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 359

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1657 agaagagtca agggcacgag 20

<210> 1658 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1658 aggccgaacc ttttctgg 18

<210> 1659 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1659 tgtccaagaa aggcatggct accc 24

<210> 1660 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1660 agaagagtca agggcacgag catcgggtag ccatgccttt cttggacatc cagaaaaggt 60 tcggcct 67

<210> 1661 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1661 gtgaggcagc gcgactct 18

<210> 1662 <211> 23 Page 360

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1662 tgccaatggt gtacaacact tca 23

<210> 1663 2020201779

<211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1663 tgccttcccg ggctgaggac t 21

<210> 1664 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1664 gtgaggcagc gcgactctgg cgactggccg gccatgcctt cccgggctga ggactatgaa 60 gtgttgtaca ccattggca 79

<210> 1665 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1665 ccagggcacc atactgtttc 20

<210> 1666 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1666 Page 361

GHDX‐046_SEQLIST.TXT 11 Mar 2020

aacggtaaat caaggtcttc gt 22

<210> 1667 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1667 agccaaccct tttctcccat caca 24

<210> 1668 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1668 ccagggcacc atactgtttc cagcagccaa cccttttctc ccatcacaac tacgaagacc 60 ttgatttacc gtt 73

<210> 1669 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1669 aggaggagga agaaggtagc a 21

<210> 1670 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1670 gagctcctga tctggtttgc 20

<210> 1671 <211> 25 <212> DNA <213> Artificial Sequence

Page 362

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1671 tcatcttcag cagtggagcc attca 25

<210> 1672 <211> 72 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1672 aggaggagga agaaggtagc atcatgaatg gctccactgc tgaagatgaa gagcaaacca 60 gatcaggagc tc 72

<210> 1673 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1673 ctgaacccct ctcctggtc 19

<210> 1674 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1674 aggaaacgat ggcgaggt 18

<210> 1675 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1675 cgagaatcag tccccgtgga gttc 24

<210> 1676 Page 363

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1676 ctgaacccct ctcctggtca ccgagaatca gtccccgtgg agttccccct ccacctcgcc 60 atcgtttcct 70 2020201779

<210> 1677 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1677 cagtcaaggt cagaggctga g 21

<210> 1678 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1678 ctttggctcg tggcattc 18

<210> 1679 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1679 cgggttccta ccccacagtc attc 24

<210> 1680 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 364

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1680 cagtcaaggt cagaggctga gcccgggttc ctaccccaca gtcattcagc agcagaatgc 60 cacgagccaa ag 72

<210> 1681 <211> 20 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1681 cagaccaagg agatggacct 20

<210> 1682 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1682 agctgccagt gctatccg 18

<210> 1683 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1683 aagctgtaaa catgagccgc acca 24

<210> 1684 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1684 cagaccaagg agatggacct cagcgtggtg cggctcatgt ttacagcttt tcttccggat 60 agcactggca gct 73

<210> 1685 <211> 18 <212> DNA Page 365

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1685 ctactggacg accgccac 18

<210> 1686 <211> 21 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1686 ccttgaccat ctgctcgtac t 21

<210> 1687 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1687 ctcgtctttc atggagtcca ggcc 24

<210> 1688 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1688 ctactggacg accgccacga cagcggcctg gactccatga aagacgagga gtacgagcag 60 atggtcaagg 70

<210> 1689 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1689 ccaaccctgc agactccaa 19 Page 366

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1690 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1690 2020201779

atgtataatg ttcctgccaa cttgtatg 28

<210> 1691 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1691 cctgggacca tccgtggaga cttct 25

<210> 1692 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1692 ccaaccctgc agactccaag cctgggacca tccgtggaga cttctgcata caagttggca 60 ggaacattat acat 74

<210> 1693 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1693 cctagggcag ggatggag 18

<210> 1694 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 367

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1694 ctagtccagc caaacatccc 20

<210> 1695 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1695 ccctctcctc atgcccagac tctc 24

<210> 1696 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1696 cctagggcag ggatggagag agagtctggg catgaggaga gggtctcggg atgtttggct 60 ggactag 67

<210> 1697 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1697 atctccgcct cgctcatg 18

<210> 1698 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1698 tcggagccat acaggattgt c 21

<210> 1699 <211> 22 Page 368

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1699 ttcactcgct tcgccatcac cg 22

<210> 1700 2020201779

<211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1700 atctccgcct cgctcatggg cacggtgatg gcgaagcgag tgaaggcgac aatcctgtat 60 ggctccga 68

<210> 1701 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1701 cctcaactgc agccttatcc 20

<210> 1702 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1702 tgcttggaac cttctgtgat 20

<210> 1703 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1703 Page 369

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ccgaacactc ttggcttacc tccg 24

<210> 1704 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1704 cctcaactgc agccttatcc ttttacccat gtgccgaaca ctcttggctt acctccgagg 60 atcacagaag gttccaagca 80

<210> 1705 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1705 tcaccaacct gttcatcctc 20

<210> 1706 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1706 gatgttgatg ggcagcac 18

<210> 1707 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1707 atcgccgacg agctcttcac g 21

<210> 1708 <211> 71 <212> DNA <213> Artificial Sequence

Page 370

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1708 tcaccaacct gttcatcctc aacctggcca tcgccgacga gctcttcacg ctggtgctgc 60 ccatcaacat c 71

<210> 1709 <211> 22 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1709 aatgttgtcc aggttctatt gc 22

<210> 1710 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1710 caagcaaagg gtggagttc 19

<210> 1711 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1711 aacaggcatt ttggacaaca cattcttg 28

<210> 1712 <211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1712 aatgttgtcc aggttctatt gccaagaatg tgttgtccaa aatgcctgtt tagtttttaa 60 agatggaact ccaccctttg cttg 84

Page 371

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1713 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1713 cgagactctc ctcatagtga aaggtat 27 2020201779

<210> 1714 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1714 cttggcgtgt ggaaatctac ag 22

<210> 1715 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1715 atgaccaccc cggctcgtat gtca 24

<210> 1716 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1716 cgagactctc ctcatagtga aaggtatgtg tcagccatga ccaccccggc tcgtatgtca 60 cctgtagatt tccacacgcc aag 83

<210> 1717 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 372

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1717 cccacaagca tgaaggaga 19

<210> 1718 <211> 19 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1718 tgctcaatct ggcccacta 19

<210> 1719 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1719 agctttctct accccggcat ctca 24

<210> 1720 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1720 cccacaagca tgaaggagaa aagctttctc taccccggca tctcaaagta gtgggccaga 60 ttgagca 67

<210> 1721 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1721 cagctctctc cacgcgattc 20

<210> 1722 <211> 19 <212> DNA Page 373

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1722 cccagcagct ccattctga 19

<210> 1723 <211> 28 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1723 caggatctac cccgagagag ccactcat 28

<210> 1724 <211> 82 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1724 cagctctctc cacgcgattc atcaggatct accccgagag agccactcat ggcggactgg 60 ggctcagaat ggagctgctg gg 82

<210> 1725 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1725 agcctctttg cgtcaatagc 20

<210> 1726 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1726 ctgtggtcac aggggtacag 20 Page 374

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1727 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1727 2020201779

tcatctgcca ccactggact ctcc 24

<210> 1728 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1728 agcctctttg cgtcaatagc aactgctcca acctcatctg ccaccactgg actctccctc 60 tgtacccctg tgaccacag 79

<210> 1729 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1729 agcaaggaca gctttgcagt 20

<210> 1730 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1730 gaagacatgg tcggctcg 18

<210> 1731 <211> 24 <212> DNA <213> Artificial Sequence

<220> Page 375

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1731 ctgctcctca gcgaactcca ggag 24

<210> 1732 <211> 66 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1732 agcaaggaca gctttgcagt tctcctggag ttcgctgagg agcagctgcg agccgaccat 60 gtcttc 66

<210> 1733 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1733 ccctcccatc cgagtttc 18

<210> 1734 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1734 gacgcgggag tgtaggtg 18

<210> 1735 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1735 ctcctccctc ggtgaccaat tcac 24

<210> 1736 <211> 74 Page 376

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1736 ccctcccatc cgagtttcag gtgaattggt caccgaggga ggaggccgac acaccacacc 60 tacactcccg cgtc 74 2020201779

<210> 1737 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1737 agagatcacc ggcgtaatca a 21

<210> 1738 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1738 cgggctcagc tatgattctc a 21

<210> 1739 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1739 ccagcgttgg acaaatactt tccgtca 27

<210> 1740 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1740 Page 377

GHDX‐046_SEQLIST.TXT 11 Mar 2020

agagatcacc ggcgtaatca acccagcgtt ggacaaatac tttccgtcag actctggagt 60 gagaatcata gctgagcccg 80

<210> 1741 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1741 catgttggaa ggagcgttct 20

<210> 1742 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1742 caccagtttg gtggtgactg 20

<210> 1743 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1743 tggcctggat ctcctgaagc taca 24

<210> 1744 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1744 catgttggaa ggagcgttct atggcctgga tctcctgaag ctacattcag tcaccaccaa 60 actggtg 67

<210> 1745 <211> 19 <212> DNA <213> Artificial Sequence Page 378

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1745 tcagaactga ggccgacac 19

<210> 1746 <211> 21 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1746 ccagatagtc tacctcccgc t 21

<210> 1747 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1747 cagacgatcc actctcccgg agat 24

<210> 1748 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1748 tcagaactga ggccgacacc atctccggga gagtggatcg tctggagcgg gaggtagact 60 atctgg 66

<210> 1749 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1749 cgcaaactca agactatccc a 21

Page 379

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1750 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1750 cagtcacagc ctcaatttca tt 22 2020201779

<210> 1751 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1751 tccgatgcac attcagcaac tctacc 26

<210> 1752 <211> 82 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1752 cgcaaactca agactatccc aaatattccg atgcacattc agcaactcta ccttcagttc 60 aatgaaattg aggctgtgac tg 82

<210> 1753 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1753 gcatgctttc aggcattga 19

<210> 1754 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 380

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1754 agaagatggc cagcattttg 20

<210> 1755 <211> 24 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1755 tcctcatctc cacctcatcc atgc 24

<210> 1756 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1756 gcatgctttc aggcattgac atcctcatct ccacctcatc catgcccaaa atgctggcca 60 tcttct 66

<210> 1757 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1757 tatggtgcca aaaccaaaca 20

<210> 1758 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1758 gtccttgtca cagctgatct tg 22

<210> 1759 <211> 24 <212> DNA Page 381

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1759 acatagccag cacccgtgtt ctga 24

<210> 1760 <211> 69 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1760 tatggtgcca aaaccaaaca gatcagaaca cgggtgctgg ctatgttcaa gatcagctgt 60 gacaaggac 69

<210> 1761 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1761 gtttctgaag gggaggtcac 20

<210> 1762 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1762 aggtgtctgg tttgggaca 19

<210> 1763 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1763 ctgagctggc ctcctatgcc tcat 24 Page 382

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1764 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1764 2020201779

gtttctgaag gggaggtcac agcctgagct ggcctcctat gcctcatcat gtcccaaacc 60 agacacct 68

<210> 1765 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1765 caacctgacg aagtggaatc 20

<210> 1766 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1766 cagatgctcc ctcatcctct 20

<210> 1767 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1767 ccaactcaaa gtcaggattc tacacctgc 29

<210> 1768 <211> 79 <212> DNA <213> Artificial Sequence

<220> Page 383

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1768 caacctgacg aagtggaatc accaactcaa agtcaggatt ctacacctgc tgaagagaga 60 gaggatgagg gagcatctg 79

<210> 1769 <211> 21 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1769 gaatctcagc aagaggaacc a 21

<210> 1770 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1770 gttcttcgat cggaggtgtt 20

<210> 1771 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1771 ccaactgaca atcaggatat tgaacctgg 29

<210> 1772 <211> 85 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1772 gaatctcagc aagaggaacc accaactgac aatcaggata ttgaacctgg acaagagaga 60 gaaggaacac ctccgatcga agaac 85

<210> 1773 Page 384

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1773 cctccaggtc acccacag 18 2020201779

<210> 1774 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1774 gtcccttcag gccagaactt 20

<210> 1775 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1775 agtttcagga aggctgcccc tctc 24

<210> 1776 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1776 cctccaggtc acccacagcc agtttcagga aggctgcccc tctctcccac taagttctgg 60 cctgaaggga c 71

<210> 1777 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 385

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1777 tggtaatccc tggttaacct tc 22

<210> 1778 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1778 tccaccttat gcctttcaca 20

<210> 1779 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1779 cagcacagtt ctttaggcag ccca 24

<210> 1780 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1780 tggtaatccc tggttaacct tcatgggctg cctaaagaac tgtgctgatg tgaaaggcat 60 aaggtgga 68

<210> 1781 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1781 cgtgattgtc aggagcaaga 20

<210> 1782 <211> 20 <212> DNA <213> Artificial Sequence Page 386

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1782 agaaagggga gatgcagagg 20

<210> 1783 <211> 24 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1783 ctgagatgct ccctgccttc agtg 24

<210> 1784 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1784 cgtgattgtc aggagcaaga cctgagatgc tccctgcctt cagtgtcctc tgcatctccc 60 ctttct 66

<210> 1785 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1785 cccagcgttg aagcagat 18

<210> 1786 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1786 gaaacgccag tccgtgtt 18

Page 387

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1787 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1787 attcttaaac agcaagcccc gcc 23 2020201779

<210> 1788 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1788 cccagcgttg aagcagataa gaagattctt aaacagcaag ccccgcccaa cacggactgg 60 cgtttc 66

<210> 1789 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1789 gaaggtgttg gaggcactca ag 22

<210> 1790 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1790 ggtttacacc gctggagcta a 21

<210> 1791 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 388

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1791 atcccagcag gcctcgttga tgag 24

<210> 1792 <211> 71 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1792 gaaggtgttg gaggcactca aggacctcat caacgaggcc tgctgggata ttagctccag 60 cggtgtaaac c 71

<210> 1793 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1793 ttccacaact tccggcac 18

<210> 1794 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1794 agactgcaga gccagacca 19

<210> 1795 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1795 tacatcatct gggccacgca gaag 24

<210> 1796 <211> 68 <212> DNA Page 389

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1796 ttccacaact tccggcactg cttctgcgtg gcccagatga tgtacagcat ggtctggctc 60 tgcagtct 68

<210> 1797 2020201779

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1797 ccagctctcc ttccagctac 20

<210> 1798 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1798 gggtggctct cacttagctc 20

<210> 1799 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1799 atcaatgtcc ctgtccgagt gctg 24

<210> 1800 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1800 ccagctctcc ttccagctac agatcaatgt ccctgtccga gtgctggagc taagtgagag 60 Page 390

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ccaccc 66

<210> 1801 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1801 tgtatttcaa gacctctgtg cactt 25

<210> 1802 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1802 ttagcctgag gaattgctgt gtt 23

<210> 1803 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1803 tttatgaacc tgccctgctc ccaca 25

<210> 1804 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1804 tgtatttcaa gacctctgtg cacttattta tgaacctgcc ctgctcccac agaacacagc 60 aattcctcag gctaa 75

<210> 1805 <211> 19 <212> DNA <213> Artificial Sequence

Page 391

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1805 ggagaagttc cctccccag 19

<210> 1806 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1806 atctgtgtcc aggcccac 18

<210> 1807 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1807 ctaccttcgg cactaccgct gagc 24

<210> 1808 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1808 ggagaagttc cctccccaga agctcatcta ccttcggcac taccgctgag ccggcgcccg 60 ggtgggcctg gacacagat 79

<210> 1809 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1809 attcccatgc cctgttttac 20

<210> 1810 Page 392

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1810 ctggctggaa gcatctcat 19 2020201779

<210> 1811 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1811 actgccctct ccttctatga cgggt 25

<210> 1812 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1812 attcccatgc cctgttttac cactgccctc tccttctatg acgggtacag acatgagatg 60 cttccagcca g 71

<210> 1813 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1813 gtggttttcc ctcggagc 18

<210> 1814 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 393

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1814 agcaagggaa cagcctcat 19

<210> 1815 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1815 atcttctcag acgtcccgag ccag 24

<210> 1816 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1816 gtggttttcc ctcggagccc cctggctcgg gacgtctgag aagatgccgg tcatgaggct 60 gttcccttgc t 71

<210> 1817 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1817 agagccagtt gctgtagaac tcaa 24

<210> 1818 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1818 ctgggcctac acagtccttc a 21

<210> 1819 <211> 27 <212> DNA <213> Artificial Sequence Page 394

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1819 tctctgctgg gcaaggatgt tctgttc 27

<210> 1820 <211> 74 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1820 agagccagtt gctgtagaac tcaaatctct gctgggcaag gatgttctgt tcttgaagga 60 ctgtgtaggc ccag 74

<210> 1821 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1821 gataaaggag ccgcgtgtca 20

<210> 1822 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1822 tcacaagtcc ggcacttgag 20

<210> 1823 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1823 taaattgccg tcgcagccgc a 21

Page 395

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1824 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1824 gataaaggag ccgcgtgtca ctaaattgcc gtcgcagccg cagccactca agtgccggac 60 2020201779

ttgtga 66

<210> 1825 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1825 gatatggctg atgctgctcc 20

<210> 1826 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1826 ggtttgggtg ttcttgtgga 20

<210> 1827 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1827 acaatctggc aatgcacagt tccc 24

<210> 1828 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 396

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1828 gatatggctg atgctgctcc tgggaactgt gcattgccag attgtttcca caagaacacc 60 caaacc 66

<210> 1829 <211> 21 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1829 ataccaatca ccgcacaaac c 21

<210> 1830 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1830 cacactagca ttttctccgc ata 23

<210> 1831 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1831 tgtgctgtga ctggacttaa caaatagcct 30

<210> 1832 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1832 ataccaatca ccgcacaaac ccaggctatt tgttaagtcc agtcacagca caaagaaaca 60 tatgcggaga aaatgctagt gtg 83

<210> 1833 <211> 20 Page 397

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1833 gtgattgaag agcatgccaa 20

<210> 1834 2020201779

<211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1834 gtcctgcgtg ggaatagc 18

<210> 1835 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1835 tcctgcttct cgggatacag acca 24

<210> 1836 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1836 gtgattgaag agcatgccaa ttggtctgta tcccgagaag caggatttag ctattcccac 60 gcaggac 67

<210> 1837 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1837 Page 398

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ggagaactca atgtccatct cc 22

<210> 1838 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1838 tgatgcttag gcagggct 18

<210> 1839 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1839 ttctggacaa ttactgccac ccga 24

<210> 1840 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1840 ggagaactca atgtccatct ccattcttct ggacaattac tgccacccga tagccctgcc 60 taagcatca 69

<210> 1841 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1841 ctgctcaagg acaccgtcta 20

<210> 1842 <211> 18 <212> DNA <213> Artificial Sequence

Page 399

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1842 ggatccactc tggagggc 18

<210> 1843 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1843 tacactcggg tcccatcgaa gtcc 24

<210> 1844 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1844 ctgctcaagg acaccgtcta cacggacttc gatgggaccc gagtgtatag ccctccagag 60 tggatcc 67

<210> 1845 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1845 cctggctgtg gtttatcctt 20

<210> 1846 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1846 tgacccatgc tgatgatttc 20

<210> 1847 Page 400

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1847 tggcaataca taaatcctgt tgccca 26 2020201779

<210> 1848 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1848 cctggctgtg gtttatcctt ttgactggca atacataaat cctgttgccc atatgaaatc 60 atcagcatgg gtca 74

<210> 1849 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1849 gtggatgtgc cctgaagga 19

<210> 1850 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1850 ctgcggatcc agggtaagaa 20

<210> 1851 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 401

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1851 aagccaggcg tctacacgag agtctcac 28

<210> 1852 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1852 gtggatgtgc cctgaaggac aagccaggcg tctacacgag agtctcacac ttcttaccct 60 ggatccgcag 70

<210> 1853 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1853 cccatggatg ctcctctgaa 20

<210> 1854 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1854 ccggtggcta ccagacattg 20

<210> 1855 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1855 cattgactgc cgaggcccca tg 22

<210> 1856 <211> 76 <212> DNA <213> Artificial Sequence Page 402

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1856 cccatggatg ctcctctgaa gagactttcc tcattgactg ccgaggcccc atgaatcaat 60 gtctggtagc caccgg 76

<210> 1857 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1857 ggcaaaattt ccaagaccat 20

<210> 1858 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1858 atgtatccat gagcgtgtgg 20

<210> 1859 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1859 tgccaggcct gggactctca 20

<210> 1860 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1860 ggcaaaattt ccaagaccat gtctggactg gaatgccagg cctgggactc tcagagccca 60 cacgctcatg gatacat 77 Page 403

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1861 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1861 2020201779

aatgaataca gtattcccaa gcacat 26

<210> 1862 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1862 tgtctgaagc atcttctgga tga 23

<210> 1863 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1863 aaccccgtgg ccgcctcc 18

<210> 1864 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1864 aatgaataca gtattcccaa gcacatcaac cccgtggccg cctccctcat ccagaagatg 60 cttcagaca 69

<210> 1865 <211> 19 <212> DNA <213> Artificial Sequence

<220> Page 404

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1865 cagggaggtg gttgcaaat 19

<210> 1866 <211> 19 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1866 tctcccagga tgcatgaag 19

<210> 1867 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1867 tccagccttt tcgtggtgac tcaa 24

<210> 1868 <211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1868 cagggaggtg gttgcaaatt tctaaggtac aattgctcta ttgagtcacc acgaaaaggc 60 tggagcttca tgcatcctgg gaga 84

<210> 1869 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1869 cctgatctgc ttcagtgcc 19

<210> 1870 <211> 21 Page 405

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1870 gcagcaagga tcatctcaat c 21

<210> 1871 2020201779

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1871 acaccaggct actcctccct gtcg 24

<210> 1872 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1872 cctgatctgc ttcagtgcct ccacaccagg ctactcctcc ctgtcggtga ttgagatgat 60 ccttgctgc 69

<210> 1873 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1873 tggagaaggt gaactgcatc 20

<210> 1874 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1874 Page 406

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cacggcttgg gtgtacatt 19

<210> 1875 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1875 acccgtgcct ccagtccaca c 21

<210> 1876 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1876 tggagaaggt gaactgcatc tgtgtggact ggaggcacgg gtcccgggca atgtacaccc 60 aagccgtg 68

<210> 1877 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1877 gtggcccaat taggcttg 18

<210> 1878 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1878 tcacaggtgc cagcaaag 18

<210> 1879 <211> 24 <212> DNA <213> Artificial Sequence

Page 407

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1879 ttctccatct ggcctcagag caga 24

<210> 1880 <211> 67 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1880 gtggcccaat taggcttggc atctgctctg aggccagatg gagaatacac tttgctggca 60 cctgtga 67

<210> 1881 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1881 acaagcacca tcccagtga 19

<210> 1882 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1882 cacgaagaaa actatgcagc ag 22

<210> 1883 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1883 accagggctc cttgagcaaa tcct 24

<210> 1884 Page 408

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1884 acaagcacca tcccagtgat gttctggcag gatttgctca aggagccctg gtggcctgct 60 gcatagtttt cttcgtg 77 2020201779

<210> 1885 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1885 cctggagctc cgttactctc 20

<210> 1886 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1886 agccacatag ggatccagg 19

<210> 1887 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1887 cacccacttt accttctggt gccc 24

<210> 1888 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 409

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1888 cctggagctc cgttactctc aggcacccac tttaccttct ggtgcccacc tggatcccta 60 tgtggct 67

<210> 1889 <211> 20 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1889 cggcaagggg ttgatataga 20

<210> 1890 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1890 tgcctggcat ctctaagca 19

<210> 1891 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1891 ccgttcttct tcctttcgag ctgc 24

<210> 1892 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1892 cggcaagggg ttgatataga agcagctcga aaggaagaag aacggatcat gcttagagat 60 gccaggca 68

<210> 1893 <211> 18 <212> DNA Page 410

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1893 atactccgag cccacgaa 18

<210> 1894 <211> 18 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1894 ggaagcctgt tgtttggc 18

<210> 1895 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1895 tacatgcggt accctgcatc ttgg 24

<210> 1896 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1896 atactccgag cccacgaagc ccaagatgca gggtaccgca tgtacaggaa aagccaaaca 60 acaggcttcc 70

<210> 1897 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1897 atcctcttcc ctgagccg 18 Page 411

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1898 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1898 2020201779

cccagctgag agggaattta 20

<210> 1899 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1899 tgacgcatcc agggctctag tctg 24

<210> 1900 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1900 atcctcttcc ctgagccgct gacgcatcca gggctctagt ctgcacataa attccctctc 60 agctggg 67

<210> 1901 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1901 acaaaaccat gactgcgct 19

<210> 1902 <211> 18 <212> DNA <213> Artificial Sequence

<220> Page 412

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1902 tgtcatccag gtgagcga 18

<210> 1903 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1903 aaggccatct ccaagaacgt gctc 24

<210> 1904 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1904 acaaaaccat gactgcgctg gccaaggcca tctccaagaa cgtgctcttc gctcacctgg 60 atgaca 66

<210> 1905 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1905 tgataatcgt gggagtttcg 20

<210> 1906 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1906 gcaccaggag aggtagcagt 20

<210> 1907 <211> 29 Page 413

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1907 cgaactggcc ttaatgtaca atacaccca 29

<210> 1908 2020201779

<211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1908 tgataatcgt gggagtttcg gcgaactggc cttaatgtac aatacaccca gagcagctac 60 aatcactgct acctctcctg gtgc 84

<210> 1909 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1909 caagcaatgc gtcatcaatg t 21

<210> 1910 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1910 gtaaatccgc cccctcttct 20

<210> 1911 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1911 Page 414

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cagcctctgc ggaatggatc acact 25

<210> 1912 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1912 caagcaatgc gtcatcaatg tccccagcct ctgcggaatg gatcacactg agaagagggg 60 gcggatttac 70

<210> 1913 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1913 gacccagctc cactcctg 18

<210> 1914 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1914 cccattcacg tactccatca 20

<210> 1915 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1915 ccagaccatg gaccgcctgt actt 24

<210> 1916 <211> 67 <212> DNA <213> Artificial Sequence

Page 415

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1916 gacccagctc cactcctgct tccagaccat ggaccgcctg tactttgtga tggagtacgt 60 gaatggg 67

<210> 1917 <211> 19 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1917 ctatgacagg catgccacc 19

<210> 1918 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1918 ctccaaccat gaggaagacg 20

<210> 1919 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1919 acccgaggct gtgtctccaa cac 23

<210> 1920 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1920 ctatgacagg catgccaccc cgaccacccg aggctgtgtc tccaacaccg gaggcgtctt 60 cctcatggtt ggag 74

Page 416

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1921 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1921 gcagcacagg aatcttcttc tt 22 2020201779

<210> 1922 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1922 cccacctatc caacctaatc tg 22

<210> 1923 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1923 ctcatcctga cagactgcag ctgc 24

<210> 1924 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1924 gcagcacagg aatcttcttc ttggcagctg cagtctgtca ggatgagata tcagattagg 60 ttggataggt ggg 73

<210> 1925 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 417

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1925 accgtcatca gcaaaggct 19

<210> 1926 <211> 19 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1926 cgtgatgttc ttcttgccc 19

<210> 1927 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1927 cctgtgagtc atccacgcag ttca 24

<210> 1928 <211> 78 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1928 accgtcatca gcaaaggctg cagcttgaac tgcgtggatg actcacagga ctactacgtg 60 ggcaagaaga acatcacg 78

<210> 1929 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1929 ggaggagctc tacacgaaga ag 22

<210> 1930 <211> 19 <212> DNA Page 418

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1930 cggatcctgc acaaaatca 19

<210> 1931 <211> 24 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1931 cctgaagtgt cagctgatgc caca 24

<210> 1932 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1932 ggaggagctc tacacgaaga agttgtggca tcagctgaca cttcaggtgc ttgattttgt 60 gcaggatccg 70

<210> 1933 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1933 ccacgacaaa gccgactac 19

<210> 1934 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1934 tactcgatgg gctctgctg 19 Page 419

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1935 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1935 2020201779

cctgaaacaa ggctgagaat cccg 24

<210> 1936 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1936 ccacgacaaa gccgactaca tgcctgaaac aaggctgaga atcccggcag cagagcccat 60 cgagta 66

<210> 1937 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1937 tggctaagtg aagatgacaa tcatg 25

<210> 1938 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1938 tgcacatatc attacaccag ttcgt 25

<210> 1939 <211> 29 <212> DNA <213> Artificial Sequence

<220> Page 420

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1939 cctttccagc tttacagtga attgctgca 29

<210> 1940 <211> 81 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1940 tggctaagtg aagatgacaa tcatgttgca gcaattcact gtaaagctgg aaagggacga 60 actggtgtaa tgatatgtgc a 81

<210> 1941 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1941 taactggggc aaccttttct 20

<210> 1942 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1942 ttgcaggaaa aggtgactgt 20

<210> 1943 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1943 cctttgcctt cctggggctc tt 22

<210> 1944 <211> 78 Page 421

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1944 taactggggc aaccttttct tcgcctctgc ctttgccttc ctggggctct tggcgctgac 60 agtcaccttt tcctgcaa 78 2020201779

<210> 1945 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1945 gaatcattca ccaggcaaat tg 22

<210> 1946 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1946 ctgtactgcg ggtggaacat 20

<210> 1947 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1947 cctaccacca gcaaccctgc ca 22

<210> 1948 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1948 Page 422

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gaatcattca ccaggcaaat tgctggcagg gttgctggtg gtaggaatgt tccacccgca 60 gtacag 66

<210> 1949 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1949 cgaggtacaa gctgagatca agaa 24

<210> 1950 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1950 gcgtgccttt cgcttgaa 18

<210> 1951 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1951 ccagtgccag tgtccagcgg ct 22

<210> 1952 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1952 cgaggtacaa gctgagatca agaaatcttg gagccgctgg acactggcac tggacttcaa 60 gcgaaaggca cgc 73

<210> 1953 <211> 22 <212> DNA <213> Artificial Sequence Page 423

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1953 agtgactggg agtgggctag aa 22

<210> 1954 <211> 21 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1954 aagcctgtta ccgtgaatcg a 21

<210> 1955 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1955 tgacacctcc acaacgtcgc tgga 24

<210> 1956 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1956 agtgactggg agtgggctag aaggggacca cctgtctgac acctccacaa cgtcgctgga 60 gctcgattca cggtaacagg ctt 83

<210> 1957 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1957 gaccggtcga atgataaggt 20

Page 424

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1958 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1958 ctggacatct cgatgacagc 20 2020201779

<210> 1959 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1959 accaggcccg tcacattctc gtac 24

<210> 1960 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1960 gaccggtcga atgataaggt gtacgagaat gtgacgggcc tggtgaaagc tgtcatcgag 60 atgtccag 68

<210> 1961 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1961 caagcccagc cgacctaag 19

<210> 1962 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 425

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1962 gaacctggaa ctgcagcttt g 21

<210> 1963 <211> 23 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 1963 ctccgcaaac caacctcctg gct 23

<210> 1964 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1964 caagcccagc cgacctaagt acagaccccc tccgcaaacc aacctcctgg ctccaaagct 60 gcagttccag gttc 74

<210> 1965 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1965 gtgcaggaaa ggttcacaaa 20

<210> 1966 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1966 gcacacacga tggagtaagg 20

<210> 1967 <211> 24 <212> DNA Page 426

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1967 agtgtctgcg tccaatacac gcgt 24

<210> 1968 <211> 79 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1968 gtgcaggaaa ggttcacaaa tgtggagtgt ctgcgtccaa tacacgcgtg tgctcctctc 60 cttactccat cgtgtgtgc 79

<210> 1969 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1969 tcagaggact cacggttcg 19

<210> 1970 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1970 catacacctc cacgctgttg 20

<210> 1971 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1971 cgcaaggtcc cattcttgaa gacc 24 Page 427

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1972 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1972 2020201779

tcagaggact cacggttcga ggtcttcaag aatgggacct tgcgcatcaa cagcgtggag 60 gtgtatg 67

<210> 1973 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1973 aatgaggaag tttcggatgg 20

<210> 1974 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1974 cttcgatcac agccaggtag 20

<210> 1975 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1975 ctgatccaga cagccgacca gct 23

<210> 1976 <211> 74 <212> DNA <213> Artificial Sequence

<220> Page 428

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 1976 aatgaggaag tttcggatgg ggctgatcca gacagccgac cagctgcgct tctcctacct 60 ggctgtgatc gaag 74

<210> 1977 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 1977 tcaaaccctc ccagtgct 18

<210> 1978 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1978 agcagccagt tcgtccag 18

<210> 1979 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1979 ccccatcgtt gtacattgca gtgc 24

<210> 1980 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1980 tcaaaccctc ccagtgctgg ccccatcgtt gtacattgca gtgctggtgc tggacgaact 60 ggctgct 67

<210> 1981 Page 429

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1981 ggctactctg atctatgttg ataaggaa 28 2020201779

<210> 1982 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1982 gcttcagccc atccttagca 20

<210> 1983 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1983 cacacgggtg cctggttctc ca 22

<210> 1984 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1984 ggctactctg atctatgttg ataaggaaaa tggagaacca ggcacccgtg tggttgctaa 60 ggatgggctg aagc 74

<210> 1985 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 430

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1985 ctttatagac cagcaccggg 20

<210> 1986 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 1986 agcatccagc agccactc 18

<210> 1987 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1987 acgtttgtga ccctcgcgat aagc 24

<210> 1988 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1988 ctttatagac cagcaccggg ctgcgcttat cgcgagggtc acaaacgttg agtggctgct 60 ggatgct 67

<210> 1989 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1989 tgagagatta atgggcattg tg 22

<210> 1990 <211> 20 <212> DNA <213> Artificial Sequence Page 431

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 1990 ccggatgctt tattcgtagg 20

<210> 1991 <211> 26 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1991 acaaattgct tctcaccatc cccatt 26

<210> 1992 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1992 tgagagatta atgggcattg tgtacaaatt gcttctcacc atccccatta gacctacgaa 60 taaagcatcc gg 72

<210> 1993 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1993 taaaggctga ggcacgga 18

<210> 1994 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1994 ctccccagca tctcatgg 18

Page 432

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 1995 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1995 ccatcagggc agttgctgat tcct 24 2020201779

<210> 1996 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1996 taaaggctga ggcacggaga agaaaaggaa tcagcaactg ccctgatggg ccatgagatg 60 ctggggag 68

<210> 1997 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1997 ctgaaggacc ctacgctcg 19

<210> 1998 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 1998 atgcaaagcc agtgtgctc 19

<210> 1999 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 433

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 1999 cttctcaaag tgaggtgcca ggcc 24

<210> 2000 <211> 67 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2000 ctgaaggacc ctacgctcgg tggcctggca cctcactttg agaagagtga gcacactggc 60 tttgcat 67

<210> 2001 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2001 tagggatggt atctgaaaca aca 23

<210> 2002 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2002 tcgcgtacac ctctgctc 18

<210> 2003 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2003 cacttaaaac gaatctcaag agggtgacca 30

<210> 2004 <211> 84 <212> DNA Page 434

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2004 tagggatggt atctgaaaca acaatggtca ccctcttgag attcgtttta agtgtaattc 60 cataatgagc agaggtgtac gcga 84

<210> 2005 2020201779

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2005 agactactcg ggtcgaggtg 20

<210> 2006 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2006 agcatccgca gaaacctg 18

<210> 2007 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2007 ctttcagcca ggcagatgca cttg 24

<210> 2008 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2008 agactactcg ggtcgaggtg agctttcagc caggcagatg cacttggcca ggtttctgcg 60 Page 435

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gatgct 66

<210> 2009 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2009 gccatcttca ccatcaagg 19

<210> 2010 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2010 cggtgtctga gagtgtggc 19

<210> 2011 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2011 ctttgctgga cggccacttt gtct 24

<210> 2012 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2012 gccatcttca ccatcaagga ctctttgctg gacggccact ttgtcttggc cacactctca 60 gacaccg 67

<210> 2013 <211> 20 <212> DNA <213> Artificial Sequence

Page 436

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2013 cgtcgtatgc gagagtctgt 20

<210> 2014 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2014 tgaaggcgtg aggtgtagaa 20

<210> 2015 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2015 tccaggatgc ctgttagttc tcagca 26

<210> 2016 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2016 cgtcgtatgc gagagtctgt ttccaggatg cctgttagtt ctcagcacag atattctaca 60 cctcacgcct tca 73

<210> 2017 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2017 attaggggac tttggctcct 20

<210> 2018 Page 437

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2018 gggtggagat gtattccgtg 20 2020201779

<210> 2019 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2019 ccggagtgtc tattccaagc agcc 24

<210> 2020 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2020 attaggggac tttggctcct gccggagtgt ctattccaag cagccgtaca cggaatacat 60 ctccaccc 68

<210> 2021 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2021 tggtcctgaa tgtagcgtgt 20

<210> 2022 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 438

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2022 ccccatttca cctcttcaat 20

<210> 2023 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2023 ttgtgtttct tgggcagtct ttcttgaa 28

<210> 2024 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2024 tggtcctgaa tgtagcgtgt aagcttgtgt ttcttgggca gtctttcttg aaattgaaga 60 ggtgaaatgg gg 72

<210> 2025 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2025 ggtgtcagat ataaatgtgc aaatgc 26

<210> 2026 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2026 ttcgatattg ccagcagcta taaa 24

<210> 2027 <211> 28 <212> DNA <213> Artificial Sequence Page 439

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2027 tgctgtcctg tcggtctcag tacgttca 28

<210> 2028 <211> 84 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2028 ggtgtcagat ataaatgtgc aaatgccttc ttgctgtcct gtcggtctca gtacgttcac 60 tttatagctg ctggcaatat cgaa 84

<210> 2029 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2029 tgacagcgtg agaggtacta gg 22

<210> 2030 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2030 ctgagccaag aacgactagc tt 22

<210> 2031 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2031 cacgcatgat gcaagcttgt caaa 24

Page 440

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2032 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2032 tgacagcgtg agaggtacta ggttttgaca agcttgcatc atgcgtgagt ataagctagt 60 2020201779

cgttcttggc tcag 74

<210> 2033 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2033 atgaaccctt gaccccaagt 20

<210> 2034 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2034 gagctgggtg agatgctagg 20

<210> 2035 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2035 tgtgctctgc tgtgttccca cttg 24

<210> 2036 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 441

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2036 atgaaccctt gaccccaagt tcaagtggga acacagcaga gcacagtcct agcatctcac 60 ccagctc 67

<210> 2037 <211> 19 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2037 agggcacgtg aagtcattg 19

<210> 2038 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2038 aaagagtgca aacttgcgg 19

<210> 2039 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2039 caccaccaag aactttcgca gcag 24

<210> 2040 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2040 agggcacgtg aagtcattga ggccctgctg cgaaagttct tggtggtgga tgacccccgc 60 aagtttgcac tcttt 75

<210> 2041 <211> 20 Page 442

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2041 cgaagccctt acaagtttcc 20

<210> 2042 2020201779

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2042 ggactcttca ggggtgaaat 20

<210> 2043 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2043 cccttacgga ttcctggagg gaac 24

<210> 2044 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2044 cgaagccctt acaagtttcc tagttcaccc ttacggattc ctggagggaa catctatatt 60 tcacccctga agagtcc 77

<210> 2045 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2045 Page 443

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gtcgccgagt gtgcttct 18

<210> 2046 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2046 gtgggatgat gggtttgc 18

<210> 2047 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2047 tcaagtgtcc ttcgctcttg gcag 24

<210> 2048 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2048 gtcgccgagt gtgcttctgt caagtgtcct tcgctcttgg cagctggatg caaacccatc 60 atcccac 67

<210> 2049 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2049 tgctaactcc tgcacagcc 19

<210> 2050 <211> 20 <212> DNA <213> Artificial Sequence

Page 444

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2050 tgctaggttt cccctctgaa 20

<210> 2051 <211> 25 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2051 tcctcttcct ttctgctagc ctggc 25

<210> 2052 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2052 tgctaactcc tgcacagccc cgtcctcttc ctttctgcta gcctggctaa atctgctcat 60 tatttcagag gggaaaccta gca 83

<210> 2053 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2053 ctgccgggat ggcttctat 19

<210> 2054 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2054 ccaggttctg gaaactgtgg at 22

<210> 2055 Page 445

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2055 ctgagctctg cccggaccgc t 21 2020201779

<210> 2056 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2056 ctgccgggat ggcttctatg aggctgagct ctgcccggac cgctgcatcc acagtttcca 60 gaacctgg 68

<210> 2057 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2057 tcctctccaa gttcgagcc 19

<210> 2058 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2058 caggccctgg tacagcac 18

<210> 2059 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 446

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2059 tccaatggac caagcactgt gaca 24

<210> 2060 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2060 tcctctccaa gttcgagccc gtgctccaat ggaccaagca ctgtgacaac gtgctgtacc 60 agggcctg 68

<210> 2061 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2061 agacatccac gacagcgat 19

<210> 2062 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2062 ccatttggct gtgctcttg 19

<210> 2063 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2063 agttccagca gcagccacca gag 23

<210> 2064 <211> 67 <212> DNA <213> Artificial Sequence Page 447

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2064 agacatccac gacagcgatg gcagttccag cagcagccac cagagcctca agagcacagc 60 caaatgg 67

<210> 2065 <211> 19 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2065 caggctgcag agagcattt 19

<210> 2066 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2066 tttgcttgtg cttctgcttg 20

<210> 2067 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2067 tgaaaatgaa ctcccacttc cggg 24

<210> 2068 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2068 caggctgcag agagcatttg cccggaagtg ggagttcatt ttcatgcaag cagaagcaca 60 agcaaa 66 Page 448

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2069 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2069 2020201779

tggcatagct ctggggtg 18

<210> 2070 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2070 tgccacagct gcatgaac 18

<210> 2071 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2071 aaatgggctc aaccagaaaa gccc 24

<210> 2072 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2072 tggcatagct ctggggtggg cagttttttg aaaatgggct caaccagaaa agcccaagtt 60 catgcagctg tggca 75

<210> 2073 <211> 21 <212> DNA <213> Artificial Sequence

<220> Page 449

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2073 aagcatgaac aggacttgac c 21

<210> 2074 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2074 cctccccaag tcagttgc 18

<210> 2075 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2075 ctttccaacc cctggggaag acat 24

<210> 2076 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2076 aagcatgaac aggacttgac catctttcca acccctgggg aagacatttg caactgactt 60 ggggagg 67

<210> 2077 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2077 cccgttcggt ctgaggaa 18

<210> 2078 <211> 22 Page 450

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2078 gagcactcaa ggtagccaaa gg 22

<210> 2079 2020201779

<211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2079 tccggttcgc catgtcccg 19

<210> 2080 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2080 cccgttcggt ctgaggaagg ccgggacatg gcgaaccgga tcagtgcctt tggctacctt 60 gagtgctc 68

<210> 2081 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2081 agctgaaggc agccctatc 19

<210> 2082 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2082 Page 451

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ttggaatcct ttaatgcagg t 21

<210> 2083 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2083 tgagaggcaa ccatcattac cagagc 26

<210> 2084 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2084 agctgaaggc agccctatct gagaggcaac catcattacc agagctacag cagtatgtac 60 ctgcattaaa ggattccaa 79

<210> 2085 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2085 tcggaattgg acttgggag 19

<210> 2086 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2086 ctggttactc ccctccaaca 20

<210> 2087 <211> 24 <212> DNA <213> Artificial Sequence

Page 452

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2087 ttttaagcct gactcctcac cgcg 24

<210> 2088 <211> 66 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2088 tcggaattgg acttgggagg cgcggtgagg agtcaggctt aaaacttgtt ggaggggagt 60 aaccag 66

<210> 2089 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2089 tgacagggga agtgggtc 18

<210> 2090 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2090 ggaagacagc tttggcaaga 20

<210> 2091 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2091 ccaggtcagc ccttctcttc cctt 24

<210> 2092 Page 453

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2092 tgacagggga agtgggtccc caggtcagcc cttctcttcc ctttgggctc ttgccaaagc 60 tgtcttcc 68 2020201779

<210> 2093 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2093 ctacaaggcc cagccaac 18

<210> 2094 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2094 caccagtggc tttacatttc ag 22

<210> 2095 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2095 ctgtaccatc cactgccagc gttt 24

<210> 2096 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 454

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2096 ctacaaggcc cagccaacca aacgctggca gtggatggta cagcgttact gaaatgtaaa 60 gccactggtg 70

<210> 2097 <211> 20 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2097 gggctactgg cagctacatt 20

<210> 2098 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2098 ctctcagcat cggtacaagg 20

<210> 2099 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2099 cattggaatt gccattagtc ccagc 25

<210> 2100 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2100 gggctactgg cagctacatt gctgggacta atggcaattc caatggcctt gtaccgatgc 60 tgagag 66

<210> 2101 <211> 20 <212> DNA Page 455

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2101 cagcgggatt aaacagtcct 20

<210> 2102 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2102 atctgcgttg aagcagtgag 20

<210> 2103 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2103 ccagcacagc cagttaaaag atgca 25

<210> 2104 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2104 cagcgggatt aaacagtcct ttaaccagca cagccagtta aaagatgcag cctcactgct 60 tcaacgcaga t 71

<210> 2105 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2105 agacaaggat gccgtggata a 21 Page 456

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2106 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2106 2020201779

gaagtccacc tgggcatctc 20

<210> 2107 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2107 ttgctcaagg acctggacgc caa 23

<210> 2108 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2108 agacaaggat gccgtggata aattgctcaa ggacctggac gccaatggag atgcccaggt 60 ggacttc 67

<210> 2109 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2109 ccttttacca ctgcctggtt 20

<210> 2110 <211> 19 <212> DNA <213> Artificial Sequence

<220> Page 457

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2110 acaatgctgt gtccttccg 19

<210> 2111 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2111 tccagtgctc tttcggcact tctg 24

<210> 2112 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2112 ccttttacca ctgcctggtt gcagaagtgc cgaaagagca ctggactccg gaaggacaca 60 gcattgt 67

<210> 2113 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2113 tgacaatcag cacacctgca t 21

<210> 2114 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2114 tgtgactaca gccgtgatcc tta 23

<210> 2115 <211> 20 Page 458

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2115 caggccctct tccgagcggt 20

<210> 2116 2020201779

<211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2116 tgacaatcag cacacctgca ttcaccgctc ggaagagggc ctgagctgca tgaataagga 60 tcacggctgt agtcaca 77

<210> 2117 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2117 gaaattgacg aggggtgtct 20

<210> 2118 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2118 aggagctaac ggagaacctg 20

<210> 2119 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2119 Page 459

GHDX‐046_SEQLIST.TXT 11 Mar 2020

ctctgagcgc ctccatccaa gg 22

<210> 2120 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2120 gaaattgacg aggggtgtct tgggcagagc tggctctgag cgcctccatc caaggccagg 60 ttctccgtta gctcct 76

<210> 2121 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2121 ggattgaagt ggctggaaag 20

<210> 2122 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2122 accagccaca gtaccctca 19

<210> 2123 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2123 aactccatct ccttccccag gcat 24

<210> 2124 <211> 68 <212> DNA <213> Artificial Sequence

Page 460

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2124 ggattgaagt ggctggaaag agtgatgcct ggggaaggag atggagttat gagggtactg 60 tggctggt 68

<210> 2125 <211> 18 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2125 cttccctcgg gtctcagg 18

<210> 2126 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2126 ttccctcctg gtaaaggtca 20

<210> 2127 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2127 ttacatcctc cctctccccg caat 24

<210> 2128 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2128 cttccctcgg gtctcaggca tttacatcct ccctctcccc gcaatctgac ctttaccagg 60 agggaa 66

Page 461

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2129 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2129 agggttccca tgtgaccag 19 2020201779

<210> 2130 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2130 gcaggcatgc tgtggaat 18

<210> 2131 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2131 cgggcttcta catcctgcag tgg 23

<210> 2132 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2132 agggttccca tgtgaccagg tggccgggct tctacatcct gcagtggaaa ttccacagca 60 tgcctgc 67

<210> 2133 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 462

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2133 cgtgtgcatt agatcagaca gg 22

<210> 2134 <211> 22 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2134 cccattacca tgtatcctcc ag 22

<210> 2135 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2135 tcctggagat gaaatgctgt ccca 24

<210> 2136 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2136 cgtgtgcatt agatcagaca ggtctcctgg agatgaaatg ctgtcccaac cttactggag 60 gatacatggt aatggg 76

<210> 2137 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2137 ttggaatgca gtccgaagt 19

<210> 2138 <211> 20 <212> DNA Page 463

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2138 ctcttcattt cgcctctgga 20

<210> 2139 <211> 24 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2139 ttgccaatag accagcgctc tctg 24

<210> 2140 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2140 ttggaatgca gtccgaagtc gcagagagcg ctggtctatt ggcaattcca gaggcgaaat 60 gaagag 66

<210> 2141 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2141 cagtgaccac gagtaccagg 20

<210> 2142 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2142 cttcgatggt accccacttg 20 Page 464

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2143 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2143 2020201779

ttgccaatag accagcgctc tctg 24

<210> 2144 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2144 cagtgaccac gagtaccagg tcaacggcaa gaggatcctt gggaggaaga ccaagtgggg 60 taccatcgaa g 71

<210> 2145 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2145 gtgtggccct gtctgctta 19

<210> 2146 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2146 ccctgtgcat gtgagagcta c 21

<210> 2147 <211> 24 <212> DNA <213> Artificial Sequence

<220> Page 465

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2147 agggaatcgc tgtcaccttc caag 24

<210> 2148 <211> 68 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2148 gtgtggccct gtctgcttat ccttggaagg tgacagcgat tccctgtgta gctctcacat 60 gcacaggg 68

<210> 2149 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2149 cagatggcca ctttgagaac att 23

<210> 2150 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2150 ggcagcatta accacaagga tt 22

<210> 2151 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2151 agctgacaac agtgtgaacg accagacc 28

<210> 2152 <211> 77 Page 466

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2152 cagatggcca ctttgagaac attttagctg acaacagtgt gaacgaccag accaaaatcc 60 ttgtggttaa tgctgcc 77 2020201779

<210> 2153 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2153 gaccctggtt ttgggtatga 20

<210> 2154 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2154 gagctcggaa tgttggca 18

<210> 2155 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2155 tgctcttctc ctcgtctggc aaag 24

<210> 2156 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2156 Page 467

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gaccctggtt ttgggtatga agactttgcc agacgaggag aagagcattt gccaacattc 60 cgagctc 67

<210> 2157 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2157 tacaggatga ggctgggc 18

<210> 2158 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2158 gttgttaggg caaggggc 18

<210> 2159 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2159 cctgggacag cctatgtaag gcca 24

<210> 2160 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2160 tacaggatga ggctgggcat tgcctgggac agcctatgta aggccatgtg ccccttgccc 60 taacaac 67

<210> 2161 <211> 20 <212> DNA <213> Artificial Sequence Page 468

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2161 ccatcacaac agccttgaac 20

<210> 2162 <211> 20 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2162 cactggggtg ctgatctcta 20

<210> 2163 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2163 aaccggatgg tccattctcc ttca 24

<210> 2164 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2164 ccatcacaac agccttgaac actctcaacc ggatggtcca ttctccttca gggcgccata 60 tggtagagat cagcacccca gtg 83

<210> 2165 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2165 cctccaaagc cattgtcaag 20

Page 469

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2166 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2166 ctttgagagc cagagttcag c 21 2020201779

<210> 2167 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2167 cacagcagtc atctgcacca gtcc 24

<210> 2168 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2168 cctccaaagc cattgtcaag accacagcag tcatctgcac cagtccagct gaactctggc 60 tctcaaag 68

<210> 2169 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2169 gtccaaggca catatccact g 21

<210> 2170 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 470

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2170 gaagcagcct cccgattt 18

<210> 2171 <211> 24 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2171 caccgagttc tctgctttca ccga 24

<210> 2172 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2172 gtccaaggca catatccact gctcggtgaa agcagagaac tcggtggcgg ccaaatcggg 60 aggctgcttc 70

<210> 2173 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2173 agcgggtgct agagcttgta 20

<210> 2174 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2174 atggcacttc ggtctcca 18

<210> 2175 <211> 25 <212> DNA Page 471

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2175 ccatcactgc caacaagaac acctg 25

<210> 2176 <211> 67 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2176 agcgggtgct agagcttgta tccatcactg ccaacaagaa cacctgtcct ggagaccgaa 60 gtgccat 67

<210> 2177 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2177 gatggtagga agggatgtgc 20

<210> 2178 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2178 cacaaggagc tgtgaatgag g 21

<210> 2179 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2179 cgcctctcca cgcactcagc tat 23 Page 472

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2180 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2180 2020201779

gatggtagga agggatgtgc ccgcctctcc acgcactcag ctatacctca ttcacagctc 60 cttgtg 66

<210> 2181 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2181 ctaggacagc ttggcttcca 20

<210> 2182 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2182 cataaccgta gggctccaca 20

<210> 2183 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2183 cgccacaatg ccctcatagt tgac 24

<210> 2184 <211> 67 <212> DNA <213> Artificial Sequence

<220> Page 473

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2184 ctaggacagc ttggcttcca tgtcaactat gagggcattg tggcggatgt ggagccctac 60 ggttatg 67

<210> 2185 <211> 21 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2185 agaggctgaa tatgcaggac a 21

<210> 2186 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2186 ctatcggcct cagcatgg 18

<210> 2187 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2187 ccaatctctg cctcagttct gcca 24

<210> 2188 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2188 agaggctgaa tatgcaggac agttggcaga actgaggcag agattggacc atgctgaggc 60 cgatag 66

<210> 2189 Page 474

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2189 atcgtcagcg agtttgacct 20 2020201779

<210> 2190 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2190 caggatggct tgggtgag 18

<210> 2191 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2191 cagcatccac gcattgacac agac 24

<210> 2192 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2192 atcgtcagcg agtttgacct tgtctgtgtc aatgcgtgga tgctggacct cacccaagcc 60 atcctg 66

<210> 2193 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 475

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2193 aagtgttttt cccccttgag at 22

<210> 2194 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2194 ggccgatcga tagtctctct t 21

<210> 2195 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2195 tcatggtgct gcatagcaaa tatcca 26

<210> 2196 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2196 aagtgttttt cccccttgag ataatggata tttgctatgc agcaccatga agaagagaga 60 ctatcgatcg gcc 73

<210> 2197 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2197 aggaccgtag ctgcacagac 20

<210> 2198 <211> 18 <212> DNA <213> Artificial Sequence Page 476

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2198 atcccatccc aatgcaga 18

<210> 2199 <211> 24 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2199 taccatggct gctgctcttc atcc 24

<210> 2200 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2200 aggaccgtag ctgcacagac ataccatggc tgctgctctt catcctcttc tgcattggga 60 tgggat 66

<210> 2201 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2201 ggacattact ggcctgttca ca 22

<210> 2202 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2202 accaatactc aggagcagga tga 23

Page 477

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2203 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2203 tgcattccag cctcccattt cca 23 2020201779

<210> 2204 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2204 ggacattact ggcctgttca caatgagctt gcattccagc ctcccatttc caatcatcct 60 gctcctgagt attggt 76

<210> 2205 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2205 taccgactga acccccaa 18

<210> 2206 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2206 gacatcaccc gctaggtttc 20

<210> 2207 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 478

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2207 tatcttacct ctaccgcctg ccgc 24

<210> 2208 <211> 66 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2208 taccgactga acccccaaga gtatcttacc tctaccgcct gccgccgaaa cctagcgggt 60 gatgtc 66

<210> 2209 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2209 ccgagttagc atatcccagg 20

<210> 2210 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2210 cctttgtgcc cagctgtc 18

<210> 2211 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2211 cccacccttg ctgtgttgag tctg 24

<210> 2212 <211> 67 <212> DNA Page 479

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2212 ccgagttagc atatcccagg ctcgcagact caacacagca agggtgggag acagctgggc 60 acaaagg 67

<210> 2213 2020201779

<211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2213 ggcatccagt gccagaac 18

<210> 2214 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2214 cgcgatgtag ctgtgcat 18

<210> 2215 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2215 cttcacagag gctgagcacc agga 24

<210> 2216 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2216 ggcatccagt gccagaaccc gctcttcaca gaggctgagc accaggacat gcacagctac 60 Page 480

GHDX‐046_SEQLIST.TXT 11 Mar 2020

atcgcg 66

<210> 2217 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2217 cccaatcgga agcctaacta 20

<210> 2218 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2218 gtagggctgc tggaaggtaa 20

<210> 2219 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2219 tctggattag agtcctgcag ctcgc 25

<210> 2220 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2220 cccaatcgga agcctaacta cagcgagctg caggactcta atccagagtt taccttccag 60 cagccctac 69

<210> 2221 <211> 20 <212> DNA <213> Artificial Sequence

Page 481

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2221 cgtttcctgc ttttggttct 20

<210> 2222 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2222 aggtagaagg cgcacgaa 18

<210> 2223 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2223 cccacctaag gcctacgccg acta 24

<210> 2224 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2224 cgtttcctgc ttttggttct tacagtagtc ggcgtaggcc ttaggtgggt tcgtgcgcct 60 tctacct 67

<210> 2225 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2225 tgaagagagg catgttggag 20

<210> 2226 Page 482

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2226 aatagacaca tcggccacac 20 2020201779

<210> 2227 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2227 tttgtcagca gtcacattgc ccaa 24

<210> 2228 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2228 tgaagagagg catgttggag acttgggcaa tgtgactgct gacaaagatg gtgtggccga 60 tgtgtctatt 70

<210> 2229 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2229 gcagatgagt ggaggctttc 20

<210> 2230 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 483

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2230 agcgagtgaa gagggctg 18

<210> 2231 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2231 atttccattg gcatcagcac tgga 24

<210> 2232 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2232 gcagatgagt ggaggctttc ttccagtgct gatgccaatg gaaatgccca gccctcttca 60 ctcgct 66

<210> 2233 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2233 agatgatctc gggagactgg 20

<210> 2234 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2234 gcgcccttca gtaggtga 18

<210> 2235 <211> 24 <212> DNA <213> Artificial Sequence Page 484

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2235 cgagtccagc atctccaacc tggt 24

<210> 2236 <211> 66 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2236 agatgatctc gggagactgg ctcgagtcca gcatctccaa cctggttttc acctactgaa 60 gggcgc 66

<210> 2237 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2237 tcttccctgt acactggcag ttc 23

<210> 2238 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2238 agctcggtgt gggagaggta 20

<210> 2239 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2239 tggaccagca ccccattgac gg 22

Page 485

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2240 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2240 tcttccctgt acactggcag ttcggccagc tggaccagca ccccattgac gggtacctct 60 2020201779

cccacaccga gct 73

<210> 2241 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2241 ggcacagtgc aagtgatga 19

<210> 2242 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2242 gattgagctc tctcggcct 19

<210> 2243 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2243 acttcatccc aagccaggcc tttc 24

<210> 2244 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 486

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2244 ggcacagtgc aagtgatgac tacttcatcc caagccaggc ctttctggag gccgagagag 60 ctcaatc 67

<210> 2245 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2245 ccatccgcca gtattacaag 20

<210> 2246 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2246 gggtgcacga actggtaga 19

<210> 2247 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2247 atcatccgga agccagacat ctcc 24

<210> 2248 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2248 ccatccgcca gtattacaag aagggcatca tccggaagcc agacatctcc cagcgcctcg 60 tctaccagtt cgtgcaccc 79

<210> 2249 <211> 20 Page 487

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2249 ctgccatatg acccttccag 20

<210> 2250 2020201779

<211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2250 gttgaaaact gcaccgcac 19

<210> 2251 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2251 accacgtctc ttcagaagcc tggg 24

<210> 2252 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2252 ctgccatatg acccttccag tcccaggctt ctgaagagac gtggtaagtg cggtgcagtt 60 ttcaac 66

<210> 2253 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2253 Page 488

GHDX‐046_SEQLIST.TXT 11 Mar 2020

attcccagca caggctctgt 20

<210> 2254 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2254 agatggctac caccaccaca a 21

<210> 2255 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2255 ctgtcgcagt gttcctggtc atctgc 26

<210> 2256 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2256 attcccagca caggctctgt ggagatggct gtcgcagtgt tcctggtcat ctgcattgtg 60 gtggtggtag ccatct 76

<210> 2257 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2257 tcacacatgg aaagcgagg 19

<210> 2258 <211> 18 <212> DNA <213> Artificial Sequence

Page 489

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2258 gttcaggtcc tgggcaac 18

<210> 2259 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2259 tgaatggtgc atacaaggcc atcc 24

<210> 2260 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2260 tcacacatgg aaagcgagga gttgaatggt gcatacaagg ccatccccgt tgcccaggac 60 ctgaac 66

<210> 2261 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2261 attttcgagg ccaaaaaatc 20

<210> 2262 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2262 cctgagcaag gatattcacg 20

<210> 2263 Page 490

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2263 tgggcaagaa aaacatctca ttcctttg 28 2020201779

<210> 2264 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2264 attttcgagg ccaaaaaatc attttactgg gcaagaaaaa catctcattc ctttgtcgtg 60 aatatccttg ctcagg 76

<210> 2265 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2265 tgaggagtgg tattttggca aga 23

<210> 2266 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2266 ctctcgggtt ctctgcattg a 21

<210> 2267 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 491

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2267 aaccgctctg actcccgtct ggtg 24

<210> 2268 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2268 tgaggagtgg tattttggca agatcaccag acgggagtca gagcggttac tgctcaatgc 60 agagaacccg agag 74

<210> 2269 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2269 gggctggaat ctgtctagga 20

<210> 2270 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2270 ccatgactgc acaatggct 19

<210> 2271 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2271 cctctctcgg aggccacaga ggct 24

<210> 2272 <211> 71 <212> DNA <213> Artificial Sequence Page 492

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2272 gggctggaat ctgtctagga gccctctctc ggaggccaca gaggctgggg gtagccattg 60 tgcagtcatg g 71

<210> 2273 <211> 20 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2273 gtaggtctcc tggcgttctg 20

<210> 2274 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2274 tccctggaag ggtaggagta a 21

<210> 2275 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2275 agacaccact cagaatcccc aggc 24

<210> 2276 <211> 81 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2276 gtaggtctcc tggcgttctg ccagctggcc tggggattct gagtggtgtc tgcttagagt 60 ttactcctac ccttccaggg a 81 Page 493

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2277 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2277 2020201779

cctgtcctgc cagagcat 18

<210> 2278 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2278 cagctgcaca aaactggc 18

<210> 2279 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2279 agtcacgagc acccagcgaa actt 24

<210> 2280 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2280 cctgtcctgc cagagcatgg atgaagtttc gctgggtgct cgtgactggc cagttttgtg 60 cagctg 66

<210> 2281 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 494

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2281 gggctcagct ttcagaagtg 20

<210> 2282 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2282 acatgttcag ctggtccaca 20

<210> 2283 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2283 tggcagtttt cttctgtcac caaaa 25

<210> 2284 <211> 81 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2284 gggctcagct ttcagaagtg ctgagttggc agttttcttc tgtcaccaaa agaggtctca 60 atgtggacca gctgaacatg t 81

<210> 2285 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2285 tcacatgcca ctttggtgtt 20

<210> 2286 <211> 20 Page 495

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2286 cttgcaggaa gcggctatac 20

<210> 2287 2020201779

<211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2287 tcctgggaga gattgaccag ca 22

<210> 2288 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2288 tcacatgcca ctttggtgtt tcataatctc ctgggagaga ttgaccagca gtatagccgc 60 ttcctgcaag 70

<210> 2289 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2289 gaggcgctca acatgaaatt c 21

<210> 2290 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2290 Page 496

GHDX‐046_SEQLIST.TXT 11 Mar 2020

gccaggaaca cgaggttctc 20

<210> 2291 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2291 cggttgctct gcacttcggc ct 22

<210> 2292 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2292 gaggcgctca acatgaaatt caaggccgaa gtgcagagca accggggcct gaccaaggag 60 aacctcgtgt tcctggc 77

<210> 2293 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2293 ccagtggtgg tgatcgttca 20

<210> 2294 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2294 gcaaaagcat tgtcccagag a 21

<210> 2295 <211> 23 <212> DNA <213> Artificial Sequence

Page 497

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2295 cagccaggac aacaatgcga cgg 23

<210> 2296 <211> 74 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2296 ccagtggtgg tgatcgttca tggcagccag gacaacaatg cgacggccac tgttctctgg 60 gacaatgctt ttgc 74

<210> 2297 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2297 aatacccaac gcacaaatga 20

<210> 2298 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2298 ggagacaatg caaaccacac 20

<210> 2299 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2299 cacgttctct gccccgtttc ttg 23

<210> 2300 Page 498

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2300 aatacccaac gcacaaatga ccgcacgttc tctgccccgt ttcttgcccc agtgtggttt 60 gcattgtctc c 71 2020201779

<210> 2301 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2301 gaagatccct ttcctcctac tgttc 25

<210> 2302 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2302 ggatgatgtt cggccttgat 20

<210> 2303 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2303 ctgcgtggct ctcggcttcc ca 22

<210> 2304 <211> 74 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 499

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2304 gaagatccct ttcctcctac tgttctttct gtgggaagcc gagagccacg cagcatcaag 60 gccgaacatc atcc 74

<210> 2305 <211> 20 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2305 tgcagttgta gggagtctgg 20

<210> 2306 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2306 tctcaagaat tgccgttgac 20

<210> 2307 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2307 taccgtgcca gcagaagcca aag 23

<210> 2308 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2308 tgcagttgta gggagtctgg ttaccgtgcc agcagaagcc aaagaaagag tcaacggcaa 60 ttcttgaga 69

<210> 2309 <211> 20 <212> DNA Page 500

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2309 gtgaagccac cgtcatcatg 20

<210> 2310 <211> 22 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2310 ccttccttct tatcccccaa gt 22

<210> 2311 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2311 ctgaccagga ggcaaaacct tcaactga 28

<210> 2312 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2312 gtgaagccac cgtcatcatg tctgaccagg aggcaaaacc ttcaactgag gacttggggg 60 ataagaagga agg 73

<210> 2313 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2313 acttgcccag cacaagga 18 Page 501

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2314 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2314 2020201779

gacaccatcc gtgtcacatc 20

<210> 2315 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2315 accccaggac tgatgtcaag gcat 24

<210> 2316 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2316 acttgcccag cacaaggaag accccaggac tgatgtcaag gcatacgatg tgacacggat 60 ggtgtc 66

<210> 2317 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2317 gcgctccact ctcagtcttt 20

<210> 2318 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 502

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2318 cttgtgctca tggtgatggt 20

<210> 2319 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2319 agcctccaaa cacagtgacc acca 24

<210> 2320 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2320 gcgctccact ctcagtcttt actaaggaat ctacagcctc caaacacagt gaccaccatc 60 accaccatca ccatgagcac aag 83

<210> 2321 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2321 gagcaacacg attctggga 19

<210> 2322 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2322 ggcaccgtta accagctaaa t 21

<210> 2323 <211> 23 Page 503

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2323 tcttcatggt gttcccctcc tgg 23

<210> 2324 2020201779

<211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2324 gagcaacacg attctgggat cccaggaggg gaacaccatg aagactaacg acacatacat 60 gaaatttagc tggttaacgg tgcc 84

<210> 2325 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2325 gcccgaaacg ccgaatata 19

<210> 2326 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2326 cgtggctctc ttatcctcat gat 23

<210> 2327 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2327 Page 504

GHDX‐046_SEQLIST.TXT 11 Mar 2020

taccgcagca aaccgcttgg g 21

<210> 2328 <211> 65 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2328 gcccgaaacg ccgaatataa tcccaagcgg tttgctgcgg taatcatgag gataagagag 60 ccacg 65

<210> 2329 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2329 tgcgaagtgc ttttgtttgt 20

<210> 2330 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2330 gccttccaga cagtctccat 20

<210> 2331 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2331 cgcaccagca tggcaataag cttt 24

<210> 2332 <211> 83 <212> DNA <213> Artificial Sequence

Page 505

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2332 tgcgaagtgc ttttgtttgt ttgttttcgt ttggttaaag cttattgcca tgctggtgcg 60 gctatggaga ctgtctggaa ggc 83

<210> 2333 <211> 19 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2333 gccctcccag tgtgcaaat 19

<210> 2334 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2334 cgtcgatggt attaggatag aagca 25

<210> 2335 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2335 tgctgtttcg acgacaccgt tcg 23

<210> 2336 <211> 86 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2336 gccctcccag tgtgcaaata agggctgctg tttcgacgac accgttcgtg gggtcccctg 60 gtgcttctat cctaatacca tcgacg 86

Page 506

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2337 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2337 aggcactgtt catctcagtt tttct 25 2020201779

<210> 2338 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2338 catcaggctc cagatatgaa ctttc 25

<210> 2339 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2339 cagaagcgct tgccgggagc aaagg 25

<210> 2340 <211> 80 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2340 aggcactgtt catctcagct tttctgtccc tttgctcccg gcaagcgctt ctgctgaaag 60 ttcatatctg gagcctgatg 80

<210> 2341 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 507

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2341 ggtgtgccac agaccttcct 20

<210> 2342 <211> 24 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2342 acggagttct tgacagagtt ttga 24

<210> 2343 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2343 ttggcctgta atcacctgtg cagcctt 27

<210> 2344 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2344 ggtgtgccac agaccttcct acttggcctg taatcacctg tgcagccttt tgtgggcctt 60 caaaactctg tcaagaactc cgt 83

<210> 2345 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2345 gctactttga gcgcttctcg 20

<210> 2346 <211> 19 <212> DNA Page 508

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2346 ggtcaccatc ttgtgtcgg 19

<210> 2347 <211> 24 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2347 caagatgtgg cttctgcaac cagc 24

<210> 2348 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2348 gctactttga gcgcttctcg ccaagatgtg gcttctgcaa ccagcccatc cgacacaaga 60 tggtgacc 68

<210> 2349 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2349 accagtcccc cagaagacta 20

<210> 2350 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2350 cctggtgctg ttgtagatgg 20 Page 509

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2351 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2351 2020201779

tcctgagccc gaggaagtcc c 21

<210> 2352 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2352 accagtcccc cagaagacta tcctgagccc gaggaagtcc ccccggaggt gatttccatc 60 tacaacagca ccagg 75

<210> 2353 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2353 ggatcgagct cttccagatc ct 22

<210> 2354 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2354 gccaccgata tagcgctgtt 20

<210> 2355 <211> 21 <212> DNA <213> Artificial Sequence

<220> Page 510

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2355 cggccagatg agcacattgc c 21

<210> 2356 <211> 65 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2356 ggatcgagct cttccagatc cttcggccag atgagcacat tgccaaacag cgctatatcg 60 gtggc 65

<210> 2357 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2357 aacaccaatg ggttccatct 20

<210> 2358 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2358 cctcttcatc aggccaaact 20

<210> 2359 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2359 ttctgggctc ctgattgctc aagc 24

<210> 2360 <211> 66 Page 511

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2360 aacaccaatg ggttccatct ttctgggctc ctgattgctc aagcacagtt tggcctgatg 60 aagagg 66 2020201779

<210> 2361 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2361 caagactggc tacatcagag tcttagtg 28

<210> 2362 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2362 cagcgtaggt ttggtcatag atagg 25

<210> 2363 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2363 tgagtctgcc atgacctgtt ttccttcat 29

<210> 2364 <211> 86 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2364 Page 512

GHDX‐046_SEQLIST.TXT 11 Mar 2020

caagactggc tacatcagag tcttagtgca tgaaggaaaa caggtcatgg cagactcagg 60 acctatctat gaccaaacct acgctg 86

<210> 2365 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2365 ggacaagacc ctctcaggct 20

<210> 2366 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2366 ttggaggctg tgggtcag 18

<210> 2367 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2367 caagctccca agagcttcca gagc 24

<210> 2368 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2368 ggacaagacc ctctcaggct gtcccaagct cccaagagct tccagagctc tgacccacag 60 cctccaa 67

<210> 2369 <211> 18 <212> DNA <213> Artificial Sequence Page 513

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2369 gtccctggct gaaaatgg 18

<210> 2370 <211> 19 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2370 gggctcccga agtcttcta 19

<210> 2371 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2371 tggagccctt ctcccaagat ggta 24

<210> 2372 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2372 gtccctggct gaaaatggcc tggagccctt ctcccaagat ggtaccctag aagacttcgg 60 gagccc 66

<210> 2373 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2373 tcaccctctg tgacttcatc gt 22

Page 514

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2374 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2374 tgtggttcag gctcttcttc tg 22 2020201779

<210> 2375 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2375 ccctgggaca ccctgagcac ca 22

<210> 2376 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2376 tcaccctctg tgacttcatc gtgccctggg acaccctgag caccacccag aagaagagcc 60 tgaaccaca 69

<210> 2377 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2377 ctacctgcct tgctttgtga 20

<210> 2378 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 515

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2378 accgaaattg gagagcatgt 20

<210> 2379 <211> 24 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2379 ccaagaacga gtgtctctgg accg 24

<210> 2380 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2380 ctacctgcct tgctttgtga cttccaagaa cgagtgtctc tggaccgaca tgctctccaa 60 tttcggt 67

<210> 2381 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2381 gccgggaaga ccgtaattgt 20

<210> 2382 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2382 cagcggcacc aggttcag 18

<210> 2383 <211> 26 <212> DNA Page 516

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2383 caaatggctt cctctggaag gtccca 26

<210> 2384 <211> 84 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2384 gccgggaaga ccgtaattgt ggctgcactg gatgggacct tccagaggaa gccatttggg 60 gccatcctga acctggtgcc gctg 84

<210> 2385 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2385 ggacagtgtg cacctcaaag 20

<210> 2386 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2386 ctcccacgag gaaggtcc 18

<210> 2387 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2387 aagcactgtg catcaccttg accc 24 Page 517

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2388 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2388 2020201779

ggacagtgtg cacctcaaag actaagaaag cactgtgcat caccttgacc ctggggacct 60 tcctcgtggg ag 72

<210> 2389 <211> 15 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2389 gaggcggagg gcgag 15

<210> 2390 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2390 actggtcctc actcacaact 20

<210> 2391 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2391 taaggcttcc tgccgcgctc ca 22

<210> 2392 <211> 82 <212> DNA <213> Artificial Sequence

<220> Page 518

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2392 gaggcggagg cggagggcga ggggcgggga gcgccgcctg gagcgcggca ggaagcctta 60 tcagttgtga gtgaggacca gt 82

<210> 2393 <211> 15 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2393 gaggcggagg gcgag 15

<210> 2394 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2394 ttcctcgggt ctccaaagat 20

<210> 2395 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2395 cctggaataa cctgccgcgc 20

<210> 2396 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2396 gaggcggagg gcgaggggcg gggagcgccg cctggagcgc ggcaggttat tccaggatct 60 ttggagaccc gaggaa 76

<210> 2397 Page 519

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2397 ggagaagggt gaccgactca 20 2020201779

<210> 2398 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2398 tgcccagact cggcaaag 18

<210> 2399 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2399 cgctgagatc aatcggcccg acta 24

<210> 2400 <211> 69 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2400 ggagaagggt gaccgactca gcgctgagat caatcggccc gactatctcg actttgccga 60 gtctgggca 69

<210> 2401 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 520

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2401 tgcacagagg gtgtgggtta c 21

<210> 2402 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2402 tcttcatctg atttacaagc tgtacatg 28

<210> 2403 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2403 caatgcttcc aacaatttgt ttgcttgcc 29

<210> 2404 <211> 83 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2404 tgcacagagg gtgtgggtta caccaatgct tccaacaatt tgtttgcttg cctcccatgt 60 acagcttgta aatcagatga aga 83

<210> 2405 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2405 ctctgagaca gtgcttcgat gact 24

<210> 2406 <211> 19 <212> DNA <213> Artificial Sequence Page 521

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2406 ccatgaggcc caacttcct 19

<210> 2407 <211> 23 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2407 cagacttggt gccctttgac tcc 23

<210> 2408 <211> 84 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2408 ctctgagaca gtgcttcgat gactttgcag acttggtgcc ctttgactcc tgggagccgc 60 tcatgaggaa gttgggcctc atgg 84

<210> 2409 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2409 cagaagctgc cagttccc 18

<210> 2410 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2410 cacccacagg tctcccag 18

Page 522

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2411 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2411 ccttctcctc tgccgatcgc tc 22 2020201779

<210> 2412 <211> 79 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2412 cagaagctgc cagttccccg aggaagagcg gggcgagcga tcggcagagg agaaggggcg 60 gctgggagac ctgtgggtg 79

<210> 2413 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2413 cttcacagtg ctcctgcagt ct 22

<210> 2414 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2414 catctgcttc agctcgttgg t 21

<210> 2415 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 523

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2415 aagtacacgt aagttacagc cacaca 26

<210> 2416 <211> 73 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2416 cttcacagtg ctcctgcagt ctctctgtgt ggctgtaact tacgtgtact ttaccaacga 60 gctgaagcag atg 73

<210> 2417 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2417 aactgcatgt gggctatgg 19

<210> 2418 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2418 tgacaccctc tccacttcag 20

<210> 2419 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2419 acatgaccag ggaccaaccc ctc 23

<210> 2420 <211> 74 <212> DNA Page 524

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2420 aactgcatgt gggctatggg aggggttggt ccctggtcat gtgccccttc gcagctgaag 60 tggagagggt gtca 74

<210> 2421 2020201779

<211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2421 aatccaaggg ggagagtgat 20

<210> 2422 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2422 gtacagattt tgcccgagga 20

<210> 2423 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2423 catatggact ttgactcagc tgtggc 26

<210> 2424 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2424 aatccaaggg ggagagtgat gacttccata tggactttga ctcagctgtg gctcctcggg 60 Page 525

GHDX‐046_SEQLIST.TXT 11 Mar 2020

caaaatctgt ac 72

<210> 2425 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2425 ctttgaaccc ttgcttgcaa 20

<210> 2426 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2426 cccgggacaa agcaaatg 18

<210> 2427 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2427 aagtcctggg tgcttctgac gcaca 25

<210> 2428 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2428 ctttgaaccc ttgcttgcaa taggtgtgcg tcagaagcac ccaggacttc catttgcttt 60 gtcccggg 68

<210> 2429 <211> 20 <212> DNA <213> Artificial Sequence

Page 526

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2429 ccccaagcag tgcctctaca 20

<210> 2430 <211> 23 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2430 gaatcgcaca gcatcaataa cac 23

<210> 2431 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2431 cccgggtctc actggagccc a 21

<210> 2432 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2432 ccccaagcag tgcctctaca gtcagtgtgg gctccagtga gacccggggt gagcgtgtta 60 ttgatgctgt gcgattc 77

<210> 2433 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2433 gcctgtgaga ttcctacctt tg 22

<210> 2434 Page 527

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2434 atgtgcttgg acctcgctt 19 2020201779

<210> 2435 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2435 tctgctaccc actgccagat gctg 24

<210> 2436 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2436 gcctgtgaga ttcctacctt tgttctgcta cccactgcca gatgctgcaa gcgaggtcca 60 agcacat 67

<210> 2437 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2437 tctctgagct ctgcatttgt c 21

<210> 2438 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 528

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2438 ggctctaagg caggatgcta 20

<210> 2439 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2439 ttctccagct gaccctggtt ctctc 25

<210> 2440 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2440 tctctgagct ctgcatttgt ctattctcca gctgaccctg gttctctctc ttagcatcct 60 gccttagagc c 71

<210> 2441 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2441 aggagatgca gctgaaggag 20

<210> 2442 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2442 ccacctcttc atatttgcgg 20

<210> 2443 <211> 24 <212> DNA <213> Artificial Sequence Page 529

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2443 ccaagcacat cgctgaggat tcag 24

<210> 2444 <211> 66 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2444 aggagatgca gctgaaggag gccaagcaca tcgctgagga ttcagaccgc aaatatgaag 60 aggtgg 66

<210> 2445 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2445 taaccgtggc atctacctcc 20

<210> 2446 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2446 atgccaacgc catgatct 18

<210> 2447 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2447 atcctgttca ggtggctgca cctt 24

Page 530

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2448 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2448 taaccgtggc atctacctcc gagatcctgt tcaggtggct gcaccttcag atcatggcgt 60 2020201779

tggcat 66

<210> 2449 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2449 tcagctgtga gctgcggata 20

<210> 2450 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2450 acggtcctag gtttgaggtt aaga 24

<210> 2451 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2451 caggtcccat tgccgggcg 19

<210> 2452 <211> 65 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 531

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2452 tcagctgtga gctgcggata ccgcccggca atgggacctg ctcttaacct caaacctagg 60 accgt 65

<210> 2453 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2453 gcaaatccag atcccaacac 20

<210> 2454 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2454 cttcacgaag atccctctct g 21

<210> 2455 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2455 aactgaggcc aaacactcca aggc 24

<210> 2456 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2456 gcaaatccag atcccaacac ttgccttgga gtgtttggcc tcagtttgta cacaacagag 60 agggatcttc gtgaag 76

<210> 2457 <211> 18 Page 532

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2457 cctcacagga accgagca 18

<210> 2458 2020201779

<211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2458 ctggggctgg gaatcata 18

<210> 2459 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2459 tggatctgcc aaccatagac acgg 24

<210> 2460 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2460 cctcacagga accgagcagg cctggatctg ccaaccatag acacgggata tgattcccag 60 ccccag 66

<210> 2461 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2461 Page 533

GHDX‐046_SEQLIST.TXT 11 Mar 2020

caagaaaagc accaagagcc 20

<210> 2462 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2462 atgtccgcgt gattctgc 18

<210> 2463 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2463 agtgctgagc cacgaattcg tcc 23

<210> 2464 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2464 caagaaaagc accaagagcc ccccagtgct gagccacgaa ttcgtcctgc agaatcacgc 60 ggacat 66

<210> 2465 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2465 ttaccagtgg ctttcagatg g 21

<210> 2466 <211> 19 <212> DNA <213> Artificial Sequence

Page 534

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2466 tgtcccggtt ctaactccc 19

<210> 2467 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2467 ttcggcgatt tcaaacactc caga 24

<210> 2468 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2468 ttaccagtgg ctttcagatg gttctggagt gtttgaaatc gccgaagctt cgggagttag 60 aaccgggaca 70

<210> 2469 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2469 cattcgcctt aaggaaagca 20

<210> 2470 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2470 caaggtacct ggcttggtg 19

<210> 2471 Page 535

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2471 aactgccagc tctcagaccc ttcc 24 2020201779

<210> 2472 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2472 cattcgcctt aaggaaagca taaactgcca gctctcagac ccttccagca ccaagccagg 60 taccttg 67

<210> 2473 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2473 gcaactgcca cccatacag 19

<210> 2474 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2474 tggtgtggat actggctgtc 20

<210> 2475 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 536

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2475 ccacccaagg ccaaattacc aatg 24

<210> 2476 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2476 gcaactgcca cccatacagc taccacccaa ggccaaatta ccaatgagac agccagtatc 60 cacacca 67

<210> 2477 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2477 cgagagccag gactatctgc 20

<210> 2478 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2478 tagccgtagc aaggcagc 18

<210> 2479 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2479 cttctcccag ctccgagtcc atg 23

<210> 2480 <211> 81 <212> DNA <213> Artificial Sequence Page 537

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2480 cgagagccag gactatctgc tcatggactc ggagctggga gaagacggct gcccgcaagc 60 cccgctgcct tgctacggct a 81

<210> 2481 <211> 19 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2481 ccgtagtccc tgcaacctc 19

<210> 2482 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2482 tcctcactgt tcacacaggc 20

<210> 2483 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2483 actttgggga gcaccctttg tcct 24

<210> 2484 <211> 72 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2484 ccgtagtccc tgcaacctca tctactttgg ggagcaccct ttgtcctttg ctgcctgtgt 60 gaacagtgag ga 72 Page 538

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2485 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2485 2020201779

caatttggac ttctggagga a 21

<210> 2486 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2486 cacctcaaag gccgagtg 18

<210> 2487 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2487 aacgtgcaca tgaacgacaa cgtc 24

<210> 2488 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2488 caatttggac ttctggagga aaaacgtgca catgaacgac aacgtcctgc actcggcctt 60 tgaggtg 67

<210> 2489 <211> 20 <212> DNA <213> Artificial Sequence

<220> Page 539

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2489 cgaggacgag gcttaaaaac 20

<210> 2490 <211> 20 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2490 accatgcttg aggacaacag 20

<210> 2491 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2491 tctcagatca atcgtgcatc cttagtgaa 29

<210> 2492 <211> 73 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2492 cgaggacgag gcttaaaaac ttctcagatc aatcgtgcat ccttagtgaa cttctgttgt 60 cctcaagcat ggt 73

<210> 2493 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2493 ctatatgcag ccagagatgt gaca 24

<210> 2494 <211> 24 Page 540

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2494 ccacgagttt cttactgaga atgg 24

<210> 2495 2020201779

<211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2495 acagcctgcc actcatcaca gcc 23

<210> 2496 <211> 82 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2496 ctatatgcag ccagagatgt gacagccacc gtggacagcc tgccactcat cacagcctcc 60 attctcagta agaaactcgt gg 82

<210> 2497 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2497 gcctcggtgt gcctttca 18

<210> 2498 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2498 Page 541

GHDX‐046_SEQLIST.TXT 11 Mar 2020

cgtgatgtgc gcaatcatg 19

<210> 2499 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2499 catcgccagc tacgccctgc tc 22

<210> 2500 <211> 65 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2500 gcctcggtgt gcctttcaac atcgccagct acgccctgct cacgtacatg attgcgcaca 60 tcacg 65

<210> 2501 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2501 ctggagacgg tcgtagctg 19

<210> 2502 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2502 gccaagcttt gtagaaatag gg 22

<210> 2503 <211> 24 <212> DNA <213> Artificial Sequence

Page 542

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2503 tacctgtaaa cctttctcgg cgcg 24

<210> 2504 <211> 81 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2504 ctggagacgg tcgtagctgc ggtcgcgccg agaaaggttt acaggtacat acattacacc 60 cctatttcta caaagcttgg c 81

<210> 2505 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2505 tgtctggcga taaagggatt 20

<210> 2506 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2506 atggtcccta cccatttgaa 20

<210> 2507 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2507 tctgccttcc ctgaatcaga caacc 25

<210> 2508 Page 543

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2508 tgtctggcga taaagggatt tctgccttcc ctgaatcaga caaccttttc aaatgggtag 60 ggaccat 67 2020201779

<210> 2509 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2509 tgacactgaa cgaggtggc 19

<210> 2510 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2510 aagcagagag gaatcgcct 19

<210> 2511 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2511 ttgtcccacc agtgcctcat cagt 24

<210> 2512 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 544

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2512 tgacactgaa cgaggtggct tttgtcccac cagtgcctca tcagtgtgag gcgattcctc 60 tctgctt 67

<210> 2513 <211> 20 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2513 tgttctcaaa ttgccaccaa 20

<210> 2514 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2514 agaggtcaac acagttgcga 20

<210> 2515 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2515 aggtgcttgg agaccatccc tcaa 24

<210> 2516 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2516 tgttctcaaa ttgccaccaa aaggtgcttg gagaccatcc ctcaacatcg caactgtgtt 60 gacctct 67

<210> 2517 <211> 19 <212> DNA Page 545

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2517 gaaactccag agggccaga 19

<210> 2518 <211> 19 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2518 ctctgggaac ccagtgctc 19

<210> 2519 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2519 tatacagcac acagggcctg caca 24

<210> 2520 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2520 gaaactccag agggccagag agctgtgcag gccctgtgtg ctgtatatga gcactgggtt 60 cccagag 67

<210> 2521 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2521 aagcctgaag tggaatgact g 21 Page 546

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2522 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2522 2020201779

cctccattta aaaccctcca 20

<210> 2523 <211> 29 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2523 aaagatggga ctcctccttt atttcagca 29

<210> 2524 <211> 70 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2524 aagcctgaag tggaatgact gaaagatggg actcctcctt tatttcagca tggagggttt 60 taaatggagg 70

<210> 2525 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2525 ttgagtttgt catgcgcc 18

<210> 2526 <211> 18 <212> DNA <213> Artificial Sequence

<220> Page 547

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2526 tccaggtgag gttgtggg 18

<210> 2527 <211> 24 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2527 acccgaaggt gcttggctcc ttta 24

<210> 2528 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2528 ttgagtttgt catgcgccat aaaggagcca agcaccttcg ggtcgcagcc cacaacctca 60 cctgga 66

<210> 2529 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2529 ctacaggggc aaacagatgg 20

<210> 2530 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2530 ggtgtcattc aggcggac 18

<210> 2531 <211> 24 Page 548

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2531 cggccatacc ctcttcgact acga 24

<210> 2532 2020201779

<211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2532 ctacaggggc aaacagatgg aggacggcca taccctcttc gactacgagg tccgcctgaa 60 tgacacc 67

<210> 2533 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2533 gattgcacaa aaatgccaag 20

<210> 2534 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2534 ggaaagcaga cattctgatc c 21

<210> 2535 <211> 28 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2535 Page 549

GHDX‐046_SEQLIST.TXT 11 Mar 2020

tcgaaattgt cctcatttca agaatgca 28

<210> 2536 <211> 76 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2536 gattgcacaa aaatgccaag ttcgaaattg tcctcatttc aagaatgcag tgagtggatc 60 agaatgtctg ctttcc 76

<210> 2537 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2537 tggcttcagg agctgaatac c 21

<210> 2538 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2538 tgctgtcgtg atgagaaaat agtg 24

<210> 2539 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2539 caggcacaca caggtgggac acaaat 26

<210> 2540 <211> 89 <212> DNA <213> Artificial Sequence

Page 550

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2540 tggcttcagg agctgaatac cctcccaggc acacacaggt gggacacaaa taagggtttt 60 ggaaccacta ttttctcatc acgacagca 89

<210> 2541 <211> 23 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2541 gataccacaa ctcccatcaa gct 23

<210> 2542 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2542 tccctgttag gcgcatcag 19

<210> 2543 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2543 agtggcagcc acggcgcc 18

<210> 2544 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2544 gataccacaa ctcccatcaa gctgttggca gtggcagcca cggcgcctcc tgatgcgcct 60 aacaggga 68

Page 551

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2545 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2545 tttctcccag taccattcgt g 21 2020201779

<210> 2546 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2546 tgaataggga gccttggtag g 21

<210> 2547 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2547 tggtccatcc tctgcacctg ctac 24

<210> 2548 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2548 tttctcccag taccattcgt gatggtccat cctctgcacc tgctacacct accaaggctc 60 cctattca 68

<210> 2549 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 552

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2549 cctctccttc cagcctgagt 20

<210> 2550 <211> 20 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2550 tcattgccaa acacttcgag 20

<210> 2551 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2551 cagcatgaag ctaacgcccc ttgt 24

<210> 2552 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2552 cctctccttc cagcctgagt gcagcatgaa gctaacgccc cttgtgctcg aagtgtttgg 60 caatga 66

<210> 2553 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2553 ctgctgtctt gggtgcattg 20

<210> 2554 <211> 18 <212> DNA Page 553

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2554 gcagcctggg accacttg 18

<210> 2555 <211> 25 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2555 ttgccttgct gctctacctc cacca 25

<210> 2556 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2556 ctgctgtctt gggtgcattg gagccttgcc ttgctgctct acctccacca tgccaagtgg 60 tcccaggctg c 71

<210> 2557 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2557 tgacgatggc ctggagtgt 19

<210> 2558 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2558 ggtaccggat catgaggatc tg 22 Page 554

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2559 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2559 2020201779

ctgggcagca ccaagtccgg a 21

<210> 2560 <211> 71 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2560 tgacgatggc ctggagtgtg tgcccactgg gcagcaccaa gtccggatgc agatcctcat 60 gatccggtac c 71

<210> 2561 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2561 cctcagcaag acgttatttg aaatt 25

<210> 2562 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2562 aagtgtgatt ggcaaaactg attg 24

<210> 2563 <211> 26 <212> DNA <213> Artificial Sequence

<220> Page 555

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2563 cctctctctc aaggccccaa accagt 26

<210> 2564 <211> 83 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2564 cctcagcaag acgttatttg aaattacagt gcctctctct caaggcccca aaccagtaac 60 aatcagtttt gccaatcaca ctt 83

<210> 2565 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2565 tgcccttaaa ggaaccaatg a 21

<210> 2566 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2566 gcttcaacgg caaagttctc tt 22

<210> 2567 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2567 atttcacgca tctggcgttc ca 22

<210> 2568 <211> 72 Page 556

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2568 tgcccttaaa ggaaccaatg agtccctgga acgccagatg cgtgaaatgg aagagaactt 60 tgccgttgaa gc 72 2020201779

<210> 2569 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2569 acgttatgca cccctgtctt 20

<210> 2570 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2570 ccgatggagt ttagcaaggt 20

<210> 2571 <211> 26 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2571 cgaaacccca tgatgtctaa gcttcg 26

<210> 2572 <211> 82 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2572 Page 557

GHDX‐046_SEQLIST.TXT 11 Mar 2020

acgttatgca cccctgtctt tccgaaaccc catgatgtct aagcttcgaa actaccggaa 60 ggaccttgct aaactccatc gg 82

<210> 2573 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2573 gagtggccca gatgtccata 20

<210> 2574 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2574 gatgcttgag ggcttggtt 19

<210> 2575 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2575 cccctcgacg tatgtctccc attc 24

<210> 2576 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2576 gagtggccca gatgtccata agaatgggag acatacgtcg aggggttaac caagccctca 60 agcatc 66

<210> 2577 <211> 18 <212> DNA <213> Artificial Sequence Page 558

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2577 acccctgctc tgtccctc 18

<210> 2578 <211> 19 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2578 ataccttcgg ccacgtcac 19

<210> 2579 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2579 ctatgagtgc cacatcctga gccc 24

<210> 2580 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2580 acccctgctc tgtccctcgg gctatgagtg ccacatcctg agcccaggtg acgtggccga 60 aggtat 66

<210> 2581 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2581 agaggcatcc atgaacttca ca 22

Page 559

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2582 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2582 caaactccac agtacttggg ttga 24 2020201779

<210> 2583 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2583 cgggctgcat cagcacacgc 20

<210> 2584 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2584 agaggcatcc atgaacttca cacttgcggg ctgcatcagc acacgctcct atcaacccaa 60 gtactgtgga gtttg 75

<210> 2585 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2585 gtatcaggac cacatgcagt acatc 25

<210> 2586 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 560

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2586 tgtcggaatt gatactggca tt 22

<210> 2587 <211> 24 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2587 ttgatgcctg tcttcgcgcc ttct 24

<210> 2588 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2588 gtatcaggac cacatgcagt acatcggaga aggcgcgaag acaggcatca aagaatgcca 60 gtatcaattc cgaca 75

<210> 2589 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2589 atcgcagctg gtgggtgtac 20

<210> 2590 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2590 agctccctgt tgcatggact t 21

<210> 2591 <211> 27 <212> DNA Page 561

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2591 ctgctgttta ccttggcgag gcctttc 27

<210> 2592 <211> 74 2020201779

<212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2592 atcgcagctg gtgggtgtac acactgctgt ttaccttggc gaggcctttc accaagtcca 60 tgcaacaggg agct 74

<210> 2593 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2593 gcagttggaa gacacaggaa agt 23

<210> 2594 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2594 tgcgtggcac tattttcaag a 21

<210> 2595 <211> 27 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2595 tccccaaatt gcagatttat caacggc 27 Page 562

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2596 <211> 77 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2596 2020201779

gcagttggaa gacacaggaa agtatcccca aattgcagat ttatcaacgg cttttatctt 60 gaaaatagtg ccacgca 77

<210> 2597 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2597 agcccacttc agcgtctc 18

<210> 2598 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2598 agcaggattc acacttccaa c 21

<210> 2599 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2599 tctggctgaa ggcagtgtca cctc 24

<210> 2600 <211> 67 <212> DNA <213> Artificial Sequence

<220> Page 563

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2600 agcccacttc agcgtctcca gtctggctga aggcagtgtc acctctgttg gaagtgtgaa 60 tcctgct 67

<210> 2601 <211> 18 <212> DNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2601 acccgggcaa caagaagt 18

<210> 2602 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2602 gaccgagaac tcgccctc 18

<210> 2603 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2603 ttgatctgca cctgcttctg ctcc 24

<210> 2604 <211> 68 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2604 acccgggcaa caagaagtgg gagcagaagc aggtgcagat caagaccctg gagggcgagt 60 tctcggtc 68

<210> 2605 Page 564

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2605 ctgtggagcc tctgcctg 18 2020201779

<210> 2606 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2606 ggagcagggt tggattgag 19

<210> 2607 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2607 acctggccca actctaccag catc 24

<210> 2608 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2608 ctgtggagcc tctgcctgcg gacctggccc aactctacca gcatcagctc aatccaaccc 60 tgctcc 66

<210> 2609 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

Page 565

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2609 cattaaccca ctcccctga 19

<210> 2610 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2610 cccccaccat catgaatact 20

<210> 2611 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2611 caggtcccca agtgtgcaag ctc 23

<210> 2612 <211> 75 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2612 cattaaccca ctcccctgac ctcacgctgg ggcaggtccc caagtgtgca agctcagtat 60 tcatgatggt ggggg 75

<210> 2613 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2613 ggtctgggcc aaactgaag 19

<210> 2614 <211> 20 <212> DNA <213> Artificial Sequence Page 566

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2614 tgcccgtctt tatcccttag 20

<210> 2615 <211> 24 <212> DNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2615 cttttgcagg ccagaatgga aacc 24

<210> 2616 <211> 66 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2616 ggtctgggcc aaactgaagg ggtttccatt ctggcctgca aaagctctaa gggataaaga 60 cgggca 66

<210> 2617 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2617 cgaagggact ctgctcca 18

<210> 2618 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2618 gcaggaggtc ctcagaagg 19

Page 567

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2619 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2619 aggaggttcc acactcgcca gttc 24 2020201779

<210> 2620 <211> 67 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2620 cgaagggact ctgctccagt gaactggcga gtgtggaacc tcctgacacc ttctgaggac 60 ctcctgc 67

<210> 2621 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2621 tgcctgagga ccctctacc 19

<210> 2622 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2622 gaggtggcgg agtgacttt 19

<210> 2623 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 568

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2623 cccgccttca gagaagaaac caga 24

<210> 2624 <211> 66 <212> DNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2624 tgcctgagga ccctctaccg cccccgcctt cagagaagaa accagaaaaa gtcactccgc 60 cacctc 66

<210> 2625 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2625 tagaggccat caaaattggc 20

<210> 2626 <211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2626 tccgtttcct ctgggctt 18

<210> 2627 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2627 accaaggccc tgactcagat ggag 24

<210> 2628 <211> 66 <212> DNA Page 569

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2628 tagaggccat caaaattggc ctcaccaagg ccctgactca gatggaggaa gcccagagga 60 aacgga 66

<210> 2629 2020201779

<211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2629 uggaauguaa agaaguaugu au 22

<210> 2630 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2630 gcagcauugu acagggcuau ga 22

<210> 2631 <211> 21 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2631 uaaagugcug acagugcaga u 21

<210> 2632 <211> 23 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2632 uacccuguag auccgaauuu gug 23 Page 570

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<210> 2633 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2633 2020201779

uuuggucccc uucaaccagc ug 22

<210> 2634 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2634 uaacacuguc ugguaaagau gg 22

<210> 2635 <211> 23 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2635 guccaguuuu cccaggaauc ccu 23

<210> 2636 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2636 ugagaacuga auuccauagg cu 22

<210> 2637 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide Page 571

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<400> 2637 ucucccaacc cuuguaccag ug 22

<210> 2638 <211> 21 <212> RNA <213> Artificial Sequence

<220> 2020201779

<223> Synthetic oligonucleotide

<400> 2638 ucagugcaug acagaacuug g 21

<210> 2639 <211> 23 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2639 uuaaugcuaa ucgugauagg ggu 23

<210> 2640 <211> 24 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2640 uuuggcaaug guagaacuca cacu 24

<210> 2641 <211> 23 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2641 caacggaauc ccaaaagcag cug 23

<210> 2642 <211> 22 <212> RNA <213> Artificial Sequence Page 572

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<220> <223> Synthetic oligonucleotide

<400> 2642 uguaaacauc cucgacugga ag 22

<210> 2643 <211> 23 <212> RNA 2020201779

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2643 uaauacugcc ggguaaugau gga 23

<210> 2644 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2644 uccuucauuc caccggaguc ug 22

<210> 2645 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2645 uggaauguaa ggaagugugu gg 22

<210> 2646 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2646 uagcuuauca gacugauguu ga 22

<210> 2647 Page 573

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2647 cugugcgugu gacagcggcu ga 22 2020201779

<210> 2648 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2648 aagcugccag uugaagaacu gu 22

<210> 2649 <211> 21 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2649 agcuacaucu ggcuacuggg u 21

<210> 2650 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2650 uucaaguaau ccaggauagg cu 22

<210> 2651 <211> 21 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2651 Page 574

GHDX‐046_SEQLIST.TXT 11 Mar 2020

uucacagugg cuaaguuccg c 21

<210> 2652 <211> 21 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide 2020201779

<400> 2652 uucacagugg cuaaguucug c 21

<210> 2653 <211> 23 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2653 uagcaccauu ugaaaucagu guu 23

<210> 2654 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2654 cuuucagucg gauguuugca gc 22

<210> 2655 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2655 cuuucagucg gauguuuaca gc 22

<210> 2656 <211> 21 <212> RNA <213> Artificial Sequence

<220> Page 575

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<223> Synthetic oligonucleotide

<400> 2656 aggcaagaug cuggcauagc u 21

<210> 2657 <211> 21 <212> RNA <213> Artificial Sequence 2020201779

<220> <223> Synthetic oligonucleotide

<400> 2657 gccccugggc cuauccuaga a 21

<210> 2658 <211> 23 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2658 aaugacacga ucacucccgu uga 23

<210> 2659 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2659 uggcagugua uuguuagcug gu 22

<210> 2660 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2660 uccuguacug agcugccccg ag 22

<210> 2661 <211> 22 <212> RNA Page 576

GHDX‐046_SEQLIST.TXT 11 Mar 2020

<213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2661 uauugcacuu gucccggccu gu 22

<210> 2662 <211> 23 2020201779

<212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2662 caaagugcug uucgugcagg uag 23

<210> 2663 <211> 22 <212> RNA <213> Artificial Sequence

<220> <223> Synthetic oligonucleotide

<400> 2663 aacccguaga uccgaucuug ug 22

Page 577

Claims (25)

1. A method for determining a likelihood of cancer recurrence in a human patient with prostate cancer, comprising: measuring an expression level of an RNA transcript of AZGP1 and one or more of KLK2, FAM13C, and SRD5A2 in a biological sample comprising prostate tissue obtained from the patient; normalizing the RNA expression level of the RNA transcripts based on expression level of an RNA transcript of at least one reference gene in the sample; and predicting likelihood of cancer recurrence for the patient based on the normalized expression levels of the RNA transcripts; wherein normalized RNA expression levels of AZGP1, KLK2, FAM13C, and SRD5A2 negatively correlate with risk of recurrence.

2. The method of claim 1, further comprising generating a report based on the normalized RNA expression levels.

3. The method of claim 1 or 2, wherein the likelihood of cancer recurrence is based on clinical recurrence-free interval (cRFI).

4. The method of any one of claims 1-3, wherein the likelihood of cancer recurrence is based on biochemical recurrence-free interval (bRFI).

5. The method of any one of claims 1-4, wherein the biological sample has a positive TMPRSS2 fusion status.

6. The method of any one of claims 1-4, wherein the biological sample has a negative TMPRSS2 fusion status.

7. The method of any one of claims 1-6, wherein the patient has early-stage prostate cancer.

8. The method of any one of claims 1-7, wherein the biological sample comprises prostate tumor tissue with the primary Gleason pattern for said prostate tumor.

9. The method of any one of claims 1-7, wherein the biological sample comprises prostate tumor tissue with the highest Gleason pattern for said prostate tumor.

10. The method of any one of claims 1-7, wherein the biological sample is prostate tumor tissue.

11. The method of any one of claims 1-7, wherein the biological sample comprises non-tumor prostate tissue.

12. The method of any one of claims 1-11, further comprising determining a likelihood of upgrading or upstaging in the patient with prostate cancer, wherein normalized RNA expression levels of AZGP1, KLK2, FAM13C, and SRD5A2 negatively correlate with risk of upgrading/upstaging.

13. The method of any one of claims 1-12, wherein the biological sample is a fixed, paraffin-embedded tissue sample.

14. A method for determining a likelihood of cancer recurrence in a human patient with prostate cancer, comprising: measuring an expression level of an RNA transcript of AZGP1 and one or more of KLK2, FAM13C, and SRD5A2, as well as at least one further gene chosen from BGN, COL1A1, SFRP4, FLNC, GSN, GSTM2, TPM2, and TPX2 in a biological sample comprising prostate tissue obtained from the patient; normalizing the RNA expression level of the RNA transcripts based on expression level of an RNA transcript of at least one reference gene in the sample; and predicting likelihood of cancer recurrence for the patient based on the normalized expression levels of the RNA transcripts; wherein normalized RNA expression levels of AZGP1, KLK2, FAM13C, and SRD5A2 as well as FLNC, GSN, GSTM2, TPM2 negatively correlate with risk of recurrence and wherein normalized RNA expression levels of BGN, COL1A1, SFRP4 and TPX2 positively correlate with risk of recurrence.

15. The method of claim 14, wherein the method comprises determining the normalized RNA expression levels of each of AZGP1, KLK2, FAM13C, SRD5A2, BGN, COL1A1, SFRP4, FLNC, GSN, GSTM2, TPM2, and TPX2.

16. The method of any one of claim 14 or 15, further comprising generating a report based on the normalized RNA expression levels.

17. The method of any one of claims 14-16, wherein the likelihood of cancer recurrence is based on clinical recurrence-free interval (cRFI).

18. The method of any one of claims 14-17, wherein the likelihood of cancer recurrence is based on biochemical recurrence-free interval (bRFI).

19. The method of any one of claims 14-18, wherein the biological sample has a positive TMPRSS2 fusion status.

20. The method of any one of claims 14-18, wherein the biological sample has a negative TMPRSS2 fusion status.

21. The method of any one of claims 14-20, wherein the patient has early-stage prostate cancer.

22. The method of any one of claims 14-21, wherein the biological sample comprises prostate tumor tissue with the primary Gleason pattern for said prostate tumor.

23. The method of any one of claims 14-21, wherein the biological sample comprises prostate tumor tissue with the highest Gleason pattern for said prostate tumor.

24. The method of any one of claims 14-21, wherein the biological sample is prostate tumor tissue.

25. The method of any one of claims 14-21, wherein the biological sample comprises non-tumor prostate tissue.