AU2009324641A1 - Somatic cell-derived pluripotent cells and methods of use therefor - Google Patents

Abstract

Provided are methods for producing a reprogrammed fibroblast. The methods can include growing a plurality of fibroblasts in monolayer culture to confluency; and disrupting the monolayer culture to place at least a fraction of the plurality of fibroblasts into suspension culture under conditions sufficient to form one or more embryoid body-like spheres, wherein the one or more embryoid body-like spheres comprise one or more reprogrammed fibroblasts that express one or more markers not expressed by a fibroblast growing in the monolayer culture prior to the disrupting step. Also provided are reprogrammed fibroblasts produced by the disclosed methods, formulations that include reprogrammed fibroblasts, and methods for treating an injury to a tissue in a subject by administering to a subject in need thereof a composition of reprogrammed fibroblast cells in a pharmaceutically acceptable carrier.

Description

WO 2010/068758 PCT/US2009/067503 DESCRIPTION SOMATIC CELL-DERIVED PLURIPOTENT CELLS AND METHODS OF USE THEREFOR CROSS REFERENCE TO RELATED APPLICATIONS This application is based on and claims priority to United States 5 Provisional Application Serial Number 61/201,420, filed December 10, 2008, the disclosure of which is incorporated herein by reference in its entirety. GRANT STATEMENT This invention was made with government support under grant EY018603 awarded by the National Institutes of Health. The government has 10 certain rights in the invention. TECHNICAL FIELD The presently disclosed subject matter relates to reprogrammed somatic cells. Particularly, the presently disclosed subject matter provides reprogrammed somatic cells, methods for generating reprogrammed somatic 15 cells, and uses for reprogrammed somatic cells. BACKGROUND It has long been believed that the development of the cells, tissues, and organs of animals results from an orderly progression of differentiation events from stem cells to terminally differentiated cells. This progression has been 20 thought to be unidirectional, starting with the earliest totipotent cells found in the early stage embryo to the ultimate, terminally differentiated cells that make up the vast majority of the adult animal. This paradigm has been challenged recently by reports that certain differentiated somatic cells can be "reprogrammed" to what appears to be an 25 earlier stage of development (i.e., a more pluripotent state) by introducing expression vectors that encode polypeptides associated with pluripotency into the cells. For example, it has been shown that both mouse and human fibroblasts can be reprogrammed to form embryonic stem (ES) cell-like cells by the recombinant expression of four transcription factors: Oct4, Sox2, Klf4, and 30 c-Myc (Takahashi & Yamanaka, 2006; Takahashi et al., 2007). These cells have been referred to as "induced pluripotent stem cells" (iPSCs), and have -1- WO 2010/068758 PCT/US2009/067503 been shown to express certain stem cell markers, form teratomas, and even give rise to germline-competent chimeric mice when injected into blastocysts (see Maherali & Hochedlinger, 2008). Thus, it appears that differentiation might not be unidirectional, and at least some degree of pluripotency can be 5 reacquired by cells otherwise believed to be terminally differentiated. Unfortunately, recombinant DNA techniques have certain disadvantages for reprogramming cells, particularly with respect to cells that are to be administered to subjects. For example, many expression vectors that are commonly used for expressing exogenous nucleic acids such as those that 10 might induce reprogramming are based on retroviruses. Retroviral expression vectors have been shown to be characterized by significant safety issues, most notably increased incidences of cancer resulting from the introduction and subsequent integration of the vectors into the cells of subjects to whom the retroviral vectors had been administered. 15 What are needed, then, are methods for reprogramming somatic cells to reintroduce some degree of pluripotency desirably without the need to resort to the use of recombinant expression constructs, particularly in the form of retroviral constructs. This need, among others, is addressed by the presently disclosed subject matter. 20 SUMMARY This Summary lists several embodiments of the presently disclosed subject matter, and in many cases lists variations and permutations of these embodiments. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given 25 embodiment is likewise exemplary. Such an embodiment can typically exist with or without the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible combinations of such features. 30 The presently disclosed subject matter provides methods for producing a reprogrammed fibroblast. In some embodiments, the methods comprise (a) growing a plurality of fibroblasts in monolayer culture to confluency; and (b) disrupting the monolayer culture to place at least a fraction of the plurality of -2- WO 2010/068758 PCT/US2009/067503 fibroblasts into suspension culture under conditions sufficient to form one or more embryoid body-like spheres, wherein the one or more embryoid body-like spheres comprise a reprogrammed cell (e.g., a reprogrammed fibroblast) comprising expressing one or more markers not expressed by a cell growing in 5 a monolayer culture prior to the disrupting step. In some embodiments, the fibroblast is a mammalian fibroblast, optionally a human fibroblast. In some embodiments, the fibroblast is a non-recombinant fibroblast. In some embodiments, the disrupting comprises scraping the confluent monolayer off of a substrate upon which the confluent monolayer is being cultured. In some 10 embodiments, the methods further comprise maintaining the one or more embryoid body-like spheres in suspension culture for at least one month. In some embodiments, the one or more embryoid body-like spheres are maintained in a medium comprising Dulbecco's Modified Eagle Medium (DMEM) and 10% fetal bovine serum (FBS). In some embodiments, the 15 reprogrammed fibroblast expresses a stem cell marker selected from the group consisting of Oct4, Nanog, fibroblast growth factor-4 (FGF4), Sox2, Klf4, SSEA1, and Stat3. In some embodiments, the reprogrammed fibroblast is non tumorigenic in nude mice. The presently disclosed subject matter also provides reprogrammed 20 fibroblasts produced by the disclosed methods. The presently disclosed subject matter also provides reprogrammed fibroblast cells non-recombinantly induced to express one or more endogenous stem cell markers. The presently disclosed subject matter also provides formulations 25 comprising the disclosed reprogrammed fibroblast cells in a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutically acceptable carrier or excipient is acceptable for use in humans. The presently disclosed subject matter also provides embryoid body-like spheres comprising a plurality of reprogrammed fibroblasts. 30 The presently disclosed subject matter also provides cell cultures comprising the disclosed embryoid body-like spheres in a medium sufficient to maintain the embryoid body-like spheres in suspension culture for at least one month. -3- WO 2010/068758 PCT/US2009/067503 The presently disclosed subject matter also provides methods for inducing expression of one or more stem cell markers in a fibroblast. In some embodiments, the methods comprise (a) growing a plurality of fibroblasts in monolayer culture to confluency; and (b) disrupting the monolayer culture to 5 place at least a fraction of the plurality of fibroblasts into suspension culture under conditions sufficient to form one or more spheres, wherein the one or more spheres comprise a fibroblast expressing one or more stem cell markers. The presently disclosed subject matter also provides methods for differentiating a reprogrammed fibroblast cell into a cell type of interest. In 10 some embodiments, the methods comprise (a) providing an embryoid body-like sphere comprising reprogrammed fibroblast cells; and (b) culturing the embryoid body-like sphere in a culture medium comprising a differentiation inducing amount of one or more factors that induce differentiation of the reprogrammed fibroblast cells or derivatives thereof into the cell type of interest 15 until the cell type of interest appears in the culture. In some embodiments, the cell type of interest is selected from the group consisting of a neuronal cell, an endodermal cell, and a cardiomyocyte, and derivatives thereof. In some embodiments, the cell type of interest is a neuronal cell or a derivative thereof. In some embodiments, the neuronal cell or derivative thereof 20 is selected from the group consisting of an oligodendrocyte, an astrocyte, a glial cell, and a neuron. In some embodiments, the neuronal cell or derivative thereof expresses a marker selected from the group consisting of glial fibrillary acidic protein (GFAP), nestin, @ Ill tubulin, oligodendrocyte transcription factor (Olig) 1, and Olig2. In some embodiments, the culturing is for at least about 10 25 days. In some embodiments, the culture medium comprises about 10 ng/ml recombinant human epidermal growth factor (rhEGF), about 20 ng/ml fibroblast growth factor-2 (FGF2), and about 20 ng/ml nerve growth factor (NGF). In some embodiments, the cell type of interest is an endodermal cell or derivative thereof. In some embodiments, the culturing comprises culturing the embryoid 30 body-like sphere in a first culture medium comprising Activin A; and thereafter culturing the embryoid body-like sphere in a second culture medium comprising N2 supplement-A, B27 supplement, and about 10 mM nicotinamide. In some embodiments, the culturing in the first culture medium is for about 48 hours. In -4- WO 2010/068758 PCT/US2009/067503 some embodiments, the culturing in the second culture medium is for at least about 12 days. In some embodiments, the endodermal cell or derivative thereof expresses a marker selected from the group consisting of Nkx6-1, Pdx 1, and C-peptide. 5 In some embodiments, the cell type of interest is a cardiomyocyte or a derivative thereof. In some embodiments, the culturing is for at least about 15 days. In some embodiments, the culture medium comprises a combination of basic fibroblast growth factor, vascular endothelial growth factor, and transforming growth factor P1 in an amount sufficient to cause a subset of the 10 embryoid body-like sphere cells to differentiate into cardiomyocytes. In some embodiments, the cardiomyocyte or derivative thereof expresses a marker selected from the group consisting of Nkx2-5/Csx and GATA4. In some embodiments, the embryoid body-like sphere is prepared by (a) growing a plurality of fibroblasts in monolayer culture on a tissue culture plate to 15 confluency; and (b) disrupting the monolayer culture to place at least a fraction of the plurality of fibroblasts into suspension culture under conditions sufficient to form one or more embryoid body-like spheres, wherein the one or more embryoid body-like spheres comprise a reprogrammed fibroblast. The presently disclosed subject matter also provides methods for 20 treating a disease, disorder, or injury to a tissue in a subject comprising administering to the subject a composition comprising a plurality of reprogrammed fibroblast cells in a pharmaceutically acceptable carrier, in an amount and via a route sufficient to allow at least a fraction of the reprogrammed fibroblast cells to engraft the tissue and differentiate therein, 25 whereby the disease, disorder, or injury is treated. In some embodiments, the disease, disorder, or injury is selected from the group consisting of an ischemic injury, a myocardial infarction, and stroke. In some embodiments, the subject is a mammal. In some embodiments, the mammal is selected from the group consisting of a human and a mouse. In some embodiments, the methods 30 further comprise differentiating the reprogrammed fibroblast cells to produce a pre-determined cell type prior to administering the composition to the subject. In some embodiments, the pre-determined cell type is selected from the group -5- WO 2010/068758 PCT/US2009/067503 consisting of a neural cell, an endoderm cell, a cardiomyocyte, and derivatives thereof. Thus, it is an object of the presently disclosed subject matter to provide methods for producing reprogrammed somatic cells. 5 An object of the presently disclosed subject matter having been stated hereinabove, and which is achieved in whole or in part by the presently disclosed subject matter, other objects will become evident as the description proceeds when taken in connection with the accompanying drawings as best described hereinbelow. 10 BRIEF DESCRIPTION OF THE DRAWINGS Figures 1A-1 I are a series of photographs showing that sphere formation triggered stable changes in triple knockout cells (TKOs; i.e., cells with disruptions in all three RB1 family genes: RB1, RBL1, and RBL2) morphology. Figure 1A shows TKOs at passage 4 in monolayer culture. Figure 1B 15 shows TKOs lacked contact inhibition and formed mounds after reaching confluence in culture. Figure 1C shows outgrowth of mounds, such as those shown in Figure 1 B, subsequently led to detachment from the plate and sphere formation. Figure 1 D shows TKO spheres two weeks after transfer to a non adherent plate. Figure 1 E shows central cavity formation (arrow) evident in 20 TKO spheres after several weeks in suspension culture. Figure 1F shows TKO spheres formed in suspension culture reattached when transferred back to tissue culture plates, and all cells in the spheres migrated back onto the plate to reform a monolayer. Figure 1 G shows a higher power view of the boxed region in Figure 1F. Figure 1H shows monolayers of sphere-derived cells two days 25 after spheres were transferred back to a tissue culture plate. Figure 11 shows cells in Figure 1 H after one week in culture. Note that cells in Figures 1 H and 11 had diverse morphologies, and further that they were smaller than TKO cells prior to sphere formation (Figure 1A). Figure 2A is a photograph of TKO cells placed in suspension following 30 trypsinization. These cells did not form spheres in suspension. The cells died after 24 hours. Similar results were seen with RB1~'~ murine embryonic fibroblasts (MEFs). -6- WO 2010/068758 PCT/US2009/067503 Figure 2B is a photograph of TKO-Ras cells (TKO MEFs that were infected with a retrovirus expressing oncogenic V12 Ras; Sage et aL, 2000) showing that they also did not form spheres in suspension culture. Like TKO cells, TKO-Ras were not contact inhibited, but they detached from culture 5 dishes as they became confluent and formed small groups or clusters of cells that survived in suspension and proliferated. These small groups or clusters of cells were distinguishable from the spheres of the presently disclosed subject matter in that individual cell borders remained visible and the cells were not tightly packed into a spherical structure with a defined border. 10 Figure 3 is a set of bar graphs and photographs depicting the results of soft agar assays of TKOs, TKO cells derived from spheres (TKO Sphere), and TKO cells that overexpress Ras (TKO-Ras). Two independent assays are shown. Equal numbers of cells were plated, and visible colonies were counted after 3 weeks. Colony size was similar with TKO cells derived from spheres and 15 TKO-Ras. Colonies formed with TKO cells were very small. The bar graphs below each photograph show the number of colonies per plate in each independent assay. Figures 4A and 4B show Western blot analyses of Ras expression and activity in MEFs, TKOs, and TKO-Ras cells. To produce TKO-Ras cells, TKOs 20 were infected with a V12 Ha Ras-expressing retrovirus as described in Telang etal., 2006. Figure 4A is a digital image of a Western blot showing total Ras expression in TKOs and in TKO-Ras cells. The bottom panel of Figure 4A shows P-actin expression, which was included as a loading control. Figure 4B 25 is a digital image of a Western blot showing activated Ras that was detected by binding to GST-Raf. The bottom panel of Figure 4B shows a Western blot of input total Ras protein used for each assay. Note that not only did TKO-Ras cells have an increased level of Ras relative to TKOs (Figure 4A), there was also an increased percentage of Ras that was activated in TKO-Ras cells 30 (Figure 4B). Figures 5A-5D are a series of photographs showing sphere formation in RB1~'~ MEFs led to stable morphological changes. -7- WO 2010/068758 PCT/US2009/067503 Figure 5A shows RB1'- MEFs in monolayer culture. Figure 5B shows spheres formed when cells were scraped from dishes and placed in suspension culture. Figure 5C shows re-adhesion of an RB1' MEF sphere to a tissue culture plate. Note that cells migrated from the sphere to reform a monolayer. 5 Figure 5D shows a higher power view of the cells in the box in Figure 5C. Cells in Figures 5A and 5D are similar magnification. Note the difference in size and morphology in Figures 5A and 5D. Figures 6A-6D provide the results of experiments showing that sphere formation led to expression of mRNAs for several stem cell markers in TKO 10 and RB1-'- MEF spheres, and to downregulation of RB1 family members (RB1, RBL1, and RBL2) in RB1- MEFs. Figure 6A is a bar graph depicting the results of Real Time PCR assays showing induction of mRNAs for stem cell markers in TKO and RB1* spheres after two weeks in suspension culture. Similar mRNA induction was maintained 15 in monolayers derived from the spheres. Figure 6B is a bar graph depicting the results of assays showing that Oct4 and Nanog mRNA increased in RB1' spheres with the number of days (d) in culture. Real Time PCR was used to analyze mRNA levels. Figure 6C is a series of photomicrographs showing the results of immunostaining for Oct4 in sections of RB1f MEFs after 4 and 24 20 days in culture. The right hand panels depict a higher power view. Note only cytoplasmic staining at 4 days, whereas nuclear staining is evident at 24 days. No staining was evident in the absence of the Oct4 primary antibody. Figure 6D is a bar graph providing the results of Real Time PCR demonstrating changes in expression of other mRNAs associated with stem cells and cancer stem cells 25 after two weeks in suspension culture (see also Figure 7). The comparison with respect to relative abundance is to expression of the listed genes cells in subconfluent monolayers. Figure 7 is a bar graph showing the results of Real Time PCR analysis of mRNA levels of the listed genes in RB1'/ cells after 8 days as spheres in 30 suspension culture compared to RB1- cells maintained as monolayers. Figures 8A-8D shows sphere formation in TKOs or RB1 MEFs generated cells with characteristics of a tumor side population (SP). -8- WO 2010/068758 PCT/US2009/067503 Immunostaining for Abcg2 and CD1 33 is shown on the left, and Hoechst dye staining is shown on the right. Figure 8A is a set of fluorescence micrographs showing TKOs in subconfluent monolayer culture. Figure 8B is a set of fluorescence micrographs 5 showing cells derived from TKO spheres after two weeks in suspension culture. Similar results were seen with cells derived from RB1f MEF spheres. Figure 8C is a bar graph showing quantification of SP (Hoechst~/Abcg2*/CD133*) cells. Figure 8D is a bar graph showing TKO and RB1' MEF sphere-derived cells separated into SP (Hoechst~/Abcg2*/CD133*) and main population (MP; 10 Hoechst*/Abcg2~/CD133-) and placed in culture (day 0). Atthe indicated times, the cells were again examined to quantify the appearance of MP cells within the SP population, and SP cells within the MP population. Figure 9 is a series of fluorescence micrographs of wild type MEFs and TKO cells maintained as subconfluent monolayers showing that these cells do 15 not express CD133 or Abcg2 (left panels) or exclude Hoechst dye (right panels). Figure 10 is a FACS plot of TKO cells derived from spheres stained with Hoechst 33342 and propidium iodide (PI) dyes followed by analysis and sorting using a MOFLO TM cell sorter. Living cells were visualized on dot-plots 20 according to their Hoechst red (Ho Red) and Hoechst blue (Ho Blue) fluorescence. SP cells excluding Hoechst 33342 were sorted from region R2 and the region enclosing only living cells identified based on PI staining (region R1, not shown). The percentage represented the content of SP in total sorted cells. Gates were set stringently to ensure no contamination with MP cells. 25 Assessment of sorted cells revealed 100% Hoechst~/Abcg2*/CD1 33* cells. Figure 11 is a bar graph showing about 50,000 sorted MP (Hoechst*/Abcg27/CD133~) and SP (Hoechst~/Abcg2*/CD133*) cells derived from spheres after two weeks in suspension culture placed in culture at day 0. SP and MP cells were then counted in the two populations after 3 days in 30 culture. Note that SP cell number remained constant in the sorted SP cells, while this population gave rise to MP cells. Also note that sorted MP cells gave rise to a small population of SP cells (-1%) by day three in culture. -9- WO 2010/068758 PCT/US2009/067503 Figures 12A-12E are a series of bar graphs showing that SP cells expressed mRNAs for stem cell markers, overexpressed the epithelial mesenchymal transition (EMT) transcription factor Zeb1, and they had a CD44high/CD24' " mRNA pattern. 5 Figures 12A shows TKO sphere-derived cells separated into SP (Hoechst-/Abcg2*/CD1 33*) and MP (Hoechst*/Abcg2~/CD1 33~) by cell sorting, and Real Time PCR was used to assess the relative level of mRNAs or stem cell markers in these populations compared to expression levels of these same markers in ES cells per se maintained in monolayer culture in the presence of 10 LIF. Results shown are normalized to p-actin (ACTB) mRNA, but similar results were seen with normalization to glyceraldehyde 3-phosphate dehydrogenase (Gapdh) mRNA or p 2 -microglobulin mRNA. Figure 12B shows that Zeb1, but not Zeb2, Snail, or Snai2 mRNA was induced in SP cells compared to the MP or unsorted sphere-derived cells. Figure 12C shows that Zeb1 mRNA was 15 induced in a time course during culture of RB1f MEFs in suspension. Real Time PCR results are shown. Figure 12D shows that CD44 mRNA was induced in SP cells, whereas CD24 was diminished. Real Time PCR results are shown. Figure 12E shows that knockdown of Zeb1 (Zeb1 sh) but not Zeb2 (Zeb2 sh) induced expression of CD24 mRNA. Lentiviral shRNA constructs were used to 20 infect MEFs and efficiently knockdown Zeb1 and Zeb2 (see Figure 13), and Real Time PCR results are shown. Figures 13A-1 3E show the results of lentiviral vector expression of green fluorescent protein (GFP) and shRNAs for Zeb1 or Zeb2 used to infect MEFs. Infection efficiency was >80%. 25 Figure 13A is a set of photomicrographs showing an example of GFP expression in MEFs infected with a GFP-expressing lentiviral vector. Figures 13B and 13C are bar graphs showing RNA levels determined by Real Time PCR. Figures 13D and 13E are digital images of Western blots. shRNA sequences for mouse Zeb1 and Zeb2 knockdown are described in Nishimura et 30 al, 2006 and in the Method and Materials for the EXAMPLES section hereinbelow. Figures 14A-14D are a series of photomicrographs showing TKO cells formed spheres when cultured in non-adherent plates. -10- WO 2010/068758 PCT/US2009/067503 Figure 14A shows that after 2 weeks, spheres began to form central cavities (denoted by the arrow). Figures 14B-14D show that the spheres aggregated into larger structures. Such structures are shown after 2 months in culture. Figures 14C and 14D are hematoxylin and eosin (H&E)-stained 5 sections of the boxed region in Figures 14B and 14C, respectively. Figures 15A-151 are a series of photomicrographs of H&E-stained sections of TKO spheres and aggregates after 3 weeks in non-adherent plates. Diverse cell morphologies are shown in the photomicrographs. Figure 15A shows a low power view of spheres containing cells of 10 varying morphologies merging to form a large spherical structure. Figures 15B and 15C show cells with morphologies of hematopoietic cells. Figures 15D-1 51 show cells with neural tissue morphologies. Figure 15D shows H&E staining demonstrating cells with elongated projects resembling neurons. Figures 15E and 15F show cells with neuronal morphology and tissue 15 resembling brain. Figures 15G-151 show additional cells with elongated morphology of neurons. Figures 16A-16F are a series of bar graphs showing sphere formation triggered induction of mRNAs representative of the three embryonic layers as well as mRNAs in important developmental signaling pathways. Figures 16A 20 16F show the results of Real Time PCR used to analyze the effect of sphere formation on expression of mRNAs representative of different embryonic layers (endoderm: Figure 16A; ectoderm: Figure 16B; and mesoderm: Figure 16C), and the Wnt (Figure 16D), Notch (Figure 16E), and various growth factor (Figure 16F) developmental signaling pathways. Relative mRNA expression in 25 TKO subconfluent monolayers was compared to cells derived from TKO spheres which had been in suspension culture for three weeks. Similar results were seen with the spheres themselves. See Figure 7 for similar analyses of RB1 MEF spheres. Figures 17A-17L are a series of photomicrographs of the results of 30 immunostaining RB1' spheres showing expression of markers representative of the three embryonic layers. Figure 17A is an H&E stained section of an RB1-/ MEF sphere after two weeks in suspension culture. An arrow denotes the edge of the sphere. Figure -11- WO 2010/068758 PCT/US2009/067503 17B is a higher power view of the perimeter of the sphere in Figure 17A. Note the band of cells with endodermal-like morphology and eosinophilic cytoplasm. Figure 17C is a higher power view of the region immediately interior to the band of cells at the perimeter of the sphere. Note cells with epithelial-like 5 morphology. Figures 17D-1 7L show the results of immunostaining sections of RB1- MEF spheres with antibodies directed against AFP (Figures 17D and 17E), globin (Figures 17F-17H), CD31 (Figures 171 and 17J), Cdh1 (Figure 17K), and p-1ll tubulin (Figure 17L). A Nomarski image (panel 1), followed by immunostaining (panel 2), 4,6'-diamidino-2-phenylindole (DAPI) staining (panel 10 3), and a merged image (panel 4) for each of Figures 17D-17L. Arrows denote the same position in each panel. AFP: a-fetoprotein; HB: hemoglobin; Tubb3: p-1ll tubulin; Cdh1: E-cadherin. Figure 18 is a series of photomicrographs of the results of immunostaining of 3 week old TKO spheres for representative markers of 15 differentiation. a-fetoprotein (AFP); GATA4 (GATA); vimentin (Vim);ca-tyrosine hydroxylase (cTH); p-Ill tubulin; myelin basic protein (MBP); Is11; tyrosine hydroxylase (TH); and glial acidic fibrillary protein (GFAP). Wild type MEFs and TKOs prior to sphere formation did not immunostain for AFP, GATA4, TH, Is|1, MBP, GFAP, or Tubb3. Wild type MEFs did express vimentin. 20 Figures 19A-19T are a series of photomicrographs of RB1~'~ MEF spheres after 24 days in suspension. Figures 19A-1 9P show autofluorescence in conjunction with H&E staining to allow assessment of cellular morphology. Note that most of the autofluorescent cells are nucleated, however, a subset of the cells lack nuclei (Figures 19N-19P). Cells in the perimeter of the spheres 25 immunostained for globin (Figures 19N-19R). Little green autofluorescence was seen in the absence of the primary globin antibody (Figures 19Q-19R). However, autofluorescence of the globin* cells was seen with a red filter. This autofluorescence completely overlapped with globin immunostaining. In addition to globin* cells, H&E staining showed cells with characteristics of other 30 hematopoietic cells (Figures 19S and 19T). Note the large multinucleated cell in the center resembling a megakaryocyte. Figures 20A-20L are a series of photographs and photomicrographs showing that SP cells are the primary tumorigenic population in the spheres, -12- WO 2010/068758 PCT/US2009/067503 and tumors derived from these cells consists of cancer cells and neuronal whorls. Figure 20A is a photograph showing tumors formed in nude mice three weeks after injection of 100 SP cells subcutaneously into the hind leg. Figure 5 20B is a photograph showing that tumors failed to form when 20,000 MP cells were injected. Figures 20C and 20D show that both TKO-Ras cells (Figure 20C) and MP cells (Figure 20D) formed tumors when 50,000 cells were injected. These tumors were indistinguishable histologically, and appeared to be spindle cell sarcomas. Multiple tumors from the two cell types showed the 10 same histology. H&E-stained sections are shown. Figure 20E shows an H&E stained section of a tumor formed three weeks after injection of 100 SP cells. Note the presence of numerous closely packed whorls with eosinophilic centers. Figure 20F is a higher power view of a whorl in the tumor from Figure 20E. Figure 20G shows a Nomarksi image of a section of the tumor in Figure 15 20E. Figure 20H shows immunostaining of the section in Figure 20G for p-Ill tubulin. Arrows indicate the same position in Figure 20G and Figure 20H. Only the whorls immunostained, and tumors derived form MP and TKO-Ras cells lacked these whorls and did not immunostain. Figures 201 and Figure 20J show nuclear immunostaining for Oct4 in a section of an SP cell tumor. The boxed 20 region in Figure 201 is shown at higher power in Figure 20J. Figure 20K and Figure 20L show nuclear immunostaining for Nanog in a section of the SP tumor. Figure 20L is a higher power view of the section shown in Figure 20K. Figures 21A-21 D are a series of photomicrographs of tumors formed in nude mice. 25 Figure 21A is an H&E-stained section of a tumor formed following injection of spheres of small TKO after two weeks in suspension culture into nude mice. Figure 21 B is an H&E section of a tumor formed following injection of two week old RB1~'~ MEF spheres into nude mice. Note spheres/whorls with eosinophilic centers. Figure 21C shows a Nomarski image of the tumor in 30 Figure 21B. Arrows indicate spheres/whorls. Figure 21D depicts immunostaining of Figure 21C for p-Ill tubulin (Tubb3). Figures 22A-22D depict analysis of spheres formed from wild type (i.e., RB1 ', RBL1 +', and RBL2**+) murine embryonic fibroblasts (MEFs). -13- WO 2010/068758 PCT/US2009/067503 Figure 22A is a photomicrograph of spheres formed by wild type MEFs after one week in suspension culture, demonstrating that wild type fibroblasts can form spheres and survive in suspension culture. Figure 22B is a bar graph showing the results of Real Time PCR assays of the induction of mRNAs for 5 genes associated with embryonic stem (ES) cells. Upregulation of the stem cell markers Oct4, Nanog, Klf4, Sox2, and SSEA1 was observed, suggested that MEFs present within the spheres were reprogrammed to an ES cell-like gene expression pattern by the techniques disclosed herein. Also, the mRNA forthe epithelial-mesenchymal transition (EMT) transcription factor ZebI was induced. 10 Figure 22C is a series of photomicrographs of immunostaining of the spheres shown in Figure 22A showing regions of cells expressing the stem cell markers Oct4, Nanog, and SSEA1. Figure 22D is a bar graph of Real Time PCR showing expression of mRNAs for a variety of transcription factors that drive differentiation as well as markers of differentiation of cell types from all three 15 embryonic layers. mRNA expression was examined in spheres of wild type MEFs after one week in suspension culture. Figures 23A-23P are photomicrographs of spheres formed from human foreskin fibroblasts (Figures 23A-23G) or wild type MEFs (Figures 23H-23P) after 2 weeks in culture. 20 Figure 23A is a photomicrograph of endodermal-like cells at the border of the sphere after H&E staining. Figures 23B and 23C show H&E staining of cells resembling nucleated blood cells. Figure 23D shows benzidine staining which demonstrated the presence of hemoglobin. Figures 23E-23G show the results of immunostaining the field shows in Figure 23A for the endodermal 25 marker a-fetoprotein (AFP; see Figure 23E), the endothelial marker CD31 (see Figure 23F), and a-globin (see Figure 23G). Each of Figures 23E-23G includes five panels: Nomarski images (panel 1), DAPI staining (panel 2), immunostaining for the indicated genes (panel 3), merges of panels 2 and 3 (panel 4), and merges of panels 1-3 (panel 5). Figures 23H and 231 show low 30 and high power views of H&E stained sections showing endothelial cells (gray arrow in Figure 231) surrounding a blood vessel. A ductal structure is shown by the white arrow in Figure 231. Figure 23J shows benzidine staining of wild type MEF spheres and demonstrates the presence of hemoglobin in the cells of -14- WO 2010/068758 PCT/US2009/067503 these spheres. Figure 23K, panel 1 shows an H&E stain of an erythrocyte, and Figure 23K, panel 2 shows immunostaining of an adjacent section of the sphere for globin, demonstrating that this erythrocyte expressed hemoglobin. Figure 23L shows immunostaining of another erythrocyte for globin. This cell 5 was nucleated as demonstrated by DAPI nuclear staining (panel 1), and was positive for globin (panel 2; panel 3 shows a merge of panels 1 and 2) demonstrating that wild type MEF spheres contained both nucleated and mature erythrocytes. Figure 23M shows DAPI staining (panel 1 ); immunostaining for CD31, which is a marker of endothelial cells (panel 2); and 10 a merge of panels 1 and 2 (panel 3); and demonstrates that endothelial cells are formed in the wild type MEF spheres. Figures 23N and 230 are photomicrographs showing a region of cartilage stained with alcian blue. Figure 23P is a photomicrograph showing pearls of keratin (dark staining) in an keratinized cyst. 15 Figures 24A-24F are photomicrographs of wild type MEFs allowed to form spheres in suspension culture for 3 weeks, demonstrating that these cells gave rise to differentiated structures and tissues. Figure 24A is a photomicrograph showing showing a secretory epithelial ascinar like structure with a central duct (arrow). Figure 24B is a 20 photomicrograph showing secretory ducts (gray arrows) and red blood cells (white arrow). Figures 24C and 24D are photomicrographs showing immunostaining for the epithelial marker E cadherin (Cdh1) and the neuronal marker p-l1l tubulin. Nuclear staining with DAPI is shown. Figures 24E and 24F (the latter an enlargement of the field in the box in Figure 24E) show hair fibers 25 at the border of the spheres (the border is identified by black arrows). Figures 25A-25Q are a series of photomicrographs of spheres produced by Hoechst~/Abcg2*/CD1 33* cells derived from wild type MEFs after 2 weeks in culture. The Hoechst~/Abcg2*/CD133* cells were isolated by cell sorting and cultured on a feeder layer of irradiated fibroblasts. Hoechst~/Abcg2*/CD133* 30 cells are shown on feeder layers after one day (Figures 25A and 2513) and after one week in culture (Figure 25C). Immunostaining for the indicated markers is shown after one week in monolayer culture in Figures 25D-25Q. Each of Figures 25D-25Q includes three panels: the left panels show Nomarski images, -15- WO 2010/068758 PCT/US2009/067503 the center panels show immunostaining for the indicated markers of the same fields as shown in the Nomarski images as well as nuclear localization with DAPI, and the right panels show merges of the left and center panels for each Figure. 5 Figures 26A-26E are a series of photomicrographs of teratoma formation by Hoechst~/Abcg2*/CD133* cells derived from wild type MEF spheres after 2 weeks in suspension culture. Four independent preparations of 50,000 cells were injected into both hindlimbs of nude mice. Tumors were observed in all 8 injections, and were tumors were Collected after three weeks. 10 Figure 26A is a Normarski image of a teratoma. Figure 26B is a higher power view of an adjacent section of the tumor stained with H&E. Note the variety of structures characteristic of a teratoma. Figure 26C shows DAPI nuclear staining of the section presented in Figure 26A. The MEFs were isolated from Actin-GFP mice and immunostaining for GFP in Figure 26D, 15 which shows that the tumor is GFP* whereas surrounding host tissue is GFP~. Figure 26E is a merge of Figures 26C and 26D. Figures 27A-27H are a series of photomicrographs of teratomas formed with Hoechst-/Abcg2*/CD133* cells derived from wild type MEF spheres showing cobblestone epithelial morphology and expressing the epithelial 20 specification protein E-cadherin. Figures 27A-27D are a series of low power views. A Nomarski image of the section is shown in Figure 27A. DAPI nuclear Staining is shown in Figure 27B and E-cadherin immunostaining on the surface of the cells is shown in Figure 27C. A merge of Figures 27Band 27C is shown in Figure 27D. Figures 25 27E-27H are a series of higher power images. A Nomarski image is shown in Figure 27E. DAPI nuclear staining is shown in Figure 27F and E-cadherin immunostaining on the surface of the cells is shown in Figure 27G. A merge of Figures 27F and 27G is shown in Figure 27H. Figures 28A-28P are a series of photomicrographs showing the 30 formation of differentiated tissues in teratomas produced from Hoechst~ /Abcg2*/CD133* cells isolated from wild type MEF spheres. Tumors were isolated 3 weeks after injection of 50,000 cells and sectioned for immunostaining. -16- WO 2010/068758 PCT/US2009/067503 Figure 28A is a Nomarski image of adipose tissue present in a teratoma. Figure 28B shows DAPI staining showing cell nuclei. Figure 28C shows immunostaining for GFP showing that the adipose tissue is derived from the injected Hoechst/Abcg2*/CD1 33* cells. Figure 28D is a merge of Figures 28B 5 and 28C. Figure 28E is a Nomarski image of a neuronal structure in a teratoma. Figure 28F shows DAPI nuclear staining of the section in Figure 28D. Figure 28G shows immunostaining of the section of Figure 28E for p-Ill tubulin, showing a cluster of neurons within a neuronal structure in the teratoma. Figure 10 28H is a merge of Figures 28F and 28G. Figure 281 is a Nomarski image of a region of intestinal-like epithelium in a teratoma. Figure 28J shows DAPI nuclear staining of the section of Figure 281. Figure 28K shows immunostaining for GFP, and shows that this intestinal like structure is derived from injected Hoechst~/Abcg2*/CD133* cells. Figure 15 28L is a merge of Figures 28J and 28K. Figure 28M is a Nomarski image of a secretory epithelial structure in a teratoma. Figure 28N shows DAPI nuclear staining in the structure of Figure 28M. Figure 280 shows GFP immunostaining and demonstrates that the structure in Figure 28M is derived from the injected Hoechst7/Abcg2*/CD1 33* 20 cells. Figure 28P shows the results of immunostaining for CDH1, which demonstrates that the structure shown is epithelial. These results demonstrates multiple differentiated tissues in the teratoma formed with Hoechst /Abcg2*/CD133* cells derived from wild type MEF cells following sphere formation. 25 Figures 29A-291 are a series of photomicrographs showing formation of skeletal muscle in a teratoma arising from injection of wild type MEF Hoechst /Abcg2*/CD133* cells derived from spheres into nude mice. Figure 29A is a photomicrograph of an H&E stained section showing skeletal muscle fibers in the teratoma. A Nomarski image of an adjacent section is shown as Figure 30 29B. DAPI nuclear staining is shown in Figure 29C, and GFP staining is shown in Figure 29D, demonstrating that the muscle cells ware tumor-derived. A merge is shown in Figure 29E. Figures 29F-291 are a series of control photomicrographs. A Nomarski image of host skeletal muscle is shown in -17- WO 2010/068758 PCT/US2009/067503 Figure 29F. DAPI staining is shown in Figure 29G and GFP is shown in Figure 29H. There was a lack of GFP staining in Figure 29H, which is host muscle that does not express GFP. Figures 30A-30K are a series of micrographs of MEF spheres after two 5 weeks in suspension culture. Spheres attached to the plates and cells began to migrate out onto the plate as with TKO and RB1 MEF spheres. However, in contrast to the TKO and RB1 MEFs, only a portion of the cells from the wild type MEF spheres migrated back onto the plate. These cells were highly pigmented (see Figures 30A-30C). Initially, most of the cells were rounded or 10 epithelial in appearance. However after several days on the plate, the cells remained pigmented but they began to elongate (see Figures 30D-30F). Figures 30G and 30H show lower power views of the cells. Figures 301-30K each consist of five panels. Figures 301 and 30J show immunostaining of these cells for the melanocyte marker Miff, and Figure 30K shows immunostaining of 15 the cells for a second melanocyte marker Mel5. Taken together, these results demonstrated that immature melanosomes were formed in the spheres (the highly pigmented cells lacking dendritic extensions in Figures 30A-30D), and when the spheres were allowed to attached to a culture plate these cells migrated from the spheres onto the plate and undewent differentiation as 20 characterized by dendrite formation and expression of two markers of melanocytes. Melanocyte differentiation is also a property shared by ES cells and iPSCs. Figure 31 is a bar graph showing gene expression analysis of the cells shown in Figure 30. The Real Time PCR results for mRNA levels were 25 compared to monolayers of control wild type MEFs prior to sphere formation. Figures 32A-32J are a series of photomicrographs showing primary cultures of human lung bronchial epithelial cells grown to confluence, scraped from tissue culture dishes, and placed in suspension culture in non-adherent plates as described herein for fibroblasts. Spheres were allowed to form for 5 30 days, and then the spheres were fixed and sectioned into 5 micron sections. Figures 32A-32C show sections of the sphere stained with H&E (Figure 32A) and globin (Figure 328) to demonstrate erythrocyte differentiation in the sphere. Figures 32D-321 show higher power views of the spheres showing -18- WO 2010/068758 PCT/US2009/067503 erythrocytes immunostaining for globin. Figure 32J shows benzidine staining of a section of the sphere, further demonstrating the presence of hemoglobin. These results demonstrated that wild type human lung epithelial cells can also form spheres in suspension and undergo differentiation into erythrocytes 5 expressing hemoglobin. These spheres also showed cells with a variety of morphologies, suggesting that like wild type MEFs and human foreskin fibroblasts, the epithelial cells could also undergo differentiation into a variety of cells types in the spheres, thereby extending the presently disclosed sphere formation technique to wild type human epithelial cells. 10 Figure 33 depicts a model proposing a pathway for generation of cells with properties of cancer stem cells from differentiated somatic cells. BRIEF DESCRIPTION OF THE SEQUENCE LISTING SEQ ID NOs: 1-70 are the nucleotide sequences of oligonucleotide primers that can be employed in pairwise combination (e.g., SEQ ID NOs: 1 15 and 2; SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, etc.) to detect the expression of the 25 genes listed in Table 1 below. SEQ ID NO: 71 is the nucleotide sequence of an oligonucleotide that specifically binds to an SP6 promoter fragment. SEQ ID NO: 72 is a nucleotide sequence of an exemplary shRNA sense 20 strand that can be used to knockdown expression of Zeb1. SEQ ID NO: 73 is a nucleotide sequence of an exemplary shRNA sense strand that can be used to knockdown expression of Zeb2. SEQ ID NO: 74 is a nucleotide sequence of a control shRNA sense strand that can be used to test the specificity of the shRNAs comprising SEQ 25 ID NO: 72 or SEQ ID NO: 73 used to knockdown expression of Zeb1 or Zeb2, respectively. Table 1 Summary of PCR Primers Employed for Detection of Stem Cell Markers and Markers of Differentiation Tm Ampl. Gene Primer Pair Sequences (*C) Size Aldob AGTGGCGTGCTGTGTTGAG (SEQ ID NO: 1) 61 122 bp AACAATAGGGACCAGCCCATT (SEQ ID NO: 2) 62 -19- WO 2010/068758 PCT/US2009/067503 Acta2 GTCCCAGACATCAGGGAGTAA (SEQ ID NO: 3) 59 102 bp TCGGATACTTCAGCGTCAGGA (SEQ ID NO: 4) 63 Des GTGGATGCAGCCACTCTAG (SEQ ID NO: 5) 57 218 bp TTAGCCGCGATGGTCTCATA(SEQ ID NO: 6) 62 CD34 AAGGCTGGGTGAAGACCCTTA (SEQ ID NO: 7) 62 157 bp TGAATGGCCGTTTCTGGAAGT (SEQ ID NO: 8) 64 Co14 CAAGCATAGTGGTCCGAGTC (SEQ ID NO: 9) 58 463 bp AGGCAGGTCAAGTTCTAGCG (SEQ ID NO: 10) 60 GATA4 CACCCCAATCTCGATATGTTT (SEQ ID NO: 11) 59 151 bp GGTTGATGCCGTTCATCTTGT (SEQ ID NO: 12) 62 Myh2 AAGTGACTGTGAAAACAGAA (SEQ ID NO: 13) 51 222 bp GCAGCCATTTGTAAGGGTTGA (SEQ ID NO: 14) 62 LAMB- GAAAGGAAGACCCGAAGAAA (SEQ ID NO: 15) 58 131 bp 1 CCATAGGGCTAGGACACCAAA (SEQ ID NO: 16) 61 Nes AACTGGCACACCTCAAGATGT (SEQ ID NO: 17) 56.8 235 bp TCAAGGGTATTAGGCAAGGGG (SEQ ID NO: 18) 56.5 Trf TCCTCCACTCAACCATTCTT (SEQ ID NO: 19) 57 149 bp TCAAGGCAGAGCAGTTCATA (SEQ ID NO: 20) 57 FGFR2 GGATCTTCATGGTGAATGTCA (SEQ ID NO: 21) 58 103 bp CTCTGGTTGCTCCTGTTCTCA (SEQ ID NO: 22) 61 BMP4 GACTTCGAGGCGACACTTCTA (SEQ ID NO: 23) 60 267 bp GTTGAAGAGGAAACGAAAAGCA (SEQ ID NO: 24) 61 FGF9 TCTTCCCCAACGGTACTATC (SEQ ID NO: 25) 57 124 bp CCGAGGTAGAGTCCACTGT (SEQ ID NO: 26) 55 Oct4 AGTTGGCGTGGAGACTTTGC (SEQ ID NO: 27) 58.2 160 bp CAGGGCTTTCATGTCCTGG (SEQ ID NO: 28) 56 Prom1 GTTGAGACTGTGCCCATGAAA (SEQ ID NO: 29) 55.5 98 bp GACGGGCTTGTCATAACAGGA (SEQ ID NO: 30) 57 Msil CCTCTCACGGCTTATGGGC (SEQ ID NO: 31) 58.1 271 bp CTGTGGCAATCAAGGGACC (SEQ ID NO: 32) 56.2 -20- WO 2010/068758 PCT/US2009/067503 CD44 TCTGCCATCTAGCACTAAGAGC (SEQ ID NO: 33) 56.3 106 bp GTCTGGGTATTGAAAGGTGTAGC (SEQ ID NO: 34) 55.4 CD24a ACCCACGCAGATTTACTGCAA (SEQ ID NO: 35) 57.2 101 bp CCCCTCTGGTGGTAGCGTTA (SEQ ID NO: 36) 58.7 Flot2 TGTGAGGACGTAGAGACGG (SEQ ID NO: 37) 55.8 148 bp GCAGCACGACGTTCTTAATGTC (SEQ ID NO: 38) 56.5 Nanog TTGCTTACAAGGGTCTGCTACT (SEQ ID NO: 39) 56 106 bp ACTGGTAGAAGAATCAGGGCT (SEQ ID NO: 40) 55.4 Sox2 GCGGAGTGGAAACTTTTGTCC (SEQ ID NO: 41) 56.7 157 bp CGGGAAGCGTGTACTTATCCTT (SEQ ID NO: 42) 56.7 Stat3 AGCTGGACACACGCTACCT (SEQ ID NO: 43) 58.7 190 bp AGGAATCGGCTATATTGCTGGT (SEQ ID NO: 44) 56 Scale AGGAGGCAGCAGTTATTGTGG (SEQ ID NO: 45) 57.4 114 bp CGTTGACCTTAGTACCCAGGA (SEQ ID NO: 46) 55.9 ACTB GGCTGTATTCCCCTCCATCG (SEQ ID NO: 47) 57.6 154 bp CCAGTTGGTAACAATGCCATGT (SEQ ID NO: 48) 55.9 GAPDH AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 49) -57.6 123 bp TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO: 50) 55.1 Pax3 GGGCAGAATTACCCACGCA (SEQ ID NO: 51) 58.1 154 bp CTGGCGAGAAATGACGCAA (SEQ ID NO: 52) 55.9 Soxl0 ACACCTTGGGACACGGTTTTC (SEQ ID NO: 53) 57.9 123 bp TAGGTCTTGTTCCTCGGCCAT (SEQ ID NO: 54) 58.1 Tyr AGTCGTATCTGGCCATGGCTTCTT (SEQ ID NO: 55) 60.3 145 bp ACAGCAAGCTGTGGTAGTCGTCTT (SEQ ID NO: 56) 60.4 Tyrp1 ATACTGGGACCAGATGGCAACACA (SEQ ID NO: 57) 60.3 137 bp AAGCGGGTCCTTCGTGAGAGAAAT (SEQ ID NO: 58) 60.3 RPE65 TGGATCTCTGTTGCTGGAAAGGGT (SEQ ID NO: 59) 60.3 177 bp AGGCTGAGGAGCCTTCATAGCATT (SEQ ID NO: 60) 60.2 MITF TTGATGGATCCGGCCTTGCAAATG (SEQ ID NO: 61) 60.3 165 bp TATGTTGGGAAGGTTGGCTGGACA (SEQ ID NO: 62) 60.5 -21- WO 2010/068758 PCT/US2009/067503 MITF-A TTCACGAAGAACCCAAAACC (SEQ ID NO: 63) 53.3 135 bp AGTTGCTGGCGTAGCAAGAT (SEQ ID NO: 64) 57.1 MITF-H GATGGAGGCGCTTAGATTTGA (SEQ ID NO: 65) 54.9 139 bp CATGAGTTGCTGGCGTAGCA (SEQ ID NO: 66) 58 MITF-M GCTGGAAATGCTAGAATAC (SEQ ID NO: 67) 48.1 172 bp GGCTGGCATGTTTATTTGCT (SEQ ID NO: 68) 54.2 ACTB GGCTGTATTCCCCTCCATCG (SEQ ID NO: 69) 57.6 154 bp CCAGTTGGTAACAATGCCATGT (SEQ ID NO: 70) 55.9 DETAILED DESCRIPTION Disclosed herein in some embodiments is the discovery that outgrowth of fibroblasts in which all three retinoblastoma (RB1) family members have 5 been mutated (referred to herein as "triple knockouts"; TKOs) into spheres led to stable reprogramming of the cells to a cancer stem cell phenotype. While fibroblasts containing only an RB1 mutation retained cell contact inhibition, bypassing this inhibition by forcing the cells to form spheres in suspension led to downregulation of RBL1 and RBL2, and to similar reprogramming of the 10 RB1- cells to a cancer stem cell phenotype. These cancer stem cells not only divided asymmetrically to produce cancer cells, they also generated differentiated cells. The results presented herein provide evidence of a potential pathway for generation of cancer stem cells from differentiated somatic cells. Based at least in part on these findings, disclosed herein is a 15 new tumor suppressor function for the RB1 pathway that imposes contact inhibition to prevent outgrowth of differentiated somatic cells into spherical structures where reprogramming to cancer stem cells can occur. Also disclosed herein is the discovery that when wild type mouse or human fibroblasts were induced to form spheres, they were also 20 reprogrammed, but these cells only gave rise to differentiated cells; i.e., they did not produce cancer stem cells or cancer cells. Therefore, an intact RB1 pathway can prevent cancer cell formation when fibroblasts are reprogrammed by sphere formation. 25 -22- WO 2010/068758 PCT/US2009/067503 1. Definitions All technical and scientific terms used herein, unless otherwise defined below, are intended to have the same meaning as commonly understood by one of ordinary skill in the art. References to techniques employed herein are 5 intended to refer to the techniques as commonly understood in the art, including variations on those techniques or substitutions of equivalent techniques that would be apparent to one of skill in the art. While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently 10 disclosed subject matter. Following long-standing patent law convention, the terms "a", "an", and "the" mean "one or more" when used in this application, including the claims. Thus, the phrase "a stem cell" refers to one or more stem cells, unless the context clearly indicates otherwise. 15 Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". The term "about", as used herein when referring to a measurable value such as an amount of mass, weight, time, volume, concentration or percentage 20 is meant to encompass variations of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1 % from the specified amount, as such variations are appropriate to perform the disclosed methods. Accordingly, unless indicated to the contrary, the numerical 25 parameters set forth in this specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently disclosed subject matter. As used herein, the term "and/or" when used in the context of a list of entities, refers to the entities being present singly or in combination. Thus, for 30 example, the phrase "A, B, C, and/or D" includes A, B, C, and D individually, but also includes any and all combinations and subcombinations of A, B, C, and D. -23- WO 2010/068758 PCT/US2009/067503 The term "comprising", which is synonymous with "including" "containing", or "characterized by", is inclusive or open-ended and does not exclude additional, unrecited elements and/or method steps. "Comprising" is a term of art that means that the named elements and/or steps are present, but 5 that other elements and/or steps can be added and still fall within the scope of the relevant subject matter. As used herein, the phrase "consisting of" excludes any element, step, or ingredient not specifically recited. For example, when the phrase "consists of" appears in a clause of the body of a claim, rather than immediately following 10 the preamble, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole. As used herein, the phrase "consisting essentially of"limits the scope of the related disclosure or claim to the specified materials and/or steps, plus those that do not materially affect the basic and novel characteristic(s) of the 15 disclosed and/or claimed subject matter. For example, a pharmaceutical composition can "consist essentially of' a pharmaceutically active agent or a plurality of pharmaceutically active agents, which means that the recited pharmaceutically active agent(s) is/are the only pharmaceutically active agent(s) present in the pharmaceutical composition. It is noted, however, that 20 carriers, excipients, and other inactive agents can and likely would be present in the pharmaceutical composition. With respect to the terms "comprising", "consisting essentially of', and "consisting of', where one of these three terms is used herein, the presently disclosed and claimed subject matter can include the use of either of the other 25 two terms. For example, the presently disclosed subject matter relates in some embodiments to compositions that comprise reprogrammed cells. It is understood that the presently disclosed subject matter thus also encompasses compositions that in some embodiments consist essentially of reprogrammed cells, as well as compositions that in some embodiments consist of 30 reprogrammed cells. Similarly, it is also understood that in some embodiments the methods of the presently disclosed subject matter comprise the steps the steps that are disclosed herein and/or that are recited in the claims, in some embodiments the methods of the presently disclosed subject matter consist -24- WO 2010/068758 PCT/US2009/067503 essentially of the steps that are disclosed herein and/or that are recited in the claims, and in some embodiments the methods of the presently disclosed subject matter consist of the steps that are disclosed herein and/or that are recited in the claim. 5 The term "subject" as used herein refers to a member of any invertebrate or vertebrate species. Accordingly, the term "subject" is intended to encompass any member of the Kingdom Animalia including, but not limited to the phylum Chordata (i.e., members of Classes Osteichythyes (bony fish), Amphibia (amphibians), Reptilia (reptiles), Aves (birds), and Mammalia 10 (mammals)), and all Orders and Families encompassed therein. Similarly, all genes, gene names, and gene products disclosed herein are intended to correspond to homologs and/or orthologs from any species for which the compositions and methods disclosed herein are applicable. Thus, the terms include, but are not limited to genes and gene products from humans 15 and mice. It is understood that when a gene or gene product from a particular species is disclosed, this disclosure is intended to be exemplary only, and is not to be interpreted as a limitation unless the context in which it appears clearly indicates. Thus, a given nucleic acid or amino acid sequence is intended to encompass homologous and/or orthologous genes and gene products from 20 other animals including, but not limited to other mammals, fish, amphibians, reptiles, and birds. The methods of the presently disclosed subject matter are particularly useful for warm-blooded vertebrates. Thus, the presently disclosed subject matter concerns mammals and birds. More particularly provided is the isolation, 25 manipulation, and use of reprogrammed somatic cells from mammals such as humans and other primates, as well as those mammals of importance due to being endangered (such as Siberian tigers), of economic importance (animals raised on farms for consumption by humans) and/or social importance (animals kept as pets or in zoos) to humans, for instance, carnivores other than humans 30 (such as cats and dogs), swine (pigs, hogs, and wild boars), ruminants (such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels), rodents (such as mice, rats, and rabbits), marsupials, and horses. Also provided is the use of the disclosed methods and compositions on birds, including those kinds of birds -25- WO 2010/068758 PCT/US2009/067503 that are endangered, kept in zoos, as well as fowl, and more particularly domesticated fowl, e.g., poultry, such as turkeys, chickens, ducks, geese, guinea fowl, and the like, as they are also of economic importance to humans. Thus, also provided is the isolation, manipulation, and use of reprogrammed 5 somatic cells from livestock, including but not limited to domesticated swine (pigs and hogs), ruminants, horses, poultry, and the like. The term "isolated", as used in the context of a nucleic acid or polypeptide (including, for example, a peptide), indicates that the nucleic acid or polypeptide exists apart from its native environment. An isolated nucleic acid 10 or polypeptide can exist in a purified form or can exist in a non-native environment. The terms "nucleic acid molecule" and "nucleic acid" refer to deoxyribonucleotides, ribonucleotides, and polymers thereof, in single-stranded or double-stranded form. Unless specifically limited, the term encompasses 15 nucleic acids containing known analogues of natural nucleotides that have similar properties as the reference natural nucleic acid. The terms "nucleic acid molecule" and "nucleic acid" can also be used in place of "gene", "cDNA", and "mRNA". Nucleic acids can be synthesized, or can be derived from any biological source, including any organism. 20 Several genes are disclosed herein. Representative sequences of nucleic acid and amino acid products from these genes are set forth in Table 2. It is understood that while Table 2 discloses Accession Numbers for certain of these genes that can be found in the GENBANK@ database as they relate to humans and mice, other sequences from humans, mice, and other species are 25 also included within the scope of the present disclosure and would be known and/or identifiable by one of ordinary skill in the art after consideration of the instant disclosure. Table 2 GENBANK@ Accession Nos. for Representative Nucleic acid 30 and Amino acid Sequences Gene Homo sapiens Mus musculus p-Ill tubulin Nucleic acid NM_006086 NM_023279 Amino acid NP_006077 NP_075768 -26- WO 2010/068758 PCT/US2009/067503 C-peptide Nucleic acid NM_000207a NM_008386" Amino acid NP_000198 NP_032412 FGF4 Nucleic acid NM_002007 NM_010202 Amino acid NP_001998 NP_034332 GATA4 Nucleic acid NM_002052 NM_008092 Amino acid NP_002043 NP_032118 GFAP Nucleic acid NM_002055 NM_010277 Amino acid NP_002046 NP_034407 KLF4 Nucleic acid NM_004235 NM_010637 Amino acid NP_004226 NP_034767 NANOG Nucleic acid NM_024865 NM_028016 Amino acid NP_079141 NP_082292 NESTIN Nucleic acid NM_006617 NM_016701 Amino acid NP_006608 NP_057910 NKX6-1 Nucleic acid NM_006168 NM_144955 Amino acid NP_006159 NP_659204 NKX2-5/CSX Nucleic acid NM_004387 NP_004378 Amino acid NM_008700 NP_032726 OCT4 Nucleic acid NM_002701 NM_013633 Amino acid NP_002692 NP_038661 OLIG1 Nucleic acid NM_138983 NM_016968 Amino acid NP_620450 NP_058664 OLIG2 Nucleic acid NM_005806 NM_016967 Amino acid NP_005797 NP_058663 PDX1 Nucleic acid NM_000209 NM_008814 Amino acid NP_000200 NP_032840.1 SOX2 Nucleic acid NM_003106 NM_011443 Amino acid NP_003097 NP_035573 SSEA1 Nucleic acid NM_002033 NM_010242 Amino acid NP_002024 NP_034372 STAT3 Nucleic acid NM_139276 NM_213659 Amino acid NP_644805 NP_998824 a NM_000207 is a nucleotide sequence of human insulin. Nucleotides 228 -27- WO 2010/068758 PCT/US2009/067503 320 of NM_000207 encode the human C-peptide, which corresponds to amino acids 57-87 of NP_000198. b NM_008386 is a nucleotide sequence of murine insulin. Nucleotides 351 438 of NM_008386 encode the murine C-peptide, which corresponds to 5 amino acids 57-85 of NP_032412. The term "isolated", as used in the context of a cell (including, for example, a reprogrammed somatic cell of the presently disclosed subject matter), indicates that the cell exists apart from its native environment. An isolated cell can also exist in a purified form or can exist in a non-native 10 environment. As used herein, a cell exists in a "purified form" when it has been isolated away from all other cells that exist in its native environment, but also when the proportion of that cell in a mixture of cells is greater than would be found in its native environment. Stated another way, a cell is considered to be 15 in "purified form" when the population of cells in question represents an enriched population of the cell of interest, even if other cells and cell types are also present in the enriched population. A cell can be considered in purified form when it comprises in some embodiments at least about 10% of a mixed population of cells, in some embodiments at least about 20% of a mixed 20 population of cells, in some embodiments at least about 25% of a mixed population of cells, in some embodiments at least about 30% of a mixed population of cells, in some embodiments at least about 40% of a mixed population of cells, in some embodiments at least about 50% of a mixed population of cells, in some embodiments at least about 60% of a mixed 25 population of cells, in some embodiments at least about 70% of a mixed population of cells, in some embodiments at least about 75% of a mixed population of cells, in some embodiments at least about 80% of a mixed population of cells, in some embodiments at least about 90% of a mixed population of cells, in some embodiments at least about 95% of a mixed 30 population of cells, in some embodiments at least about 99% of a mixed population of cells, and in some embodiments about 100% of a mixed population of cells, with the proviso that the cell comprises a greater percentage of the total cell population in the "purified" population that it did in -28- WO 2010/068758 PCT/US2009/067503 the population prior to the purification. In this respect, the terms "purified" and "enriched" can be considered synonymous. II. Reprogrammed Somatic Cells and Methods for Producing the Same The presently disclosed subject matter provides in some embodiments 5 methods for producing a reprogrammed cell (e.g., a reprogrammed fibroblast). As used herein, the term "reprogrammed", and grammatical variants thereof, refers to a cell that has be manipulated in culture in order to acquire a degree of pluripotency that it would not have acquired had the manipulation in culture not taken place. Exemplary reprogrammed cells include, but are not 10 limited to fibroblasts that as a result of the manipulations disclosed herein are induced to express markers associated with stem cells or with differentiated cells other than fibroblasts that the fibroblasts in culture do not and/or would not have expressed if maintained in monolayer culture. As used herein, the phrases "markers associated with stem cells", "stem 15 cell markers", and "mRNA for stem cell markers" refer to genes the expression of which is generally associated with stem cells and other pluripotent and/or totipotent cells including, but not limited to embryonic stem (ES) cells and induced plurippotent cells (iPSCs), but that that is not generally associated with reprogrammed cells in culture prior to the in vitro manipulation(s) that caused 20 the cells to become reprogrammed. For example, the genes Oct4, Nanog, fibroblast growth factor-4 (FGF4), Sox2, Klf4, SSEA1, and Stat3 are all expressed by ES cells and other pluripotent cells, but are not expressed or expressed to a much lower level in fibroblasts. As such, they are referred to herein as "stem cell genes" or "stem cell markers". Upon reprogramming, 25 fibroblasts upregulate one or more of these genes, and the upregulation of the one or more of these stem cell markers is indicative of reprogramming. Thus, in some embodiments, the methods comprise (a) growing a plurality of cells (e.g., fibroblasts) in monolayer culture to confluency; and (b) disrupting the monolayer culture to place at least a fraction of the plurality of 30 cells into suspension culture under conditions sufficient to form one or more embryoid body-like spheres, wherein the one or more embryoid body-like spheres comprise a reprogrammed cell induced to express at least one -29- WO 2010/068758 PCT/US2009/067503 endogenous gene not expressed by the cell growing in the monolayer culture prior to the disrupting step. As used herein, the phrase "conditions sufficient to form one or more embryoid body-like spheres" refers to any culture conditions wherein cells 5 growing in monolayers that are disrupted initiate sphere formation while growing in suspension. Such conditions include various tissue culture media as well as different disruption techniques. For example, in some embodiments the monolayers and/or the spheres that are generated therefrom are grown in a tissue culture medium. Tissue 10 culture media that can be employed in the growth and maintenance of the cells and spheres of the presently disclosed subject matter include, but are not limited to any tissue culture medium that is generally used for growing and maintaining mammalian cells, particularly stem cells such as embryonic stem cells. Non-limiting examples of such media are DMEM, F12, RPMI-1640, and 15 combinations thereof, which can be augmented with mammalian serum (e.g., 5-20% fetal bovine or fetal calf serum) and/or serum substitutes (e.g., OPTI MEM@ Reduced Serum Medium available from INVITROGEN

TM

), glutamine and/or other essential amino acids, antibiotics and/or antimycotics, etc. as would be understood by one of ordinary skill in the art. Exemplary media that 20 can be employed in the practice of the presently disclosed subject matter are disclosed in Nagy et al., 2003 and in U.S. Patent Nos. 6,602,711; 7,153,684; and 7,220,584. As used herein, the terms "disruption" and grammatical variants thereof refer to a manipulation of a monolayer of cells in culture that results in at least a 25 subset of the monolayer detaching from the substrate on which it is growing (and optionally, from other cells present in the monolayer) and growth in suspension. Mechanical methods of disruption including, but not limited to scraping a portion of the monolayer off a tissue culture plate, can be employed. Non-limiting examples of other disruption strategies include using light 30 trypsinization and/or collagenase treatment to remove sheets of cells and scraping of monolayer cells followed by moderate pipetting with a pipetting device to generate the spheres. Alternatively or in addition, a hanging drop method wherein lightly trypsinized cells in suspension are allowed to adhere to -30- WO 2010/068758 PCT/US2009/067503 underside of tissue culture plate top can also be employed. One day later, drops can be removed and placed in suspension culture. This procedure has been employed with ES cells to produced uniformly sized spheres or embryoid bodies, and can also be employed with the methods and compositions of the 5 presently disclosed subject matter. In some embodiments, a reprogrammed cell of the presently disclosed subject matter has the property of long term self renewal. In some embodiments, the phrase "long term self renewal" refers to an ability to self renew in culture over a period of at least one month, two month, three month, 10 four month, five month, six months, or longer. In some embodiments, a cell of the presently disclosed subject matter is a fibroblast. Fibroblasts can come from many sources from various species. In some embodiments, the fibroblast is a mammalian fibroblast, optionally a human fibroblast. Methods for isolating fibroblasts from various species are 15 also known. In some embodiments, a fibroblast is isolated from a source and grown in culture without any genetic manipulation (i.e., without the introduction of any exogenous coding and/or regulatory sequences using recombinant DNA technology). 20 In some embodiments, the cell is selected from the group including adult human skin fibroblasts, adult peripheral blood mononuclear cells, adult human bone marrow-derived mononuclear cells, neonatal human skin fibroblasts, human umbilical vein endothelial cells, human umbilical artery smooth muscle cells, human postnatal skeletal muscle cells, human postnatal adipose cells, 25 human postnatal peripheral blood mononuclear cells, or human cord blood mononuclear cells. Thus, in such embodiments the cell (i.e., the fibroblast) is referred to as a non-recombinant cell. Alternatively, a cell can be genetically manipulated by introducing into the cell one or more exogenous nucleic acid sequences. The 30 exogenous nucleic acid sequences can include coding sequences. Alternatively or in addition, the exogenous nucleic acid sequence can include one or more regulatory sequences designed to regulate the expression of the -31- WO 2010/068758 PCT/US2009/067503 exogenous coding sequences, endogenous coding sequences present in the cell, or both. In order to create one or more embryoid body-like spheres from cells (e.g., fibroblasts) growing in monolayer culture, the monolayers are disrupted to 5 place at least a fraction of the fibroblasts into suspension culture. As used herein, the term "disrupted" refers to a physical manipulation of the monolayer such that a plurality of cells becomes detached from the rest of the monolayer and from the growth surface and grows in suspension. The disruption can be anything that causes pluralities of cells as a unit to detach from the growth 10 surface and grow in suspension. In some embodiments, the disrupting comprises scraping at least a fraction of the confluent monolayer off of a substrate upon which the confluent monolayer is being cultured. As the disrupted cells (e.g., fibroblasts) grow in culture, they can form one or more embryoid body-like spheres. As used herein, the phrase "embryoid 15 body-like sphere" refers to an aggregate of disrupted cells that appears morphologically similar to an embryoid body formed by embryonic stem (ES) cells under appropriate in vitro culturing conditions (see e.g., Nagy etaL, 2003; U.S. Patent No. 5,914,268). These embryoid body-like spheres are stable in culture; in some embodiments, they can be maintained in suspension culture 20 for at least one month, and in some embodiments, they can be maintained in suspension culture for at least two months. In some embodiments, the one or more embryoid body-like spheres are maintained in a medium comprising Dulbecco's Modified Eagle Medium (DMEM) and 10% fetal bovine serum (FBS). 25 Upon formation of embryoid body-like spheres, some of the cells present therein are reprogrammed cells (in some embodiments, reprogrammed fibroblasts). The reprogrammed cells can be characterized by the expression of one or more stem cell markers that are not expressed (or are expressed to a much lower degree) by the cells (e.g., fibroblasts) in monolayer culture prior to 30 formation of the embryoid body-like sphere. In some embodiments, the reprogrammed fibroblasts express a stem cell marker selected from the group including, but not limited to Oct4, Nanog, FGF4, Sox2, Klf4, Sseal, and Stat3. Reagents that can be employed to assay for the expression of these stem cell -32- WO 2010/068758 PCT/US2009/067503 markers and others include oligonucleotide primers comprising the sequences set forth in Table 1 hereinabove (e.g., for use in expression assays such as the RT-PCR assay). Unlike ES cells, however, the reprogrammed fibroblasts of the presently disclosed subject matter are in some embodiments non-tumorigenic 5 in nude mice. Since reprogrammed cells (e.g., fibroblasts) express certain stem cell markers that are not expressed by the cells absent reprogramming (or are expressed at a much lower level), the presently disclosed subject matter also provides methods for inducing expression of one or more stem cell markers in 10 a cell (in some embodiments, a fibroblast). In some embodiments, the methods comprise (a) growing a plurality of cells in monolayer culture to confluency; and (b) disrupting the monolayer culture to place at least a fraction of the plurality of cells into suspension culture under conditions sufficient to form one or more spheres, wherein the one or more spheres comprise a cell with upregulated 15 expression of one or more stem cell markers. The presently disclosed subject matter also provides reprogrammed cells produced by the presently disclosed methods, reprogrammed cells non recombinantly induced to express one or more endogenous stem cell markers, embryoid body-like spheres comprising a plurality of reprogrammed cells, and 20 cell cultures comprising the presently disclosed embryoid body-like spheres in a medium sufficient to maintain the embryoid body-like spheres in suspension culture for at least one month. In some embodiments, the cells are fibroblasts. Once formed, reprogrammed cells (e.g., fibroblasts) can be manipulated in vitro to differentiate into cell types of interest. Thus, the presently disclosed 25 subject matter also provides methods for differentiating a reprogrammed cell into a cell type of interest. In some embodiments, the methods comprise (a) providing an embryoid body-like sphere comprising reprogrammed cells; and (b) culturing the embryoid body-like sphere in a culture medium comprising a differentiation-inducing amount of one or more factors that induce 30 differentiation of the reprogrammed cells or derivatives thereof into the cell type of interest until the cell type of interest appears in the culture. The reprogrammed cells of the presently disclosed subject matter can thus be differentiated into cell-types of various lineages, if desired. Examples of -33- WO 2010/068758 PCT/US2009/067503 differentiated cells include any differentiated cells from ectodermal (e.g., neurons and fibroblasts), mesodermal (e.g., cardiomyocytes), or endodermal (e.g., pancreatic cells) lineages. In some embodiments, the differentiated cells can be one or more: pancreatic beta cells, neural stem cells, neurons (e.g., 5 dopaminergic neurons), oligodendrocytes, oligodendrocyte progenitor cells, hepatocytes, hepatic stem cells, astrocytes, myocytes, hematopoietic cells, or cardiomyocytes. The differentiated cells derived from the reprogrammed cells of the presently disclosed subject matter can in some embodiments be terminally 10 differentiated cells, or they can be capable of giving rise to cells of a specific lineage. For example, reprogrammed cells of the presently disclosed subject matter can be differentiated into a variety of multipotent cell types, e.g., neural stem cells, cardiac stem cells, or hepatic stem cells. These stem cells can then be further differentiated into new cell types, e.g., neural stem cells can be 15 differentiated into neurons; cardiac stem cells can be differentiated into cardiomyocytes; and hepatic stem cells can be differentiated into hepatocytes. There are numerous methods for differentiating the reprogrammed cells of the presently disclosed subject matter into a more specialized cell type. Methods of differentiating reprogrammed cells can be similar to and based on 20 those methods used to differentiate stem cells, particularly ES cells, MSCs, MAPCs, MIAMI, and hematopoietic stem cells (HSCs). In some embodiments, the differentiation occurs ex vivo; in some embodiments the differentiation occurs in vivo. Any known method for generating neural stem cells from ES cells can be 25 used to generate neural stem cells from the presently disclosed reprogrammed cells, See e.g., Reubinoff et al., 2001. For example, neural stem cells can be generated by culturing the reprogrammed cells of the presently disclosed subject matter in the presence of noggin, or other bone morphogenetic protein antagonists (see e.g., Itsykson et al., 2005). In some embodiments, neural 30 stem cells can be generated by culturing the reprogrammed cells of the presently disclosed subject matter in the presence of growth factors including, but not limited to FGF-2 (see Zhang et al., 2001). In some embodiments, the cells are cultured in serum-free medium containing FGF-2. In some -34- WO 2010/068758 PCT/US2009/067503 embodiments, the reprogrammed cells of the presently disclosed subject matter are co-cultured with a mouse stromal cell line, e.g., PA6 in the presence of serum-free medium comprising FGF-2. In some embodiments, the reprogrammed cells of the presently disclosed subject matter are directly 5 transferred to serum-free medium containing FGF-2 to directly induce differentiation. Neural stems derived from the reprogrammed cells of the presently disclosed subject matter can be differentiated into neurons, oligodendrocytes, and/or astrocytes. Often, the conditions used to generate neural stem cells can 10 also be used to generate neurons, oligodendrocytes, and/or astrocytes. Dopaminergic neurons play a central role in Parkinson's Disease and other neurodegenerative diseases and are thus of particular interest. In orderto promote differentiation into dopaminergic neurons, reprogrammed cells of the presently disclosed subject matter can be co-cultured with a PA6 mouse 15 stromal cell line under serum-free conditions (see e.g., Kawasaki et al., 2000). Other methods have also been described in, for example, Pomp et al., 2005; U.S. Patent No. 6,395,546; Lee et al., 2000. Oligodendrocytes can also be generated from the reprogrammed cells of the presently disclosed subject matter. Differentiation of the reprogrammed 20 cells of the presently disclosed subject matter into oligodendrocytes can be accomplished by known methods for differentiating ES cells or neural stem cells into oligodendrocytes. For example, oligodendrocytes can be generated by co-culturing reprogrammed cells of the presently disclosed subject matter or neural stem cells derived therefrom with stromal cells (see e.g., Hermann etal., 25 2004). In some embodiments, oligodendrocytes can be generated by culturing the reprogrammed cells of the presently disclosed subject matter or neural stem cells in the presence of a fusion protein, in which the Interleukin (IL)-6 receptor, or derivative, is linked to the IL-6 cytokine, or derivative thereof. Oligodendrocytes can also be generated from the reprogrammed cells of the 30 presently disclosed subject matter by other methods known in the art (see e.g. Kang et al., 2007). Astrocytes can also be produced from the reprogrammed cells of the presently disclosed subject matter. Astrocytes can be generated by culturing -35- WO 2010/068758 PCT/US2009/067503 reprogrammed cells of the presently disclosed subject matter or neural stem cells derived therefrom in the presence of neurogenic medium with bFGF and EGF (see e.g., Brustle et aL, 1999). Reprogrammed cells of the presently disclosed subject matter can be 5 differentiated into pancreatic beta cells by methods known in the art (see e.g., Assady et al., 2001; Lumelsky et al., 2001; D'Amour et al., 2005; D'Amour et al., 2006). The method can comprise culturing the reprogrammed cells of the presently disclosed subject matter in serum-free medium supplemented with Activin A, followed by culturing in the presence of serum-free medium 10 supplemented with all-trans retinoic acid, followed by culturing in the presence of serum-free medium supplemented with bFGF and nicotinamide (see e.g., Jiang et al., 2007). In some embodiments, the method comprises culturing the reprogrammed cells of the presently disclosed subject matter in the presence of serum-free medium, activin A, and Wnt protein from about 0.5 to about 6 days, 15 e.g., about 0.5, 1, 2, 3, 4, 5, 6, days; followed by culturing in the presence of from about 0.1% to about 2%, e.g., 0.2%, FBS and activin A from about 1 to about 4 days, e.g., about 1, 2, 3, or 4 days; followed by culturing in the presence of 2% FBS, FGF-10, and KAAD-cyclopamine (keto-N aminoethylaminocaproyl dihydro cinnamoylcyclopamine) and retinoic acid from 20 about 1 to about 5 days, e.g., 1, 2, 3, 4, or 5 days; followed by culturing with 1% B27, gamma secretase inhibitor and extendin-4 from about 1 to about 4 days, e.g., 1, 2, 3, or 4 days; and finally culturing in the presence of 1% B27, extendin-4, IGF-1, and HGF for from about 1 to about 4 days, e.g., 1, 2, 3, or 4 days. 25 Hepatic cells or hepatic stem cells can be differentiated from the reprogrammed cells of the presently disclosed subject matter. For example, culturing the reprogrammed cells of the presently disclosed subject matter in the presence of sodium butyrate can generate hepatocytes (see e.g., Rambhatla et al., 2003). In some embodiments, hepatocytes can be produced 30 by culturing the reprogrammed cells of the presently disclosed subject matter in serum-free medium in the presence of Activin A, followed by culturing the cells in fibroblast growth factor-4 and bone morphogenetic protein-2 (see e.g., Cai et aL, 2007). In some embodiments, the reprogrammed cells of the presently -36- WO 2010/068758 PCT/US2009/067503 disclosed subject matter are differentiated into hepatic cells or hepatic stem cells by culturing the reprogrammed cells of the presently disclosed subject matter in the presence of Activin A from about 2 to about 6 days, e.g., about 2, about 3, about 4, about 5, or about 6 days, and then culturing the 5 reprogrammed cells of the presently disclosed subject matter in the presence of hepatocyte growth factor (HGF) for from about 5 days to about 10 days, e.g., about 5, about 6, about 7, about 8, about 9, or about 10 days. The reprogrammed cells of the presently disclosed subject matter can also be differentiated into cardiac muscle cells. Inhibition of bone 10 morphogenetic protein (BMP) signaling can result in the generation of cardiac muscle cells or cardiomyocytes (see e.g., Yuasa et al., 2005). Thus, in some embodiments, the reprogrammed cells of the presently disclosed subject matter are cultured in the presence of noggin for from about two to about six days, e.g., about 2, about 3, about 4, about 5, or about 6 days, prior to allowing 15 formation of an embryoid body, and culturing the embryoid body for from about 1 week to about 4 weeks, e.g., about 1, about 2, about 3, or about 4 weeks. In some embodiments, cardiomyocytes can be generated by culturing the reprogrammed cells of the presently disclosed subject matter in the presence of leukemia inhibitory factor (LIF), or by subjecting them to other 20 methods known in the art to generate cardiomyocytes from ES cells (see e.g., Bader et al., 2000; Kehat et al., 2001; Mummery et al., 2003). Examples of methods to generate other cell-types from reprogrammed cells of the presently disclosed subject matter include: (1) culturing reprogrammed cells of the presently disclosed subject 25 matter in the presence of retinoic acid, leukemia inhibitory factor (LIF), thyroid hormone (T3), and insulin in order to generate adipocytes (see e.g., Dani etal., 1997); (2) culturing reprogrammed cells of the presently disclosed subject matter in the presence of BMP-2 or BMP-4 to generate chondrocytes (see e.g., 30 Kramer et al., 2000); (3) culturing the reprogrammed cells of the presently disclosed subject matter under conditions to generate smooth muscle (see e.g., Yamashita et al., 2000); -37- WO 2010/068758 PCT/US2009/067503 (4) culturing the reprogrammed cells of the presently disclosed subject matter in the presence of P1 integrin to generate keratinocytes (see e.g., Bagutti et al., 1996); (5) culturing the reprogrammed cells of the presently disclosed 5 subject matter in the presence of Interleukin-3 (IL-3) and macrophage colony stimulating factor to generate macrophages (see e.g., Lieschke & Dunn, 1995); (6) culturing the reprogrammed cells of the presently disclosed subject matter in the presence of IL-3 and stem cell factor to generate mast cells (see e.g., Tsai et al., 2000); 10 (7) culturing the reprogrammed cells of the presently disclosed subject matter in the presence of dexamethasone and stromal cell layer, steel factor to generate melanocytes (see e.g., Yamane et al., 1999); (8) co-culturing the reprogrammed cells of the presently disclosed subject matter with fetal mouse osteoblasts in the presence of dexamethasone, 15 retinoic acid, ascorbic acid, and p-glycerophosphate to generate osteoblasts (see e.g., Buttery et al., 2001); (9) culturing the reprogrammed cells of the presently disclosed subject matter in the presence of osteogenic factors to generate osteoblasts (see e.g., Sottile et al., 2003); 20 (10) overexpressing insulin-like growth factor-2 in the reprogrammed cells of the presently disclosed subject matter and culturing the cells in the presence of dimethyl sulfoxide to generate skeletal muscle cells (see e.g., Prelle et al., 2000); (11) subjecting the reprogrammed cells of the presently disclosed 25 subject matter to conditions for generating white blood cells; or (12) culturing the reprogrammed cells of the presently disclosed subject matter in the presence of BMP4 and one or more: SCF, FLT3, IL-3, IL 6, and GCSF to generate hematopoietic progenitor cells (see e.g., Chadwick et al., (2003). 30 Thus, in some embodiments, the cell type of interest is selected from the group including, but not limited to a neuronal cell, an endodermal cell, a cardiomyocyte, and derivatives thereof. -38- WO 2010/068758 PCT/US2009/067503 In some embodiments, the cell type of interest is a neuronal cell or a derivative thereof. In some embodiments, the neuronal cell or derivative thereof is selected from the group including, but not limited to an oligodendrocyte, an astrocyte, a glial cell, and a neuron. In some embodiments, the neuronal cell or 5 derivative thereof expresses a marker selected from the group including, but not limited to GFAP, nestin, P Ill tubulin, Olig1, and Olig2. In some embodiments, the culture medium comprises about 10 ng/ml rhEGF, about 20 ng/ml FGF2, and about 20 ng/ml NGF, optionally wherein the culturing is for at least about 10 days. Neuronal cells and/or derivatives thereof can be identified 10 using techniques known in the art including, but not limited to the use of antibodies that bind to GFAP, nestin, P 111 tubulin, Olig1, and Olig2, and/or other neuronal cell markers, or Reverse Transcription PCR using oligonucleotides are specific for GFAP, nestin, P III tubulin, Olig1, and Olig2 and/or other genes expressed in neuronal cells or their derivatives. Exemplary oligonucleotides 15 are set forth in Table 1 hereinabove. In some embodiments, the cell type of interest is an endodermal cell or derivative thereof. Culture conditions that can give rise to endodermal cells and/or derivatives thereof from reprogrammed fibroblasts include, but are not limited to culturing an embryoid body-like sphere in a first culture medium 20 comprising Activin A; and thereafter culturing the embryoid body-like sphere in a second culture medium comprising N2 supplement-A, B27 supplement, and about 10 mM nicotinamide. In some embodiments, the culturing in the first culture medium is for about 48 hours. In some embodiments, the culturing in the second culture medium is for at least about 12 days. Culturing under one or 25 more of these conditions can be sufficient to cause a differentiated derivative of a reprogrammed fibroblast to express a marker selected from the group including, but not limited to Nkx6-1, Pdx 1, and C-peptide. Endodermal cells and/or derivatives thereof can be identified using techniques known in the art including, but not limited to the use of antibodies that bind to Nkx6-1, Pdx 1, 30 and C-peptide, and/or other endodermal cell markers, or Reverse Transcription PCR using oligonucleotides are specific for Nkx6-1, Pdx 1, C-peptide, and/or other genes expressed in endodermal cells or their derivatives. Exemplary oligonucleotides are set forth in Table 1 hereinabove. -39- WO 2010/068758 PCT/US2009/067503 In some embodiments, the cell type of interest is a cardiomyocyte or a derivative thereof. To produce a cardiomyocyte or a derivative thereof, the culturing is in some embodiments for at least about 15 days, optionally, in a culture medium comprising a combination of basic fibroblast growth factor, 5 vascular endothelial growth factor, and transforming growth factor P1 in an amount sufficient to cause a subset of the embryoid body-like sphere cells to differentiate into cardiomyocytes. Culturing under these conditions can lead to the cardiomyocyte or the derivative thereof expressing a marker selected from the group including, but not limited to Nkx2-5/Csx and GATA4. Cardiomyocytes 10 and/or derivatives thereof can be identified using techniques known in the art including, but not limited to the use of antibodies that bind to Nkx2-5/Csx and GATA4, and/or other cardiomyocyte markers, or Reverse Transcription PCR using oligonucleotides are specific for Nkx2-5/Csx, GATA4, and/or other genes expressed in cardiomyocytes and/or their derivatives. Exemplary 15 oligonucleotides are set forth in Table 1 hereinabove. ll. Applications Ill.A. Methods for Obtaining Cells to be Reprogrammed Exemplary methods for obtaining somatic cells (e.g., human somatic cells) are well established. See e.g., Schantz & Ng, 2004. In some 20 embodiments, the methods include obtaining a cellular sample (e.g., by a biopsy such as, but not limited to a skin biopsy), blood draw, or alveolar or other pulmonary lavage. It is to be understood that initial plating densities of cells prepared from a tissue can be varied based on such variables as expected viability or adherence of cells from the particular tissue. Methods for 25 obtaining various types of somatic cells include, but are not limited to, the following exemplary methods. Skin tissue containing the dermis is harvested, for example, from the back of a knee or buttock. The skin tissue is then incubated for 30 minutes at 37 0 C in 0.6% trypsin/Dulbecco's Modified Eagle's Medium (DMEM)/F-12 with 30 1% antibiotics/antimycotics, with the inner side of the skin facing downward. After the skin tissue is turned over, tweezers are used to lightly scrub the inner side of the skin. The skin tissue is finely cut into 1 mm2 sections and is then centrifuged at 1200 rpm for 10 minutes at room temperature. The -40- WO 2010/068758 PCT/US2009/067503 supernatant is removed, and 25 ml of 0.1% trypsin/DMEM/F-12/1% antibiotics, antimycotics, is added to the tissue precipitate. The mixture is stirred at 200 300 rpm using a stirrer at 37 0 C. for 40 minutes. After confirming that the tissue precipitate is fully digested, 3 ml fetal bovine serum (FBS) is added, and filtered 5 sequentially with gauze, a 100 pm nylon filter, and a 40 pm nylon filter. After centrifuging the resulting filtrate at 1200 rpm for 10 minutes at room temperature to remove the supernatant, DMEM/F-12/1% antibiotics, antimycotics is added to wash the precipitate, and then centrifuged at 1200 rpm at room temperature for 10 minutes. The cell fraction thus obtained is then 10 cultured as described herein. Dermal cells can be enriched by isolating dermal papilla from scalp tissue. Human scalp tissue (0.5 - 2 cm2 or less) is rinsed, trimmed to remove excess adipose tissues, and cut into small pieces. These tissue pieces are enzymatically digested in 12.5 mg/mI dispase (INVITROGEN T M , Carlsbad, 15 California, United States of America) in DMEM for 24 hours at 4 0 C. After the enzymatic treatment, the epidermis is peeled off from the dermis; and hair follicles are pulled out from the dermis. Hair follicles are washed with phosphate-buffered saline (PBS); and the epidermis and dermis are removed. A microscope can be used for this procedure. Single dermal-papilla derived 20 cells are generated by culturing the explanted papilla on a plastic tissue culture dish in the medium containing DMEM and 10% fetal calf serum (FCS) for 1 week. When single dermal papilla cells are generated, these cells are removed and cultured in FBM supplemented with FGM-2 SINGLEQUOTS@ (Lonza Inc., Allendale, New Jersey, United States of America) or cultured in the presence of 25 20 ng/ml EGF, 40 ng/ml FGF-2, and B27 without serum. Epidermal cells can be also enriched from human scalp tissues (0.5 - 2 cm2 or less). Human scalp issues is rinsed, trimmed to remove excess adipose tissues, and cut into small pieces. These tissue pieces are enzymatically digested in 12.5 mg/ml dispase (INVITROGEN T M ) in Dulbecco's modified 30 Eagle's medium (DMEM) for 24 hours at 4 0 C. After the enzymatic treatment, the epidermis is peeled off from the dermis; and hair follicles are pulled out from the dermis. The bulb and intact outer root sheath (ORS) are dissected under a microscope. After the wash, the follicles are transferred into a plastic -41- WO 2010/068758 PCT/US2009/067503 dish. Then the bulge region is dissected from the upper follicle using a fine needle. After the wash, the bulge is transferred into a new dish and cultured in medium containing DMEM/F12 and 10% FBS. After the cells are identified, culture medium is changed to the EPILIFE TM Extended-Lifespan Serum-Free 5 Medium (Sigma-Adrich Corp., St. Louis, Missouri, United States of America). Ill.B. Methods of Treatment The presently disclosed subject matter provides in some embodiments methods for treating a disease, disorder, or injury to a tissue in a subject. In some embodiments, the methods comprise administering to the subject a 10 composition comprising a plurality of reprogrammed cells (e.g., fibroblasts) in a pharmaceutically acceptable carrier in an amount and via a route sufficient to allow at least a fraction of the reprogrammed cells to engraft the target tissue and differentiate therein, whereby the disease, disorder, or injury is treated. The disease, disorder, or injury can be any disease, disorder, or injury in which cell 15 replacement therapy might be expected to be beneficial. As such, in some embodiments the disease, disorder, or injury is selected from the group including, but not limited to an ischemic injury, a myocardial infarction, and stroke. The terms "target tissue" and "target organ" as used herein refer to an 20 intended site for accumulation of a reprogrammed cell of the presently disclosed subject matter and/or a differentiated derivative thereof (e.g., an in vitro differentiated derivative thereof) following administration to a subject. For example, in some embodiments the methods of the presently disclosed subject matter involve a target tissue or a target organ that has been damaged, for 25 example by ischemia or other injury. The term "control tissue" as used herein refers to a site suspected to substantially lack accumulation of an administered cell. For example, in accordance with the methods of the presently disclosed subject matter, a tissue or organ that has not been injured or damaged is a representative control 30 tissue, as is a tissue or organ other than the intended target tissue. The terms "targeting" and "homing", as used herein to describe the in vivo activity of a cell (for example, a reprogrammed cell of the presently disclosed subject matter and/or an in vitro differentiated derivative thereof) -42- WO 2010/068758 PCT/US2009/067503 following administration to a subject, and refer to the preferential movement and/or accumulation of the cell in a target tissue as compared to a control tissue. The terms "selective targeting" and "selective homing" as used herein 5 refer to a preferential localization of a cell (for example, a reprogrammed cell of the presently disclosed subject matter and/or an in vitro differentiated derivative thereof) that results in an accumulation of the administered reprogrammed cell of the presently disclosed subject matter and/or an in vitro differentiated derivative thereof in a target tissue that is in some embodiments about 2-fold 10 greater than accumulation of the administered reprogrammed cell of the presently disclosed subject matter and/or an in vitro differentiated derivative thereof in a control tissue, in some embodiments accumulation of the administered reprogrammed cell of the presently disclosed subject matter and/or an in vitro differentiated derivative thereof that is about 5-fold or greater, 15 and in some embodiments an accumulation of the administered reprogrammed cell of the presently disclosed subject matter and/or an in vitro differentiated derivative thereof that is about 10-fold or greater than in an control tissue. The terms "selective targeting" and "selective homing" also refer to accumulation of a reprogrammed cell of the presently disclosed subject matter and/or an in vitro 20 differentiated derivative thereof in a target tissue concomitant with an absence of accumulation in a control tissue, in some embodiments the absence of accumulation in all control tissues. Techniques that can be employed for targeting reprogrammed cells of the presently disclosed subject matter are disclosed in PCT International Patent Application Publication Nos. WO 25 2007/067280 and WO 2009/059032, the disclosure of each of which is incorporated by reference herein in its entirety. The term "absence of targeting" is used herein to describe substantially no binding or accumulation of a reprogrammed cell of the presently disclosed subject matter and/or an in vitro differentiated derivative thereof in one or more 30 control tissues under conditions wherein accumulation would be detectable if present. The phrase also is intended to include minimal, background accumulation of a reprogrammed cell of the presently disclosed subject matter -43- WO 2010/068758 PCT/US2009/067503 and/or an in vitro differentiated derivative thereof in one or more control tissues under such conditions. In some embodiments, the administering is of a reprogrammed cell, or a differentiated derivative thereof, which is from a donor. In some embodiments, 5 the donor is the same individual as the recipient, but in some embodiments the donor is a different individual. In the case of different donors and recipients, the donor can be immunocompatible with the recipient. In some embodiments, the donor is identified as immunocompatible if the HLA genotype matches the HLA genotype of the recipient. In some embodiments, the immunocompatible 10 donor is identified by genotyping a blood sample from the immunocompatible donor. Depending on the nature of the injury to be treated, the methods can further comprise differentiating the reprogrammed cells (e.g., fibroblasts) to produce a pre-determined cell type prior to administering the composition to the 15 subject. For example, the pre-determined cell type can be selected from the group including, but not limited to a neural cell, an endoderm cell, a cardiomyocyte, and derivatives thereof, although the presently disclosed subject matter is not limited to just these cell types of interest. Ill.B.1. Formulations 20 The compositions of the presently disclosed subject matter comprise in some embodiments a composition that includes an active agent (e.g., a reprogrammed cell and/or a derivative thereof, as well as pluralities thereof) and a carrier, particularly a pharmaceutically acceptable carrier, such as but not limited to a carrier pharmaceutically acceptable for use in humans. Any suitable 25 pharmaceutical formulation can be used to prepare the compositions for administration to a subject. For example, suitable formulations can include aqueous and non aqueous sterile injection solutions that can contain anti-oxidants, buffers, bacteriostatics, bactericidal antibiotics, and solutes that render the formulation 30 isotonic with the bodily fluids of the intended recipient. It should be understood that in addition to the ingredients particularly mentioned above the formulations of the presently disclosed subject matter can include other agents conventional in the art with regard to the type of -44- WO 2010/068758 PCT/US2009/067503 formulation in question. For example, sterile pyrogen-free aqueous and non aqueous solutions can be used. The therapeutic regimens and compositions of the presently disclosed subject matter can be used with additional adjuvants and/or biological response 5 modifiers (BRMs) including, but not limited to, cytokines and other immunomodulating compounds. Exemplary adjuvants and/or biological response modifiers include, but are not limited to monoclonal antibodies, interferons (IFNs, including but not limited to IFN-a and IFN-y), interleukins (ILs, including but not limited to 1L2, 1L4, 1L6, and IL1 0), cytokines (including, but not 10 limited to tumor necrosis factors), and colony-stimulating factors (CSFs, including by not limited to GM-CSF and GCSF). l11.B.2. Administration Suitable methods for administration of the compositions of the presently disclosed subject matter include, but are not limited to intravenous 15 administration and delivery directly to the target tissue or organ. In some embodiments, the method of administration encompasses features for regionalized delivery or accumulation of the compositions of the presently disclosed subject matter at the site in need of treatment. In some embodiments, the compositions of the presently disclosed subject matter are 20 delivered directly into the tissue or organ to be treated. In some embodiments, selective delivery of the cells present in the compositions of the presently disclosed subject matter is accomplished by intravenous injection of the presently disclosed compositions, where the cells present therein can home to the target tissue and/or organ and engraft therein. 25 III.B.3. Dose An effective dose of a composition of the presently disclosed subject matter is administered to a subject in need thereof. A "treatment effective amount" or a "therapeutic amount" is an amount of a therapeutic composition sufficient to produce a measurable response (e.g., a biologically or clinically 30 relevant response in a subject being treated). Actual dosage levels of an active agent or agents (e.g., a reprogrammed cell and/ or a differentiated derivative thereof) in the compositions of the presently disclosed subject matter can be varied so as to administer an amount of the active agent(s) that is effective to -45- WO 2010/068758 PCT/US2009/067503 achieve the desired therapeutic response for a particular subject. The selected dosage level will depend upon the activity of the therapeutic composition, the route of administration, combination with other drugs or treatments, the severity of the condition being treated, and the condition and prior medical history of the 5 subject being treated. However, it is within the skill of the art to start doses of the compositions of the presently disclosed subject matter at levels lower than required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. The potency of a composition can vary, and therefore a "treatment effective amount" can vary. However, one 10 skilled in the art can readily assess the potency and efficacy of a therapeutic composition of the presently disclosed subject matter and adjust the therapeutic regimen accordingly. After review of the disclosure of the presently disclosed subject matter presented herein, one of ordinary skill in the art can tailor the dosages to an 15 individual subject, taking into account the particular formulation, method of administration to be used with the composition, and particular injury treated. Further calculations of dose can consider subject height and weight, severity and stage of symptoms, and the presence of additional deleterious physical conditions. Such adjustments or variations, as well as evaluation of when and 20 how to make such adjustments or variations, are well known to those of ordinary skill in the art. IV. Other Applications The presently disclosed subject matter also provides methods for analyzing differentiation of different cell lineages. As such, the reprogramming 25 strategies disclosed herein, and the cells produced therewith, can be employed to study the differentiation of cells representative of all three embryonic layers. For example, the results disclosed herein with respect to erythrocytes and the Real Time PCR results demonstrating expression of early and late stage markers of differentiation demonstrated that reprogrammed cells progressed 30 along pathways of differentiation under the disclosed conditions. Molecular events including sequential gene expression patterns as well as epigenetic changes in each of the cell types can be investigated using the compositions and methods of the presently disclosed subject matter. -46- WO 2010/068758 PCT/US2009/067503 The presently disclosed subject matter also provides methods for analyzing the transition of differentiated somatic cells to cancer stem cells during tumor formation and/or progression. Additionally, the present disclosure includes a large amount of data that demonstrates that mutations of the 5 members of the RB1 family can lead to the generation of cells with properties of cancer stem cells. Mutations in RB family members are known to be important events in cancer, as most if not all cancers appear to inactivate one or more RB1 family members as a step toward transformation. Thus, the compositions and methods of the presently disclosed subject 10 matter can be employed as a model for RB1 family-dependent transition of cells (e.g., ES cells, iPSCs, or other cells) to cancer stem cells. What gene expression changes regulate this transition and which epigenetic changes might be responsible for such changes in gene expression can be investigated using the presently disclosed subject matter. One such change in gene 15 expression which can be examined for a role in the generation of cancer stem cells (dependent upon whether wild type or RB1 -mutant cells are used) are the epithelial-mesenchymal transcription (EMT) factors including, but not limited to Zeb1. Moreover, the presently disclosed subject matter can be employed in 20 investigations of other events that might be responsible for transition of cells to cancer stem cells. And finally, emerging evidence suggests that cancers can be initiated by an outgrowth of fully differentiated somatic cells into sphere-like structures with concomitant loss of cell-cell contact inhibition. Cells within these growing 25 spheres undergo dedifferentiation to form cells with properties of cancer stem cells. As such, the methods and compositions of the presently disclosed subject matter could be employed as a model in culture and also in vivo in tumor formation models to define the steps in cancer formation that are initiated by outgrowth of differentiated somatic cells lacking cell-cell contact inhibition. 30 In some embodiments, this could involve investigation of gene expression changes as well as epigenetic changes responsible for such alterations in gene expression. -47- WO 2010/068758 PCT/US2009/067503 EXAMPLES The presently disclosed subject matter will be now be described more fully hereinafter with reference to the accompanying EXAMPLES, in which representative embodiments of the presently disclosed subject matter are 5 shown. The presently disclosed subject matter can, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the presently disclosed subject matter to those skilled in the art. 10 Method and Materials for the EXAMPLES Cells and cell culture: Wild type mouse embryo fibroblasts (MEFs) were isolated from E13.5 mouse embryos, and Rb family mutant MEFs were kind gifts from Tyler Jacks (Massachusetts Institute of Technology, Cambridge, Massachusetts, United States of America), Julien Sage (Stanford University, 15 Palo Alto, California, United States of America), and Gustavo Leone (The Ohio State University, Columbus, Ohio, United States of America). Fibroblasts in which all three RB1 family members have been mutated (referred to herein as "triple knockouts"; TKOs) derived from four separate embryos were used in the experiments described herein with similar results. Cells were analyzed 20 beginning at passage 4, but similar results were also seen at passage 11. The cells were cultured in DMEM with 10% heat-inactivated fetal bovine serum. One (1) unit/mL of leukemia inhibitory factor (LIF; CHEMICON® International, Inc., Temecula, California, United States of America) was added to embryonic stem cell cultures. 25 Immunohistochemistry. Exemplary primary and secondary antibodies employed herein are described in Tables 3 and 4. Primary antibodies were incubated at 4 0 C overnight, and after three washes with phosphate-buffered saline (PBS), slides were incubated at 1:200 dilution with secondary antibodies conjugated with either Cy3 orALEXA FLUOR@ 488 (MOLECULAR PROBES@, 30 a division of INVITROGEN T M Corp., Carlsbad, California, United States of America) at room temperature for 60 minutes. After three washes with PBS, slides were mounted with coverslips using either the anti-fade medium

PERMOUNT

TM (Fisher Scientific, Fair Lawn, New Jersey, United States of -48- WO 2010/068758 PCT/US2009/067503 America) or VECTASHIELD@ Mounting Medium with DAPI (Vector Laboratories, Inc., Burlingame, California, United States of America), and images were captured with an Olympus confocal microscope. Table 3 5 Listing of Primary Antibodies Employed Specificity IgG Cross- Supplier Dilution Type' reactivity2 AFP goat (P) m, r, h Santa Cruz 1:100 Anti-E-cadherin mouse (M) m, r, Douglas Darling 1:50 (Cdh1) h, d (BD Biosciences Pharmingen) BCRP/Abcg2 rat (M) m, r, h Abcam 1:20 BRDU (G3G4) mouse (P) m, r, h Douglas Darling 1:50 Calbindin-D-28K rabbit (P) h, m, r Thermo Scientific 1:500 CD133 rat (M) m, r, h CHEMICON@ 1:50 CD31 (PECAM) mouse (M) m, h Tongalp Tezel 1:50 c-peptide pig (P) m, r, h Millipore 1:200 GATA4 mouse (M) m, r, h Santa Cruz 1:100 GFAP mouse (M) m, r, h CHEMICON@ 1:50 hemoglobin (HB) goat (P) m, r, h Tongalp Tezel 1:50 Insolin pig (P) m, r, h Abcam 1:200 Islet1 mouse (M) m, r, h Douglas Darling 1:0 MBP mouse (M) m, r, h Abcam 1:100 mouse nanog rat (M) m, r, h EBIOSCIENCE T M 1:200 nanog rat (M) m, r, h EBIOSCIENCE TM 1:20 PKC alpha mouse (M) h, m, r, Assay Designs 1:500 others POU5F1 (Oct4) rabbit (P) m, r, h Sigma 1:20 recoverin rabbit (P) h, m, r, CHEMICON@ 1:500 c, f Rhodopsin mouse (M) h, m, r Thermo Scientific 1:500 (Opsin) -49- WO 2010/068758 PCT/US2009/067503 sarcomeric mouse (M) m, r, h Abcam 1:100 actinin SSEA1 mouse (M) m, r, h CHEMICON@ 1:100 Synapsin-1 rabbit (P) h, m, r INVITROGEN T M 1:500 (Myzel) TH alpha mouse (M) m, r, h Douglas Darling 1:0 troponin I mouse (M) m, r, h CHEMICON@ 1:200 vimentin goat (P) m, r, h Santa Cruz 1:50 p-Ill tubulin mouse (M) m, r, h CHEMICON@ 1:50 (M) - monoclonal; (P) - polyclonal. 2 m - mouse; r - rat; h - human; c - chick; f - frog; d - dog. Abcam: Abcam Inc., Cambridge, Massachusetts, United States of America; Assay Designs: Assay Designs, Inc., Ann Arbor, Michigan, United States of 5 America; CHEMICON@: Chemicon Inc., a division of Millipore Corp., Billerica, Massachusetts, United States of America; Doug Darling: Dental School University of Louisville, Louisville, Kentucky, United States of America; 10 EBIOSCIENCE T M : eBioscience, Inc., San Diego, California, United States of America; INVITROGEN T

M

: INVITROGEN TM Corp., Carlsbad, California, United States of America; Millipore: Millipore Corp., Billerica, Massachusetts, United States of America; 15 Santa Cruz: Santa Cruz Biotechnology Inc., Santa Cruz, California, United States of America; Sigma: Sigma-Aldrich Corp., St. Louis, Missouri, United States of America; Thermo Scientific: Thermo Fischer Scientific Inc., Waltham, Massachusetts, United States of America; 20 Tongalp Tezel: Department of Ophthalmology and Visual Sciences, University of Louisville, Louisville, Kentucky, United States of America. -50- WO 2010/068758 PCT/US2009/067503 Table 4 Listing of Secondary Antibodies Employed Description Manufacturer Dilution Cy3-conjugated CHEMICOM@ 1:200 Rabbit anti-rat IgG ALEXA FLUOR@ 488- MOLECULAR 1:200 conjugated Goat anti-mouse IgG PROBES® ALEXA FLUOR@ 488- MOLECULAR 1:200 conjugated Goat anti-rabbit IgG PROBES@ ALEXA FLUOR@ 488- MOLECULAR 1:200 conjugated Donkey anti-goat IgG PROBES® Cy3-conjugated Sigma 1:200 Sheep anti-rabbit IgG Tumor formation in nude mice. Either spheres (after two weeks in 5 suspension culture) or trypsinized monolayers of cells derived from spheres were injected subcutaneously into the right hind limb of Balb/cAnNCr-nu/nu nude mice (available from the National Cancer Institute at Fredrick, Frederick, Maryland, United States of America). Tumors were fixed in 10% buffered formalin, embedded in paraffin, sectioned at 5 pm, and stained with 10 hematoxylin and eosin (H&E) or used for immunostaining. Identification and isolation of SP and MP cells. Cells were trypsinized from tissue culture plates, suspended in pre-warmed DMEM containing 2% FBS and 10 mM 4-(2-hydroxyethyl)-1 -piperazineethanesulfonic acid (HEPES), and stained with 5 [g/ml of Hoechst 33342 dye (MOLECULAR PROBES@) for 15 90 minutes at 37 0 C. Cells were then washed and resuspended in Hank's Buffered Salt Solution (HBSS) containing 2% FBS and 10 mM HEPES. Before cell sorting, 2 ptg/ml propidium iodide (Sigma-Aldrich, Inc., St. Louis, Missouri, United States of America) was added to exclude nonviable cells. SP cells were identified and isolated using a MOFLO TM cell sorter (Dako North America, Inc., 20 Carpinteria, California, United States of America) after excitation of the Hoechst dye with a 350 nm UV laser (100 mW power was used). Fluorescence light emitted by cells was directed toward a 510 nm DCLP dichroic mirror and -51- WO 2010/068758 PCT/US2009/067503 collected simultaneously by two independent detectors following a 450/65 nm and a 670/30 nm band pass filters, respectively. Cells were analyzed on a linearly amplified fluorescence scale. For immunostaining, Hoechst 33342-treated cells were collected by 5 centrifugation, washed twice with PBS, and incubated either with a rat anti Abcg2 (1:20) or a mouse anti-CD1 33 (1:50) primary antibody for 1 hour at room temperature. No blocking serum was used. Cy3-conjugated anti-rat IgG (1:200; CHEMICON@ International, Inc.) and ALEXA FLUOR@ 488-conjugated anti mouse IgG (1:200; MOLECULAR PROBES@) were the secondary antibodies 10 for anti-Abcg2 and anti-CID133, respectively. Images were captured with an Olympus confocal microscope. RNA extraction and Real Time PCR. RNA was extracted using TRIZOL@ reagent (INVITROGEN T M Corp.), and cDNA was synthesized using the INVITROGEN TM RT kit (INVITROGEN T M Corp.), and SYBR® Green Real Time 15 PCR was performed using a Stratagene Mx3000P Real Time PCR system (Stratagene, La Jolla, California, United States of America). PCR primers are described in Table 1 hereinabove. A mouse stem cell Real Time PCR Array was also analyzed (Catalogue No. APMM-405, SABIOSCIENCES T M Corporation, Frederick, Maryland, United States of America). Three 20 independent samples, each in triplicate, were analyzed for each Real Time PCR condition. Lentivirus shRNA Methods. The shRNA oligomers used for and Zeb2 silencing were described previously (Nishimura et al., 2006). The shRNAs were first cloned into a CMV-GFP lentiviral vector where its expression was driven by 25 the mouse U6 promoter. Briefly, each shRNA construct was generated by synthesizing an 83-mer oligonucleotide containing: (i) a 19-nucleotide sense strand and a 19-nucleotide antisense strand separated by a nine-nucleotide loop (5'-TTCAAGAGA-3'); (ii) a stretch of five adenines as a template for the Pollil promoter termination 30 signal; (iii) 21 nucleotides complimentary to the 3' end of the PolIll U6 promoter; and (iv) a 5' end containing a unique Xbal restriction site. The long oligonucleotide was used together with a SP6 oligonucleotide (5' ATTTAGGTGACACTATAGAAT-3'; SEQ ID NO: 71) to PCR-amplify a fragment -52- WO 2010/068758 PCT/US2009/067503 containing the entire U6 promoter plus shRNA sequences. The resulting product was digested with Xbal and Spel, ligated into the Nhel site of the lentivirus vector, and the insert was sequenced to ensure that no errors had occurred during the PCR or cloning steps. The sequences of the 19-nucleotide 5 sense strands were 5'-AAGACAACGTGAAAGACAA-3' (SEQ ID NO: 72) for Zeb1 and 5'-GGAAAAACGTGGTGAACTA-3' (SEQ ID NO: 73) for Zeb2. A negative control shRNA was also tested that had a sense strand of 5' AACAAGATGAAGAGCACCA-3' (SEQ ID NO: 74). The detailed procedure is described in Tiscornia et aL, 2006. Briefly, 10 293T cells were transfected with the lentiviral vector and packaging plasmids, and the supernatants containing recombinant pseudolentiviral particles were collected from culture dishes on the second and third days after transfection. MEFs were transduced with these lentiviral particles expressing shRNAs targeting Zeb1 or Zeb2 (or the negative control shRNA). A transduction 15 efficiency of near 100% was achieved based on GFP-positive cells. EXAMPLE 1 RB1 Family Mutation Allows Outgrowth of Cells into Spheres Leading to Survival in Suspension and Stable Changes in Cell Morphology Consistent with their lack of cell-cell contact inhibition, once mouse 20 embryo fibroblasts (MEFs) in which all three RB1 family members had been mutated (referred to herein as "TKOs") became confluent in culture, they began to stack up on one another leading to the generation of mounds of cells on the plates. See Figures 1A and 1B. Similar results were seen with cells at passages 4, 11, and 40, and with TKOs isolated from four different litters of 25 mice. Subsequently, outgrowth of cells in these mounds led to detachment of the mounds from the culture plate and formation of spheres in suspension (see Figures 1C and 1D). This sphere formation was efficient, and with time, most TKO cells on the plate formed spheres. In contrast to TKOs, wild type MEFs, RB1 MEFs, and RBl/RBL2* MEFs remained contact inhibited, and thus did 30 not form such mounds or spheres. The TKO spheres visually resembled embryoid bodies seen when embryonic stem cells are placed in suspension culture (see Figures 1 C and 1 D; Desbaillets et al., 2000), and when transferred to non-adherent plates, these -53- WO 2010/068758 PCT/US2009/067503 spheres could be maintained for at least two months in suspension. During this period, they increased in size and formed a central cavity (see Figure 1 E). When the spheres were transferred back to a tissue culture plate, they adhered to the plate and all of the cells within the spheres migrated back onto the plate, 5 reforming a monolayer (see Figures 1 F and 1 G). Surprisingly, none of the cells in these monolayers resembled TKOs prior to sphere formation; they were smaller and morphologically heterogeneous (compare Figure 1A to Figures 1H and 11). These sphere-derived TKOs retained this smaller size and distinct morphology as they were passaged in culture, demonstrating a stable 10 morphological transition. The generation of cells with such morphology in TKOs maintained in subconfluent monolayer cultures was not observed, even after 40 passages. If TKOs were trypsinized and suspended as single cells in culture, spheres did not form, and the single cells began to die after 24 hours in 15 suspension (Figure 2A). However, if TKOs present in confluent monolayers were scraped from the surface of a plate (i.e., without trypsinization), the cells formed spheres in suspension. Such spheres were indistinguishable in the experiments described hereinbelow from mound-derived cells that spontaneously detached from confluent TKO cultures. Consistent with their lack 20 of survival in suspension culture, trypsinized TKO did not form colonies in soft agar nor did they form tumors in nude mice (Figure 3; see below). However, expression of activated V12Ras in TKOs (TKO-Ras; Figure 4) allowed for their survival and proliferation of trypsinized TKOs in suspension. Thus, whether TKO-Ras cells could form colonies in soft agar was also 25 examined. Previously, Sage et al. reported that TKO-Ras cells could indeed form colonies in soft agar and tumors in nude mice (Sage et al., 2000), but Peeper et al. reported that V1 2Ras expression did not allow for growth of TKOs in soft agar (Peeper et al., 2001). Contrary to the results disclosed in Peeper et al., 2001, TKO-Ras cells 30 did form colonies in soft agar and tumors in nude mice when 50,000 cells were injected (Figure 3; see below). Conceivably, the differential effects of V12Ras in the TKO-Ras cells could be due to the levels of Ras expression in different cells, since three different V12Ras-expressing cells were used in the studies. -54- WO 2010/068758 PCT/US2009/067503 Interestingly, TKO-Ras cells did not form spheres in suspension that resembled those formed by TKOs (see Figure 2B). Instead, single cells and small clusters of TKO-Ras cells began to appear in suspension after the TKO Ras cells achieved confluence in culture. As with the trypsinized cells, these 5 single cells and clusters survived and proliferated in suspension culture. When TKO-Ras cells in suspension were allowed to reattach to culture plates, they were visually indistinguishable from cells maintained in monolayer culture. Thus, the TKO-Ras cells in suspension did not undergo the morphological changes seen with TKO cells in spheres. Further, activated Ras allows for 10 survival and proliferation of single TKO cells in suspension. Formation of spheres allowed the TKOs to survive and proliferate in suspension in the absence of activated Ras. EXAMPLE 2 Sphere Formation in RB1~'~ MEFs Also Led to Survival in Suspension 15 and Stable Morphological Changes As noted above, persistence of contact inhibition in RB1~' MEFs (mediated by RBL1 and RBL2) prevented formation of mounds and in turn spheres in monolayer culture (Figure 5A). However, scraping confluent monolayers of TKO cells and placing the cells in suspension culture led to 20 formation of spheres with properties indistinguishable from those seen in spheres derived from mounds that spontaneously detached from confluent plates. Therefore, it was postulated that bypassing contact inhibition by scraping confluent RB1-~ MEFs from plates and placing them in suspension culture might lead to sphere formation and generation of cells with distinct 25 morphology. Indeed when RB1 '~ MEFs were scraped from the plates upon which they were growing, they formed spheres in suspension as efficiently as TKOs, and the spheres were indistinguishable morphologically from those formed with TKOs and they increased in size and remained viable for at least two months in 30 culture (Figure 5B). As with TKO spheres, RB1~'~ MEF spheres in suspension culture on nonadherent plates reattached when transferred to tissue culture plates, and all cells in the spheres migrated back onto the plate to reform a monolayer (Figure 5C). As with TKO-sphere-derived cells, RB1'~ cells in these -55- WO 2010/068758 PCT/US2009/067503 monolayers were small, morphologically diverse, and distinct from the original RB1* MEFs (see Figure 5D). Real Time PCR demonstrated that mRNAs for RBL1 and RBL2 were downregulated in the RB1* spheres, potentially accounting for the loss of contact inhibition in the spheres (see Figure 6A). 5 EXAMPLE 3 Sphere Formation in TKOs and RB1~'~ MEFs Led to Expression of ES Cell Genes Real Time PCR was used to examine gene expression in TKOs and RB1~'~ MEFs prior to and following sphere formation. Induction of classic stem 10 cell marker mRNAs was observed in cells derived from spheres after two weeks in suspension culture. These mRNAs included Oct4, Nanog, Sox2, and Klf4 (see Figure 6A). Expression of both Oct4 and Nanog mRNA increased during a time course of RB1 MEF sphere formation in suspension culture (Figure 6B). 15 To confirm Oct4 protein expression, spheres were immunostained for Oct4. After 4 days in suspension, only low level cytoplasmic staining for Oct4 was observed (Figure 6C). Even though this cytoplasmic staining was dependent upon the primary antibody, little or no Oct4 mRNA was detected at this time (Figure 6B). Thus, this cytoplasmic immunostaining might be non 20 specific, as has been reported previously for Oct4 (Lengner et al., 2007). After 8 days in suspension culture, strong nuclear immunostaining for Oct4 became evident in clusters of the cells in the spheres, and this correlated with the appearance of Oct4 mRNA by Real Time PCR; the number of cells showing nuclear Oct4 immunostaining increased at 24 days, and during this 25 period there was a corresponding increase in the level of Oct4 mRNA (Figures 6B and 6C). Nanog is a downstream target of Oct4 and thus its expression can be viewed as a functional readout of Oct4 activity. The level of Nanog mRNA paralleled that of Oct4 during this time course of sphere culture (Figure 6B). In 30 addition to these stem cell-specific genes, upregulation of other genes associated with stem cells was observed in both TKO and RB1 ' MEF spheres (Figure 6D; Figure 7). Expression of CD44 and CD1 33 was induced, and CD24 expression was downregulated (see Figure 6D). -56- WO 2010/068758 PCT/US2009/067503 EXAMPLE 4 A Subset of Cells with Properties of a Side Population Generated in TKO and RB1~'~ MEF spheres Wild type MEFs, TKOs maintained as subconfluent monolayers, and 5 TKOs derived from spheres were tested for Hoechst dye exclusion and cell surface expression of Abcg2 and CD133. MEFs and TKOs maintained as subconfluent monolayers did not exclude Hoechst dye or express Abcg2 or CD1 33 on their surface (Figures 8A and 8C; Figure 9). However, about 10% of sphere-derived TKOs were Hoechst~/Abcg2*/CD1 33 (see Figures 8B and 8C). 10 Notably, these Hoechst-/Abcg2*/CD133* cells were much smaller (about 5 microns in diameter) than the main population (MP), which included Hoechst*/Abcg2~/CD133- cells that were typically greater than 10 microns in diameter. See Figure 10. RB1~'~ cells were then examined for SP properties including exclusion of 15 Hoechst dye; cell surface expression of Abcg2 and CD133; small size (e.g., about 5-7 microns in diameter); and expression of the Klf4, Oct4, Sox2, and c myc in levels similar to those seen in ES cells. Additional properties identified forthese cells included an ability to divide asymmetrically to yield additional SP cells and MP cells (which lack these properties), and ability of a low number (as 20 few as 100 cells) to generate tumors in nude mice. As opposed to MP cells, the tumors formed with SP cells contained cancer cells as well as differentiated cells expressing the neuronal marker beta3 tubulin. MP tumors did not contain differentiated cells (see below). As with wild type MEFs, the RB1~'~ MEFs in monolayer culture did not 25 display SP properties (Figure 8C); however, cells derived from RB1~- MEF spheres showed a similar SP population to TKOs (Figure 8C). The sorted MP cells were analyzed. These cells were proliferative, but they did not divide asymmetrically to give rise to SP cells (Figure 8D). However, it is of note that while the sorted MP cells were originally devoid of SP cells, a 30 small number of SP cells appeared in the dividing MP culture (-1 %), and this number remained relatively constant in the proliferating MP population for at least one month (Figure 11). Taken together, it appears that SP cells from both TKO and RB1~'~ spheres can give rise to MP cells via asymmetric division, and -57- WO 2010/068758 PCT/US2009/067503 that the MP cells in turn can divide symmetrically to increase their number in the population (although there was a low level of SP cell generation in the MP). EXAMPLE 5 The Hoechst~/Abcq2*/CD133* SP Cells Express Stem Cell Markers 5 Gene expression in sorted SP and MP populations of cells derived from spheres was compared to that in embryonic stem (ES) cells using Real Time PCR. The SP cells from spheres expressed mRNAs for stem cell markers in levels similar to those seen in ES cells (Figure 12A). These markers included Oct4, Sox2, c-myc, and Klf4, for which retroviral reexpression is sufficient for 10 reprogramming of MEFs to pluripotency (Takahashi & Yamanaka, 2006; Okita et al., 2007; Wernig et al., 2007; Jaenisch & Young, 2008). Conversely, there was little expression of the stem cell mRNAs in the MP cells. These results suggested that the Oct4* and Nanog t cells observed in spheres corresponded to SP cells, and that as the SP cells divided stem cell genes were 15 downregulated and/or silenced in daughter MP cells. As noted above, TKO-Ras cells did not form spheres in suspension nor did they express significant levels of Oct4, Klf4, or Nanog mRNAs. EXAMPLE 6 Zeb1 mRNA is Induced in SP cells and is Associated with 20 a CD44 high/CD24 low mRNA Expression Pattern Overexpression of E-box binding transcriptional repressors including Snai (1 and 2), twist, and Zeb classically leads to repression of E-cadherin and epithelial-mesenchymal transition (EMT), and Snail repression of E-cadherin and EMT appears to be mediated at least in part through induction of Zeb1 and 25 Zeb2 (Peinado et al., 2007). Recent studies have demonstrated that overexpression of these EMT factors can also trigger a CD44high/CD24 pattern on epithelial cells, which is associated with the somatic cells acquiring stem cell and cancer stem cell properties (Mani et al., 2008). Therefore, whether expression of these EMT transcription factors was induced in the 30 sphere-derived SP cells was tested. Using Real Time PCR, it was determined that Zeb1 (but not Zeb2, snail or snai2) mRNA was induced in SP cells compared to MP cells (Figure 12B), -58- WO 2010/068758 PCT/US2009/067503 and that Zeb1 mRNA increased in a time course of sphere formation in RB1 MEFs similar to that seen with Oct4 and Nanog mRNA (Figures 6B and 12C). Next, whether overexpression of Zeb1 mRNA coincided with induction of CD44 mRNA and downregulation of CD24 mRNA in SP cells was tested. 5 Indeed, CD44 mRNA was induced in SP cells, whereas CD24 mRNA was diminished (Figure 12D). In addition to this CD 4 4 high/CD 24 ' mRNA pattern in the SP cells, it is of note that CD1 33 mRNA and protein was also induced in the SP cells along with Zeb1 mRNA (Figure 12A). Both Zeb1 and Zeb2 are expressed in wild type MEFs (Liu et al., 2007a; 10 Liu et al., 2008), and while CD44 mRNA was not detected in these cells, CD24 mRNA was expressed (Figure 12E). Leniviral shRNA constructs were employed to knock down Zeb1 and Zeb2 expression in these cells (Figures 13A-1 3E) to determine whether either of these EMT transcription factors might be important in maintaining repression of CD24. It was found that knockdown of 15 Zeb2 had little effect on the level of CD24 mRNA. However, CD24 mRNA was significantly induced with Zeb1 knockdown (Figure 12E). These results provided evidence that the normal level of Zeb1 in the cells played a role in repressing CD24. EXAMPLE 7 20 RB1~'~ and TKO MEF Spheres Express Markers of All Three Embryonic Layers The appearance of SP cells expressing stem cell markers in TKO and RB1~'~ MEF spheres, together with the diverse morphology seen in cells derived from these spheres (see Figures 1H and 11; Figures 5, 14, and 15), led to an 25 investigation of whether there was evidence of differentiation in the spheres (e.g., analogous to differentiation seen when embryonic stem cells form embryoid bodies). Real Time PCR was employed to analyze mRNA expression in spheres and in cells which had been allowed to migrate from spheres and reform monolayers on tissue culture plates. Results were similar with the 30 spheres and the sphere-derived monolayers. mRNA expression in the sphere-derived cells was compared to that in cells maintained as subconfluent monolayers. The results are summarized in Table 5. -59- WO 2010/068758 PCT/US2009/067503 Table 5 Real Time PCR to Compare mRNA Expression in Monolayer Culture: MEFs vs. TKO' Symbol AVG STD Symbol AVG STD 1. Hematopoietic CD19 2.162756 0.918958 CD8b1 3.936995 2.663557 CD3d 1.617454 1.223371 Cxcl12 1.822446 0.073269 CD4 3.749245 1.782565 CD34 0.157265 0.043373 CD8a 5.686071 4.412893 2. Notch signaling Dil1 1.148384 0.601116 Jag1 2.564684 1.33494 D113 1.113073 0.726302 Notch2 0.679858 0.125039 Dtx1 1.402929 1.070028 Numb 1.874094 0.449959 Dtx2 2.152268 0.552309 Notch1 1.539392 0.374914 3. Wnt signaling Axin1 1.201534 0.376246 Fzd1 0.281172 0.070987 Dvil 3.235461 1.582196 Wntl 1.307538 1.156752 Frat1 2.552954 1.296211 4. Cell cycle Ccna2 0.405613 0.07395 Ccnel 0.431615 0.031129 Ccnd1 0.851618 0.132826 Cdc2a 0.531838 0.085725 Ccnd2 6.150291 0.628415 5. FGF regulation Fgf1 1.356579 0.432323 Fgf4 3.907379 1.139585 Fgf2 4.165012 0.515002 Fgfr1 2.191219 0.124001 Fgf3 1.478631 0.482986 Fgfr2 0.578845 0.034025 6. BMP signaling Bmpl 2.157023 0.4534 Gdf2 1.939791 0.274414 Bmp2 2.159411 0.813333 Gdf3 3.459464 0.481626 -60- WO 2010/068758 PCT/US2009/067503 Bmp3 1.743361 0.796377 BMP4 0.825059 0.654531 7. Stem cell Mystl 1.299416 0.236055 Gdf3 3.459464 0.481626 Aldh1al 13.33841 5.658154 Hspa9a 1.562171 0.12653 Aldh2 1.705199 0.8791 Krtl-15 0.979351 0.41743 Cd44 1.473242 0.189387 Prom1 0.663089 0.093934 Neurog2 2.124203 1.844036 Oct4 n.d. n.d. Sox2 0.858702 0.576787 CD34 0.157265 0.043373 Dl1 1.148384 0.601116 Nanog 3.883355 3.539828 Fgf3 1.478631 0.482986 Stat3 1.771547 0.008683 Fgf4 3.907379 1.139585 8. Endoderm Foxa2 2.476501 1.109203 GATA4 1.554909 0.280444 Aldob 1.294869 0.11409 LAMB1 3.063086 0.359485 CoI4 6.085709 0.208754 Trf n.d. n.d. 9. Mesoderm Actcl 4.218635 0.742679 Msx1 1.261426 0.789689 Bglapl 1.251945 0.336007 Col9al 3.245166 1.36648 T 1.434407 1.020334 Col4 6.085709 0.208754 Agc1 2.245066 0.659756 Myh2 3.287027 0.449688 Cd19 2.162756 0.918958 10. Neural/Ectoderm Adar 1.693513 0.281798 Oprsl 0.782157 0.024446 Agcl 2.245066 0.659756 S100b 1.553241 0.260488 Aldh2 1.705199 0.8791 Sox1 1.619727 0.994576 Cd44 1.473242 0.189387 Sox2 0.858702 0.576787 Dhh 4.425596 3.392188 Wntl 1.307538 1.156752 Gjb1 1.920556 0.789268 DIl1 1.148384 0.601116 Ncaml 6.068963 0.662156 Nes 0.219374 0.013968 Neurog2 2.124203 1.844036 Proml 0.663089 0.093934 -61- WO 2010/068758 PCT/US2009/067503 Notch1 1.539392 0.374914 Stat3 1.771547 0.008683 The data in the AVG columns present fold changes of expression in MEFs as compared to TKOs (individual levels normalized based on ACTB expression levels. n.d., not determined as the gene product was not detected in one or the other sample. 5 Induction of mRNAs for markers of all three embryonic layers was seen in the sphere-derived cells (see also Figures 7 and 16A-16C). These markers included important developmental transcription factors such as GATA4, T, Msxl, Foxa2, MyoD, Ascl2, PDX1, PPARy and islets, and components of development signaling pathways including TGF-p/BMP, notch, wnt, and FGF 10 (Figures 7 and 16A-16P). They also included markers of terminal differentiation such as cardiac actin, myosin heavy chain, osteocalcin, aggrecan, E-cadherin, transferin, a-fetoprotein (AFP), myelin basic protein, GFAP, tyrosine hydroxylase, p-Ill tubulin, NCAM, Neurog2, Col9al, CD19, CD3, CD4, and CD8. 15 Next, spheres were fixed and sectioned for immunostaining. The perimeter of embryoid bodies formed from ES cells typically contain early endodermal cells characterized by expression of AFP and GATA4, and this region is a site of hematopoietic and endothelial differentiation resembling embryonic yolk sac blood islands (Burkert et al., 1991). A band of cells was 20 observed around the perimeter of RB1 MEF spheres which resembled endodermal cells (Figures 17A-17C), and these cells immunostained for AFP (Figures 17D and 17E). This region also immunostained for GATA4 and mRNAs for GATA4 and the early endodermal transcription factors Foxa2, PDX1, and Isl were also induced in spheres (Figures 7, 17A, and 18). 25 This region of the spheres also contained a number of cells with eosinophilic cytoplasm, and these cells immunostained for globin, indicating that they were erythroid (Figures 17F-17H and 19). While most of these globin* cells were nucleated, some of the cells lacked nuclei (Figures 17H and 19), implying that they might have been progressing from erythroblast like 30 progenitors toward erythrocytes in the spheres. -62- WO 2010/068758 PCT/US2009/067503 This perimeter region of the spheres also contained cells with elongated morphology resembling endothelial cells (Figures 17A-1 7C), and indeed these cells immunostained for the endothelial marker CD31 (Figures 171 and 17J). Although less abundant than the globin+ cells, cells with morphologies of 5 other hematopoietic lineages, including megakaryocytes, were also evident (see Figures 19A-19T). Flow cytometry of total sphere-derived cells revealed that approximately 2% of the population expressed the hematopoietic stem cell marker CD34 and approximately 1% expressed the B cell marker CD1 9. CD34 and CD19 mRNAs were also induced in the spheres (Figure 16C). Taken 10 together, these results provided evidence that, as in embryoid bodies, the perimeter of the spheres was a site of hematopoietic/endothelial differentiation. As erythrocytes mature they lose their nuclei. Figures 19A-19M show that the cells in spheres differentiated to form erythrocytes at various stages of differentiation, some of which have nuclei and some of which have lost their 15 nuclei. Figures 19N-1 9R show immunostaining for hemoglobin demonstrating that the forming erythrocytes expressed hemoglobin. Other cells of hematopoietic origin were also evident in the spheres. Figures 19S and 19T show a megakaryocyte. Together, these results demonstrated that cells in the spheres differentiated into various hematopoietic lineages, which is also a 20 characteristic of ES cells and iPSC cells. Cells interior to the globin* cells in spheres displayed epithelial-like morphology (Figures 17A and 17C), and these cells expressed the early epithelial marker, E-cadherin (cdhl; see Figure 17K). In addition to upregulation of cdhl, expression of the epithelial progenitor marker Ker 5 was 25 also induced (Figure 7). Immunostaining for the neuronal marker p-Ill tubulin was also observed (Figure 17L). These P-Ill tubulin* cells were generally in clusters or spherical structures. Immunostaining for all of the markers of differentiation increased in a time dependent fashion from 4 days in suspension culture out to at least 24 days. By 24 days, a higher percentage of the p-Ill 30 tubulin* cells exhibited elongated morphology characteristic of neurons. Similar staining for globin, AFP, CD31 was also seen in the periphery of spheres derived from TKO cells. Again, p-Ill tubulin* cells were found primarily in clusters containing cells with neuronal morphology, and cells in these -63- WO 2010/068758 PCT/US2009/067503 clusters also expressed a-tyrosine hydroxlyase (a marker of dopaminergic neurons; Figure 18). Cells surrounding some of these neuronal clusters showed elongated projections and immunostained for both tyrosine hydroxylase and the motor neuron marker, isl1 (Figure 18). In addition to these 5 neuronal markers, immunostaining for markers of oligodendrocytes (myelin basic protein) and glia/astrocytes (GFAP) was also evident in distinct regions of the spheres (Figure 18). Expression of these neural markers is consistent with the induction of mRNA for various neural markers in the spheres (Figures 7 and 16B). 10 Based on these Real Time PCR and immunostaining results, it appeared that in addition to generation of cells with SP properties, sphere formation in RB1~'~ and TKO MEF spheres triggered differentiation into cells representative of all three embryonic layers. EXAMPLE 8 15 SP Cells Form Tumors in Nude Mice Because sphere formation in TKO and RB1~'~ MEFs led to cells with properties of cancer stem cells in culture, whether these cells might be capable of tumor formation in vivo was tested. As a control, 100,000 trypsinized TKO cells from subconfluent monolayer culture were injected subcutaneously into 20 the hind limbs of nude mice. Both early (passage 4) and late (passage 40) passage TKOs were employed. The results are summarized in Table 6. Table 6 Tumor Formation In vivo by Iniected Cells Number of Injected Cells Cell Type 100,000 50,000 20,000 5,000 2,000 1,000 500 100 TKO - n.d. n.d. n.d. n.d. n.d. n.d. n.d.

TKO

+ n.d. n.d. n.d. n.d. n.d. n.d. n.d. SDC MP + + - - - - - SP n.d. + n.d. + + + + +

TKO

+ + n.d. n.d. n.d. n.d. n.d. n.d. Ras -64- WO 2010/068758 PCT/US2009/067503 n.d.: not determined. TKO-SDC: TKO sphere-derived cells containing approximately 10% SP and 90% MP cells (see Figure 8). Tumors did not form in the mice, even after two months, nor did these 5 cells TKOs or RB1~'~ MEFs form colonies in soft agar (Figure 3). However, injection of small spheres of TKOs or RB1'~ MEFs after two weeks in suspension culture led to tumor formation. Examples of tumor formation in nude mice are shown in Figures 20A and 20B. 50,000 sphere-derived TKOs or RB1'~ MEFs, which had migrated from 10 spheres to reform monolayers, were also injected. These cells were trypsinized from culture plates and compared to an .equal number of TKO-Ras cells; tumors were harvested after 31 days. TKO-Ras cells formed tumors (average tumor mass = 515 ± 104 mg), and the different tumors were histologically indistinguishable and they appeared to be spindle cell sarcomas (Figure 20C). 15 The sphere-derived TKO and RB1~'~ MEF cells also formed tumors (500 ±18 mg). Histologically, the tumors formed from small spheres or sphere-derived cells were indistinguishable, and tumors from TKO or RB1~'~ sphere-derived cells were also indistinguishable (Figure 21). These tumors also appeared to be spindle cell sarcomas similar to those formed with TKO-Ras cell. 20 However, tumors from sphere-derived cells also contained sphere-like whorls with eosinophilic centers (which were not evident in TKO-Ras tumors; Figures 20C and 21). These sphere-like whorls appeared histologically similar to regions evident in spheres in culture, which expressed neuronal markers (Figure 18). Indeed, immunostaining of tumor sections revealed that these 25 whorls expressed p-Ill tubulin, and as with spheres in culture, no other regions of the tumor expressed p-Il tubulin (Figure 21). No p-1Il tubulin expression was seen in TKO-Ras tumors. Tumors resulting from injection of sphere-derived cells from TKO or RB1~'~ MEFs showed clusters of cells with nuclear immunostaining for Oct4 and Nanog, suggesting that the Oct4- and Nanog 30 expressing SP cells are retained in these tumors. SP cells were originally identified as the subpopulation of tumors capable of efficiently regenerating the tumor when transplanted. Therefore, different numbers of sorted SP and MP cells were injected into nude mice to -65- WO 2010/068758 PCT/US2009/067503 assess which population was tumorigenic. Two independent experiments were performed with two injections of each cell number in the following experiments. Initially, 50,000, 20,000, 5,000, or 1,000 MP cells were injected. While tumors formed with each injection of 50,000 MP cells (523 ± 93 mg after 31 days), no 5 tumors were observed in any injection with 20,000 or fewer MP cells, even after two months. However, when 5,000; 2,000; 500; or 100 SP cells were injected, tumors formed at each injection level and grew rapidly (e.g., 813 ± 279 mg at three weeks with 100 SP cells injected). Based on these results, it was concluded that SP cells were the primary 10 initiators of tumor formation among the sphere derived cells. Even though the sorted MP population was initially devoid of SP cells, it is of note that a small percentage of SP cells (- 1%) became evident with passage of the MP population in culture, and this number of SP cells remained relatively constant for at least one month in culture (Figure 11). Therefore, the appearance of a 15 small percentage of SP cells among the MP population might account fortumor formation seen when a large number of MP cells (50,000) was injected. However, the tumors formed from SP and MP cells were histologically distinct (see Figures 20D-20F). The MP tumors were indistinguishable histologically from those formed with TKO-Ras cells (Figures 20C and 20D), 20 whereas SP tumors contained neuronal whorls (Figures 20E and 20F). These whorls were similar in appearance those seen in tumors derived from unsorted sphere-derived TKO or RB1~'~ cells (Figure 21), but they were more numerous; they also immunostained for the neuronal marker P-111 tubulin (Figures 20G and 20H). The SP tumors also contained clusters of cells expressing nuclear Oct4 25 and Nanog throughout the tumor (Figures 201-20L), suggesting that SP cells were maintained in the forming tumor. EXAMPLE 9 Generation of Cells with Stem Cell Properties from Wild Type MEFs The studies described hereinabove demonstrated that sphere formation 30 can trigger reprogramming of fibroblasts with an RB1 pathway mutation to a phenotype resembling ES cells. However, these cells in addition to producing differentiated cells also produced cancer cells. Therefore, the same sphere formation was performed with wild type MEFs and with human fibroblasts to -66- WO 2010/068758 PCT/US2009/067503 determine whether sphere formation would produce the same reprogramming to an ES cell-like phenotype, but without the production of cancer cells that occurred with RB1 pathway mutation. Initially, wild type MEFs from E13.5 mouse embryos (i.e., mouse 5 embryos at embryonic day 13.5 post coitus (p.c.)) were isolated using standard techniques (see e.g., Nagy et al., 2003) and employed to form spheres. MEFs were grown to confluency, scraped from tissue culture plates, and placed in suspension as described hereinabove. Cells immediately formed spheres (see Figure 22A) and these spheres were viable in culture for at least two months. 10 RNA was isolated from the spheres and used in Real Time PCR assays. As described hereinabove, there was induction of mRNAs for several stem cell genes (see Figure 221B). Histological sections of sphere after one month in culture showed the presence of both nucleated and anucleated red blood cells that immunostained 15 for globin and reacted with benzadine, which demonstrated the presence of hemoglobin in the cells. Megakarocytes and neutrophils were also evident. Other bone marrow cells were also present. Immunostaining for p-Ill tubulin demonstrated the presence of neurons, and immunostaining for E-cadherin and ZO1 was evident on the surface of epithelial cells arranged in secretory 20 ducts. Immunostaining of MEF spheres is shown in Figure 22C. Real Time PCR was also employed to assay expression of various markers associated with different cell types, and the results are presented in Figure 22D. Additionally, Hoechst7/Abcg2*/CD1 33+ SP cells have been isolated from 25 wild type MEF spheres, and it was determined that the Hoechst~ /Abcg2*/CD1 33* SP cells were the cells that expressed markers. Additionally, these cells had an additional property that distinguished them from other cells in the spheres; they were small in diameter, ranging from 5-7 microns. Taken together, these results demonstrated that cells with the size and expression 30 pattern of stem cells could be generated from wild type MEFs after one week of culture as spheres in suspension culture. When cultured under similar sphere-forming conditions, ES cells undergo differentiation into cells representative of all three embryonic layers. -67- WO 2010/068758 PCT/US2009/067503 Indeed, the results demonstrated that mRNA indicative of each of the three embryonic layers were induced in the spheres. Thus, stem cell-like cells in the spheres had the same property as ES cells in that they were capable of generating differentiated cells representing each of the three embryonic layers 5 in spheres. Similar studies were performed with human fibroblasts (see Figure 23). These included primary cultures of human foreskin fibroblasts and primary cultures of fibroblasts from lung (IMR90 and W138). Figure 23A shows the presence of endodermal-like cells at the border of the sphere after H&E 10 staining as evidenced by immunostaining with the endodermal marker a fetoprotein (AFP; see Figure 23E). These same cells were positive for the endothelial marker CD31 (see Figure 23F) and a-globin (see Figure 23G). Cells resembling nucleated blood cells were also present (see Figures 23B and 23C), which was confirmed by benzidine staining, which demonstrated the presence 15 of hemoglobin (see Figure 23D). Furthermore, H&E stained sections (Figures 23H and 231) showed the presence of endothelial cells (gray arrow in Figure 231) surrounding a blood vessel, as well as a ductal structure(white arrow in Figure 231. Figure 23J shows benzidine staining of wild type MEF spheres. 20 Benzidine staining demonstrated the presence of hemoglobin in cells of MEF spheres. Figure 23K1 shows H&E staining of an erythrocyte, and Figure 23K2 shows immunostaining of an adjacent section of the sphere for hemoglobin, demonstrating that this erythrocyte expressed hemoglobin. Figures 23L1 -23L3 show immunostaining of another erythrocyte for hemoglobin, and this cell was 25 nucleated as demonstrated by DAPI nuclear staining. Thus, wild type MEF spheres contained both nucleated (i.e., immature) and mature erythrocytes. Figures 23M1-23M3 show innumostaining for CD31, which is a marker of endothelial cells. DAPI staining was used to show the nucleus of the cell. CD31 staining demonstrated that endothelial cells were formed in the wild type 30 MEF spheres, which also occurs in ES cell and iPSC spheres. Figures 23N and 230 are photomicrographs showing a region of cartilage stained with alcian blue. Figure 23P is a photomicrograph showing pearls of keratin (dark staining) in an keratinized cyst. -68- WO 2010/068758 PCT/US2009/067503 Additionally, Figure 24A is a photomicrograph showing a secretory epithelial ascinar like structure with a central duct (arrow), and Figure 24B shows evidence of the formation of secretory ducts (gray arrows) and red blood cells (white arrow). The top middle and top right photomicrographs of Figure 24 5 show hair fibers at the border of the spheres (the border is identified by black arrows), and Figures 24C and 24D shows immunostaining for the epithelial marker E cadherin (Cdh1) and the neuronal marker p-Ill tubulin. Figures 24E and 24F (the latter an enlargement of the field in the box in Figure 24E) show hair fibers at the border of the spheres (the border is identified by black 10 arrows). These results demonstrated that wild type MEFs in spheres can differentiate into elaborate tissues and structures including hair and secretory epithelial structures, both of which are properties of ES cells and iPSC. And finally, Figures 25A-25Q are a series of photomicrographs of spheres produced by Hoechst~/Abcg2*/CD133* cells derived from wild type 15 MEFs after 2 weeks in culture. The Hoechst~/Abcg2*/CD133* cells were isolated by cell sorting and cultured on a feeder layer of irradiated fibroblasts. The wild type MEFs were isolated from p-actin-GFP mice obtained from The Jackson Laboratory (Bar Harbor, Maine, United States of America). Cells in the center of the colonies maintained a Hoechst~ phenotype (characteristic of ES 20 cells), whereas cells on the edges of the colonies became Hoechst+ (which is characteristic of differentiating cells). These Hoechst+ cells gave rise to a variety of differentiated cells that migrated away from the original colony. These differentiated cells expressed p-Ill tubulin (p3Tub), GFAP, Troponin I, CD34, CD45, AFP, ZO1, Ter 19, or globin as shown in Figures 25D-25Q. 25 These results demonstrated that Hoechst~/Abcg2*/CD1 33+ cells derived from the wild type MEF spheres could be maintained in an undifferentiated state in culture, and that these cells could give rise to lineages representative of all three embryonic layers. These results also demonstrated that the Hoechst /Abcg2*/CD133* cells could differentiate into a variety of different lineages in 30 monolayer culture: p-Ill tubulin indicative of neurons; GFAP indicative of glial cells; AFP indicative of endodermal cells; ZO1 indicative of epithelial cells; troponin I indicative of cardiomyocytes; CD34 and CD45 indicative of hematopoietic lineages; Ter 19 indicative of erythrocyte progenitors; and globin -69- WO 2010/068758 PCT/US2009/067503 indicative of erythrocytes. This ability of Hoechst~/Abcg2*/CD133* cells from wild type MEF spheres to differentiate into a variety of lineages is shared by ES cells and inducible pluripotent stem cells (iPSC). Thus, the cells behaved like ES cells and iPSC in monolayer culture as well as in the spheres. 5 As such, sphere formation with both mouse and human fibroblasts led to expression of proteins indicative of all three embryonic layers. Further, the morphologies of the cells in these spheres were consistent with such differentiation. These results demonstrated that at the protein and morphology levels, mouse and human fibroblasts behaved like ES cells or induced 10 pluripotent stem cells (iPSC) when induced to form spheres in that they gave rise to cells representative of all three embryonic layers. EXAMPLE 10 Teratoma Formation by Spheres and Sphere-derived Cells Small spheres and sphere-derived cells from wild type MEFs and human 15 fibroblasts were injected into nude mice to assess tumor formation. Figures 26A-26E are a series of photomicrographs of teratoma formation by Hoechst~/Abcg2*/CD133* cells derived from wild type MEF spheres after 2 weeks in suspension culture. Four independent preparations of 50,000 cells were injected into both hindlimbs of nude mice. Tumors were observed in all 8 20 injections, and were tumors were collected after three weeks. Figure 26A is a Normarski image of a representative teratoma, and Figure 26B is a higher power view of an adjacent section of the tumor stained with H&E. A variety of structures characteristic of a teratoma can be seen. The MEFs were isolated from Actin-GFP mice and immunostaining for GFP (see 25 Figure 26D), which showed that the tumor was GFP* whereas surrounding host tissue was GFP~. These results demonstrate Hoechst~/Abcg2*/CD133* cells derived from wild type MEF spheres had another property of ES cells and iPSCs: they formed teratomas. Turning now to Figures 27A-27H, these Figures are a series of 30 photomicrographs of teratomas formed with Hoechst~/Abcg2*/CD133* cells derived from wild type MEF spheres showing cobblestone epithelial morphology and expressing the epithelial specification protein E-cadherin (see Figures 27C and 27D (low power) and 27G and 27H (higher power), which -70- WO 2010/068758 PCT/US2009/067503 present E-cadherin immunostaining on the surface of the cells). These teratomas contained cells representative of all three embryonic layers as well as differentiated tissues, similar to teratoma formation by ES cells. Thus, Hoechst7/Abcg2*/CD133* isolated from MEF-derived spheres formed 5 teratomas containing differentiated epithelial cells. Turning now to Figure 28, Figure 28A is a Nomarski image of adipose tissue present in a teratoma. Figure 28C shows immunostaining for GFP showing that the adipose tissue was derived from the injected Hoechst /Abcg2*/CD133* cells. 10 Figure 28E is a Nomarski image of a neuronal structure in a teratoma. Figure 28G shows immunostaining of the section of Figure 28E for p-ll1 tubulin, showing a cluster of neurons within a neuronal structure in the teratoma. Figure 281 is a Nomarski image of a region of intestinal-like epithelium in a teratoma. Figure 28K shows immunostaining of the cells presented in Figure 15 281 for GFP, and shows that this intestinal-like structure was derived from injected Hoechst~/Abcg2*/CD1 33+ cells. Figure 28M is a Nomarski image of a secretory epithelial structure in a teratoma. Figure 280 shows GFP immunostaining and demonstrated that the structure in Figure 28M is derived from the injected Hoechst7/Abcg2*/CD1 33+ 20 cells. Figure 28P shows the results of immunostaining the structure for CDH1 expression, which demonstrated that the structure was epithelial. Figures 29A-291 are a series of photomicrographs showing formation of skeletal muscle in a teratoma arising from injection of wild type MEF Hoechst~ /Abcg2*/CD1 33* cells derived from spheres into nude mice. Figure 29A shows 25 skeletal muscle fibers in the teratoma by H&E staining. A Nomarski image of an adjacent section is shown as Figure 29B and GFP staining is shown in Figure 29D, demonstrating that the muscle cells ware tumor-derived. Control photomicrographs are presented in Figures 29F-291 . A Nomarski image of host skeletal muscle is shown in Figure 29F. DAPI staining 30 is shown in Figure 29G and GFP is shown in Figure 29H. There was a lack of GFP staining in Figure 29H, which is host muscle that does not express GFP, indicating that Hoechst~/Abcg2*/CD133* cells derived from wild type MEF -71- WO 2010/068758 PCT/US2009/067503 spheres formed teratomas in nude mice containing skeletal muscle, which is also known to occur with teratomas derived from ES cells. Thus, the presently disclosed subject matter demonstrated the presence of multiple differentiated tissues in the teratoma formed with Hoechst 5 /Abcg2*/CD133* cells derived from wild type MEF cells following Sphere formation. These results further demonstrated that the Hoechst /Abcg2*/CD1 33+ cells derived from wild type MEF spheres had properties of ES cells or inducible pluripotent stem cells (iPSC). Thus, sphere formation was able to generate reprogammed fibroblasts that does not rely on re-expression 10 of exogenous stem cells genes. Instead, this technique led to re-induction of endogenous stem cell genes to reprogram the wild type MEFs. Summarily, none of the wild type cells produced tumors. This sphere dependent reprogramming in the wild type fibroblasts thus did not appear to produce cancer cells as was observed in cells in which the RB1 pathway was 15 mutated. EXAMPLE 11 Production of Melanocyte-like Cells from MEF Spheres MEF spheres after two weeks in suspension culture were transferred to tissue culture dishes. Spheres attached to the plates and cells began to migrate 20 out onto the plate as was observed with TKO and RB1 MEF spheres. However, in contrast to the TKO and RB1- MEF cells, only a portion of the cells from the wild type MEF spheres migrated back onto the plate. These cells were highly pigmented (see Figures 30A-30C). Initially, most of the cells were rounded or epithelial in appearance. However after several days on the plate, 25 the cells remained pigmented but they began to elongate (see Figures 30D 30F). After several more days, the cells were still pigmented but then began to send out multiple dendritic-like projections resembling melanocytes. The cells were immunostained for two melanocyte-specific markers: Miff and mel5. All of the pigmented cells immunostained for both markers, 30 suggesting that the pigmented cells which migrated out of the MEF spheres were melanosome-like and that they took on the morphology and gene expression pattern of melanocytes after several days in culture. -72- WO 2010/068758 PCT/US2009/067503 Similar results were seen with spheres formed from human foreskin fibroblasts and with the normal human lung fibroblast lines IMR90 and W138 obtained from the American Type Culture Collection (ATCC@; Manassas, Virginia, United States of America). 5 EXAMPLE 12 Gene Expression Analysis of Melanocyte-like Cells from MEF Spheres RNA was isolated from melanocyte-like cells from MEF spheres and used for Real Time PCR comparison to MEF maintained as subconfluent monolayers using the primers disclosed in Table 4. Tyr and Tyrp1 are key 10 genes in the pigment synthesis cascade. Pax3 and Sox1O cooperate with MITF-M isoform in specification of melanocytes. RPE65 is a marker of retinal pigment epithelial cells which is not expressed in melanocytes and thus was employed as a control. Taken together, the results shown in Figures 30A-30F and 31 demonstrated the efficient formation of melanocytes from mouse and 15 human fibroblasts via sphere formation. MEFs, human foreskin fibroblasts, or normal human lung fibroblast cell lines IMR90 and Wi38 were grown to confluence and then scraped from tissue culture plates and placed in suspension culture in non-adherent plates. After two weeks in culture, the resulting spheres were transferred to culture dishes 20 and as with TKO and RB1 null MEFs, cells in the sphere migrated back onto the tissue culture dishes to reform a monolayer. However, in contrast to the mutant MEFs, not all of the cells in the wild type spheres migrated back out of the spheres. The cells migrating out of the spheres were highly pigmented, and 25 results shown in Figures 30A-30F and 31 suggested that these pigment cells were melanocyte precursors which subsequently sent out dendritic process and differentiated into melanocytes following re-adhesion to the tissue culture dish. This conclusion is based both on morphology (dentritic processes and pigment) and expression of the melanocyte-specific markers Mift-M and Mel5 (see 30 Figures 301-30K) and the melanocyte specification genes Sox10 and Pax3. Because highly pigmented melanocyte precursors are the primary cell type that migrated from the wild type mouse and human spheres, these cells could be obtained in relatively pure form. -73- WO 2010/068758 PCT/US2009/067503 Antibody information: Miff and mel5 (tyrosinase related protein 75) antibodies were from Abcam Inc., Cambridge, Massachusetts, United States of America and were used at a dilution of 1:50 as described by the manufacturer. EXAMPLE 13 5 Sphere Formation using Human Lung Bronchial Epithelial Cells Primary cultures of human lung bronchial epithelial cells were grown to confluence, and then scraped from tissue culture dishes and placed in suspension culture in non-adherent plates as described hereinabove for fibroblasts. Spheres were allowed to form for 5 days, and then the spheres 10 were fixed and sectioned into 5 micron sections. The spheres appeared morphologically similar to those formed with fibroblasts, and the efficiency of sphere formation in the epithelial cells and fibroblasts was similar. As with the fibroblast spheres, these epithelial spheres contained a number of nucleated and non-nucleated eosinophilic cells resembling 15 erythrocytes and erythrocyte progenitors similar to those seen with spheres of fibroblasts. Sections of the epithelial spheres were then immunostained for the alpha globin chain of hemaglobin, and the sections were also stained with benzidine-peroxide, which produced a dark blue reaction in the presence of hemoglobin (see arrows in Figures 32A-32J). 20 Thus, human lung epithelial cells could also form spheres in suspension culture and underwent a similar differentiation into cells resembling erythrocytes as seen with fibroblast spheres. As such, it appeared that epithelial cells induced to form spheres in suspension also underwent reprogramming and differentiated into other cell types. 25 Discussion of the EXAMPLES Embryonic stem (ES) cells and induced pluripotent stem cells (iPSC) can classically differentiate into cells representing each of the three embryonic lineages (ectoderm, endoderm, and mesoderm) when placed in suspension culture, and this differentiation is accompanied by activation of signaling 30 pathways including Wnt, Notch, and growth factors such as BMP and FGF. The Real Time PCR results disclosed herein demonstrated that TKO cells placed in spheres can, like ES cells and iPSC, differentiate into cells expressing mRNAs for markers of all three embryonic layers. The results also -74- WO 2010/068758 PCT/US2009/067503 demonstrated that TKO induced to form spheres expressed mRNA for genes associated with Wnt, Notch, and growth factor signaling that are known to drive these types of differentiation. In this way, TKO cells resembled ESC and iPSC. However, TKO cells could also give rise to cancer cells, suggesting that 5 mutation of the RB1 family might associated with cancer generation in these cells. It is also disclosed herein that wild type MEFs without the RB1 family mutations (i.e., that are RB1*, RBL1*, and RBL2*) also differentiated into cells expressing mRNAs for markers of all three embryonic layers, but did not give rise to cancer cells in the same fashion as did TKO MEFs. 10 When the RB1 pathway was mutated, these reprogrammed cells gave rise to both differentiated cells as well as cancer stem cells, which in turn gave rise to cancer cells. Additionally, sphere formation using wild type mouse or human fibroblasts led to similar reprogramming, but cancer cells were not produced. Thus, maintaining a functional RB1 pathway could prevent the 15 production of cancer cells during reprogramming of fibroblast via sphere formation. Sphere formation can provide reprogramming, but since the endogenous stem cell genes were reexpressed (i.e., without requiring ectopic expression from recombinant vectors), there was no need for viral infection and its 20 associated cancer risk. Undifferentiated ES cells form teratomas when injected into hosts, thus these cells must be partially differentiated in culture prior to injection. Nevertheless, a cancer risk remains from any remaining undifferentiated cells. Additionally, partial differentiation of ES cells seems to be required for their 25 ability to facilitate repair of tissues in vivo. Sphere-derived cells from wild type mouse or human fibroblasts did not appear to pose a cancer risk. Therefore, progenitors representative of cells in all three embryonic layers can be sorted from spheres using specific cell surface markers and can be used in similar therapies as partially differentiated ES cells or induced pluripotent fibroblasts. 30 Based on the discoveries described herein, cells in spheres can be directed toward specific differentiation pathways by using the various differentiation protocols that have been established for ES cells. An exemplary approach is that skin fibroblasts from a patient following punch biopsy are -75- WO 2010/068758 PCT/US2009/067503 placed in culture and used to form spheres. During or following sphere formation, the sphere derived cells can be exposed to appropriate growth factors and cytokines designed to enhance and/or facilitate formation of a specific cellular lineage. Cells surface markers specific for this lineage can be 5 used to sort the differentiated cells, which can then in turn be used therapeutically in cell transfer back to the patient. These transfer experiments are analogous to those currently underway with ES cells and induced pluripotent fibroblasts. Exemplary advantages of employing the presently disclosed cells rather 10 than ES cells include, but are not limited to the fact that the former are not characterized by the ethical concerns raised by use of the latter, apparently have greatly reduced or no risk of teratoma formation, and would not give rise to histocompatibility issues (or other genetic or infection issues) because the sphere-derived cells can be isolated from the subject into which they would 15 thereafter be introduced (unlike ES cells). Another advantage that the induced pluripotent fibroblasts disclosed herein would be expected to have over ES cells is that endogenous "pluripotency markers" (e.g., Oct4, Sox2, and Klf4) are caused to be re expressed in the sphere-derived cells without the need to resort to employing 20 viral infection, which has been linked to cancer risk. As disclosed herein, sphere formation is a mechanism for reprogramming of fibroblasts to a multipotential phenotype. While the instant co-inventors do not wish to be bound by any particular theory of operation, a proposed model for a pathway for generation of cells with properties of cancer 25 stem cells from differentiated somatic cells is presented in Figure 33. REFERENCES All references listed in the instant disclosure, including but not limited to all patents, patent applications and publications thereof, scientific journal articles, and database entries (including but not limited to GENBANK@ 30 database entries including all annotations available therein) are incorporated herein by reference in their entireties to the extent that they supplement, explain, provide a background for, or teach methodology, techniques, and/or compositions employed herein. -76- WO 2010/068758 PCT/US2009/067503 Ajioka et al. (2007) Cell 131, 378-390. Ansieau et al. (2008) Cancer Cell 14, 79-89. Assady et al. (2001) Diabetes 50, 1691-1697. Bader et al. (2000) Circ Res 86, 787-794. 5 Bagutti et al. (1996) Dev Biol 179, 184-196. Brustle et al. (1999) Science 285, 754-756. Burkert et al. (1991) New Biol 3, 698-708. Buttery et al. (2001) Tissue Eng 7, 89-99. Cai et al. (2007) Hepatology 45, 1229-1239. 10 Candi et al. (2007) Cell Cycle 6, 274-285. Chadwick et al. (2003) Blood 102, 906-915. D'Amour et at. (2005) Nat Biotechno/ 23, 1534-1541. D'Amour et al. (2006) Nat Biotechnol 24, 1392-1401. Dalerba et al. (2007) Annu Rev Med 58, 267-84. 15 Dannenberg & te Riele (2006) Results Probl Cell Differ 42, 183-225. Dannenberg et al. (2000) Genes Dev 14, 3051-64. Desbaillets et al. (2000) Exp Physiol 85, 645-651. Dick (2005) Ann NY Acad Sci 1044, 1-5. Du & Pogoriler (2006) Oncogene 25, 5190-5200. 20 Frolov et al. (2004) J Cell Sci 117, 2173-81. Godar et al. (2008) Cell 134, 62-73. Harlow & Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Harlow & Lane (1999) Usinq Antibodies: A Laboratory Manual, Cold 25 Spring Harbor Laboratory, Cold Spring Harbor, New York. Hermann et al. (2004) J Cell Sci 117, 4411-4422. Hirschmann-Jax et al. (2005) Cell Cycle 4, 203-205. Itsykson et al. (2005) Mol Cell Neurosci 30, 24-36. Jaenisch & Young (2008) Cell 132, 567-582. 30 Jiang et al. (2007) Cell Res 4, 333-444. Kang et al. (2007) Stem Cells 25, 419-424. Kansara & Thomas (2007) DNA Cell Biol 26, 1-18. Kawasaki et al. (2000) Neuron 28, 3140. -77- WO 2010/068758 PCT/US2009/067503 Kaye (2002) Oncogene 21, 6908-6914. Kehat et al. (2001) J Clin Invest 108, 407-414. Knoblich (2008) Cell 132, 583-597. Kramer et al. (2000) Mech Dev 92, 193-205. 5 Lee et al. (2000) Nat Biotechnol 18, 675-679. Lengner et al. (2007) Cell Stem Cell 1, 403-415. Lieschke & Dunn (1995) Exp Hemat 23, 328-334. Liu et al. (2007a) Biochem J 408, 79-85. Liu et al. (2007b) N Eng/ J Med 356, 217-226. Liu et al. (2008) Development 235, 579-588. 10 Liu et al. (2009) Cell Stem Cell 4, 336-347. Lobo et al. (2007) Annu Rev Cell Dev Biol 23, 675-699. Lowe & Sherr (2003) Curr Opin Genet Dev 13, 77-83. Lumelsky et al. (2001) Science 292, 1389-1394. MacPherson & Dyer (2007) Cancer Res 67, 7547-7550. 15 Mani et al. (2008) Cell 133, 704-715. Mummery et al. (2003) Circulation 107, 2733-2740. Nagy et al. (2003) Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, United States of America. 20 Neth et al. (2007) Stem Cell Rev 3, 18-29. Nishimura et al. (2007) Dev Cell 11, 93-104. O'Brien et al. (2007) Nature 225, 106-110. Okita et al. (2007) Nature 448, 260-262. PCT International Patent Application Publication Nos. WO 2007/067280; 25 WO 2009/059032. Peeper et al. (2001) Nat Cell Biol 3, 198-203. Peinado et al. (2007) Nat Rev Cancer 7, 415-428. Pomp et al. (2005) Stem Cells 23, 923-930. Prelle et al. (2000) Biochem Biophys Res Commun 277, 631-638. 30 Rambhatla et al. (2003) Cell Transplant 12, 1-11. Reubinoff et al. (2001) Nat Biotechnol 19, 1134-1140. Robey et al. (2007) Cancer Metastasis Rev 26, 39-57. -78- WO 2010/068758 PCT/US2009/067503 Sabado Alvarez (2008) Clin Transl Oncol 10, 389-384. Sage et al. (2000) Genes Dev 14, 3037-3050. Sambrook & Russell (2001) Molecular Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New 5 York, United States of America. Schantz & Ng (2004) A Manual for Primary Human Cell Culture, World Scientific Publishing Co., Inc., Hackensack, New Jersey, United States of America. Seigel et a/. (2005) Mol Vis 11, 729-37. 10 Seigel et al. (2007) Mol Vis 13, 823-832. Sottile et al. (2003) Cloning Stem Cells 5, 149-155. Stemmer et al. (2008) Oncogene 27, 5075-5080. Takahashi & Yamanaka (2006) Cell 126, 663-76. Takahashi et al. (2007) Cell 131, 861-872. 15 Telang et al. (2006) Oncogene 25, 7225-7234. Tiscornia et al. (2006) Nat Protoc 1, 234-240 te Riele (2007) Cell 131, 227-229. Trimbloi et al. (2008) Cancer Res 68, 937-945. Trosko (2006) Ann NY Acad Sci 1089, 36-58. 20 Tsai et al. (2000) Proc Natl Acad Sci U S A 97, 9186-9190. U.S. Patent Application Publication Nos. 20090191159; 20090191171. U.S. Patent Nos. 5,914,268; 6,395,546; 6,602,711; 7,153,684; 7,220,584. Wernig et al. (2007) Nature 448, 318-324. 25 Wong et al. (2008) Cell Stem Cell 2, 333-344. Yamane et al. (1999) Dev Dyn 216, 450-458. Yamashita et al. (2000) Nature 408, 92-96. Yuasa et al. (2005) Nat Biotechnol 23, 607-611. Zhang & Rosen (2006) Curr Opin Genet Dev 16, 60-64. 30 Zhang et al. (1999) Cell 97, 53-61. Zhang et al. (2001) Nat Biotechnol 19, 1129-1133. -79- WO 2010/068758 PCT/US2009/067503 It will be understood that various details of the presently disclosed subject matter may be changed without departing from the scope of the presently disclosed subject matter. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation. 5 -80-

Claims (38)

1. A method for producing a reprogrammed fibroblast, the method comprising: 5 (a) growing a plurality of fibroblasts in monolayer culture to confluency; and (b) disrupting the monolayer culture to place at least a fraction of the plurality of fibroblasts into suspension culture under conditions sufficient to form one or more embryoid body-like spheres, 10 wherein the one or more embryoid body-like spheres comprise a reprogrammed fibroblast induced to express at least one endogenous gene not expressed by a fibroblast growing in the monolayer culture prior to the disrupting step. 15

2. The method of claim 1, wherein the fibroblast is a mammalian fibroblast, optionally a human fibroblast.

3. The method of claim 1, wherein the fibroblast is a non-recombinant fibroblast. 20

4. The method of claim 1, wherein the disrupting comprises scraping the confluent monolayer off of a substrate upon which the confluent monolayer is being cultured. 25

5. The method of claim 1, further comprising maintaining the one or more embryoid body-like spheres in suspension culture for at least one month, optionally for at least two months.

6. The method of claim 5, wherein the one or more embryoid body-like 30 spheres are maintained in a medium comprising DMEM and 10% FBS.

7. The method of claim 1, wherein the reprogrammed fibroblast expresses at least one endogenous gene is selected from the group consisting of -81- WO 2010/068758 PCT/US2009/067503 Oct4, Nanog, FGF4, Sox2, Klf4, Sseal, and Stat3.

8. The method of claim 1, wherein the reprogrammed fibroblast is non tumorigenic in nude mice. 5

9. A reprogrammed fibroblast produced by the method of claim 1.

10. A reprogrammed fibroblast cell non-recombinantly induced to express one or more endogenous stem cell markers. 10

11. A formulation comprising the reprogrammed fibroblast cell of one of claims 9 and 10 in a pharmaceutically acceptable carrier or excipient.

12. The formulation of claim 11, wherein the pharmaceutically acceptable 15 carrier or excipient is acceptable for use in humans.

13. An embryoid body-like sphere comprising a plurality of reprogrammed fibroblasts, optional wherein the reprogrammed fibroblasts are non recombinant fibroblasts. 20

14. A cell culture comprising the embryoid body-like spheres of claim 13 in a medium sufficient to maintain the embryoid body-like spheres in suspension culture for at least one month. 25

15. A method for inducing expression of one or more stem cell markers in a fibroblast, the method comprising: (a) growing a plurality of fibroblasts in monolayer culture to confluency; and (b) disrupting the monolayer culture to place at least a fraction of the 30 plurality of fibroblasts into suspension culture under conditions sufficient to form one or more spheres, wherein the one or more spheres comprise a fibroblast expressing one or more stem cell markers. -82- WO 2010/068758 PCT/US2009/067503

16. A method of differentiating a reprogrammed fibroblast cell into a cell type of interest, the method comprising: (a) providing an embryoid body-like sphere comprising 5 reprogrammed fibroblast cells; and (b) culturing the embryoid body-like sphere in a culture medium comprising a differentiation-inducing amount of one or more factors that induce differentiation of the reprogrammed fibroblast cells or derivatives thereof into the cell type of interest until the 10 cell type of interest appears in the culture.

17. The method of claim 16, wherein the cell type of interest is selected from the group consisting of a neuronal cell, an endodermal cell, and a cardiomyocyte, and derivatives thereof. 15

18. The method of claim 17, wherein the cell type of interest is a neuronal cell or a derivative thereof.

19. The method of claim 18, wherein the neuronal cell or derivative thereof 20 is selected from the group consisting of an oligodendrocyte, an astrocyte, a glial cell, and a neuron.

20. The method of claim 18, wherein the neuronal cell or derivative thereof expresses a marker selected from the group consisting of GFAP, nestin, 25 p-1ll tubulin, Olig1, and Olig2.

21. The method of claim 18, wherein the culturing is for at least about 10 days. 30

22. The method of claim 18, wherein the culture medium comprises about 10 ng/ml rhEGF, about 20 ng/ml FGF2, and about 20 ng/ml NGF.

23. The method of claim 17, wherein the cell type of interest is an -83- WO 2010/068758 PCT/US2009/067503 endodermal cell or derivative thereof.

24. The method of claim 23, wherein the culturing comprises culturing the embryoid body-like sphere in a first culture medium comprising Activin 5 A; and thereafter culturing the embryoid body-like sphere in a second culture medium comprising N2 supplement-A, B27 supplement, and about 10 mM nicotinamide.

25. The method of claim 24, wherein the culturing in the first culture medium 10 is for about 48 hours.

26. The method of claim 24, wherein the culturing in the second culture medium is for at least about 12 days. 15

27. The method of claim 24, wherein the endodermal cell or derivative thereof expresses a marker selected from the group consisting of Nkx6 1, Pdx1, and C-peptide.

28. The method of claim 17, wherein the cell type of interest is a 20 cardiomyocyte or a derivative thereof.

29. The method of claim 28, wherein the culturing is for at least about 15 days. 25 30. The method of claim 28, wherein the culture medium comprises a combination of basic fibroblast growth factor, vascular endothelial growth factor, and transforming growth factor P1 in an amount sufficient to cause a subset of the embryoid body-like sphere cells to differentiate into cardiomyocytes.

30

31. The method of claim 28, wherein the cardiomyocyte or derivative thereof expresses a marker selected from the group consisting of Nkx2-5/Csx and GATA4. -84- WO 2010/068758 PCT/US2009/067503

32. The method of claim 16, wherein the embryoid body-like sphere is prepared by: (a) growing a plurality of fibroblasts in monolayer culture on a tissue 5 culture plate to confluency; and (b) disrupting the monolayer culture to place at least a fraction of the plurality of fibroblasts into suspension culture under conditions sufficient to form one or more embryoid body-like spheres, wherein the one or more embryoid body-like spheres comprise a 10 reprogrammed fibroblast.

33. A method of treating a disease, disorder, or injury to a tissue in a subject, the method comprising administering to the subject a composition comprising a plurality of reprogrammed fibroblast cells in a 15 pharmaceutically acceptable carrier, in an amount and via a route sufficient to allow at least a fraction of the reprogrammed fibroblast cells to engraft the tissue and differentiate therein, whereby the disease, disorder, or injury is treated. 20

34. The method of claim 33, wherein the disease, disorder, or injury is selected from the group consisting of an ischemic injury, a myocardial infarction, and stroke.

35. The method of claim 33, wherein the subject is a mammal. 25

36. The method of claim 35, wherein the mammal is selected from the group consisting of a human and a mouse.

37. The method of claim 33, further comprising differentiating the 30 reprogrammed fibroblast cells to produce a pre-determined cell type prior to administering the composition to the subject.

38. The method of claim 37, wherein the pre-determined cell type is -85- WO 2010/068758 PCT/US2009/067503 selected from the group consisting of a neural cell, an endoderm cell, a cardiomyocyte, and derivatives thereof. -86-