AU2015202292B2 - Modulation of macrophage activation - Google Patents

Abstract

,A me thod for detecting c with a desired potenc,,y m odoMafin macrophage actlvaton comprises assayig cels for the desired potency the cetl being non embryonic stem, non-germ ceps that express One Ofmore of ocm4 telmease erx1, or ;(ox~ and/or can differentiate into cefl types of at east two of endoderma, ectodermal and mesoderma germdayers

Description

2015202292 01 May 2015

Regulation 3.2 Revised 2/98 AUSTRALIA Patents Act, 1990 ORIGINAL COMPLETE SPECIFICATION APPLiCAMT/S: ΑΒΪ Holding Company Case Western Reserve University INVENTORS: TING, Anthony E. MAYS, Robert W. HAMILTON, Jason A. BUSCH, Sarah A. SILVER, Jerry ADDRESS FOR SERVICE : Peter Maxwell and Associates Level 6 60 Pitt Street SYDNEY NSW 2000 INVENTION TITLE: MODULATION OF MACROPHAGE ACTIVATION DETAILS OF ASSOCIATED APPLICATION NO{S): Divisional of AU 2011 220 721 filed on 24 February 2011

The following statement is a full description of this invention including the best method of performing it known to us:~ 1 m:\docs\20111197\3S8015.doc

MODULATION OF MACROPHAGE ACTIVATION 2015202292 01 May 2015

FIELD OF THE INVENTION

[0001] The invention provides methods for treating conditions associated with an undesirable inflammatory component, e.g., conditions of the central nervous system (CNS). The invention is generally directed to reducing inflammation by administering cells that modulate macrophage activation. The invention is also directed to chug discovery methods to semen fear agents that modulate theabiliiy of the ceils to modulate macrophage activation. The invention is also directed to ceil banks that can he died to provide cells for administration to a subject, the banks comprising cep having a desired potency for modulating macrophage activation. The invention is also directed to compositions comprising cells of specific potency for modulating macrophage activation, such as pharmaceutical compositions. The invention is alio directed to methods for evaluating the dose efficacy Of the cells in a patient by assessing the in vim or in vitro activation of macrophages. The invention is also directed to diagnostic methods conducted prior to administering the cells to a subject to he treated, including assays to assess the desired potency of the ceils to be administered^ The invention is further directed to post-treatment diagnostic assays to assess the effect of the cells on a subject being treated. The cells are non-embryonie stem, non-germ ceils that can be characterized by one or more of the following: extended replication in culture and express markers of extended replication, such as teiomerase, markers of piuripoicniiality, and broad differentiation potential, without being teanslanaaed,

SUMMARY OF THE INVENTION

[0002] The invention is broadly directed to methods for imnainotixxMation by modulating macrophage activation.

[0003] The invention is more specifically directed to methods for immunamoduiaiion within the CNS by modulating macrophage activation.

[0004] The invention is also more specifically directed to methods for reducing macrophage neurotoxic activation and/or increasing macrophage neuroproteetive activation in CNS conditions.

[00Qf| The invention is also more specifically directed to methods for reducing antigen presentation by macrophages. Such reduction may result, for example, from reduced expression of one or more genes involved in the antigen presentation. I Ov

Use invention is also more specifically directed 8» methods lor modulating the activation state of macrophages by means of secreted factors. 2015202292 01 May 2015 [OOWf] The invention is |tso more specifically directed to methods for modulating the activation state of macrophages in CNS conditions by secreted factors that increase neuroprotective activation and/or reduce neurotoxic activation. ffMMlSl The invention is also directed to methods for driving macrophages towards a TH2 (neuroproteetive) immune response car away from a ill! (neurotoxic) immune response in CNS injury. (0099] The invention is |||p directed to methods for reducing injury, mclUtMig» but not limited to, acute and chronic conditions in cardiovascular, e.g., acute myocardial infarction; central nervous system injury, e.g., stroke; peripheral vascular disease; pulmonary, e.g,, asthma, ARDS; autoimmune, e.g., rheumatoid arthritis, multiple sclerosis, lupus, sclerodoma; psoriasis; gastrointestinal, e.g., graft-versus-host-disease, Crohn’s disease, diabetes, ulcerative colitis, acute and chronic transplantation rejection, colitis, alveolitis, bronchiolitis obliterans, ileitis, pancreatitis, glomerulonephritis, uveitis, arthritis, hepatitis, dermatitis, and enteritis by modulating macrophage activation.

[0010] The invention is also directed to methods for reducing CNS injury, including, but not limited to, ischemic stroke, multiple sclerosis, Alzheimer’s Disease, ALS, Parkinson’s Disease, hypoxic-ischemia, neonatal hypoxic ischemia, aid traumatic brain or spinal cord injury, by modulating macrophage activation.

[0011] The invention is also directed to methods for reducing CNS injury by increasing neuroprelective activation by macrophages and/or reducing neurotoxic activation.

[0012] Factors that induce neuroprotective activation include, but are not limited to, CCL21 and CXCL10. Factors that suppress neurotoxic activation include, but are not limited to, TGF0, CCL5, NGF, Galectin-1, Pentraxin-3, TGF-β, YEGF, BDNF, HGF, adrenomedullin, and thrombospondin.

[0013] Factors secreted by macrophages during activation include, but are not limited to, iNGS, CD16, CD86, CD64, and CD32, scavenger receptor A, CD163, arginase 1, CD 14, CD206, CD23, and scavenger receptor B.

[0014] Factors sec reted fy macrophages during neurotoxic activation include, but are not liltited to, iNGS, CD 16. CD86, CD64, and CD32. fetors secreted by macrophages during neuroproteetive activation include, but are not limited to, scavenger receptor A, CD 163, arginase I, CD14, CD206, CD23, and scavenger receptor B. 2 [0015] According to this invention providing the above effects can be achieved by administering ceils naturally (i.e., non-recombinantly) expressing and/or secreting one or more modulatory factors or medium conditioned by the cells. Ceils include, but are not United to, cells that are not embryonic stem cells and not gram cels, having some characteristics of embryonic stem cells, but being derived from sms-embryonic tissue, and expressing and/or secreting one or more modulatory factors. The cells may naturally express/secrete one or more modulatory factors (!e„ not genetically or pharmaceutically modified to activate expression and/or secretion). However, natural expresses can be genetically or pharmaceutically modified to increase potency. 2015202292 01 May 2015 [0916] The cells may express pluripoteney markers, such as oet4. They may also express markers associated with extended replicative capacity, such as telomerase. Other characteristics of plmipoteney can include the ability to differentiate into ceil types of more than one germ layer, such as two or three of ectodermal, endodermal, and mesodermal embryonic germ layers, Such cells may or may not be immortalized or transformed in culture, lie ceils may be highly expanded without being transformed and also maintain a normal karyotype. For example, in one embodiment, the non-embryonic stem, non-germ ceils may have undergone at least 10-40 cell doublings in culture, such as 50, 60, or more, wherein the cells arc not transformed and have a normal karyotype, lie cells may differentiate into at least one cell type of each oi two of the endodermal, ectodermal, and inesodramai embryonic lineages and may include differentiation into all three. Further the cells may not be tumorigenic, such as not producing teratomas. If cells are transformed or tumorigemc, and it is desirable to use them for infusion, such ceils may be disabled so they cannot form tumors in vivo, as by treatment that prevents cell proliferation into tumors. Such treatments are well known in the art.

[0017] Cells include, but are not limited to, the following numbered embodiments: [0918] 1. Isolated expanded non-embryonic stem, non-germ cells, the cells having undergone at least 10-40 cell doublings in culture, wherein the cells express oct4, are not transformed, and have a normal karyotype.

[0019] 2. The non-embryonic stem, non-gram cells of 1 above that further express one or more of telomerase, rex-1, mx-1, or sox-2.

[002®] 3. The non-embryonic stem, non-germ cells of 1 above that can differentiate into at least one cell type of at least two of the cndodermal, ectodermal, and mesodermal embryonic lineages.

[0021] 4. The non-embryonic stem, non-germ cells of 3 above that further express one or more of teloanerase, rex-1, rox-1, or sdX-2. 3 £¢¢22} i. The non-embryonic stem, son-genu ceils of 3 above that cars differentiate into at least one cell type of each of the endodermal, ectodermal, and mesodermal embryonic lineages, 2015202292 01 May 2015 P0233 6. The non-embryonic stem, nos-gph ceils of S above that further egress one or more of telomerase, rex-I, fox-I, or sox-2.

[0(124} 7. Isolated expanded non-embryonic stem, non-germ cells that are obtained by culture of non-embryonic, non-germ tissue, the cells having undergone at least 40 cell doublings in culture, wherein the cells are not transformed and have a normal karyotype.

[0025] 8. The non-embryonic stem, non-germ cells of 7 above that express one or more of oct4, tefomeiase, tex-l, rox-1, or sGX-2, [0026} 9. The non-embryonic stem, non-germ cells of 7 above that can differentiate into at least one cell type of at least two of the endodermal, ectodermal, and mesodermal embryonic lineages.

[0027} il§ The non-ejnbryonic stem, non-germ cells of 9 above that express one of more Of Qct4, telomerase, rex-1, rox-1, or soxt2.

[0028] 11. The non-embryonic stem, non-germ cells of 9 above that can differentiate into at least one cell type of each of the endodermal, ectodermal, and mesodermal embryonic lineages, [0029} 12. The non-embryonic stem, non-germ cells of 11 above that express one or more of oct4, telomerase, rex-1, rox-1, or sox-2.

[0030] 13. Isolated expanded non-embryonic stem, non-germ cells, the cells having undergone at least 10-40 cell doublings in culture, wherein the cells express telomerase, are not transformed, and have a normal karyotype.

[0031] 14. The non-embryonic stem, non-germ cells of 13 above that further express one or more of qet4, rex-1, rox-1, or sox-2.

[0032] 15. The non-embryonic stem, non-germ cells of 13 above that can differentiate into at least one ceil type of at least two of the endodermal, ectodermal, and mesodermal embryonic lineages.

[0633] 16. The non-embryonic stem, non-germ cells of 15 above that further express one or mope of oct4, rex-1, rox-1, or sox-2.

[0034] 17. The non-embryonic stem, non-germ cells of 15 above that can differentiate into at least one cell type of each of the endodermal, ectodermal, and mesodermal embryonic lineages. 4 ;ϋ0351 18. The eon-embryonic stem, non-germ cells of 17 above that farther express one or more of oct4, rex-1, rox-1, or sox-2. 2015202292 01 May 2015 |003$] -19. isolated expanded non-embryonic stem» non-germ cells that can differentiate into at least one celt type of at least two of the endodenual, ectodermal, and mesodermal embryonic lineages, said cells having s^ergone at least 10-40 cell doublings in culture.

[ΘΘ37] 20. The non-embryontc stem, non-germ cells of 19 above that express one nr more of oct4, telomerase, rex-1, rox-1, or sox-2. f®®3S3 21. The son-embryonic stem, non-germ cells of 19 above that can differentiate into at least one cell type of each of the endodemsal, ectodermal, and mesodermal embryonic lineages. PM)3§| 22, The non-embryonic stem, non-germ cells of 21 above that express one or more of ocl4, telomerase, rex-1, rox-1, or S0®£; |P#] in one embodiment, the subject is human, |P4lj lie cells that express and/or secrete the modulatory factors can be used in drug discovery methods to screen for an agent that affects the ability of the cells to modulate the activation of macrophages so as to be able achieve any of the a|oye effects. Such agents include, but are not limited to, small organic, molecules, antisense nucleic acids, siRNA, DNA aptamers, peptides, at^bc^es^:itonHamibcNdy::|»^tem$t,cytdEisiest chemokines, and ehemo-attraetants, [0042] Because the effects described in this application can be caused by secreted factors, not only the cells, but also conditioned medium (and extracts thereof) produced from culturing the cells, is useful to achieve the effects. Such medium would contain the secreted factor(s) and, therefore·, could he used instead of the cells or added to the cells. So, where cells can be used, it should be understood that conditioned medium (and extracts thereof) would also be effective and could be substituted or added, [0043] to view of the property of the cells to achieve the above effects, cell banks can be established (containing ceils that are selected for having a desired potency to modulate the activation of macrophages so as to be able to achieve any of the above effects. Accordingly, the invention encompasses assaying cells for the ability to modulate the activation of macrophages and banking the ceils having a desired potency. The bank cp W0W· § source If making a pharmaceutical composition; to: adnunister to & subject Cells can be used:(directly from the bank or expanded prior to use. Especially in the case that the cells are subjected to further expansion, after expansion it Is 5 desirable to validate that the cells stil have the desired potency. Banks allow “off the shelf5 use of cells that are allogeneic to die subject. 2015202292 01 May 2015 10044] Accordingly, the invention also is directed to diagnostic procedures conducted prior to administering the cells to a subject. The pre-diagnostic procedures include assessing the potency of the cells to modulate the activation of macrophages so as to be able to achieve one or more of the above effects. The cells may jje taken from a cell bank an| used directly or expanded prior to administration. In either case, the cells could be assessed for the desired potency. Especially in the case that the ceils are subjected to further expansion, after expansion it is desirable to validate that the cells still have the desired potency. Or toe cells can be derived from toe subject and expanded prior to administration. In this case, as well, the ceils could be assessed for the desired potency prior to administration back to the subject (autologous).

[0045] Although the cells selected for modulation are necessarily assayed during the selection procedure, it may be preferable and prudent to again assay the cells prior to administration to a subject for treatment to confirm that the ceils still modulate macrophage activation at desired levels. This is particularly preferable where the cells have been expanded or have been stored for any length of time, such as in a cell bank, where cells are most likely frozen during storage.

[0046} With respect to methods of treatment with cells that modulate the activation of macrophages, between the original isolation of the cells and the administration to a subject, there may be multiple (i,e., sequential) assays for modulation. This is to confirm that the cells can still modulate the activation of macrophages, at desired levels, after manipulations that occur within this time frame. For example, an assay may be performed after each expansion of the cells. If cells are stoned in a cell bank, they may be assayed after being released from storage. If they are frozen, they may be assayed after thawing. If the cells from a cell bank are expanded, they may be assayed after expansion. Preferably, a portion of the final cell product (i.e., the cell preparation that is physically administered to the subject) may be assayed.

[0047] The invention further includes post-treatment diagnostic assays, fallowing administration of toe cells, to assess efficacy. The diagnostic assays include, but are not limited to, assays for factors expressed and/or secreted by activated macrophages. Factors expressed in the neurotoxic activation state include, but are not limited to, TNP-o, JL-6, and matrix metafioproteases (MMPs). Factors expressed in the neuroprotective activation state may also be assayed. These can be derived from the patient’s serum, blood, tissue, etc.

[0048] The invention is also directed to a method for establishing the dosage of the c|(is by assessing the potency of the cells to modulate the activation of macrophages so as to be able to 6 achieve one or more of the above effects, la this case, the potency would be determined and the dosage adjusted accordingly. 2015202292 01 May 2015 [0049] Potency can be assessed by measuring the degree of macrophage activation in vivo or in vitro by means of macrophage gene expression or by the effects of macrophage activation.

[0050] One may monitor macrophage function (e.g,, activation and presentation) to establish and maintain a proper dosage regimen. One could monitor the function at various levels, such as in vivo by means of circulating secreted factors expressed by activated macrophages. One might also assay macrophages that are derived from the patient in in vitro assays of gene expression or macrophage function;: Thus, the invention is directed to evaluating the dosage efficacy of die cells as an immunomodul ator in the CMS in a patient by assessing and/or monitoring the in vivo activation of macrophage· [0051] The invention is also directed to compositions comprising a population of the cells having a desired potency, and, particularly, desired levels of modulating the activation of macrophages. Such populations may be found as pharmaceutical compositions suitable far administration to a subject and/or in cell banks from which cells can be used directly for administration to a subject or expanded prior to administration, in one embodiment, the cells have enhanced (increased) potency compared to the previous (parent) cell population. Parent cells are as defined herein. Enhancement Can be by selection of natural expresses or by external factors acting on the cells.

[0052] The methods and compositions of the invention are useful for treating any disease involving inflammation. This includes, but is not limited to, acute and chronic conditions in cardiovascular, e,g., acute myocardial infarction; peripheral vascular disease; pulmonary, e.g., asthma, ARDS; autoimmune, e.g., rheumatoid arthritis, multiple sclerosis, lupus, scierodoma; psoriasis; gastrointestinal, e.g., graft-versus-host-disease, Crohn’s disease, diabetes, ulcerative colitis, acute and chronic transplantation rejection, and dermatitis.

[0053] The methods and compositions of the invention are useful for treating any CNS condition involving inflammation, including, but not limited to, ischemic stroke, multiple sclerosis, Alzheimer’s Disease, ALS, Parkinson’s Disease, hypoxic-ischemia, neonatal hypoxic ischemia, and traumatic brain or spinal cord injury.

[0054] In one particular embodiment, the methods and compositions of the invention are used to treat traumatic brain injury or hypoxic ischemia. ? [0§55] For these treatments, one would administer the ceils that modulate the activation of Macrophages. Such ceils could have been assessed for the capacity to modulate the activation cf macrophages and selected for a desired degree of modulation. 2015202292 01 May 2015 [fMl§6] ft is understood, however, that for treatment of any of the above conditions, it may be expedient to usd such cells: that is, one that has been assessed for modulating the activation of macrophages and selected for a desired level of modulation prior to administration for treatment of the condition.

[0057] in a highly specific embodiment, the pathology is traumatic brain injury or spinal cord injury and the cells are non-embryonic stem, non-germ cells that have extended replicative capacity and pluripotentiality and, therefore, express certain markers, e.g., one or more of teiomerase, oct4, rex-1, and rox~J, and have broad differentiation potential, e.g., at least two of ectodermal, endodermsl, and mesodermal cell types, [0058] The inventors have also found, in a hypoxic ischemic injury model, that the numbers of macrophages normally found at the site of ischemic injury were severely reduced in number when cells described herein were administered intravenously to the ischemic subject (Example 2 in this application). The invention, therefore, is also broadly directed to using the cells described herein to reduce the infiltration of macrophages to the site of injury. Accordingly, treatment with the cells described heard§ may prevent macrophages from exiting the site at which they are ncapyslly activated, such as the spleen. In this case, in a clinical settisgi one may administer the cells alter obtaining a baseline by assaying for the presence of macrophages in foe circulation, either directly or by means of a gene normally expressed by the macrophages and, then, following administration of the cells during rreatmetfo monitor one or more times for the presence of foe macrophages m the circulation. One could then determine the optimized dose for treatment that will result in the macrophage not entering the circulation to roach the site of injury.

BRIEF DESCRIPTION OF THE FIGURES

[§059] Figure 1 - Multi Stem® significantly inhibits ischemia-induced markers of immune response within infarct region. qPCR analysis confirms that MuMStem® administration pevefits massive ischemia-induced upregulation of markers of immune response, such as MMP12 (expressed by macrophages). qPCR analysis of different brain regions demonstrates that foe changes in immune marker genes are specific to foe infarct region, [§060] Figure 2 - Schematic summary of in vitro experiments. (A) MAPC added to DRG neuron culture 1 day prior to time-lapse imaging and addition of macrophages. (B) Control unconditioned 8 media added to DRG neuron culture during time-lapse imaging, 30 minutes prior to macrophage addition. (C) MAPG-conditioned media added to DRG neuron culture during time-lapse imaging, 30 minutes prior to macrophage addition. (D) Macrophages that have been pretreated with MAPC-mndittaned media are added to DRG neuron culture during time-lapse imaging. 2015202292 01 May 2015 ΡΟΗ] Figure 3 - (A) qFCR demonstrating MMP-9 transcript levels from macrophages ip the presence or absence of MAfC. #) Western blot of MMP-9 levels to NR8383 macrophages to the presence or absence of spinal cord-derived NG2+ ceils. Background subtracted band densitometry was measured and analyzed by Student’s t-test for statistical significance. Error bars indicate SEM.

[¢062] Figure 4 - Graphical representation of ED-l-r immueoreactivity to the center of the dorsal column crush lesion at 2, 4, and 7 days post injury to animals receiving Vehicle only or MAPC transplants. The conditions. Vehicle control and MAPC treated groups are significantly different jfemyone another, p<0.Ol(two-way ANOVA, F'(l,66>s?,05), Error bars indicate SIM.

DETAILED DESCRIPTION OF THE INVENTION

[00633 It should be understood that tils invention is not limited to the particular methodology, protocols, and reagents, etc,, described herein and, as such, may vary. The terminology used herein is for the purpose of describing particular embodiments only, and Is not intended to limit the scope of the disclosed tovention, which is defined solely by the claims.

[0064] The section headings are used herein for organizational purposes only and are not to be construed as m any way limiting the subject matter described.

[0065] The methods and techniques of the present application are generally performed according to conventional methods welLtoown to the art and as described to various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g,, Sarabrook et aL, Molecular Cloning; A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992), and Harlow and Lane, Antibodies: A Imbomtmy Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990).

DgMtfons [0066] ‘At" or “an" means hereto one or more than oust at least one. Where the plural form is used hereto, it generally includes tile singular.

[0067] A ‘|el bank” is industry nomenclature for cells that have been grown and iored |jr future use. Cells may be stored to aliquots. They caa be used directly out of storage or may be expanded 9 after storage. This is a convenience so that there are “off the shelf5 cells available for administration. The cells may already be stored in a phannaceuticaily-acceptable excipient so they may be directly administered or they may be mixed with an appropriate excipient when they are released from storage. Celia may be frozen or otherwise stored in a form to preserve viability, hi one embodiment of the invention, cell banks are created in which the cells have been selected for enhanced modulation of activation of macrophages. Following release from storage, and prior to administration to the subject, it may be preferable to again assay the cells for potency, i.e., level of modulation of activation of macrophages. This can be done using any of the assays, direct or indirect, described in this application or otherwise known in the art. Then cells having the desired potency can then be administered to the subject for treatment. Banks can he made using cells derived from the individual to be treated (from their pre-natal, tissues such as placenta, umbilical cord blood, or umbilical cord matrix or expanded from the individual at any time after birth) (autologous). Or banks can contain cells for allogeneic uses. 2015202292 01 May 2015 [0068] “Co-administer” means to administer in conjunction wish one another, together, coordinately, including simultaneous or sequential administration of two or more agents.

[0069] “Comprising” means, without olher limitation, including the referent, necessarily, without any qualification or exclusion on what else may he included. For example, “a composition comprising x aiid y” encompasses any composition that contains x and y, no matter what «her components may be present in the composition. Likewise, “a method comprising the step of x” encompasses any method in which x is carried out; whether x is the only step in the method or it is only one of the steps, no matter how many other steps there may be and no matter how simple or complex x is in comparison to them. “Comprised of and similar phrases using words of the root “coogsise” are used herein as synonyms of “comprising” and have the same meaning.

[0070) “Comprised of’ is a synonym of “comprising” (see above). ( 0071] “Conditioned cell culture medium” is a term well-known is the art and refers to medium in which cells have been grown. Herein this means that the cells are grown for a sufficient time to secrete the factors that are effective to achieve any of the results described in this application, [0Θ72] Conditioned cell culture medium refers to medium in which cells have been cultured so as to secrete fetors into the medium. For the purposes of the present invention, cells can be grown through a sufficient number of cell divisions so as to produce effective amounts of such factors so that the medium has the effects, including modulation of activation of macrophages, etc. Cells are removed 11 ;lipm:ire;m®cium by aay of the known methods in the art, including, but not limited to, centrifugation, filtration, immunodepletion (e,g„ via tagged antibodies and magnetic columns), and FACS sorting. 2015202292 01 May 2015 [00733 ‘‘EC cells” were discovered from analysis of a type of cancer called a tefatocarctootm In 1964, researchers noted that a single cell in teratocardnomas could be isolated and remain undifferentiated to culture. Ibis type of stem cell became known as an embryonic carcinoma cell (EC cell) [0074] “Effective amount" generally means an amount which provides the desired local or systemic effect, e.g., effective to ameliorate undesirable effects of inflammation, including modulation of activation of macrophages, etc. For example, an effective amount is an amount sufficient to effectuate a beneficial or desired clinical result. The effective amounts can be provided all at once in a single administration or in fractional amounts that provide the effective amount to several administrations. The precise determination of what would be considered an effective amount may be based on factors individual to each subject, including their size, age, injury, and/or disease or injury being treated, and amount of time since the injury occurred or the disease began. One skilled in the art will be able to determine the effective amount for a given subject based on these considerations which are routine in the art. As used herein, “effective dose" means die same as “effective amount," [0075] '"'Effective route" generally means a route which provides for delivery of an agent to a desired compartment, system, or location. For example, ah effective route is one through which an agent can be tMtohtolSStod to provide at the desired site of action an amount of the agent sufficient to effectuate a beneficial or desired clinical result.

[0976] “Embryonic Stem Cells (ESC)” are well known in the art and have been prepared from many-different mammalian species. Embryonic stem cells are stem cells derived from die inner cell mass of an early stage embryo known as a blastocyst. They are able to differentiate into all derivatives of the three primary germ layers: ectoderm, endoderm, and mesoderm. These include each of the snore than 220 cell types in the adult body. The ES cells can become any tissue in the body, excluding placenta. Only the morula’s cells are totipotent, able to become all tissues and a placenta. Some cells similar to ESCs may be produced by nuclear transfer of a somatic cell nucleus into an enucleated fertilized egg.

[0077| Use of the term “includes” is riot intended to be tom ting, [007¾ “Increase” or “increasing’ with respect to increasing the neuroprotective activation state means to induce it entirely where there was no pre-existing activation or to increase die degree of neuroprotective activation. 11 [Θ079] “Induced pluripotent stem cells (1PSC or IPS cells)” are somatic ceils that haw beat reprogrammed, for example, by introducing exogenous genes that confer on the somatic cell a leas differentiated phenotype. These cells can then be induced to differentiate into less differentiated progeny. IPS cells have been derived using modifications of an approach originally discovered in 2006 (Y&amp;manaka, S. et ah, Cell Stem Cell, 1:39-49 (2007)). For example, in one instance, to create IPS cells, scientists started with skin cells that were then modified by a standard laboratory technique using retroviruses to insert genes into the cellular DNA. hi one instance, the inserted genes were Oct4, Sox2, Lif4, and c-myc, known to act together as natural regulators to keep cells in an embryonic stem cell-like state. These cells have been described in the literature. See, for example, Wernig et aL, /WAS, 105:5856-5861 (2008); Jaenisch et al.. Cell, 132:567-582 (2008); Hanna et al., Cell, 133:250-264 (2008); and Brambrink et al., Cell Stem Cell, 2:151-159 (2008). These references are incorporated by reference for teaching IPSCs and methods for producing them. It is also possible that such cells can be created by specific culture conditions (exposure to specific agents). 2015202292 01 May 2015 [0080] The term ‘Isolated” refers to a cell or cells which are not associated with one or more cells or one or more cellular components that are associated with the cell or cells in vivo. An “enriched population” means a relative increase in numbers of a desired ceil relative to one or more other cell types in vivo or in primary culture.

[0081] However, as used herein, the term “isolated” does not indicate the presence pf only stem cells. Rather, the term “isolated” indicates that the cells are removed from their natural tissue environment and are present at a higher concentration as compared to the normal tissue environment. Accordingly, an “isolated” cell population may further include cell types in addition to stem eels and may include additional Issue components, This also can be expressed in terms of cell doublings, for example. A cel may have undergone 1(½ 20, 30,40 or more doublings in vitro or ex vivo so that it is enriched compared to its original numbers in vivo or in its original tissue environment (e.g., bone maCTOw, peripheral blood, adipose tissue, etc.).

[0082] “MAPC” is an acronym for “multipotent adult progenitor cell.” It refers to a cell that is not an embryonic stem cell or germ cell but has some characteristics of these. MAPC can be characterized in a number of alternative descriptions, each of which conferred novelty to the cells when they were discovered. They can, therefore, be characterized by one or more of those descriptions. First, they have extended replicative capacity in culture without being transformed (tumorigenie) and with a normal karyotype. Second, they may give rise to cell progeny of more than one germ layer, such as two or all three germ layers (i.e., endoderm, mesoderm and ectoderm) upon differentiation. Third, although they are not embryonic stem cells or germ cells, they may express markers of these primitive cell types so that MAPCs may express one or more of Oct 3/4 (i.e., Oct 12 3A), rex-1, andrex-L They may also express one or mote of sox-2 and SSEA-4. Fourth, like a stem cli, they may sdforenew, that is, have an extended replication capacity without being transformed. This means that these cells express telomerase (i.e., have telomerase activity). Accordingly, die cell type that was designated “MAPC” may be characterized by alternative basic characteristics that describe the cell via some of its novel properties. 2015202292 01 May 2015 [0083] The term “adult” in MAPC is Bon-restrictive. It refers to a non-embryonic somatic cell. MAPCs are karyotypically normal and do not form teratomas in vivo* This acronym was first used in U.S, Patent No. 7,015,037 to describe a plnripotent cell isolated from bone matTOW. However, cells with pluripofeniiai markers and/or differentiation potential have been discovered subsequently and, for purposes of ibis invention, may be equivalent to those cells first designated “MAPC.” Essential descriptions of the MAPC type of «ell are provided in the Summary of the Invention above.

[0084} MAPC represents a more primitive progenitor cell population than MSC (YerfaiUie, C.M., Trends EeEiBiol 12:502-8 (2002), Jahagirdar, B.N., et al.s Exp Hematol, 29:543-56 (2001); Reyes, M. and C.M; Verfaillie, Ann N Y Acad $ei, 938:231-233 (2001); Jiang, Y. ei aL, Exp Hematol, 30896-904 (2002); and (Jiang, Y. et al, Ncmm* 413:41-9. ¢2002)). 10085] The term "MuliiStem®” is the trade name for a cell preparation based on the MAPCs of U.S. Patent No. 7,013,037, i.e., a non-embryonic stem, non-germ cell as described above. MnltiSiem® is prepared accixding to cell culture methods disclosed ip tits patent application, particularly, lower oxygen and higher serum.

[0086] This application refers to modulating macrophage activation. With respect to the invention, the modulatory cells cause a decrease in the macrophage activation state Ml and/or increase in M2 macrophages. Thus, the M1:M2 ratio decreases. This can be indicated, as disclosed herein, by changes in the levels of factors that are associated with Ml and M2 macrophages.

[0087] ‘ 'Phannaceutically-acceptable canter” is any phanriaceutically'acceptable medium for the cells used ia the present invention. Such a medium may retain isotonreiiy, cell metabolism, pH, and the like. It is compatible with administration to a subject in vivo, and can be used, therefore, for cell delivery and treatment.

[0088] The term “potency” refers to the ability of the ceils (or conditioned medium from tire cells) to achieve the various effects described in this application. Accordingly, potency refers to the effect at various levels, including, but not limited to, reducing symptoms of inflammation, modulating macrophage, activation, etc. 13 [008¾ ‘‘Primordial embryonic germ cells” (BG or EG cells) cm be cultured and stimulated to produce many less differentiated cell types, 2015202292 01 May 2015 [0090] “Progenitor ceils" are cells produced during differentiation of a siftii ceil that have some* hist not all, of the characteristics of their terminally-differentiated progeny. Defined progenitor cells, such as “cardiac progenitor cells,” are committed to a lineage, but not to a specific or terminally differentiated cell type. The term “progenitor” as used in die acronym “MAPC" does not limit these cells to a particular lineage A progenitor cell can form a progeny cell that is more highly differentiated than the progenitor cell, [0091] The term “reduce” as used herein means to prevent as w|U as decrease, In the contest of treatment, to “reduce” is to either prevent or ameliorate one or more clinical symptoms, A clinical symptom is one (or more) that has or will have, if left untreated, a negative impact on the quality of life (health) (rf the subject. This also applies to the underlying biological effects such as reducing pro-miammatory molecules, activation of macrophages, etc., the end result of which would he to ameliorate the deleterious effects of inflammation, [0092] “Selecting” a cell with a desired level of potency (e.g,, for modulating macrophage activation) can mean identifying (as by assay), isolating, and expanding a cell. This could create a population that has a higher potency than the parent cell population from which the cell was isolated. The “parent” cell population refers to the parent cells from which the selected cells are divided. "Parent” refers to an actual PI |! relationship (i.e., a cell progeny). So if cell X is isolated from a mixed population of eels X and Y, in which X is an expresses and ¥ is not, one would not classify a mere isolate of X as having enhanced expression. But, if a progeny cell of X is a higher expressor, one would classify the progeny cell as having enhanced expresridfe [009$] To select a cell that modulates macrophage activation would include both an assay to determine if there is modulation and would also include obtaining that cell. The cell may naturally modulate macrophage activation in that the cell was not incubated with or exposed to an agent that induces modulation of activation. The cell may not be known to be a modulator of macrophage activation prior to conducting the assay. As modulation could depend cm gene expression and/or secretion, one could also select on the basis of one or more of the genes that cause modulation.

[0094] Selection could be from cells in a tissue. For example, in this case, cells would be isolated from a desired tissue, expanded to culture* selected for modulation of activation of macrophages, and the selected cells further expanded. 14 [0095] Selection could also be from cells ex vivo, such as cells in culture, to this case, one or more of the ceils in culture would be assayed for modulation of activation of macrophages and the cells obtained that modulate the activation of macrophages could be further expanded, 2015202292 01 May 2015 [0096] Cells could also be selected for enhanced modulation of activation of macrophages. In tills case» the cell population from which die enhanced cell is obtained already modulates the activation of macrophages. Enhanced modulation of acti vation of macrophages means a higher average amount {activation of macrophages) per cell than in the parent population.

[0097] The parent population from which the enhanced cell is selected may be substantially homogeneous (the same cell type). One way to obtain such an enhanced cell from this population is to create stogie cells or cell pools and assay those cells or cell pools for modulation of activation of macrophages to obtain clones that naturally modulate the activation of macrophages (as opposed to treating the cells with a modulation of activation of macrophages toducer) and then expanding those cells that are naturally enhanced, [9098] However, cells may be heated with one or more agents that will enhance modulation of activation of macrophages of the endogenous cellular pathways. Thus, substantially homogeneous populations may be treated to enhance modulation, [0099] If the population is hot substantially homogeneous, then, it Is preferable that the parental cell population to be treated contains at least 100 of the modulator cell type in which enhanced modulation is sought, more preferably at least HOCK) of the cells, and still mote preferably, at least 10,()00 of the cells. Following treatment, this sub-population can he recovered from the heterogeneous population by known cell selection techniques and further expanded if desired, [()01001 Thus, desired levels of modulation of activation of macrophages may be those that are higher than the levels to a given preceding population; For example, cells that are put into primary culture from a tissue and expanded and isolated by culture conditions that are not specifically designed to promote modulation of activation of macrophages, may provide a parent population, Such a parent population can be treated to enhance the average modulation of activation of macrophages per ceil or screened for a cell or cells within the population that express higher modulation of activation of macrophages without deliberate treatment. Such cells can be expanded then to provide a population with a higher (desired) expression.

[00101] ‘Self-renewal” refers to the ability to produce replicate daughter Stem1 cells having differentiation potential that is identical to Upset fifom winch they arose, A similar term used in this context is 'proliferation;** 15 2015202292 01 May 2015 [00102] ‘Item cell” meansa cell that can undergo self-renewal <i.e., progeny with the same differentiation potential) and also produce progeny ceils that are more restricted in differentiation potential. Within the context of the invention, a stein cell would also encompass a more differentiated cell that has de-differentiated, for example, by nuclear transfer, by fusion with a more primitive stem cell, by introduction of specific transcription factors, or by culture under specific conditions. See, for example, Wilmut et al., Nature* 385:810-813 (1997); Ying el aL, Nature, 416:545-548 (2002); Guan et al., Nature, 440:1199-1203 (2006); Takahashi et al., Cell, 126:663-676 (2006); Okita ct al., Nature, 448:313-317 (2007); and Takahashi et al., Cell, 131:861-872 (2007).

[001031 Dedifferentiation may also be caused by the administration of certain compounds or exposure to a physical environment in vitro or in vivo that would cause the dediffereotiation. Stem cells also may be derived ferns abnormal tissue, such as a teratocarcmoma and some other sources such as embryoid bodies (although these can be considered embryonic stem cells in that they are derived from embryonic tissue, although not directly from the inner cell mass). Stem «tells may also be produced by Introducing genes associated with stem cell function into a non-stem cell, such as an induced phiripoteni stem cel.

[001041 “Subject” means a vertebrate, such as a mammal, such as a human. Mammals include* but are not limited to, humans, dogs, eats, horses, cows, aodpigs.

[00105] The term “therapeutically effective amount” refers to fee amount of an agent determined to produce any therapeutic response in a mammal. For example, effective anti-inflammatory therapeutic agents may prolong the survivability of the patient, and/or inhibit overt clinical symptoms. Treatments that are therapeutically effective within the meaning of the term as used herein, include treatments that improve a subject's quality of life even if they do not improve fee disease outcome per se. Such therapeutically effective amounts are readily ascertained by one of ordinary skill in the art. Thus, to “treat” means to deliver such an amount. Thus, treating can prevent or ameliorate any pathological symptoms of inflammation. 100106] “Treat,” ‘‘treating,’’ or “treatment" are used broadly in relation to the invention and each such term encompasses, among others; preventing, ameliorating, inhibiting, or curing a deficiency, dysfunction, disease, or other deleterious process, including those that interfere Wife and/or result from a therapy, 8» undesirabte inflammatory component, within fee context of fee invention, refers to inflammation feat includes clinically detrimental macrophage activation as a component.

[00107] “Validate” means to confirm. In the context of the invention, one confirms that a cell is an expressor with a desired potency, This is so feat one can then use that cell (in treatment, banking, drug screening, etc.) with a reasonable expectation of efficacy. Accordingly, to validate means to confirm that the cells, having been originally found to have/established as having modulatory activity, in feet, retain that activity. Thus, validation is a verification event in a two-event process involving the original determination and the foUow-up determination. The second event is referred to herein as “validation.” 2015202292 01 May 2015 gimStis [00108] He present invention can be practiced, preferably, using stem cells Of vertebrate species, such as humans, non-human primates, domestic animals, livestock, and other non-human mammals, These include, but are not limited to, those cells described below. fOOlOf] The most well studied stem cell is the embryonic stem cel (ESC) as it has unlimited self-renewal and muMpoient differentiation potential. These cells are derived from the inner cell mass of the blastocyst or can be derived from the primordial germ cells of a post-iniplantaiion embryo (embryonal germ cells or EG cells). ES and EG cells have been derived, first from mouse, and later, from many different animals, and more recently, also from non-human primates and humans. When introduced into mouse blastocysts or blastocysts of other animals, ESCs can contribute to all tissues of the animal, ES and EG cells can be identified by positive staining with antibodies against SSEA1 (mouse) and SSEA4 (human). See, for example, U.S. Patent Nos, 5,453,357; 5,656,479; 5,670,372; 5,843,780; 5,874,301; 5,914,268; 6,110,739 6,190,910; 6,200,806; 6,432,711; 6,436,701, 6,500,668; 6,703,279; 6,875,607; 7,029,913; 7,112,437; 7,145,057; 7,153,684; and 7,294,508, each of which is incorporated by reference for teaching embryonic stem cells and methods of making and expanding them. Accordingly, ESCs Mid methods for isolating and expanding them are well-known in the art.

[00110] A number of transcription factors and exogenous cytokines have been identified that influence the potency status of embryonic stem cells in vivo. The first transcription factor to be described that is involved in stem cell pluripotency is Oct4. Oct4 belongs to the POU (Pit-Oct-Unc) family of transcription factors and is a DNA binding protein that is able to activate the transcription of genes, containing an oeiameric sequence called “the oclamer motif1 within the promoter or enhancer region. Oct4 is expressed at the moment of the cleavage stage of the fertilized zygote until the egg cylinder is formed. The function of Oct3/4 is to repress differentiation inducing genes (i.e., FoxaD3, hCG) and to activate genes promoting pluripotency (FGF4, Util, Rexl). Sox2, a member of the high mobility group (HMG) box transcription factors, cooperates with Oct4 to activate transcription of genes expressed in the inner cell mass. It is essential that Oct3/4 expression in embryonic stem cells is maintained between certain levels. Overexpression or downreguiation of >50% of Oct4 expression level will alter embryonic stem cell fate, with the formation of primitive endoderm/mesoderm or 17 ih^heciodetm,: respectively. in vivo, Oct4 deficient enifeyos develop to the blastocyst stage, but the inner cell mass cells are not pluripotent. Instead they differentiate along the extraembryonic trophoblast lineage. Sall4, a mammalian Spalt transcription factor, is an upstream regulator of Qct4, and is therefore important to maintain appropriate levels of Ocr4 during early phases of embryology. When Sall4 levels fall below a certain threshold, trophectodermal ceils will expand ectopically into the inner cell mass. Another transcription factor required to piuripotency is Nanog, named after a Celtic tribe “Tir Nan Og”: the land of the ever young. In vivo, Nanog is expressed from the stage of the compacted morula, is subsequently defined to the inner cell mass, and is down-regulated by the implantation stage. Downregulation of Nanog may be important to avoid an uncontrolled expansion of pluripotent cells and to allow multilineage differentiation during gastrulation, Nanog null embryos, isolated at day 5.5, consist of a disorganized blastocyst, mainly containing extraembryonic endoderm and no discernable epibiast. 2015202292 01 May 2015

Non-Emhrvonic Stem Ceils [001111 Stem cells have been identified in most tissues. Perhaps the best characterized is the hematopoietic stem cell (HSC). HSCs are mesoderm-derived cells that can be purified using cell surface markers and functional characteristics. They have been isolated from bone marrow, peripteral blood, cord blood, fetal liver, and yolk sac. They initiate hematopoiesis and generate multiple hematopoietic lineages. When transplanted into lethaliy-irradiated animals, they can repopulate the eryihroid neutropiui -macrophage, megakaryocyte, and lymphoid hematopoietic cell pool. They can also be induced to undergo some self-renewal cell division. See, for example, U S. Patent Nos. 5,635,387. 5,460,964; 5,677,136; 5,750,397; 5,681,599; and 5,716,827. U.S. Patent No. 5,192,553 reports methods for isolating human neonatal or fetal hematopoietic stem or progenitor cells. U,S. Patent No. 5,716,827 reports human hematopoietic cells that are Thy-1+ progenitors, and appropriate growth media to regenerate them in vitro, lij. Patent No. 5,635,387 reports a method and device for culturing human hematopoietic cells and their precursors. U.S. Patent No. 6,015,554 describes a method of reconstituting human lymphoid and dendritic cells. Accordingly, HSCs and methods for isolating and expanding them are well-known in the art.

[06112] Another stem cell that is well-known in the art is the neural stem cell (NSC). These cells can proliferate in vivo and continuously regenerate at least some neuronal cells. When cultured ex vivo, neural stem cells can be induced to proliferate as well as differentiate into different types of neurons and glial cells. When transplanted into the brain, neural stem cells can engraft and generate neural and glial ceils. See, for example, Gage F.H., Science, 287:1433-1438 (2000), Svendsen S.N. e? al. Brain Pathology, 9:499-513 (1999), and Okabe S. et at., Meek Development, 59:89-102 (1996). U.S. Patent No. 5,851,832 reports multipotent neural stem cells obtained from brain tissue. U.S. 18

Patent No. 5,766,948 reports producing neuroblasts from newborn cerebral hemispheres, U.S. Patent Nos. 5,564,183 and 5,849,553 report the use of mammalian neural crest stem cells, U,S. Patent No. 6,040,180 reports in vitro generation pf differentiated neurons from cultures of mammalian nmltipotential (3NS stem cells, WO 98/50526 and WO 99/01159 report generation and isolation of neuroepithelial Stem cells, oligodendrocyte-astrocyte precursors, and lineage-restricted neuronal precursors, U.S. Patent No. 5,968,829 reports neural stem cells obtained from embryonic fore brain. Accordingly, neural stem cells and methods for making and expanding them are well-known in the 2015202292 01 May 2015 [00113] Another stem cell that has been studied extensively in the art is the mesenchymal stem cell (MSC). MSCs are derived from the embryonal mesoderm and can be isolated from many sources, including adult bone marrow, peripheral blood, fat, placenta; and umbilical blood, among others. MSCs can differentiate into many mesodermal tissues, including muscle, bone, cartilage, fat, and tendon. There is considerable literature on these cells. See, for example, U.S, Patent Nos. 5,486,389; 5,827,735; 5,811,094; 5,736,396; 5,837,539; 5,837,670; and 5,827,740. See also Pittenger, M. et aJ., Science, 284:143-147 (1999).

[00114] Another example of an adult stem cell is adipose-derived adult stem cells (ADSCs) which have been isolated from fat, typically by liposuction followed by release of the ADSCs using collagenase. ADSCs are similar in many ways to MSCs derived from bone marrow, except that it is possible to isolate many more cells from fat. These cells have been reported to differentiate into bone, fat, muscle, cartilage, and neurons. A method of isolation has been described in U.S, 2005/0153442.

[00115] Ollier stem cells that are known in the art include gastrointestinal stem cells, epidermal stem cells, and hepatic stem cells, which have also been termed “oval cells” (Potten, C, et &amp;L, Trans R Soc bond B Biol Sci, 353:821-830 (1998), Watt, F., Trans R Soc Land B Biol Sci, 353:831 (1997);

Alison et aL, Hepatology, 29:678-683 (1998).

[00116] Other nan-embryonic cells reported to be capable of differentiating into cell types pf more than one embryonic germ layer include, but are not limited to, cells from, umbilical cord blood (see U.S. Publication No, 2002/0164794); placenta (see U.S. Publication No. 2003/0181269, umbilical cord matrix (Mitchell, K.E. et aL, Stem Cells, 21:50-60 (2003», small embryonic-like stem cells (Kuda, M. et aL, J Physiol Pharmacol, 57 Suppl 5:5-18 (2(1)6)), amniotic fluid stem cells (Atala, A., J Tissue Regen Med, 1:83-96 (2007)), skin-derived precursors (Toma et aL, Nat Cell Biol, 3:778-784 (2001)), and bone marrow (see U.S. Publication Nos. 2003/0059414 and 2006/0147246), each of which is incorporated by reference for teaching these cells. 19

StetMeg ofISBSmlBi Somatic Celia 2015202292 01 May 2015 E00117J Several different strategies such as nuclear transplantation, cellular fusion, and culture induced reprajpnn^ have been employed to induce fie conversion of differentiated cells into an embryonic state. Nuclear transfer involves the injection of a somatic nucleus into an enucleated oocyte, which, upon transfer into a surrogate mother, can give rise to a clone (“reproductive cloning”), or, upon explanation in culture, can give rise to genetically matched embryonic stem (ES) ceils (“somatic cell nuclear transfer,” SCNT). Cell fusion of somatic cells with ES cells results in the generation of hybrids that show all features of pluripotent ES cells. Explantation of somatic cells in culture selects for immortal cell lines that may be pluripotent or multipoient At present, spermatogonial stem cells are the only source of pluripotent cells that can be derived from postnatal animals. Transduction of somatic cells with defined factors can initiate reprogramming to a pluripotent state. These experimental approaches have been extensively reviewed (Hochedlinger and Jaemsch, Nature, 441:1061-1067 (2QQ6) and Yamanaka, S,, Ceil Stem Celt, 1:39-49 (2007)).

Nuclear Transfer POOIISJ Nuclear transplantation (NT), also referred to US somatic cell nuclear transfer (SCNT), denotes the introduction of a nucleus from a donor somatic cell into an enucleated ogocyte to generate a cloned animal such as Dolly the sheep (Wilmat et aL, Nature, 385:810-813 (1997). The generation of live animals by NT demonstrated that the epigenetic state of somatic cells, including that of terminally differentiated ceils, while stable, is not irreversible fixed but can be reprogrammed to an embryonic state that is capable of directing development of a new organism. In addition to providing an exciting experimental approach for elucidating the basic epigenetic mechanisms involved in embryonic development and disease, nuclear cloning technology is of potential interest for patient-specific transplantation medicine.

Fusion of Somatic Cells and Embryonic Stem Cells [00119] Epigenetic reprogramming of somatic nuclei to an undifferentiated state has been demonstrated in murine hybrids produced by fusion of embryonic cells with somatic cells. Hybrids between various somatic cells and embryonic carcinoma cells (Bolter, D,> Nat Rev Genet, 7:319-327 (2006), embryonic gem (EG), or ES ceils (Zwaka and Thomson, Development, 132:227-233 (2005)) share many features with the parental embryonic cells, indicating that the pluripotent phenotype is dominant in such fusion products. As with mouse (Tada et aL, Curr Biol, 11:1553-1558 (2001)), human ES cells have the potential to reprogram somatic nuclei afro- fusion (Cowan et al„ Science, 309:1369-1373(2005»; Yu et aL, Science, 318:1917-1920 (2006)), Activation cf silent pluripotency markers such as Oct4 or reactivation of the inactive somatic X chromosome provided molecular 20 evidence for reprogramming of the somatic genome in the hybrid ceils. It has been suggested that DNA replication is essential fen- the activation of pluripotency markers, which is first observed 2 days after fusion (Do and Scholer, Stem Cells, 22:941-949 (2004)}, and that forced overexpression of 2015202292 01 May 2015

Nandi in ES ceils promotes pluripotency when fused with neural stem ceils (Silva et aL, Nature, 441:9974001 (2006)).

Culture-Induced Reprogammins [00120} Pluripotent cells have been derived from embryonic sources such as hlastomeres and the inn» cell mass (ICM) of the blastocyst (ES cells), the epiblast (EpiSC cells), primordial germ cells (EG cells), and postnatal spemiatogonial stem cells (“maGSCsm” “ES-like” cells). The following pluripotent cells, along with their dona· cell/fissue is as follows: parthogenetic ES ceils are derived from murine oocytes (Narasimba et aL, Curr Biol, 7:881-884 (1997)}; embryonic stem cells have been derived from blastomeres (Wakayama et aL, Stem Ceils, 25:986-993 (2007)); inner cell mass cells (source not applicable) (Eggan et aL, Nature, 428:44-49 (2004)); embryonic germ and embryonal carcinoma cells have been derived from primordial germ cells (Matsui et aL, Cell, 70:841-847 (1992)); GMCS, maSSC, and MASC have been derived from spermatogomal stem cells (Guan et al., Nature, 440:1199-1203 (2006); Kanatsu-Shinohara et al., Cell, 119:1001-1012 (2004); and Seandel et ai„ Nature, 449:346-330 (2007)); EpiSC cells are derived from epiblasts (Brons et al.. Nature, 448:191-195 (2007); fesar et al,, Nature, 448:196-199(2007)); parthogenetic ES cells have been derived from human oocytes (Gibelli et al., Science, 295L819 (2002); Revazova et al., Cloning Stem Cette, 9:432-449 (2007)); human ES cells have been derived from human blastocysts (Thomson et al,* Smeme, 282:11454 147 (1998)); MAPC haw been derived from bone marrow (Jiang ct ai., Natmm 418:4149 (2002); Phinuey and Prockop, Stem Cells, 25:2896-2902 (2007)); cord blood ceils (derived from cord Wood) (van de Ven et ai., Exp Hematol, 35:1753-1765 (2007)}; neurosphere derived cells derived from Bernal cell (Clarke et al.. Science* 288:1660-1663 (2000)). Donor cells from the gmm cell lineage such as PGCs or spennatogonial stem cells are known to be unipotent in vivo, but it has been shown that pluripotent ES-iike cells (Kanatsu-Shinohara et al.. Cell, 119:1001-1012 (2004) or maGSCs (Guan et al,, Nature, 440:11994203 (2006), can be isolated aft» prolonged in vitro culture. While most of these pluripotent cell types were capable of in vitro differentiation and teratoma formation, only ES, EG, EC, and the spermatogonia! stem cell-derived maGCSs or ES-iike cells were pluripotent by more stringent criteria, as they were able to form postnatal chimeras and contribute to the germline. Recently, multipotent adult spermatogomal stem cells (MASCs) were derived from testicular spermatogonia! stem cells of adult mice, and these cells had an expression profile different from that of ES cells (Seandel et al., Nature, 449:346-350 (2007)) but similar to EpiSC ceils, which were derived from the epiblast of postimplanration mouse embryos (Brons et al., Nature, 448:191-195 (2007); Tesar et al., Nature, 448:196-199 (2007)). 21 2015202292 01 May 2015 [00121} Takafaashi and Yamanaka have reported reprogramming somatic ceils back to an ES-like state (Takahashi and Yamanaka, Cell, 126:663-676 (2006)). They successfully reprogrammed mouse embryonic fibroblasts (MEFs) and adult fibroblasts to pluripotent ES-like cells after virai-rnediated transduction of the four transcription factors Oct4„ Sox2, c-myc, and Klf4 followed by selection for activation of the Oct4 target gene Fox 15 (Figure 2A). Cells that had activated Fbxl5 were coined IPS (induced pluripotent stem) cells and were shown to be pluripotent by their ability to form teratomas, although the were unable to generate live chimeras. This pluripotent state was dependent on the continuous viral expression of the transduced Qel4 and Sox2 genes, whereas the endogenous Oct4 and Nanog genes were either not expressed or were expressed at a lower level than in ES cells, and their respective promoters were found to be largely methylated. This is consistent with the conclusion that the Fbxl5-iPS cells did not correspond to ES cells but may have represented an incomplete state of reprogramming. While genetic experiments had established that Oct.4 and Sox2 are essential for piuripotency (Chambers and Smith, Oncogene, 23:7150-7160 (2004); Ivanona et al., Nature, 442:5330538 (2006); Masui et al., Nat Ceil Biol, 9:625-635 (2007)), the role of the two oncogenes c-myc and Klf4 in reprogramming is less clear. Some of these oncogenes may, in fact, be dispensable for reprogramming, as both mouse and human iPS cells have been obtains! in toe absence of c-myc transduction, although with low efficiency (Nakagawa et at., Nat Biotechnol, 26:191-106 (2008); Weming et al., Nature, 448:318-324 (2008); Yu et al.. Science, 318:1917-1920 (2007)).

MAPC

[00122} Human MAPCs are described in U.S. Patent 7,015,037. MAPCs have been identified in other mammals. Murine MAPCs, for example, are also described in U.S, Patent 7,015,037. Sat MAPCs are also described in U S. Patent No. 7,838,289.

[00123] These references me incorporated by reference for describing MAPCs first isolated by Catherine Verfaillie.

[00124} Methods of MAPC Isolation are known in the art. See, for exasnpie, U S. Patent 7,015,037, and these methods, along with the characterization (phenotype) of MAPCs, arc incorporated herein by reference; MAKS» can be isolated from multiple sources, including, but not limited to, bone marrow, placenta, umbilical cord and cord blood, muscle, him, liver, spinal cord, blood or skin. It is, therefore, possible to obtain bone marrow aspirates, brain or liver biopsies, and other organs, and isolate the cells using positive or negative selection techniques available to these of skill is the art, 22 relying upon the genes tip are expressed (or not expressed) ift these ceils (e.g., by ftmetioBai or morphological assays such as those disclosed in the above-referenced applications, which have been ineofpsaied herein toy reference). 2015202292 01 May 2015 [00125] MAPCs have also been obtained my modified methods described in Breyer et A, Ey^emmml34:1596-1601 (2006) and Subramanian et al, Cellular Programming and R^^pammiag: Methods and Protocols; S. Ding (ed.), Methods in Molecular Biology* 636:55-78 (2010), incorpsrated by reference for these methods.

[06126} MAPCs do not express the common leukocyte antigen CD45 or erythrobiast specific giycophorin-A (Gly-A). The mixed poplation of cells was subjected to a Picoll Hypaque separation. The cells were then subjected to negative selection using anti-CD45 and anti-Gly-A antibodies, depleting the population of CD45+ and. Giy-A+ cells, and the remaining approximately 0.1% of marrow mononuclear cells were thee recovered. Cells could also be plated in fibrunectin-coated wells apd cultured as described below for 2-4 weeks to deplete the ceils of CD45* and Gly-A+ cells. In cultures of adherent bone marrow cells, many adherent stromal cells undergo replicative senescence around cell doubling 30 and a more homogenous population of cells continues to expand and maintains long telomeres.

[00127] Alternatively, positive selection could be used to isolate cells via a combination of cell-specific markers. Both positive and negative selection techniques ate available to those of skjij in the art, and numerous monoclonal and polyclonal antibodies suitable for negative selection purposes are also available in the art (see, tor example, Leukocyte Typing V, Sehlossman, et al., Eds. (1995) Oxford University Press) and are commercially available from a number of sources.

[00128] Techniques for mammalian cell separation from a mixture pf cell populations have also been described by Schwartz, et aL, in Ό. S. Patent Mo. 5,759,793 (magnetic separation), Basch et al., 1983 (iinmunoaffinity chromatography), and Wysocki and Sato, 1978 (fluorescence-activated cell sorting).

[00129} Cells may be cultured in low-serum or serum-free culture medium. Serum-free medium used to culture MAPCs is described in U.S. Patent 7,015,037. Commonly-used growth factors include but are not limited to platelet-derived growth factor and epidermal growth factor. See, for example, U.S, Patent Nos. 7,169,610; 7,109,032; 7,037,721; 6,617,161; 6,617,159; 6,372,21G;6,224,860; 6,037,174; 5,908,782; 5,766,951; 5,397,706; and 4,657,866; all incorporated by reference for teaching growing ceils in serum-free medium. 23

Additional (Mftsre Methods 2015202292 01 May 2015 [00130] In additional experiments the density at which MAPCs are cultured can vary from about 100 cells/cm2 or about i50cetts/cm2 to about 10,000 cells/eor, including about 200 ceils/cm2 to about 1500 ceils/cm‘ to about 2000 ceils/enf. The density can vary between species» Additionally, optimal density can vary depending on culture conditions and source of cells. It is within the sMll of the ordinary artisan to determine the optimal density for a given set of culture conditions and ceils.

[00131] Also, effective atmospheric oxygen concentrations of less than about 10%, including about 1-5% and, especially, 3-5%, can be used at any time (hiring the isolation, growth and differentiation of MAPCs in culture.

[00132] Cells may be cultured under various serum concentrations, e.g., about 2-20%. Fetal bovine sepmi may he used. Higher serum may he used in combination with lower oxygen tensions, for example, about 15-20%. Cells need not be selected prior to adherence to culture dishes. For example, after a Ficoll gradient, cells can be directly plated, e,g., 250,000-500,GOG/cin2. Adherent colonies can be picked, possibly pooled, and expanded.

[10133] In one embodiment used in the experimental procedures in the Examples, high serum (around 15-20%) and low oxygen (around 3-5%) conditions were used for the cell culture. Specifically, adherent ceils from colonies were plated and passaged at densities pf about 1700-2300 ceils/em2 in 18% serum and 3% oxygen (with EMI and EOF).

[00134] In an embodiment specific for MAPCs, supplements are cellular factors or components that allow MAPCs to retain the ability to differentiate into cell types of more than one embryonic lineage, such as all three lineages. This may be indicated by the expression of specific markers of the undifferentiated state, such as Oct 3/4 (Oct 3A) and/or markers of high expansion capacity, such as tefomerim

QlUXMmxe [00135] For all the components listed below. See U.S. 7,015,037, which is incorporated by reference for teaching these components.

[0Q13frj In general, cells useful for die invention can be maintained and expanded in culture medium 1¾¾ is available and well-known in the art. Also contemplated is supplementation of cell culture medium vritii mammalian sept. Additional supplements can also be used advantageously to supply the cells with the necessary trace elements for optimal growth and expansion. Hormones can also be advantageously used in ceil culture. Lipids and lipid earners can also be used to supplement cell 24 culture media, depending on the type of cell and the fate of the differentiated cell. Also contemplated is the use of feeder cell layers. 2015202292 01 May 2015 [00137] Ceils in culture can be maintained either in suspension or attached to a solid support, such as extracellular matrix components. Stem cells often require additional factors that encourage their attachment to a solid support, such as type I and type Π collagen, chondroitin sulfate, fibronectin, “superfibronectin” and Obroneetin-Iike polymers, gelatin, poly-D and poiy-L-lysine, thrombospondin and vitronectin. One embodiment of the present invention utilizes fibronectin. See, for example, dhashi et aL, Nature Medicine, 13:880*885 (2007); Maisumoto et a!., J Bioscience and Bioengineering, 105:350-354 (2008); Kirouac et aL, CMl Stem Cell 3:369-381 (2008); Chua et al„ Bimmerials, 26:2537-2547 (2005); Drobinskaya et al., Stem Cells, 26:2245-2256 (2008); Dvir-Ginzberg et aL, FASEB J, 22:1440-1449 (2008); Turner et ai.s J Biomed Mater Res Part B: Appi Biomater, 82B: 156-168 (2007); and Miyazawa et al„ Journal of Gastroenterology and Hepatology, 22:1959-1964(2007)), [0013S] Cells may also be grown in “3D” (aggregated) cultures. An example is PCT/US2009/31528, filed January 21,2009.

[Θ0139] Once established in culture, ceils can be used fresh or frozen and stored as frozen stocks, using, for example, DMEM with 40% PCS and 10% DMSO. Other methods for preparing frozen stocks for cultured cells are also available fe> those of skill in the art.

[00140] U.S. 7,015,037 is incorporated by reference for teaching pharmaceutical formulations, In certain embodiments, the cell populations are present within a eotnposition adapted for and suitable for delivery, Le., physiologically compatible.

[00141] In some embodiments the purity of the cells (or conditioned medium) for administration to a subject is about 100% (substantially homogeneous). In other embodiments it is 95% to 100%, In some embodiments it is 85% to 95%. Particularly, in the case of admixtures with other ceils, the percentage can be about 10%-15%, 15%-20%, 20%-25%, 25%-30%, 30%-35%. 35%-4Q%, 40%. 45%, 45%-50%, 60%-70%, 70%-80%, 80%-90%, or 90%-95%. Or isolation/purily can be expressed in terms of cell doublings where the cells have undergone, for example, 10-20,20-30, 30-40,40-50 or more cell doublings.

[00142] The choice of formulation for administering the cells for a given application will depend on a variety of factors. Prominent among these wili be the species of subject, the nature of the condition being treated, its state and distribution in the subject, the nature of other therapies and agents that are 25 being administered, the optimum route for administration, survivability via the route, the dosing regimen, and other factors that will be apparent to those skilled in the art. For instance, the choice of suitable earners and other additives will depend on the exact route of administration and the nature of the particular dosage form. 2015202292 01 May 2015 (MMij Final formulations of the aqueous suspension of ceils/medium wilt typically involve adjusting the ionic strength of the suspension to isotonicity about 0.1 to Q2) and to physiological pH (i.e., about pH 6.8 to IS). The final formulation will also typically contain a fluid lubricant.

[00144} In some embodiments, ceils/medium are formulated in a unit dosage injectable form, such as a solution, suspension, or emulsion. Pharmaceutical formulations suitable for injection of ceils/medium typically are sterile aqueous solutions and dispersions. Carriers far injectable formulations can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), and suitable mixtures thereof.

[00145} Tie skilled artisan can readily determine the amount of ceils and optional additives, vehicles, and/or carrier in compositions to be administered in methods of the invention. TypicaUyi any additives (in addition to the cells) are present in an amount of 0.001 to 50 wt % in solution, such as in phosphate buffered saline. The active ingredient is present in the order of micrograxns to mill!grains, such as about 0.0001 to about 5 wt %, preferably about 0.0001 to about 1 wt %, most preferably about 0.0001 to about 0.05 wt % or about 0.001 to about 20 wt %, preferably about 0.01 to about 10 wt %, and most preferably about 0.05 to about 5 wt %.

[00146} In some embodiments cells are encapsulated for administration, particularly where encapsulation enhances the effectiveness of the therapy, or provides advantages in handling and/or shelf life. Cells may be encapsulated by membranes, as Well as capsules, p||r tp Implantation. It is contemplated that any of the many methods of cell encapsulation available may be employed.

[00147} A wide variety of materials may be used in various embodiments for microencapsnlation of cells, Such materials include, for example, polymer capsules. aiginate-poly-L-lysme-alginate mierocapsules, barium poly-L-iysine alginate capsules, barium alginate capsules, polyacr/loriitrile/pcilyvinyichloride (PAN/PVC) hollow fibers, and polyethersulfone (PES) hollow fibers [001483 Techniques for rrdcroencapsu lation of cells that may he used for admimstratkm of cels are known to those of skill in the art and are described, for example, in Chang, P., et al, 1999; Matthew, mm., et al., 1991; Yanagi, K., et al, 1989; Cas Z.H., et al, I98| Chang, T.M., 1992 and in U.S. 26

Patent No. 5,639,275 (which, for example, describes a biocompatible capsule for long-term maintenance of cells that stably express biologically active molecules. Additional methods of encapsulation are in European Patent Publication No. 301,777 and U.S. Pat. Nos. 4,353,888; 4^44,933; 4,749,620; 4,814,274; 5,084,350; 5,089,272; 5,578,442; 5,639,275; and 5,676,943, All of the foregoing are incorporated herein by reference in parts pertinent to encapsulation of cells. 2015202292 01 May 2015 [00149] Certain embodiments incorporate cells into a polymer, such as a biopolymer or synthetic polymer. Examples of biopolymeas include, but are not limited to, ftbroneciin, fibrin, fibrinogen, thrombin, collagen, and proteoglycans. Other factors, such as the cytokines discussed above, can also be incorporated into the polymer. In other embodiments of the invention, cells may be incorporated in the interstices of a three-dimensional gel. A large polymer or gel, typically, will be surgically implanted. A polymer or gel that can be formulated in small enough particles or liters can be administered by other common, more convenient, non-surgical routes.

[Θ015Θ] The dosage of the cells will vary within wide limits and will be fitted to the individual requirements in each particular case. In general, hi the case of parenteral administration, it is customary to administer from about 0,01 to about 20 million ce!ls/kg of recipient body weight The number of cells will vary depending on the weight and condition of the recipient, the number or frequency of administrations, and other variables known to those of skill in the art. The cells can be administered by a route that is suitable for the tissue or organ. For example, they can be administered systemically, i.e., parenterally, by intravenous administration, or can be targeted to a particular time or organ; they can be administrated via subcutaneous administration or by administration into specific desired tissues, Ιϋ5ϊ] The cells can be suspended in an appropriate excipient in a concentration from about 0.01 to about 5xlG6 ceUs/mt Suitable excipients for injection solutions are those that are biologically and physiologically compatible with the cells and with the recipient, such as buffered saline solution or other suitable excipients. The composition for administration can be formulated, produced, and stored according to standard methods complying with proper sterility and stability.

Techniques for administration into these tissues are known in the art. For example, intra-bone marrow injections can involve injecting cells directly into the bone marrow cavity typically of the posterior iliac crest but may include other sites in the iliac crest, femur, tibia, humerus, or ulna; splenic injections could involve radiographic guided injections into the spleen or surgical exposure of the spleen via laparoscopic or laparotomy; Payer’s patches, GALT, or BALT injections could require laparotomy or laparoscopic injection procedures. 27

Dmm 2015202292 01 May 2015 [00153} Doses for humans or other mammals can be determined without undue experimentation by the skilled artisan, from this disclosure, the documents cited herein, and the knowledge in the art. The dose of cells/medium appropriate to be used in accordance with various embodiments of the invention will depend on numerous factors. The parameters that will determine optimal doses to be administered for primary and adjunctive therapy generally will include some or all of the following: the disease being treated and its stage; the species of the subject, their health, gender, age, weight, and metabolic rate; the subject's immunocompetence; other therapies being administered; and expected potential complications from the subject's history or genotype. Use parameters may also include; whether the cells are syngeneic, autologous, allogeneic, or xenogeneic; their potency (specific activity); the site and/or distribution that must be targeted for the cells/medium to be effective; and such characteristics of the site such as accessibility to cells/medium and/or engraftment of ceils. Additional parameters include co-administration with other factors (such as growth factors and cytokines). The optimal dose in a given situation also will take into consideration the way in which the cells/medium are formulated, the way they are administered, and the degree to which the cells/medium will be localized at the target sites following administration.

[00154} The optimal dose Of celts Could be in the range Of doses used for autologous, mononuclear |pne marrow transplantation. 1% fairly pure preparations of cells, optimal doses is various embodiments will range from 104 to 10s cells/kg of recipient mass per administration, in some embodiments the optimal dose per administration will be between 105 ίο 107 cells/kg. In many embodiments the optimal dose per administration will be 5 x ip® to 5 x 10s cells/kg, Ify way of reference, higher doses in the foregoing are analogous to the doses of nucleated cells used in autologous mononuclear bone marrow transplantation. Some of the lower doses are analogous to the number of CD34+ ceils/kg used in autologous mononuclear bone marrow transplantation.

[00155} Is various embodiments, cells/medium may be administered in an initial dose, and thereafter maintained by further administration. Cells/medium may be administered by one method initially, and thereafter administered by the same method or one or more different methods. The levels can be maintained by the ongoing administration of the cells/medium. Various embodiments administer the cells/medium either initially or to maintain their level in the subject or both by intravenous injection. In a variety of embodiments, other forms of administration are used, dependent upon the patient's condition and other factors, discussed elsewhere herein.

[00156] Cells/medium may be administered: in many frequencies over s wide range s£ times. Generally lengths of treatment will be proportional to the length of the disease process,, the 28 effectiveness of the therapies being applied, and the condition and response of the subject being treated. 2015202292 01 May 2015

Uses [00157] Administering the cells is useful to reduce undesirable inflammation in any number of pathologies, including, but not urns ted to, colitis, alveolitis, bronchiolitis obliterans, ileitis, pancreatitis, glomerulonephritis, uveitis, arthritis, hepatitis, dermatitis, and enteritis, acute and chronic conditions in cardiovascular, e.g„ acute myocardial infarction; central nervous system injury, e.g., stroke, traumatic brain injury, spinal cord injury; peripheral vascular disease; pulmonary, e.g., asthma, ARDS; autoimmune, e.g., rheumatoid arthritis, multiple sclerosis, lupus, sclerodoma; psoriasis; gastrointestinal, e.g., graft-versus-host-disease, Crohn's disease, diabetes, ulcerative colitis, acute and chronic transplantation rejection, dermatitis, colitis, alveolitis, bronchiolitis obliterans, ileitis, pancreatitis, glomerulonephritis, uveitis, arthritis, hepatitis, dermatitis, and enteritis, [00158] Administering the cells is useful to reduce undesirable inflammation in any number of CNS pathologies, including, but not limited to, ischemic stroke, multiple sclerosis, Alzheimer’s Disease, ALS, Parkinson’s Disease, hypoxic-ischemia, neonatal hypoxic ischemia, and traumatic brain or spinal cord injury .

[110151¾ In addition, other uses are provided by knowledge of the biological mechanisms described in this application One of these includes drug discovery. This aspect involves screening one or mere compounds for die ability to affect the cell's ability to modulate the activation of macrophages. This would involve an assay for the cell’s ability to modulate the activation of macrophages. Accordingly, the assay may be designed to be conducted in vivo or in vitro. Modulation assays could assess the activation state at any desired level, e.g., morphological, gene expression, functional, etc.

[00160] Cells (or medium) can be selected by the ability to modulate or by the expression of one or more genes that act as modulators. Gene expression can be assessed by directly assaying protein or RNA. This can be done through any of the well-known techniques available in die art, such as by FACS and other antibody-based detection methods and PCR and other hybridization-based detection methods. Indirect assays may also be used for expression, such as binding to any pf the known [00161] Assays for potency may be performed by detecting the genes modulated by the cells. These may include, but are not limited to, oxygen radicals, NO, TNFa, Glu, quinolic acid, histamine, eicosanoids, NGF, BDNF, NT-4/5, TGFp, GDNF, CNTF, IL-6, LIF, bFGF, HGF, PGn, 1L-3, MMP-9, iNOS, CD 16, CD86, CD64, and CD32, scavenger receptor A, CD 163, arginase 1, CD14, CD206, 29 €U23, a nd scavenger receptor B. Detection maybe direct, e.g., via RNA or protein assays or indirect, e.g,, biological assays for one or pore biological effects of these genes. Alternatively, potency pay he assayed by detecting the modulators of these genes, e g., MMP modulators. 2015202292 01 May 2015 ¢016¾ Accordingly, a surrogate marker could be used as long as it serves as an indicator that the c||s express/scirefe foe faetoifs) that modulate macrophage activation, [00163] Assays for expression/secretion of modulatory factors include, but are not limited to, ELISA, Lumtoex. qRT-PCR, anti-factor western blots, |nd factor immunohistochemistry on tissue samples or ceils.

[00164] Quantitative deierniination of modulatory factors in cells and conditioned media can be perforated using commercially available assay kits (e.g., R&amp;D Systems that relies on a two-step subtractive antibody-based assay).

[00165] Mmtim activation assays can also be used to assess the expression/secretion of the factors. Such in vitro assays are well known in the art, for example, ELISA assay of secreted cytokines and growth factors, qRT-PCR analysis of genes associated with neurotoxic ¢$$) or nenroproteciive (M2) activation state, and iiumunohistochemislry analysis of activation state marker expression.

[00166] A further use for the invention is the establishment of cell banks to provide cells for clinical administration. Generally, a fundamental part of this procedure is to provide cells that have a desired potency for administration in various therapeutic clinical settings.

[00167] Any of the same assays useful for drug discovery could also be applied to selecting cells for the bank as well as from the bank for administration.

[00168] Accordingly, in a banking procedure, the cells (or medium) would be assayed for the ability to achieve any of the above effects. Then, cells would be selected that have a desired potency for any of the above effects, and these cells would form the basis for creating a cell bank.

[00169] It is also contemplated that potency can be increased by treatment with an exogenous compound, such as a compound discovered through screening the cells with large combinatorial, libraries. These compound libraries may be libraries pf agents that include, but are not limited to, small organic molecules, antisense nucleic acids, siRMA DMA: aptamers, peptides, antibodies, son-antibody proteins, cytokines, chemokmes. and chcmo-attractaBts. For example, cells may be exposed such agents at any time during the growth and manufacturing procedure. The only requirement is that there be sufficient numbers for foe desired assay to be conducted to assess whether or not the agent 3ls increases potency. Such an agent, found during the general drug discovery process described above, could more advantageously be applied during the last passage prior to banking. 2015202292 01 May 2015 [0017¾ One embodiment that has been applied successfully to MultiStem is as follows. Cells can be isolated from a qualified marrow donor that has undergone specific testing requirements to determine that a cell product that is obtained from this donor would be sale to be used in a clinical setting. The mononuclear cells are isolated using either a manual or automated procedure. These mononuclear cells are placed in culture allowing the ceils to adhere to the treated surface of a cell culture vessel. The MAPC cells are allowed to expand on the treated surface with media changes occurring on day 2 and day 4, On day 6, the cells are removed from the treated substrate by either mechanical or enzymatic means and replated onto another treated surface of a cell culture vessel. On days 8 and 10, the cells are removed from the treated surface as before and replated On d|y 13, the cells are removed from the treated surface, washed and combined with a cryoprotectant material and frozen, ultimately, in liquid nitrogen; After die ceils have been frozen for at least one week, an aliquot of the cells is removed alii tested for potency, identity, sterility and other tests to determine the usefulnesssofi;the eeU bank, These cells in this bank can then be used by thawing them, placing them in culture or use them out of the freeze to treat potential indications.

[00171] Another use is a diagnostic assay for efficiency and beneficial clinical effect following administration of the cells. Depending on the indication, there may be biomarkers available to assess. For example, one could assess circulating macrophages for specific markers of Ml and M2 macrophages. These are, for example, down-regulation of pro-inflammatory cytokines (TNF-α, B-6, IL-Ιβ, INF-γ) and up-regulation of anti-inflammatory cytokines (IL-4, IL-10, TGF-β). The dosage of cells can be adjusted during treatment according to the effect.

[00172] A forth®· use is to assess the efficacy of the cell to achieve any of the above results as a pre-treatment diagnostic that precedes administering the cells to a subject. Moreover, dosage can depend upon the potency of the cells that are being administered. Accordingly, a pre-treatment diagnostic assay for potency can be useful to determine the dose of die cells initially administered to the patient and, possibly, further administered during treatment based on the real-time assessment of dinical effect.

[00173] It is also to be understood that the cells of the invention cart be used to modulate acti vation not only for purposes of treatment, but Up research purposes, bod» in vivo and in yitm to understand the mechanism involved is macrophage activation, normally and in disease models. In one embodiment, assays, in vivo or in vitro, can be done is foe presence of desired agents. The effect of those agents can then be assessed. These types df assay could also be used to screen for agents that have an effect on the activation that is modulated by foe cells of the mvenion. Accordingly* in one 31 embodiment, one could screen for agents M the disease model that revise the negative effects and/or 2015202292 01 May 2015 promote positive effects,: Conversely, one could screen for agents that have.....negative effects in a model of normal activation. 100174] The invention is also directed to cell populations with specific potencies for achieving any of the effects described herein. As described above, these populations are established by selecting for ceils that have desired potency, These populations are used to make other compositions, for example, a cell bank comprising populations with specific desired potencies and pharmaceutical compositions containing a cell population with a specific desired potency,

NON-LIMITING EXAMPLES

Example 1

MuMpoteni Adult Progenitor Cells (MAPC) Significantly Decrease Matrix MetaMopgoteinase-9 iMMP.r51),Eeiease:_prom Macrophage?.

[0017¾ Using an in viiro model of axonal dieback as well as a dorsal column crush inode! of spinal cord injury the inventors found that adult stem cells exert positive immunomodulatory and neurotrophic influences following acute injury to the nervous system. MAPC can affect both macrophages and dystrophic neurons simultaneously. They significantly decrease matrix metailoproteinase-9 (MMF-9) release from macrophages, effectively preventing induction of axonal dieback. lag-teimd [00176] Previous work from the mvenfrp has shown that the infiltration erf phagocytic ED-1+ macrophages coincides with long distance axonal retraction, or dieback, from the initial site of a spinal cord lesion, resulting in a disadvantageous starting position for regenerating axons (Horn et al„ J Neumci 28:9330 (2(¾¾)). Injured axons dial become dystrophic dip to the presence of inhibitory proteoglycans in their environment are particularly susceptible to attack by macrophages. Several factors can affect the outcome of macrophage attack, including enhancement of the intrinsic growth potential erf the neuron and alteration of macrophage-secreted factors (Busch et al„ J Neurosci 29:9967 (2009)). 32 [00177] The inventors also previously have shows that macrophage-mediated axonal diebaek can be precepted in vitro by specific inhibition of MMP-9. Additionally, endogenous stem-like NG2+ progenitor cells that normally populate the lesion center can stabilise axons undergoing axonal diebaek as a result of ifseir expression of growth promoting extracellular matrix molecules. But they cannot prevent the initiation of diebaek (Busch et $l„JNeuro$d 30:255 (2010)). 2015202292 01 May 2015 [00178] In the past decade, adult stem ceils have been isolated from multiple tissues and characterized in many laboratories (Mays et al., Expert Opin Biol Ther 7:173 (2007) and Ting et a!., Crit Rev Oncol Hematol 65:81 (2008)). There is substantial interest in developing adult-derived stem ceils as therapeutic agents for the treatment of CNS injury and disease (Biemaskie et al., J Neurosci 27:9545 (2007); Bambakidis et al., Neurosurg Focus 24:E2G (2008); and Bamabe-Heider et al., Cell Stem Cell 3:16 (2008)). Adult-derived adherent stem cells demonstrate a number of favorable characteristics including genetic stability, extensive expansion capacity, and low immunogenicity profiles that support allogeneic utility (GneccM et al., Circulation Research 103:1204 (2008)). Functional improvement after administration of adult-derived cells has been demonstrated in multiple pre-clinical models of injury or disease; however, many aspects of their mechanism of action remain poorly understood (Capian et al., J Cell Biochem 98:1076 (20%); Kim et al., J Neurosci Res 87:2183 (2009); and Van't Hof et al., Cytotherapy 9:477 (2007)), [00179] There is increasing evidence that transplanted adult stem ceils tend to remain undifferentiated and often are cleared after a short time, but still promote recovery (Parr et al., Bone Marrow Transplant 40:609 (2007)). This suggests that their beneficial effects are mediated primarily through paracrine activities that impact host tissues. This has been attributed to mechanisms involving release of factors that are neuroprotective (Parr et at 2007), angiogenic (Onda et al., J Cereb Blood Flow Met ah 28:329 (2008)) and/or immunomodulatory (OhtaM et al, Proc. Nat. Acad. ScL U.S.A. 105:14638 (2008); Abrams et «l„ Restor N$urol NeurosM 27:307 (2009); ami Bou^erie et al* J Neurosci Res 87:1509 (2009)).

Strategy [00180] MAPC designates a well-characterized population of adherent stem pells isolated from adult bone marrow and other adult tissues (Jiang et at, Nature 418:41 (2002) and Jiang et at, Exp Hematol 30:896 (2002)) that can positively modulate the immune system (Kovacsovics-Bankowski et al, Cell Immunol 255:55 (2009) and Highfill et al., Blood 114:693 (2009)). Because of previous observations of the negative effects of macrophages after injury the inventors sought to determine if MAPC could affect immune cells responding to the initial insult to prevent axonal diebaek and promote regeneration. The inventors tested the effects of MAPC on macrophage-mediated axonal diebaek in vitro (Horn et al. 2008). 33 life 2015202292 01 May 2015 mm ΪΏ the in vitro dieback model, la the presence of MAPC, NR8383 macrophages formed contacts with dystrophic axons that were often transient and rapidly broken. Five out of the six imaged axons in co-culture with MAPC dp not undergo macropbage-mediaied axonal retraction. imm The ability of MAPC to prevent axonal debaek could be due to stimulatory effects on the neuron, modulatory effects cm the macrophages, or a combination of both. To determine if MAPC-secrated factors were sufficient to modulate the retaeiiou-inducing capabilities of macrophages, the inventors precreated macrophages with medium conditioned by MAPC (MAPC-CM). Hie inventors observed bo obvious differences in the ability of MAPC-CM-pretreated macrophages to recognize and tightly associate with dystrophic axons compared to untreated macrophages. However, macxoph&amp;ge-mediated axonal retraction still did not occur, indicating that MAPC-secreted factors were modulating the ability of the macrophages to induce dieback. Because the macrophages still formed long lasting contacts with the axon, it did not appear that their ability to recognize the dystrophic/injured state or adhere to the axon was impaired, but this activity alone was insufficient to induce dieback after pretreatment with MAPC, [00183] Macrophages are known to secrete a variety of proteases, which aid in the breakdown and clearance of debris after injury (Yang, Nature reviews 6:931 (2005)). MMPs have been implicated in regeneration failure after CNS injury (Noble et al., J Neurosci 22:7526 (2002) and work from the inventors’ laboratory has demonstrated that specific chemical inhibition of macrophage-produced MMP-9 can prevent axonal dieback (Busch et al. 2009). The Inventors therefore examined the effect of MAPC on MMP-9 production and secretion from macrophages. The inventors found that coculture with MAPC dramatically reduced the secretion of both the 105 kDa pro- and 95 kite activated forms of MMP-9 by macrophages as measured by Western blot (P<0,05) and levels of functional protein as measured by gelatin zymography (P<0.05). Inhibition of MMP-9 proteolytic activity by binding of tissue inhibitor of metalloproteinase^ (TIMPs) is not a factor in the decreased MMP-9 levels observed by Western Mot and zymogram, as the denaturing conditions present in these assays would disrupt any existing MMP-9 / ΉΜΡ protein complexes. Quantitative PCR demonstrated that there was no change in macrophage transcript levels of MMP-9 as a result of co-culture with MAPC (Fig. 3Y The effect was specific to MAPC as co-culture of macrophages with NG2-J- progenitor ceils <hd not decrease macrophage MMP^s^^ 3).

[Ml] The inventors also investigated the immune-modulating effects of MAPC on axonal dieback in vivo using an adult rat dorsal column crush model of spinal cord injury. The most dramatic phase of axonal dieback occurs between two and seven days post-lesion, which correlates spaliotemporaily with the infiltration of activated macrophages into the lesion (Morn et al, 2008). The 34 inventors hypothesized that MAPC would modulate activated macrophages and/or stimulate axonal growth within the lesion in such a way as to reduce the extent of axonal dieback and/or promote regeneration. Therefore, MAPC was transplanted into the dorsal column of the spinal cord immediately following injury and the extent of axonal dieback post-lesion was measured. 2015202292 01 May 2015 [00185] By four days post-lesion, MAPC-transplanted animals showed a significant decrease in the extent of axonal dieback compared to vehicle controls. Transplantation of MAPC significantly attenuated the extent of macrophage-mediated axonal dieback normally observed at this time. Also, MAPC-transplanted animals had decreased numbers of ED-1+ cell profiles in the lesion cote at both 4 and 7 days post lesion. By seven days post-lesion, injured axons in MAPC-transplanted animals had regenerated info the lesion center, whereas axons in vehicle control treated animals did not. The inventors also observed fiber's extending beyond the ntidpomt of the lesion at 7 days pOSt-infury, providing ftirtfer evidence of the trophic and axon growth supporting properties of this stem cell population.

Discussion [60186] These studies show that MAPC can positively alter the inflammatory response following injury and prevent deleterious axonal dieback. In vivo, MAPC could also influence axon outgrowth by altering other components of the lesion environment, such as the glial sear, through modification of astrocyte reactivity, possibly as a secondary effect of immunomodalaiion (Fitch et at, J Nmrosci 19:8182 (1999)). Additionally, production of trophic factors, such as VEGF, by MAPC (Vant Hof et al. 2007) could be contributing to a positive outcome by enhancing cell survival or promoting the recruitment and/or proliferation of endogenous progenitor ceils (Engel et al„ Glia 16:16 (1996); Sasaki et al., J Neurosct 29:14932 (2009); and Thau-Zuchman et al., J Cereb Blood Flow Metab (2010)) that have been shown to provide a permissive substrate for regenerating axons (Busch et al.

Bii873 These studies show that MAPCs can alter the inflammatory respond to prevent, at least in part, deleterious secondary injury in the CNS. MAPC co-culture with macrophages inhibits macrophage secretion of the protease MMP-9, which the inventors have previously shows to be responsible for macrophage-induced axonal dieback (Busch et al. 2009). There are multiple stages of macrophage MMP-9 production and processing which could be impacted by MAPCs, including transcription, translation, secretion, activation, and inhibition by TIMPs. MAPC co-culture could affect macrophage MMP-9 activity at any one, or more, of these levels. However, these studies clearly demonstrate that MMP-9 transcription is not affected by MAPC co-culture, as macrophage MMP-9 mRNA levels were unchanged In the presence of MAPC compared to control conditions. The studies also indicate that activation of pro-MMP-9 is not affected by MAPC co-culture, as both 35 the pro- and activated forms of MMP-9 protein are proportionally decreased after co-culture as seen by Western blot. It is possible that TIMP-mediated inhibition might represent a secondary level at which MAPC could further affect MMP-9 activity in diebaek assays or in vivo, as MAPC express high levels of T1MP-1. Nevertheless, these studies clearly indicate that MAPC co-culture significantly deduced the amount Of MMP-9 protein released by the cells, suggesting a direct effect ofl MMP-9 secretion. 2015202292 01 May 2015 [00188] While these studies have focused on evaluating the effects of MAPC on MMP-9 activity and M1/M2 activation markers, MAPC may also alter expression of other MMPs, and/or other proinflammatory molecules. Secretion of ^inflammatory molecules is reflective of the general activation state of macrophages, and is decreased by shifting from an Ml, or “classically activated” pro-inflammatory state, to an M2, or “alternatively activated” anti-inflammatory state (Gordon, Nat Rev Immunol 3:23 (2003)). Ml macrophages release cytokines, reactive oxygen species, nitric oxide, and MMPs, while M2 macrophages are not neurotoxic, can promote neurite outgrowth (Kigerl et al., J Neurosci 29:3435 (2009) and Block et al. Nature Reviews 8:57 (2007)), and exhibit decreased production of a number of proinflammatory molecules, including MMP-9 (Chizzolini et al, J Immunol 164:5952 (2000)), The described effects of MAPC on macrophage function may be mediated by a shift in the balance of M1/M2 activation state.

[00189] MAPC could have similar effects in other CNS injuries. The effects shown by these studies may be particularly relevant after ischemic stroke, as regulating the extent of diebaek in grey matter could significantly alter the outcome after injury. MAPC could promote maintenance of cortical association as well as other types of fibers at the lesion edge, providing an enriched, synapticafly connected lesion penumbra and an anatomical substrate for functional recovery.

Methods Per Figures 2-4 BBfUDjaaoaigse [00190¾ DRGs were harvested as previously described (Tom et al., J Neurosci 24:6531 (2004)). Briefly, DRGs were dissected out of adult female Sprague-Dawley rats. Both the central and peripheral roots were removed and ganglia incubated in a solution of Collagenase Π (200 U/mL, Worthington) and Dispase II (2.5 U/mL, Roche) in HBSS. The digested DRGs were rinsed and gently triturated in fresh HBSS-CMF three times foSowed by low speed centrifugation. The dissociated DRGs were then resuspended in Neurobasal-A media supplemented with B-27. Glutamax, and Pennicillin/Streptamycin (all front Invitrogen) and counted. DRGs were plated on Delta-T dishes (Fisher) at a density of 3,000 ceils/mL for a total of 6,000 cefls/dish. 36 2015202292 01 May 2015 {00191J Deita-T ceil culture dishes (Fisher) were prepared as described previously (Horn ei ai 2008); Briefly, a single hole was drilled through the upper half of each dish to create a port for the addition of cells to the cultures during time-lapse microscopy. Dishes were then rinsed with sterile water and coated with poly-i-lysine (0.1 mg/mL, Invitrogen) overnight at room temperature. Dishes were the» rinsed with sterile water and allowed to dry. Aggrecan gradient spots were created by pipetting 2.0 uL of aggrecan solution (2.0 mg/mL, Sigma in HBSS-CMP, invitrogen) onto die culture surface and allowed to dry. Six spots were placed per dish. After the aggrecan spots dried completely, the entire surface of the dish was bathed in laminin solution (10 ug/mL, ΒΙΪ in HBSS-CMF) for three hours at 37 degrees Celsius. The laminin bath was then removed immediately before plating of cells.

Cell Line MacrophageCultures [00192] NR8383 cells (ATCC # CRL-2192), an adult Sprague-Dawiey alveolar macrophage cell line, were cultured as described in previously (Yin et al,, J Neurosci 23:2284 (2003)), Briefly, cells were cultured in uncoated tissue culture flasks (Coming) in F-12K media (Invitrogen) supplemented with 13% FBS (Sigma), Crluiamax, Penrs/Strep (Invitrogen), and sodium bicarbonate (Sigma) and fed two to three times per week. To prepare the cell line macrophages for time-lapse microscopy experiments, cells were harvested with trypsin/EDTA (Invitrogen), washed three times, and plated in uncoated tissue culture flasks at a density of 1.0 x 106/mL in serum-free F-12K. Prior to use in time-lapse experiments, the cultured cell line macrophages were harvested with EDTA and a cell scraper and resuspended in Neurobasal-A with the addition of HEPES (50uM, Sigma) at a density of 2.5 x I05/70ul. MAPC Cultures $1¾¾¾] Sprague-Dawiey rat MAPCs labeled with GFP were prepared as described previously (Varft Hof et ai. 2007). Cells were grows in rat MAPC media consisting of low glucose DMEM (Invitrogen), 0.4X MCDB-201 medium (Sigma), IX ITS liquid media supplement (Sigma), Img/ml lindeic acid-albumin (Sigma), 100 U/ml penicillin G sodium/100 pg/ml streptomycin sulfate (Invitrogen), 100 μΜ 2-P-L-ascorbid acid (Sigma), 100 ng/ml EGF (Sigma), 100 ng/ml PDGF (R&amp;D Systems), 50 nM dexamethasone (Sigma), 1000 U/ml ESGRO (Chemicos), and 2% fetal bovine serum (Hycione). The cultures were plated on 10 ng/ml flbronectin (Invitrogen) coated 150 cm2 tissue culture flasks (Coming) at an initial density of 1000 ce!Is/emz and subsequent replating at 200 cells/cm2. The cells were maintained in 15 ml of media/flask at 37°C and 5.0% C©2 with passaging occurring every 3-4 days using trypsin/EDTA (Invitrogen). 37 2015202292 01 May 2015 100194] (Mis were eulturedsas described above and auditioned media was collected after 48 hours in SO ml conical tubes (BD Bios deuce). The conditioned media was spur* down at 400 x g for 5 thin $t 4°C and die supernatant transferred to a new 50 ml conical tube, MAPC-conditioned media was obtained as described above and concentrated 50 fold with an Amieon Mierocon tlltracel YM-3 3,003 MWCO centrifugal filter (Millipore, Bedford MA). MABC-Conditioned Media-Treated Macrophages [00195] NR8383 rat macrophages were cultured as described above. One day prior to time-lapse microscopy experiments, macrophages were harvested with tryprin/EDTA (Invitrogen), washed three times, and plated in uncoated tissue culture flasks at a density of LG x 106/mL in serum-free F-12K. Twenty uL of the 50-fold concentrated MAPC-conditioned media were added per 1 mL of serum-free F12K media, for a final concentration of IX. Prior to use in time-lapse experiments, fee cultured cell line macrophages were harvested with EDTA and a cell scraper and resuspended in Neurobasal-A wife fee addition of HEPES (5QuM, Sigma) at a density of 2,5 x IGVfdul.

Time-Lapse .Mggg§cgpy [00196] DRG neurons were incubated at 37°C for 48 hours prior to time-lapse imaging, Heurobasai-A media with HEPES (50uM, Sigma) was added to the culture prior to transfer to a heated stage apparatus. Time-lapse images were acquired every 30 seconds for 3 hours with a Zeiss Axiovert 405M microscope using a IQGx oil-immersion objective, Growth cones were chosen that extended straight into the spot run and had characteristic dystrophic morphology for 30 minutes to observe baseline behavior before the addition of cells or conditioned media and then observed for 3 hours. For cell-addition experiments, cultured rat-derived MAPCs were harvested from tissue culture flasks, washed three times and resuspended in Neurobasal-A media. For co-culture experiments, MAPCs (100,000/dish) were added to dorsal root ganglia neuron cultures after 24 hours and incubated at 37°C for 24 additional hours before time-lapse imaging. For experiments in which MAPC-conditioned media was added to DRG cultures during time-lapse imaging, 90 uL of SOX MAPC-CM was added after 30 minutes of baseline growth cone observation, MAPC-conditioned media-treated macrophages were added to time-lapse cultures after 30 minutes of baseline imaging (500,000 cells/dish). Extension/retractlon, rate of growth, turning and branching were analyzed using Metamorph software, m [00197] Following time-lapse imaging, DRGs were fixed in 4% PFA and immunostained wife anii-B-tubulin-type Hi (1:500; Sigma), anti-chondroitin sulfate (CS-56, 1:50¾ Sigma) and anti-GFP (liSl®, fovitrogen). 2015202292 01 May 2015 MMF-9 assays [00198] NRB383 cells were cultured as described above, but in 24~weE plates at as initial density of 100,000 celk/cm2. MAPCs were co-cultured with the NR8383 cells, via Transwells (0.4 μιη; Costar), at an equal plating density. Negative control wells also received Transwell inserts, with an equivalent volume of media, but no addition of MAPCs, After 24 hours, the Transwells and MAPCs were removed and discarded* NR8383 culture media was removed, and the NR8383 cells were washed 3X with PBS and re-fed with fresh media containing no FBS. After an additional 24 hours, the NR8383 conditioned media was collected for Western blot and zymogram analyses, and NR8383 total RNA was harvested for quantitative PCR analysis.

[00199] Total conditioned media from 2 replicate wells was concentrated using the described centrifugal filters to a final volume of approximately 20 μΐ. The total concentrated volume was loaded onto a 10¾ polyacrylamide gel (Bio-Rad; each gel lane represents total conditioned media concentrated from 2 replicate wells), electrophoresed for 1-2 hours at 100V, and transferred to PVDF membrane (Immobilon membrane, Millipore). Western blots were blocked in Western Blocking Solution (Sigma) for 30 minutes, then incubated in primary antibody (a-MMP-9 #AB19016, Millipore; 1:1000 dilution in blocking solution) for 2 hours at room temperature. Western blots were washed 4X in TBS, and incubated in secondary antibody (α-rabbit IgG HRP, Promega; 1:2500 dilution in blocking solution) for 1 hour at room temperature. Bound HRP-conjugated antibody was visualized using ECL chemiluminescence reagent (GE Amersham) according to manufacturer’s specifications, and imaged using a ChemlDoc-It imaging system (UYP), Background subtracted band densitometry was measured and analyzed by Student’s t-test for statistical significance.

Zgmgmkt.

[0020()] Total conditioned media from 2 replicate wells was concentrated as described above and loaded onto a 10% gelatin zymogram gel (Bio-Rad), and electrophoresed for 1-2 hours at 10QV. Zymograms were washed in 2,5% Triton X-10Q for 30 minutes, and incubated overnight at 37°C in developing buffer (50mM Tris, 200mM N&amp;CL 5mM CaCh, 0.02% Boj35). Zymograms were stained % I hour (05% Coomassie G23Q.30% methanol, 10% acetic acid), and de-stajaed (30% methapql, 39 acetic add) until bands were visualized. Zymograms were brightfieSd imaged using a ChemiDoc-It imaging system. Background subtracted band densitometry was measured and analyzed by Student’s t-test for statistical significance. 2015202292 01 May 2015

QMtttetigSJECB

[0Θ201] RNA was isolated from NR8383 cells using RNEasy columns (Qtagen) according to manufacturers specifications. Rat reference RNA (Steamgene) was Used as a positive control, Synthesis of cDNA was performed with M-MLV reverse transcriptase and random hexamers (Promega). Control reactions were performed without reverse transcriptase to control for genomic DMA contamination, SYBR Green quanitative BCR was performed using the following: primers: MMP-9 frpasi - GCGCCAGCCGACTTATGT; MMP-9 reverse AATCCTCTGCCAGCTGTGTGT; β-actm forward - AGCCCCCTCrGAACCCTAAG; β-actia reverse - CAACACAGCCTGCrATGCCTAC. qPCR was performed using an AFil 7500 with 9600 emulation. The PCR conditions were 50*C x 2 min, 95PC x IQ mia» and then 40 cycles of 95*C x 15 sec, 60°C x 1 min. NR8383 MMP-9 quantitation was normalized to β-actin levels, and expressed as percent erf rat reference MMP-9 signal [W202| All animal procedures were performed in accordance with the guidelines and protocols of the Animal Resource Center at Case Western Reserve Umversity, Adult female Sprague-Bawtey rats 250-3(X}g Were anesthetized with inhaled isoifooraue gas (2%) fear ail surgical procedures. A T1 laminectomy was performed to expose the dorsal aspect of the C8 spinal cord segment. A durotomy was made bilaterally 0.75 mm from midline with a 30 gauge needle. A dorsal column crush lesion was then made by inserting Dumont # 3 jeweler’s forceps into the dorsal spinal cord at €8 id a depth of 1$ mm,· squeezing the forceps holding pressure for ten seconds and repeated two additional ifotes. Completion of She lesion was verified by observation of white master clearing. The holes in the dura were then covered with gel film. The muscle layers were sutured with 4-0 nylon suture and the skin closed with surgical staples. Upon closing of the incision, animals received Mareaine (1.0 mg/kg) subcutaneously along the incision as well as Buprenorphine (0.1 mg/kg) intramuscularly. Post-operatively, animals were kept warm with a heating lamp during recovery from anesthesia and allowed access to food and water ad libitum. Animals were killed at 2,4, or 7 days post-lesion.

Ceil Transplantation $MK203] Cultured rat-derived MAPCs or primary bone marrow-derived macrophages (which had been simulated With interferon gamma and LPS for 24 hours) Were harvested from tissue culture 40 flails, washed three times in HBSS-CMF and resuspended in HBSS-CMP at a density of 200,000 cellsfttL. Immediately following dorsal column crush injury, 1.0 uL of the ceil suspension was injected unilaterally 0.5 mm deep into the right side dorsal columns. The injection site was 0.5 mm literal to the midline and 0,5 mm caudal to the lesion edge. Tie cells wo® injected with forty-four 23.0 aL pulses on 15 second intervals through a pulled glass pipette attached to a Nanojeci 1Ϊ Prummood), The glass pipette was then withdrawn from the spinal cord two minutes after fee final injection. Following the transplantation, the injection site was covered with gelfilm, the muscle layers were closes 1 with 4-0 erhlcon sutures, and the skin was Closed with surgical staples. Post-operatively, animals were kept warm with a heating lamp during recovery from anesthesia and allowed access to food and water ad libitum. Animals were killed two or four days post-lesion. 2015202292 01 May 2015

Axonkbeling [00204] Two days before sacrifice, die dorsal columns were labeled unilaterally with Texas-Red conjugated 30OGMW dextran, Briefly, the sciatic nerve of the right hindlimb was exposed and crushed three times with Dumont #3 forceps for ten seconds. 1.0 uL of 3000MW dextran-Texas-Red 10¾ in sterile water was the injected via a Hamilton syringe into the sciatic nerve at the crush site. The muscle layers were closed with 4-0 nylon suture and the skin with surgical staples. Upon closing of the incision, animals received Marcaine (1.0 mg/kg) subcutaneously along die incision as well as Buprenorphine (0.1 mg/kg) intramuscularly. Post-operatively, animals will be kept warm with a heating lamp during recovery from anesthesia and allowed access to food and water ad libitum. Animals were killed two days following labeling with an overdose of isofiuorane and perfused with PBS followed by 4% PPA. Tissue was harvested and post-fixed in 4% PFA and processed for inununohistoehemlstry. fa^sohigtoehemistry [00205] Tissue was post-fixed in 4% |FA overnight and then submersed in 30¾ sucrose overnight, frozen in QTC mounting media, and cut on a cryostat into 20 pm longitudinal sections. Tissue was then stained With ahtPGI^P/AlexafiUbiWS, anti -BD-l/Alexafluor-594 or -633, anii-GFP/Aiexailuor-488, and anl-vitnentm/Alexafluor-633 and imaged on a Zeiss Axiovert 510 laser-seanaring eonfoeal microscope at lOx magnification.

Axonal Dieback Quantification [00206] To quantify axonal dieback three consecutive sections per animal were analyzed, starting at a depth of 200 pm below the dorsal surface of the spinal cord. The lesion center was identified via characteristic GFAP and/or vimentin staining patterns and then centered using Zeiss LSM 5 linage 41

Browser software, The distance between the ends of 5 labeled axons projecting farthest into the lesion and the lesion center was then measured. The measurements from all sections from all animals in a group of dieback per time point 2015202292 01 May 2015

Example 2

Effects of Multi-Stem^ on Isctenila-taduccd Gene Repression Changes [00207) MultiStem significantly inhibits ischemia-induced markers of immune response with infarct region. qPCR analysis confirms that MultiStem administration prevents massive ischemia-induced upregulation of markers of immune response, such as MMPI2 (expressed by macrophages). qPCR analysis of different brain regions demonstrates that the changes in immune marker genes are specific to the infarct region.

[00208) Neonatal Hypoxia-Ischemia Paradigm, Neonatal hypoxia-ischemia (HI) was administered to neonatal rats on postnatal day 7 (P7). P7 pups underwent permanent ligation of die CCA, followed by exposure to 8% 02,92% N2 for 2.5 hours. Animals were administered MultiStem® (100,000 or 1 million cells) or vehicle IV 7 days after injury. Animals were sacrificed 3 days after cell infusion for tissue harvest.

[00209] qPCR Analysis, First-strand cDNA was prepared from 500 ng RNA using MMLV RT under standard conditions, SYBR Green qPCR was performed on an Applied Biosystems 7500 PCR machine. Results were normalized to β-acfin, and expressed as average percent of rat reference RNA (Stretagene). 42

Claims (8)

1. ΤΗΕ::01Α1Μ$ DEFINING TMlSo INVENT}014 AFtE AS FOLLOWS;

   1. A method: for detecting cels with a desired patency for moddfating: macrophage activation, the: method comphsling assaying cells for the desired potency, the cells being nod-embryonic stem, non-germ ceils that express!^ pns; or more of oct4, ielomerase, rex-1, or rox-1 and/or can: differentiate into cell types of at least two of endodarmaL ectodermal, and mesodermal germ layers, 2, A.mefbed 'fobpfepadhsO: pharmaceutical composition, comprising: (1) assessing cells for a: desired petency for modulating: macrophage activation, and (2) preparing a pharmaceutical composition: with the cells found to have the desired potency, wherein the calls are non -embryonic stem, non-germ ceils that express one or more of oef4i: telOmerase,::rex-1, or rox- i and/or can dlferentiate into cell types of at least two of endddermil eetodarmatand mesodermal germ:: layers. The method of any of claims 1 or 2 whem-n the cells express one or more: of 0014, tefomerase,: rex-T, or rox-1 sndiCari: differentiate Into cell types of at iessttwo of endoderma), ectedermal,::and mesodermal germ;:layers.:
2. 4, The method of Shy: of Claims 1-3: wherein the cels can::differentiate Into cell types oflendodermahmctodefmal, and mesodermal germ;layers:.:
3. 5. The method of any of claims 1-4 Wherein the cells express ielometase. i, method of any of claims 1-5 wherein tds celfs expross oc!4.
4. 7. The method of claims 1 or 2 wherein the cells can differentiate Into ceil types of em1oderroaji: ectodermal, and mesodermal germ layers and express ielomerase, oc!4: rex-1 , and rox~1.
5. 8. The method aTanydf claims 1~7 wherein the ceils are human , 9. 1-8 wherein the cells are allogeneic,
6. 10. The method of any of claims11-9 wherein the cells are derived: from bone marrow.
7. 11. The method of any of claims 1-10 wherein potency is assessed by an assay selected from the group consisting of (11 assay for macrophage activation factor expressed in or secreted by the cells, (2| assay for macrophage activation* (3) assay for antigen presentation ©! macrophages, and (4) assay for morphologioai changes of macrophages during activation.
8. 12. The method of any of claims 1-11 wherein the condition is selected from the group consisting of acute and chronic conditions in central nervous system ipfUry; e.g., sfrote, ischemic stroke* multiple sclerosis, Alzheimer’s Disease, ALS, Parkinson's Disease, hypoxic-ischemia, neonalai hypoxic ischemia, and traumatic brain or spinal cord injury.