AU2003212102B2 - Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ralpha1) - Google Patents
Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ralpha1) Download PDFInfo
- Publication number
- AU2003212102B2 AU2003212102B2 AU2003212102A AU2003212102A AU2003212102B2 AU 2003212102 B2 AU2003212102 B2 AU 2003212102B2 AU 2003212102 A AU2003212102 A AU 2003212102A AU 2003212102 A AU2003212102 A AU 2003212102A AU 2003212102 B2 AU2003212102 B2 AU 2003212102B2
- Authority
- AU
- Australia
- Prior art keywords
- antibody
- 13ral
- antibodies
- human
- receptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Description
WO 03/080675 PCT/AU03/00352 Monoclonal Antibody Against Interleukin-13 Receptor Alpha 1 (IL-13Ral) BACKGROUND OF THE INVENTION 5 FIELD OF THE INVENTION The present invention relates generally to antibodies that bind to the Interleukin-13 receptor al chain (IL-3Rcl) and antagonize IL-13 receptor-mediated signaling by IL-13 and/or IL-4. More particularly, the present invention provides humanized or human 10 antibodies to mammalian and in particular IL-13Ral. These antibodies have uses in the treatment or prevention of IL-13- and/or IL-4-mediated diseases or conditions. The present invention further contemplates a method -of modulating IL-13- and/or IL-4-mediated diseases or conditions by the administration of the subject antibodies. The present invention further provides an assay system useful for identifying antibodies or other agents 15 which modulate IL-13 and/or IL-4 signaling through an IL-13 receptor complex. Accordingly, a method of screening for modulators of IL-13Ral/ligand interaction is also provided. DESCRIPTION OF THE PRIOR ART 20 Bibliographic details of the publications referred to in this specification are also collected at the end of the description. Reference to any prior art in this specification is not, and should not be taken as, an 25 acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country. Interleukin-13 (IL-13) is a member of the interleukin (IL) family whose biological effects have significant physiological implications since both up- and down-regulation of activity 30 of this cytokine in vivo could potentially provide pharmacological treatments for a wide range of common pathologies. For this reason, amongst others, the study of IL-13 and WO 03/080675 PCT/AU03/00352 -2 other IL molecules is of great medical importance. For example, IL-13 is strongly involved in the induction of IgE and IgG4 production as well as the differentiation of T-helper (Th) cells into a secretory (Th2) phenotype. These immunostimulatory steps are critical in the development of atopic diseases which are a major threat to human health, such as 5 anaphylaxis (Howard et al., Am J Hum Genet 70(1): 230-236, 2002; Noguchi et al., Hum Immunol 62(11): 1251-1257, 2001) as well as milder conditions such as hay fever, allergic rhinitis and chronic sinusitis which, although not life-threatening, are responsible for considerable morbidity worldwide. 10 IL-13 is a mediator in the pathology of the acute and chronic stages of asthma. During an asthma attack, its activity increases and its effects include reduction of the capacity of lung epithelial cells to maintain a tight barrier against inhaled particles and pathogens (Ahdieh et al., Am J. Physiol. Cell Physiol. 281(6): C2029-2038, 2000) and promotion of allergen induced airway hyper-responsiveness (Morse et al., Am. J. Physiol. Lung Cell Mol. 15 Physiol. 282(1): L44-49, 2002). In the longer term, IL-13 promotes non-inflammatory structural changes to asthmatic airways, such as enhanced expression of mucin genes, airway damage and obstruction of the small airways (Howard et al., Am. J. Hum. Genet. 70(1): 230-236, 2002; Danahay et al., Am. J. Physiol. Lung Cell Mol. Physiol. 282(2): L226-236, 2002). 20 Up-regulation of IL- 13 activity may be beneficial in certain immune deficiency conditions to reduce disease progression. In HIV infection, for example, a reduction in secretion by Th2 cells reduces antigen-specific immune responses (Bailer et al., J. Immunol. 162(12): 7534-7542, 1999). IL-13, whose levels gradually decline in accordance with disease 25 progression in HIV, has been found to enhance antigen presentation in immune deficiency conditions and to reduce de novo HIV-infection of macrophages (Bailer et al., Eur. J. Immunol. 30(5): 1340-1349, 2000). The biological effects of IL-13 are mediated by a dimeric receptor complex comprising the 30 subunits IL-13Ral (or the NR4 subunit) and IL-4Ra. It is postulated that IL-13 binding to IL-13Ral triggers dimerization with IL-4Rc and activation of intracellular mediators that WO 03/080675 PCT/AU03/00352 -3 include the Janus Kinases JAK1 and JAK2, as well as STAT6, ERK and p38 (David et al., Oncogene 20(46): 6660-6668, 2001; Perez et al., J Immunol. 168(3): 1428-1434, 2002). IL-13 shows many overlapping biological effects with those of IL-4. IL-13 and IL-4 are 5 related by sequence and are involved in many related processes, such as myelopoiesis and the regulation of monocyte/macrophage pro-inflammatory functions. For example, both IL-13 and IL-4 have been shown to effect B cells in a similar fashion, up-regulating surface molecules such as MHC class II and CD23 molecules, and promoting the secretion of IgG4 and IgE. 10 The overlapping activities of IL-13 and IL-4 can be explained in part by their shared dimeric receptor complex. The Type I IL-13 receptor complex is comprised of an IL 13Ral and an IL-4Rc; this same receptor complex is also the Type II IL-4 receptor complex (Callard et al., Immunology Today 17(3): 108, 1996). As such, in looking to 15 achieve therapeutic control of the IL-13 receptor complex by blocking cytokine mediated signaling, it may be useful to have not only a molecule that antagonized signaling mediated by IL-13, but a molecule that antagonized signaling mediated by both IL-13 and IL-4. Antibodies to IL-13Ral may potentially act as antagonists of IL-13-signaling through IL 20 13 receptor complex. International Patent Publication No. WO 97/15663 suggests antibodies to human IL-13Ral as potential therapeutic agents. Gauchat et al. (Eur. J. Immunol. 28: 4286-4298, 1998) reported murine antibodies to human IL-13Ral which blocked interaction of a tagged IL-13 with a tagged and immobilized soluble IL-13Ral. The antibodies also inhibited IL-13 binding to IL-l3Ral in transfected HEK-293 cells. 25 However, all of these antibodies failed to neutralize IL-13 induced biological activity, suggesting that they were not antagonists of the complete IL-13Rcl/IL-4Ra receptor complex. In a later paper, Gauchat et al. (Eur. J. Immunol. 30: 3157-3164, 2000) reported a rat antibody, designated as C41, to murine IL-13Rcl which bound to HEK-293 cells transfected with murine IL-13Ral. However, C41 did not neutralize IL-13 induced 30 biological activities. Further, C41 did not react with the soluble form of human IL-13Ral.
WO 03/080675 PCT/AU03/00352 -4 Akaiwa et al. (Cytokine 13: 75-84, 2001) reported an antibody that recognized soluble IL 13Ral by enzyme immunoassay and a tagged full length IL-l3Ral transfected into COS7 cells. The antibody was used for immunohistochemistry but there is no indication as to whether it was a neutralizing antibody. 5 In accordance with the present invention, antibodies are generated which bind to the IL 13Rcl chain, block IL-13 binding to the IL-13Ral chain and which antagonize IL-13 signaling through the IL-13Rcl/ IL-4Ra complex. Such antibodies are proposed to inhibit IL-13 mediated biological activity. In a preferred embodiment, some antibodies of the 10 present invention surprisingly antagonize signaling by both IL-13 and IL-4 through the IL 13Ral/IL-4Rca complex.
WO 03/080675 PCT/AU03/00352 -5 SUMMARY OF THE INVENTION Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the 5 inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers. Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1 10 (SEQ ID NO:1), <400>2 (SEQ ID NO:2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided after the claims. The present invention provides antibodies that function as IL-13Rcal antagonists and may be used for treating certain conditions induced by IL-13. The present invention also 15 provides methods for treating these conditions comprising administering an IL-13Ral antagonist to a patient afflicted with such a condition. Also provided are compositions for use in such methods comprising one or more IL-13Ral antagonists. The IL-13Ral chain may be from any animal, including a mammal such as a human. 20 Preferred IL-13Rcl chains are the human IL-13Raxl chain, the murine IL-13Rcl chain, the rat IL-13Rcl chain, the canine IL-13Rcl chain, the ovine IL-13Ral chain or the cynamologus monkey IL-13Ral chain. Preferably, the IL-13Ral chain is the human IL 13Ral chain. There is a high level of sequence homology between IL-13Rcl chains from different species. For example, ovine IL-13Ral has 87% homology at the amino acid level 25 and 88.7% homology at the DNA level to human IL-13Ral. Ovine IL-13Rcl has 75% homology at the amino acid level and 82.2% homology at the DNA level to murine IL 13Rcl. Human IL-13Ral has 75% homology at the amino acid level and 81.3% homology at the DNA level to murine IL-13Rcl. Consequently, the present invention contemplates an IL-13Ral chain or its equivalent from any source such as an IL-13Rcl 30 having at least about 65% identity to human IL-13Rcl after optimal alignment.
WO 03/080675 PCT/AU03/00352 -6 The antibodies of the present invention bind, interact or otherwise associate to the IL 13Ral or a portion thereof The antibodies may be specific for IL-13Ral from a particular species, such as human IL-13Ral , or, in view of the level of sequence similarity between 5 IL-13Rcl from different species, the antibodies may show some cross-reactivity with IL 13Ral from two or more species. In the case of antibodies directed towards human IL 13Raxl, some level of cross-reactivity with other mammalian forms of IL-l3RaXl may be desirable in certain circumstances, such as for example, for the purpose of testing antibodies in animal models of a particular disease and for conducting toxicology studies 10 in a manner where IL-13 and/or IL-4 signaling in the test animal is affected by the test antibody. Species where cross-reactivity of an antibody to human IL-13Ral may be desirable include monkey, sheep, dog and rat. Accordingly, one preferred group of antibodies are those which exhibit some level of species cross-reactivity. A particularly preferred group of such antibodies are those to human IL-13Rc which exhibit some level 15 of species cross-reactivity. Antibodies of the present invention include, but are not limited to, antibodies that bind IL 13Rcl and inhibit IL-13 induced signaling through the IL-13 receptor complex, and other compounds that inhibit a biological effect that results from the binding of IL-13 to a cell 20 surface IL-13 receptor. A preferred group of antibodies are those that inhibit signaling by both IL- 13 and IL-4 through the IL- 13 receptor complex. Preferably, the antibodies are monoclonal antibodies or antigen-binding fragments thereof. Most preferably, the antibodies are humanized or human antibodies suitable for 25 administration to humans. These include humanized antibodies prepared, for example, from murine monoclonal antibodies and human monoclonal antibodies which may be prepared, for example, using transgenic mice or by phage display. Antibodies in accordance with the present invention include the murine monoclonal 30 antibody 1D9, and humanized forms of mAb 1D9.
P \OPER\Ejh\Ejh\EJH Brisbanc\Ejh.pcts\2003\12175890.amrad.il-13r.nr4.pctdoc-24/12/03 -7 The present invention contemplates methods of modulating IL-13- and/or IL-4-mediated diseases or conditions by the administration of antibodies of the present invention. Conditions to be treated in accordance with the present invention include fibrosis, Hodgkin's disease, ulcerative colitis, scleroderma, lung disorders such as asthma and 5 chronic obstructive pulmonary disease, allergic rhinitis, oncological conditions, inflammatory bowel disease and other inflammatory conditions in the gastrointestinal tract, allergic reactions to medication and any other IL- 13 mediated diseases or conditions. The present invention also provides an assay system useful for identifying antibodies or 10 other agents which modulate IL-13 and/or IL-4 signaling through an IL-13 receptor complex. Accordingly, a method of screening for modulators of IL-13Ral/ligand interaction, which method involves the assay system, is provided. A hybridoma producing murine monoclonal antibody to ID9 was deposited on 21 March 15 2003 at the European Collection of Cell Cultures (ECACC), Centre for Applied Microbiology and Research, Porton Down, Salisbury, United Kingdom, under Accession No. 03032101 on 21 March, 2003. AMENDED SHEET Ill "AIAI I WO 03/080675 PCT/AU03/00352 A summary of sequence identifiers used throughout the subject specification is provided in Table 1. TABLE 1 5 Summary of sequence identifiers SEQUENCE ID NO: DESCRIPTION 1 Nucleotide sequence encoding IL-4Ra 2 Amino acid sequence of IL-4Rc 3 Nucleotide sequence encoding human IL-13Rol 4 Amino acid sequence of human IL-13Ral 5 Nucleotide sequence encoding gp130 6 Amino acid sequence of gp130 7 Nucleotide sequence encoding IL-4Ra-gp130 fusion 8 Amino acid sequence of IL-4Rax-gp 130 fusion 9 Nucleotide sequence encoding IL-13Ral-gpl30 fusion 10 Amino acid sequence of IL-13Ra&l-gpl3O fusion 11 IL-13Rxl 5' oligonucleotide 12 IL-13Ral 3' oligonucleotide 13 gp130 5' oligonucleotide 14 gpl30 3' oligonucleotide 15 IL-4Ra 5' amplification oligonucleotide 16 IL-4Ra 3' amplification oligonucleotide 17 IL-4Ra 5' oligonucleotide 18 IL-4Ra 3' oligonucleotide 19 Amino acid sequence of murine 1D9 CDR1 in VL domain 20 Amino acid sequence of murine 1D9 CDR2 in VL domain 21 Amino acid sequence of murine 1D9 CDR3 in VL domain 22 Amino acid sequence of murine 1D9 CDR1 in VH domain WO 03/080675 PCT/AU03/00352 -9 SEQUENCE ID NO: DESCRIPTION 23 Amino acid sequence of murine 1D9 CDR2 in VH domain 24 Amino acid sequence of murine 1D9 CDR3 in VH domain 25 Amino acid sequence of murine 1D9 CDR regions from VL domain grafted onto human consensus framework 26 Amino acid sequence of murine 1D9 CDR region from VH domain grafted onto human consensus framework 27 Amino acid sequence of VL domain of murine 1D9 28 Amino acid sequence of VH domain of murine 1 D9 WO 03/080675 PCT/AU03/00352 - 10 BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a diagrammatic representation showing that dimerization of chimeric receptors mediated by IL-13 or IL-4 induces STAT-3 phosphorylation through the gp130 5 intracellular domain and subsequently expression of the STAT-3 activated luciferase reporter gene. Figure 2 is a diagrammatic representation showing construction of chimeric receptors incorporating the IL-13Ral or IL-4Ra extracellular domain and the transmembrane and 10 intracellular domains of gpl30; cloned into the pEFBOS vectors for expression as an N terminal FLAG-tagged protein. Figure 3 is a photographic representation showing transient expression of chimeric receptor constructs in COS cells. COS cells were transfected with pEFBOS encoding 15 FLAG-tagged IL-13Ral-gpl3O, FLAG-tagged IL-4Rax-gp130 (two independent clones) or control #-gal. Cell lysates were recovered at 72 hrs and after SDS-PAGE and Western transfer, probed with either an anti-FLAG antibody or the IL-13Rcl-specific mAb 1D9. Figure 4 is a graphical representation showing a dose-response analysis to LIF, IL-13 and 20 IL-4 of chimeric receptor transfected 293A12 lines 3.1.2 and 3.2.4. 293A12 cells are derivatives of 293T cells that have been stably transfected with a STAT-3 luciferase reporter construct. After initial analysis, lines 3.1.2 (A) and 3.2.4 (B) were expanded and assayed against titrating LIF, IL-13 and IL-4. Both lines and an additional line, 3.2.5 were cloned by limiting dilution. Assay conditions were 5 X 104 cells/well 24 hr incubation. 25 Figure 5 is a graphical representation showing Biosensor analysis of mAb 1D9 inhibition of binding of chimeric human IL-13Ral-Fc to human and mouse IL-13. mAb 1D9 and the chimeric receptors were pre-incubated at the indicated concentrations for 1 hour prior to analysis. 30 WO 03/080675 PCT/AU03/00352 - 11 Figure 6 is a graphical representation showing that mouse mAb 1D9 inhibits the binding of chimeric human (A) but not chimeric mouse (B) IL-13Rcl-Fc to plate bound mouse IL 13. Titrating chimeric receptor proteins were pre-incubated with mAbs (final concentration 50Rg/ml) for 45 min prior to transfer to assay plates coated with mouse IL-13. Anti 5 VEGF-B specific mAb 6C12 was used as a negative control. Figure 7 is a graphical representation showing analysis of further IL-13RC1 specific mouse mAbs for ability to inhibit binding of chimeric human IL-13Ral to plate bound mouse IL-13. Titrating chimeric human receptor was pre-incubated with IL-13Ral 10 specific mAbs (1D9, 6A9, 3F10, 2A2) or negative control antibodies (2H10, 6C12) at a final concentration of 50 pg/ml for 45 min prior to transfer to assay plates. Figure 8 is a graphical representation showing that mouse mAbs against the human IL 13Ral inhibit the 3.2.4 response to IL-13. 3.2.4-cells are cultured for 24 hrs in the 15 presence of 10 or 1 ng/ml IL-13 and the indicated concentration of mAb. mAbs 1D9, 6A9 and 2A2 are IL-13Rcl specific mAbs and 2H10 was an isotype matched negative control antibody. Percentage inhibition is calculated from (response to cytokine plus mAb/response to cytokine only) x 100. 20 Figure 9 is a graphical representation showing that mouse mAbs against the human IL 13Ral inhibit the 3.2.4 response to IL-4. 3.2.4-cells were cultured for 24 hrs in the presence of 10 or 1 ng/ml IL-4 and the indicated concentration of mAb. mAbs 1D9, 6A9 and 2A2 are IL-13Ral specific mAbs and 2H10 was an isotype matched negative control antibody. Percentage inhibition is calculated from (response to cytokine plus 25 mAb/response to cytokine only) x 100. Figure 10 is a representation of the amino acid sequence of murine mAb ID9 variable domains and human consensus framework. Sequence numbering is according to Kabat et al., (Sequences of Proteins of Immunological Interest, 5 th Ed., 1991, ed. Bethesda: Public 30 Health Services, National Institutes of Health) and key framework residues are indicated by bullets (Baca et al., J Biol. Chem. 272(16): 10678-10684, 1997). CDR sequences are WO 03/080675 PCT/AU03/00352 - 12 underlined and are defined according to the sequence definition of Kabat et al. (1991, supra) with the exception of CDR-H1, which is the combined sequence and structural definition (Chothia et al., Nature 342(6252): 877-883, 1989). The framework is the consensus sequence for the human light chain K subgroup I-heavy chain subgroup III 5 (Chuntharapai et al., Cytokine 15(5): 250-260, 2001). Figures 11A and 11B are graphical representations of binding affinities of the chimeric and CDR-grafted Fab fragment. (A) Competition ELISA of chimeric or CDR-grafted 1D9 phage displayed Fabs binding to plate bound hIL-13Rcl-Fc (ECD) (2.5 ptg/ml) competed 10 by soluble hIL-13Rcl (ECD). (B) Biosensor competition assay of soluble 1D9 chimeric or CDR-grafted Fab binding to immobilized hIL-13Ral (ECD) competed by soluble hIL 13Raxl (ECD). Fold-difference in affinity is calculated from (IC 50
/IC
50
).
WO 03/080675 PCT/AU03/00352 - 13 DETAILED DESCRIPTION OF THE INVENTION The present invention relates generally to antibodies that bind, interact or otherwise associated to or with the IL-13Ral chain or a fragment, portion or part thereof and 5 antagonize IL-13 receptor-mediated signaling by IL-13 and/or IL-4 and which may be employed in the methods of the present invention. The antibodies preferably are monoclonal antibodies or antigen-binding fragments thereof. Preferably, the antibodies are in isolated, homogenous or fully or partially purified form. 10 Most preferably, the antibodies are humanized or human antibodies suitable for administration to humans. These include humanized antibodies prepared, for example, from murine monoclonal antibodies, and human monoclonal antibodies which may be prepared, for example, using transgenic mice as described below, or by phage display. 15 Reference to "binding" of an antibody means binding, interacting or associating with or to a target antigen such as IL-13Ral. Reference to "IL-13Ral" includes it fragments or portions which comprise the epitopes to which an antibody binds. Consequently, reference to an antibody binding to IL-13Ral includes the binding, interaction or association of the antibody or an antigen-binding portion thereof, part, fragment or epitope-containing region 20 thereof. Generally, "binding", "interaction" or "association" means or includes the specific binding, interaction or association of the antibody to an IL-13Ral or a portion thereof 25 The biological effects of IL-13 are mediated by a dimeric receptor complex comprise the subunits IL-13Rcl (or the NR4 subunit) and IL-4Ra (referred to hereinafter as the IL-13 receptor). Thus, some antibodies raised against IL-13Ral which block IL-13 binding and/or signaling through the IL-13 receptor complex, may also block the signaling of IL-4 through the IL-13 receptor complex. 30 WO 03/080675 PCT/AU03/00352 - 14 Examples of antibodies contemplated by the present invention include those that bind to IL-13Ral and block the signaling of IL-13 through the IL-13 receptor complex, and preferably those that bind to IL-13Ral and block the signaling of IL-13 and/or IL-4 through the IL-13 receptor complex, thereby inhibiting an IL-13 induced and/or an IL-4 5 induced biological activity. Such antibodies, referred to herein as blocking antibodies, may be raised with an IL-13Rcl polypeptide or immunogenic parts thereof, such as for example, the extracellular domain of IL-13Ral and screened in assays for the ability to block the signaling of IL-13 and/or IL-4 through the IL-13 receptor complex. Suitable assays are assays that test the antibodies for the ability to inhibit binding of IL-13 to cells 10 expressing the IL-13 receptor complex, or that test antibodies for the ability to reduce a biological or cellular response that results from the signaling of IL- 13 and IL-4 through the IL-13 receptor complex. In one embodiment, the present invention provides antibodies that bind to IL-13Ral and 15 inhibit IL- 13 signaling through the IL- 13 receptor complex. In a further embodiment, the present invention provides antibodies that bind to IL-l3Ratl and inhibit IL-13- and IL-4-signaling through the IL-13 receptor complex. 20 Preferably the antibodies are monoclonal antibodies or antigen-binding fragments thereof. Most preferably, the antibodies are human or humanized monoclonal antibodies suitable for use in human therapeutics. 25 As such, in a preferred embodiment, the present invention provides antibodies that are human or humanized monoclonal antibodies that bind to IL-13Ral and inhibit IL-13 signaling through the IL-13 receptor complex. In an especially preferred embodiment, the present invention provides antibodies that are 30 human or humanized monoclonal antibodies that bind to IL-13Rcl and inhibit IL-13- and IL-4-signaling through the IL-13 receptor complex.
WO 03/080675 PCT/AU03/00352 - 15 Reference to an "antibody" or "antibodies" includes reference to all the various forms of antibodies, including but not limited to whole antibodies, antibody fragments, including, for example, Fv, Fab, Fab' and F(ab') 2 fragments, humanized antibodies, human antibodies 5 (e.g., produced in transgenic animals or through phage display) and immunoglobulin derived polypeptides produced through genetic engineering techniques. Unless stated otherwise, specificity in respect of an antibody of the present invention is intended to mean that the antibody does not exhibit any meaningful cross-reactivity with 10 non-IL-13Ral proteins. However, it is not intended to indicate that there is no cross reactivity with other forms of the IL-13Ral which may exist, (for example, soluble forms, splice variants or fragments of the receptor), nor is it intended to indicate that no cross reactivity with IL-13Rcl from other species may exist. The amino acid sequence of IL 13Ral is a well conserved across species, with other mammalian forms of the receptor 15 showing substantial amino acid homology with the human IL-13Ral chain. The antibodies may be specific for an IL-13Ral chain from a particular species, such as human IL-13Rcl, or, because of the level sequence similarity between IL-13Ral chains from certain mammalian species, may show some cross-reactivity with IL-13Ral chains 20 from other mammalian species. In the case of antibodies directed towards human IL 13Ral, some level of cross reactivity with other mammalian forms of IL-13Ral may be desirable in certain circumstances. For example, such antibodies are useful for the purpose of testing antibodies in animal models of a particular disease, and for conducting toxicology studies in a manner where IL-13 and/or IL-4 signaling in the test animal is 25 affected by the test antibody. Species where cross reactivity of an antibody to human IL 13Ral may be desirable include monkey, sheep, dog and rat. Accordingly, one preferred group of antibodies are those which exhibit some level of species cross reactivity. A particularly preferred group of antibodies are those antibodies to human IL-13Ra1 which exhibit some level of species cross-reactivity. 30 WO 03/080675 PCT/AU03/00352 -16 The antibodies of the present invention bind to the IL-13Ral chain. The IL-l3Ral chain may be the human IL-13Ral chain or from another animal, such as the murine IL-13Ral chain, the rat IL-13Rcl chain, the canine IL-13Ral chain, the ovine IL-13Ral chain and the cynamologus monkey IL-13Ral chain. Preferably, the IL-13Ral chain is the human 5 IL-13Ral chain. There is a high level of sequence homology between IL-13Ral chains from different species. For example, the ovine IL-13Ral chain is 87% homologous at the amino acid level and 88.7% homologous at the DNA level to human IL-13Ral. Ovine IL 13Ral is 75% homologous at the amino acid level and 82.2% homologous at the DNA level to murine IL-3Rcl. Human IL-13Raxl is 75% homologous at the amino acid level 10 and 81.3% homologous at the DNA level to murine IL-13Ral. In a preferred embodiment, the present invention provides antibodies that bind to human IL-13Raxl and to cynamolgus monkey IL-13Rcl and inhibit IL-13 signaling through the IL-13 receptor complex. 15 In a further preferred embodiment, the present invention provides antibodies that bind to human IL-13Ral and to ovine IL-13Ral and which inhibit IL-13 signaling through the IL- 13 receptor complex. 20 In still a further preferred embodiment, the present invention provides antibodies that bind to human IL-13Ral and to canine IL-13Ral and which inhibit IL-13 signaling through the IL-13 receptor complex. In yet a further preferred embodiment, the present invention provides antibodies that bind 25 to human IL-13Ral and to rat IL-13Ral and which inhibit IL-13 signaling through the IL 13 receptor complex. In yet a further preferred embodiment, the present invention provides antibodies that bind to human IL-13Ral and to murine IL-13Ral and which inhibit IL-13 signaling through 30 the IL-13 receptor complex.
WO 03/080675 PCT/AU03/00352 - 17 The antibodies of the present invention may be prepared by well known procedures. See, for example, Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Kennet et al. (eds.), Plenum Press, New York (1980); and Antibodies: A 5 Laboratory Manual, Harlow and Land (eds.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1988). One method for producing an antibody of the present invention comprises immunizing a non-human animal, such as a mouse or a transgenic mouse, with an IL-1 3Rl I polypeptide, 10 or immunogenic parts thereof, such as, for example, the extracellular domain of IL-13Ral, whereby antibodies directed against the -IL-13Rcal polypeptide are generated in said animal. Both polyclonal and monoclonal antibodies can be produced by this method. The methods 15 for obtaining both types of sera are well known in the art. Polyclonal sera are less preferred but are relatively easily prepared by injection of a suitable laboratory animal with an effective amount of an IL-13Ral polypeptide, or immunogenic parts thereof, such as, for example, the extracellular domain of IL-13Ra l, collecting serum from the animal and isolating IL-13Rcl specific sera by any of the known immunoadsorbent techniques. 20 Antibodies produced by this technique are generally less favoured, because of the potential for heterogeneity of the product. The use of monoclonal antibodies is particularly preferred because of the ability to produce them in large quantities and the homogeneity of the product. Monoclonal antibodies may 25 be produced by conventional procedures. The present invention contemplates a method for producing a hybridoma cell line comprises immunizing a non-human animal, such as a mouse or a transgenic mouse, with an IL-13Ral polypeptide, or immunogenic parts thereof, such as, for example, the 30 extracellular domain of IL-13Rxl; harvesting spleen cells from the immunized animal; fusing the harvested spleen cells to a myeloma cell line to generate hybridoma cells; and WO 03/080675 PCT/AU03/00352 - 18 identifying a hybridoma cell line that produces a monoclonal antibody that binds an IL 13Ral polypeptide. Such hybridoma cell lines and the anti-IL-13Rc monoclonal antibodies produced by them 5 are encompassed by the present invention. Monoclonal antibodies secreted by the hybridoma cell lines are purified by conventional techniques. Hybridomas or the monoclonal antibodies produced by them may be screened further to identify monoclonal antibodies with particularly desirable properties, such as the ability to inhibit IL-13- and IL-4-signaling through the IL-13 receptor complex. 10 The IL-13Rcl polypeptide or immunogenic part thereof that may be used to immunize animals in the initial stages of the production of the antibodies of the present invention may be from any mammalian source. Preferably, the IL-13RCl polypeptide or immunogenic part thereof is human IL-13Ral. 15 Antigen-binding fragments of antibodies of the present invention may be produced by conventional techniques. Examples of such fragments include, but are not limited to, Fab, Fab', F(ab') 2 and Fv fragments, including single chain Fv fragments (termed sFv or scFv). Antibody fragments and derivatives produced by genetic engineering techniques, such as 20 disulphide stabilized Fv fragments (dsFv), single chain variable region domain (Abs) molecules and minibodies are also contemplated for use. Unless otherwise specified, the terms "antibody" and "monoclonal antibody" as used herein encompass both whole antibodies and antigen-binding fragments thereof. 25 Such derivatives of monoclonal antibodies directed against IL-13Rcl may be prepared and screened for desired properties, by known techniques, including the assays described herein. The assays described herein provide the means to identify derivatives of the antibodies of the present invention that bind to IL-13Rc1, as well as identify those derivatives that also retain the activity of inhibiting signaling by IL-13 through the IL-13 30 receptor complex, and preferably, inhibiting signaling by IL-13 and IL-4 through the IL-13 receptor complex. Certain of the techniques involve isolating DNA encoding a polypeptide WO 03/080675 PCT/AU03/00352 - 19 chain (or a portion thereof) of a mAb of interest, and manipulating the DNA through recombinant DNA technology. The DNA may be fused to another DNA of interest, or altered (e.g. by mutagenesis or other conventional techniques) to add, delete, or substitute one or more amino acid residues, for example. 5 DNA encoding antibody polypeptides (e.g. heavy or light chain, variable region only or full length) may be isolated from B-cells of mice that have been immunized with IL 13Ral. The DNA may be isolated by conventional procedures such as polymerase chain reaction (PCR). Phage display is another example of a known technique whereby 10 derivatives of antibodies may be prepared. In one approach, polypeptides that are components of an antibody of interest are expressed in any suitable recombinant expression system, and the expressed polypeptides are allowed to assemble to form antibody molecules. 15 Single chain antibodies may be formed by linking heavy and light chain variable region (Fv region) fragments via an amino acid bridge (short peptide linker), resulting in a single polypeptide chain. Such single-chain Fvs (scFvs) have been prepared by fusing DNA encoding a peptide linker between DNAs encoding the two variable region polypeptides (VL and VH). The resulting antibody fragments can form dimers or trimers, depending on 20 the length of a flexible linker between the two variable domains (Kortt et al., Protein Engineering 10: 423, 1997). Techniques developed for the production of single chain antibodies include those described in U.S. Patent No. 4,946,778; Bird (Science 242: 423, 1988), Huston et al. (Proc. Natd. Acad. Sci. USA 85: 5879, 1988) and Ward et al. (Nature 334: 544, 1989). Single chain antibodies derived from antibodies provided herein are 25 encompassed by the present invention. In one embodiment, the present provides derivatives of the antibodies of the present invention that bind to IL-13Rc1, and inhibit signaling by IL-13 through the IL-13 receptor complex. Preferably, the derivatives block signaling by 11-13 and IL-4 through the 11-13 30 receptor complex.
WO 03/080675 PCT/AU03/00352 - 20 Techniques are known for deriving an antibody of a different subclass or isotype from an antibody of interest, i.e., subclass switching. Thus, IgG1 or IgG4 monoclonal antibodies may be derived from an IgM monoclonal antibody, for example, and vice versa. Such techniques allow the preparation of new antibodies that possess the antigen-binding 5 properties of a given antibody (the parent antibody), but also exhibit biological properties associated with an antibody isotype or subclass different from that of the parent antibody. Recombinant DNA techniques may be employed. Cloned DNA encoding particular antibody polypeptides may be employed in such procedures, e.g. DNA encoding the constant region of an antibody of the desired isotype. 10 The monoclonal production process described above may be used in animals, for example mice, to produce monoclonal antibodies. Conventional antibodies derived from such animals, for example murine antibodies, are known to be generally unsuitable for administration to humans as they may cause an immune response. Therefore, such 15 antibodies may need to be subjected to a humanization process in order to provide antibodies suitable for administration to humans. Such humanization processes are well known in the art and are described in further detail below. Additional embodiments include chimeric antibodies and humanized versions of murine 20 monoclonal antibodies. Such chimeric or humanized antibodies may be prepared by known techniques, for example, CDR grafting, and offer the advantage of reduced immunogenicity when the antibodies are administered to humans. In one embodiment, a chimeric monoclonal antibody comprises the variable region of a murine antibody (or just the antigen binding site thereof) and a constant region derived from a human antibody. 25 Alternatively, a humanized antibody fragment may comprise the antigen binding sites (complementarity determining regions CDRs) of a murine monoclonal antibody and a variable region fragment (lacking the antigen-binding site) derived from a human antibody. Procedures for the production of chimeric and humanized monoclonal antibodies include those described in Riechmann et al. (Nature 332: 323, 1988) Liu et al. (Proc. Natl. Acad. 30 Sci. USA 84: 3439, 1987), Larrick et al. (Bio/Technology 7: 934, 1989) and Winter and Harris (TIPS 14: 139, 1993).
WO 03/080675 PCT/AU03/00352 -21 The complementarity determining regions (CDRs) of a given antibody may be identified using the system described by Kabat et al. in Sequences of Proteins of Immunological Interest, 5th Ed., US Dept. of Health and Human Services, PHS, NIH, NIH Publication No. 5 91-3242, 1991). For example, the murine monoclonal antibody 1D9 has been subjected to humanization to reduce the immunogenicity of the antibody in a target host, as described in the Examples below. Murine monoclonal antibody 1D9 has a specific and potent antagonistic effect 10 against IL-13Ra l and inhibits signaling through the IL-13 receptor and IL-4 signaling through the IL-13 receptor. However, the potential immunogenicity of mAb 1D9 in other hosts, and in particular humans, makes the use of mAb 1D9 unsuitable as a therapeutic agent in these hosts. 15 In a particular embodiment, the antibodies of the present invention comprise within the variable region of their light chain, at least one of the CDRs found in the light chain of mAb 1D9. The CDRs of mAb 1D9 are disclosed in Figure 10 and in SEQ ID NOs: 9-24. Thus, among the antibodies contemplated by the present invention are those that comprise from one to all three of the CDR sequences from the light chain variable region of mAb 20 1D9. Further, among the antibodies contemplated by the present invention are those that comprise from one to all three of the CDR sequences from the heavy chain variable region of mAb 1D9. In a preferred embodiment, the antibodies of the present invention comprise from one to all six CDR sequences from the heavy and light chain variable regions of mAb 1D9. 25 Procedures for generating human antibodies in non-human animals have also been developed and are well known to those skilled in the art. The antibodies may be partially human, or preferably completely human. For example, transgenic mice into which genetic material encoding one or more human immunoglobulin chains has been introduced may be 30 used to produce the antibodies of the present invention. Such mice may be genetically altered in a variety of ways. The genetic manipulation may result in human WO 03/080675 PCT/AU03/00352 - 22 immunoglobulin polypeptide chains replacing endogenous immunoglobulin chains in at least some (preferably virtually all) antibodies produced by the animal upon immunization. Mice in which one or more endogenous immunoglobulin genes have been inactivated by 5 various means have been prepared. Human immunoglobulin genes have been introduced into the mice to replace the inactivated mouse genes. Antibodies produced in the animals incorporate 22 human immunoglobulin polypeptide chains encoded by the human genetic material introduced into the animal. Examples of techniques for production and use of such transgenic animals are described in U.S. Patent Nos. 5,814,318, 5,569,825, and 5,545,806, 10 which are incorporated by reference herein. As such, antibodies of the present invention may include, but are not limited to, partially human (preferably fully human) monoclonal antibodies that inhibit signaling by IL-13, and preferably, inhibit signaling by IL- 13 and IL-4 through the IL- 13 receptor complex. 15 Another method for generating human antibodies is phage display. Phage display techniques for generating human antibodies are well known to those skilled in the art, and include the methods used by companies such as Cambridge Antibody Technology and MorphoSys and which are described in- International Patent Publication Nos. WO 20 92/01047, WO 92/20791, WO 93/06213 and WO 93/11236. Antibodies of the present invention may be employed in vitro or in vivo. Among the uses for antibodies of the present invention are assays (either in vitro or in vivo) to detect the presence of IL-13Ral polypeptides and immunoaffinity chromatography to purify IL 25 13Rcl polypeptides. Further, those antibodies of the present invention that can inhibit signaling by IL-13 through the IL-13 receptor, as well as those antibodies that can inhibit signaling by IL-13 and IL-4 through the IL-13 receptor, may be used to inhibit a biological activity that results from such signaling. 30 Therefore, in one embodiment, such antibodies may be used in therapeutic applications to treat disorders caused or exacerbated (directly or indirectly) by the signaling of IL-13 or WO 03/080675 PCT/AU03/00352 - 23 IL-4 through the IL-13 receptor complex. A therapeutic application involves in vivo administration of a blocking antibody to a mammal in an amount effective to inhibit signaling by IL-13 and/or IL-4 through the IL-13 receptor. Preferably, the antibodies are human or humanized monoclonal antibodies of the present invention. 5 The antibodies may be used to treat diseases or conditions induced by either or both IL-13 and IL-4 including but not limited to fibrosis, Hodgkin's disease, ulcerative colitis, scleroderma, lung disorders such as asthma and chronic obstructive pulmonary disease, allergic rhinitis, oncological conditions, inflammatory bowel disease and other 10 inflammatory conditions in the gastrointestinal tract and allergic reactions to medication. An antibody in accordance with the present invention is the murine monoclonal antibody 1D9, and humanized forms of mAb 1D9. 15 The amino acid sequence of the variable region of the light chain of mAb 11D9 is presented in SEQ ID NO: 27. The amino acid sequence for the variable region of the heavy chain of mAb 1D9 is presented as SEQ ID NO:28. Amino acid sequence of murine 1D9 CDR regions from VL domain grafted onto a human consensus framework is presented in SEQ ID NO: 25. Amino acid sequence of murine 1D9 CDR regions from VH domain grafted 20 onto human consensus framework is presented as SEQ ID NO: 26. Antibodies of the present invention include, but are not limited to, monoclonal antibodies that comprise, in their light chain, residues 1 to 112 of SEO ID NO:25; and antibodies that additionally or alternatively comprise, in their heavy chain, residues 1 to 121 of SEO ID 25 NO:26, or monoclonal antibodies that comprise, in their light chain, residues 1 to 112 of SEO ID NO:27; and antibodies that additionally or alternatively comprise, in their heavy chain, residues I to 121 of SEO ID NO:28. Particular monoclonal antibodies of the invention are selected from the group consisting of 30 mAb 1D9; a mAb that is cross-reactive with mAb 1D9; a mAb that binds to the same epitope as mAb 1D9; a mAb that competes with mAb 1D9 for binding to a cell that WO 03/080675 PCT/AU03/00352 - 24 expresses human IL-13Ral; a mAb that possesses a biological activity of mAb 1D9; and an antigen-binding fragment of any of the foregoing antibodies. Antibodies in accordance with this embodiment include 6A9 and 3F10 as discussed in the Examples. 5 In one embodiment, the antibody has a binding affinity for human IL-13Rcl that is substantially equivalent to the binding affinity of mAb 1D9 for human IL-13Ral. mAb 1D9 is an IgG1 antibody. mAb of other isotypes (including but not limited to IgG4), derived from mAb 1D9 are also encompassed by the present invention. Hybridoma cell lines that produce any such monoclonal antibodies also are provided by the present 10 invention. Procedures for switching (altering) the subclass or isotype of an antibody are also well known to those skilled in the art. Such procedures may involve, for example, recombinant DNA technology, whereby DNA encoding antibody polypeptide chains that confer the 15 desired subclass is substituted for DNA encoding the corresponding polypeptide chain of the parent antibody. This procedure is useful, for example, in certain antibody therapeutic applications where are particular antibody isotope is preferred, such as in the treatment of asthma where IgG4 may be the preferred antibody isotype. 20 One example of a biological activity of mAb 1D9 is the ability to bind to IL-13Ral and inhibit signaling by IL-13 and IL-4 through the IL-13 receptor complex. In one embodiment, a mAb of the invention possesses IL-13 biological activity blocking activity substantially equivalent to that of mAb 1D9; and possesses IL-4 biological activity blocking activity substantially equivalent to that of mAb 1D9. Such activity may be 25 measured in any suitable conventional assay (e.g. as measured in the CD23 expression assay described below). Particular embodiments of the invention are directed to novel polypeptides. DNA and amino acid sequence information has been determined for polypeptides that are 30 components of certain antibodies of the present invention, as discussed in Examples 7, 8, and 9 below. Among the polypeptides of the present invention is a purified polypeptide WO 03/080675 PCT/AU03/00352 -25 comprising an amino acid sequence selected from the group consisting of the amino acid sequence presented in SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27 and SEQ ID NO:28. For in vivo use, the polypeptides advantageously are purified. A polypeptide may be purified individually, or in the form of a purified antibody of which the polypeptide is a 5 component. The ability of the antibodies of the present invention to interfere with signaling by IL-13 and/or IL-4 through the IL-13 receptor complex can be confirmed in a number of assays. 10 One assay that may be used is described in International Patent Publication No. WO 01/92340, which is incorporated herein by reference. This assay is based on ability of both IL-13 and IL-4 to enhance the expression of the activation-associated surface antigen CD23 on human B cells. The antibodies of the present invention are tested for the ability to inhibit CD23 expression induced by IL-13 and by IL-4. 15 In brief, antibodies raised against human IL-13Rcl can be tested either in the form of hybridoma supernatants or purified protein. Prior to addition to cultures, the antibodies are buffer exchanged against culture medium (RPMI 1640 plus 10% v/v heat-inactivated fetal bovine serum) by centrifugation, using Centricon filter devices (Amicon) with a 10 kDa 20 cutoff. Human peripheral blood B cells are purified as described (Morris et al., J. Biol. Chem. 274: 418-423, 1999). The B cells (3x10 5 /well) in culture medium are placed in 96-well round-bottomed microtiter plates and preincubated at room temperature for 30 min with 25 test antibodies. Recombinant human IL-13 or IL-4 is then added to the cultures, and the cells cultured for 20-24 hours at 370 C in a humidified atmosphere of 5% CO 2 . At the end of the culture period, the cells are washed once in PBS+0.02% NaN 3 in the 96-well culture plate and resuspended in blocking buffer (2% normal rabbit serum +1% normal goat serum in PBS+NaN 3 ). 30 WO 03/080675 PCT/AU03/00352 - 26 Phycoerythrin (PE)-conjugated CD23 monoclonal antibody (mAb) or PE-conjugated isotype control mAb (both from Pharmingen) are added to cells at a final dilution of 1:10. Cells are incubated for 30 minutes at 4*C., washed x3 in PBS+NaN 3 and analyzed on a FacScan (Becton Dickinson) for CD23 expression. 5 Negative controls such as cells cultured with hybridoma growth medium or isotype matched non-blocking human anti-hIL-13 receptor antibody are included. An anti-huIL-4R murine mAb (R&D Systems), previously shown to block the binding and function of both hIL-4 and hIL-13, can be used as a positive control for neutralization of CD23 induction 10 by IL-4 and IL-13. An alternative assay for identifying antibodies that function as IL-13Ral antagonists and block signaling by either IL-13 and/or IL-4 is described below and in the Examples. 15 In this assay, 293A12-cells are engineered to express chimeric polypeptides comprising the extracellular domain of either IL-13Ral or IL-4Ra operably connected to the transmembrane and cytoplasmic domains of the protein, gp130. When the engineered 293A12-cells are in the presence of IL-13 or IL-4, the chimeric polypeptides form a heterodimeric receptor complex which permits signal transduction to occur. The IL-13- or 20 IL-4-mediated signal transduction is observable via an identifiable signal, such as the activation of a gene encoding a reporter molecule (Example 5). Anti- IL-13Ral antibodies that antagonize IL-13 or IL-4 signaling through the IL-13 receptor will inhibit IL-13- and IL-4-mediated activation of the reporter molecule. 25 The level of signal transduction is conveniently determined by selecting cells wherein signal transduction activates a pathway regulating the expression of a gene encoding a reporter molecule that provides an identifiable. signal. Preferred reporter molecules are enzymes such as luciferase. 30 WO 03/080675 PCT/AU03/00352 - 27 293A12 cells are particularly preferred in this assay as they are 293T cells which stably express genetic material encoding a luciferase reporter molecule (Example 3). The expression of the luciferase reporter molecule is regulated by a STAT-3 signaling pathway which is activated by gpl30 signaling. 5 The signal transduction portion from gp 130 is particularly preferred, as it induces STAT-3 phosphorylation which leads to the expression of the STAT-3 activated luciferase reporter gene. However, the signal transduction portion from other molecules may also be employed. The choice of the signal transduction portion of the polypeptides must be 10 matched to the activation or promoter portion of the gene encoding the reporter molecule. Those skilled in the art appreciate that the cell based assays of the invention, for example described above and in Example 4, may be utilised as a basis for screening for modulators of IL-13Ral/ligand interaction. While such methods are well known to those skilled in the 15 art, a brief description of the method is provided herein. The method involves subjecting appropriately engineered cells to a signal producing amount of IL-13 or IL-4 under conditions where, in the absence of any antagonism of ligand receptor binding, a signal, for example luciferase expression, may be detected. The exposure is then conducted in the presence of test compounds and the level of signal detected compared with that detected in 20 the absence of a test compound. Test compounds may include compound libraries, for example libraries of natural product extracts or libraries of synthetic compounds. Alternatively, phage display libraries of antibody variable domains and the like, or panels of monoclonal antibodies against IL-13Ral may be screened across the assay. 25 Chimeric polypeptides that may be used in the assay of the present invention are described in Examples 1 and 2 and comprise the amino acid sequences set forth in SEQ ID NO:8 and SEQ ID NO:10. cDNA encoding the chimeric polypeptides contemplated for use in this assay comprise a 30 nucleotide sequence selected from SEQ ID NO:7 and SEQ ID NO:9. The sequence defined by SEQ ID NO:7 comprises a sequence which encodes the IL-4Rc extracellular domain WO 03/080675 PCT/AU03/00352 -28 fused to the transmembrane and cytoplasmic domains of gp130. SEQ ID NO:9 comprises a sequence which encodes the IL-13Ral extracellular domain fused to the transmembrane and cytoplasmic domains of gpl30. 5 Although 293A12 cells are described in the assay of the present invention, other cells may be used. Generally a eukaryotic cell is employed, and more particularly, a mammalian cell. The mammalian cells may be derived from humans, livestock animals, laboratory test animals and companion animals. Non-mammalian cells contemplated herein include cells from avian species, reptilian species, amphibian species and insect species. Preferably, the 10 cell lacks endogenous yc. The term "operably connected" is used in its broadest context to include molecules which have associated together such that they are in functional interaction with each other. Generally, the association is by a chemical linkage or bond. Preferably, the chemical 15 linkage or bond is a peptide bond. The terms include, therefore, a polypeptide comprising a contiguous series of amino acids each linked via a peptide bond wherein one contiguous series of amino acids has ligand-binding properties and another contiguous series of amino acids has signal transduction properties. 20 Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, agents used for adjusting tonicity, buffers, chelating agents, and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active 25 ingredient, use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) and sterile powders for the extemporaneous preparation of sterile 30 injectable solutions. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and WO 03/080675 PCT/AU03/00352 - 29 fungi. The carrier can be a solvent or dilution medium comprising, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof and vegetable oils. The proper fluidity can be maintained, for example, by the use of superfactants. The preventions of the action of 5 microorganisms can be brought about by various anti-bacterial and anti-fungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal and the like. In many cases, it will be preferable to include agents to adjust tonicity, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium 10 monostearate and gelatin. The compositions may also include buffers and chelating agents. Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with the active ingredient and optionally other active ingredients as required, followed by filtered sterilization or other appropriate means 15 of sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, suitable methods of preparation include vacuum drying and the freeze-drying technique which yield a powder of active ingredient plus any additionally desired ingredient. 20 The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. The compositions of the present invention are useful in modifying an IL-13- or IL-4 mediated condition including but not limited to fibrosis, Hodgkin's disease, ulcerative 25 colitis, scleroderma, lung disorders such as asthma and chronic obstructive pulmonary disease, allergic rhinitis, oncological conditions, inflammatory bowel disease and other inflammatory conditions in the gastrointestinal tract, allergic reactions to medication and any other IL- 13 mediated diseases or conditions. 30 The human and humanized antibodies of the present invention and in particular humanized 1D9 are useful in the treatment of such conditions. Any adverse condition resulting from WO 03/080675 PCT/AU03/00352 -30 IL-13 and/or IL-4 interaction with IL-13Raxl may be treated or prevented by the administration of the antibodies of the invention such as humanized 1D9. Accordingly, another aspect of the present invention contemplates a method for the 5 treatment or prophylaxis of a condition mediated by IL-13 and/or IL-4 such as but not limited to an inflammatory condition, said method comprising administering to a subject an effective amount of an antibody, such as humanized 1D9, for a time and under conditions sufficient to inhibit IL-13 and/or IL-4 signaling through the IL-13 receptor complex. 10 An "effective amount" in this context is an amount of an antibody sufficient to reduce IL 13 and/or IL-4 signaling through the IL-13 receptor complex by at least 40%, preferably at least 50%, more preferably by at least 60%, still more preferably by at least 70-80% or greater than 90%. 15 The method may also be measured at the level of amelioration of symptoms. Hence, an effective amount would be that amount required to at least partially alleviate symptoms of, for example, inflammation. 20 Preferably, the subject is a human. However, veterinary applications are also contemplated for livestock animals as well as companion animals. In such cases it would be necessary to prepare an appropriate antibody designed to avoid an immunogenic response to the antibody by the mammal. 25 In a specific embodiment, therefore, the present invention provides a method for ameliorating the effects of IL-13 or 11-4 mediated conditions in a human subject, said method comprising administering to said subject an effective amount of a humanized 1D9 monoclonal antibody or its equivalent for a time and under conditions sufficient to ameliorate the effects of inflammation. 30 The present invention further contemplates the use of a humanized 1 D9 or its equivalent in WO 03/080675 PCT/AU03/00352 -31 the manufacture of a medicament in the treatment or prophylaxis of an inflammatory condition in a subject. The humanized 1D9 may also be used to deliver specific drugs conjugated thereto to 5 particular sites, such as cells carrying the IL-13Rcl receptor. The humanized 1D9 antibodies may also be used to conduct imaging analysis to screen for active IL-13Ral receptors. The present invention is further described by the following non-limiting Examples.
WO 03/080675 PCT/AU03/00352 - 32 EXAMPLE 1 Construction of the IL13Ral/gp130 chimera To generate the chimeric IL13Ral/gpl3O cDNA molecule, the IL13R was amplified with 5 a 5' oligomer containing an Ascl restriction enzyme site, for cloning into the pEFBOS vector, and a 3' oligomer that contained an overlapping region homologous to the gpl30 cDNA. The oligomers used to amplify the gpl30 cDNA comprised a 3' oligomer containing an Mlul restriction enzyme site. 10 IL-13R1 oligomers 5' oligomer: AGCTGGCGCGCCAGGCGCCTACGGAAACTCAGCCACCTGTG [SEQ ID 11] 3' oligomer: CAGGCACGACTATGGCTTCAATTTCTCCTGTGGAATTGCGCTTCTTACCTATACTC 15 [SEQ ID NO:12] gp130 oligomers 5' oligomer: GGAGAAATTGAAGCCATAGTCGTGCCTGTTTGCTTAGC [SEQ ID NO:13] 20 3' oligomer: ACGTACGCGTTCACTGAGGCATGTAGCCGCCTTGCCG [SEQ ID NO:14] The PCR conditions to amplify the IL-13Rcl and the gp130 regions required for the construction of the chimeric cDNA were identical for both molecules. One cycle of 94*C 25 for 2 mins, 35 cycles of 94*C for 10 secs, 50'C for 10 secs and 68*C for 1 min and one cycle at 68'C for 5 mins. The molecules were amplified using the PLATINUM Pfx DNA polymerase kit (Invitrogen). The chimeric cDNA molecule was amplified using the PCR products generated from the 30 previously described reactions, with the same conditions being used, except that the WO 03/080675 PCT/AU03/00352 -33 extension time was lengthened from 60 to 90 secs. The oligomers used to generate the chimeric cDNA molecule were: 5'oligomer: 5 AGCTGGCGCGCCAGGCGCCTACGGAAACTCAGCCACCTGTG [SEQ ID NO:11] 3' oligomer: ACGTACGCGTTCACTGAGGCATGTAGCCGCCTTGCCG [SEQ ID NO:14] The chimeric cDNA was the cloned into the Mlul restriction enzyme site of the pEFBOS 10 mammalian expression vector, which contains the murine IL-3 signal sequence and a FLAG peptide at the N terminus. The cloning was carried out using the Amersham ligation kit. EXAMPLE 2 15 Construction of the IL-4Ra/gp130 chimera The IL-4Rc was amplified by RT-PCR, from mRNA isolated from Jurkat cells, using the Titan RT-PCR kit (Roche). The oligomers use to amplify the IL-4Ra were: 20 5' oligomer: TGA AGG TCT TGC AAG AGC CCA CCT GCG [SEQ ID NO:15] 3' oligomer: GTG CTG CTC GAA GGG CTCCCT GTA GGA G [SEQ ID NO:16] 25 The PCR conditions were as follows. One cycle of 50*C for 30 mins and 94*C for 2 mins, 35 cycles of 94'C for 30 secs, 50*C for 30 secs and 68 0 C for 1 min and one cycle of 68'C for 7 min. To generate the chimeric IL-4Ra/gp130 cDNA molecule, the IL-4Ra was amplified with 30 oligomers that comprised of a 5' oligomer that contained an Ascl restriction enzyme site, for cloning into the pEFBOS vector and a 3' oligomer that contained an overlapping region WO 03/080675 PCT/AU03/00352 - 34 homologous to the gpl30 cDNA. The oligomers used to amplify the gp130 cDNA comprised a 3' oligomer containing an Mlul restriction enzyme site. IL-4R oligomers 5 5' oligomer: AGCTGGCGCGCCTGAAGGTCTTGCAGGAGCCCACCTGCG [SEQ ID NO:17] 3' oligomer: CAGGCACGACTATGGCTTCAATTTCTCCGTGCTGCTCGAAGGGCTCCCTGTAGGAG 10 [SEQ ID NO:18] gp130 oligomers 5' oligomer: 15 GGAGAAATTGAAGCCATAGTCGTGCCTGTTTGCTTAGC [SEQ ID NO:13] 3' oligomer: ACGTACGCGTTCACTGAGGCATGTAGCCGCCTTGCCG [SEQ ID NO:14] The PCR conditions to amplify the IL-4a receptor and the gp130 regions required for the 20 construction of the chimeric cDNA were identical for both molecules. One cycle of 94'C for 2 mins, 35 cycles of 94'C for 10 secs, 50'C for 10 secs and 68 0 C for 1 min and one cycle at 68*C for 5 mins The molecules were amplified using the PLATINUM Pfx DNA polymerase kit (Invitrogen). 25 The chimeric cDNA molecule was amplified using the PCR products generated from the previously described reactions, with the same conditions being used, except that the extension time was lengthened from 60 to 90 secs. The oligomers used to generate the chimeric cDNA molecule were: 30 5' oligomer: AGCTGGCGCGCCTGAAGGTCTTGCAGGAGCCCACCTGCG [SEQ ID NO:17] WO 03/080675 PCT/AU03/00352 - 35 3' oligomer: ACGTACGCGTTCACTGAGGCATGTAGCCGCCTTGCCG [SEQ ID NO:14] The chimeric cDNA was cloned into the Mlul restriction enzyme site of the pEFBOS 5 mammalian expression vector, which contains the murine IL-3 signal sequence and a FLAG peptide at the N terminus. The cloning was carried out using the Amersham ligation kit. EXAMPLE 3 10 Generation of A12 cells 293T cells (obtained from Amrad Biotech) were cotransfected with 10 ptg APRE-luc (Nakajima et al., EMBO J. 15: 3651-3658, 1996) and 1 ptg pGK-puro using lipofectamine (Life Technologies, Lot #KE4YO 1). 15 Cells were selected in 25 pig/ml puromycin and positive clones tested for luciferase response. Cell line A25-20 was subsequently further cloned by limit dilution, giving the clone 293T 20 A12. EXAMPLE 4 Development of assays for analysis ofIL-13Ral interaction 25 Human factor-dependent (GM-CSF, IL-6, IL-4, or IL-13 etc.) TF-1 cells were previously used as the standard bioassay for IL-13 activity which is based on assessing the neutralizing/inhibitory activity of mouse and human mAbs. However, the assay has proven to be extremely unreliable with a relatively poor response to IL-13 and a low signal to background ratio. 30 WO 03/080675 PCT/AU03/00352 - 36 Development of a cell-based assav The inventors developed an assay based on a chimeric receptor strategy. The strategy involves fusing the extracellular domain of both the IL-13Ral and the IL-4Ra to the 5 transmembrane and cytoplasmic domains of gpl30. Following production of these two chimeric receptors in the 293A12 cell line (a 293T derivative with stable expression of a luciferase reporter under the control of a STAT-3 responsive promoter), IL-13 mediated dimerization activates STAT-3 and subsequently luciferase reporter gene expression (Figure 1). 10 An important aspect of this strategy is that it allows the identification of IL-13Ral antagonists such as mAbs that inhibit IL-4 signaling mediated through the IL-4 type II receptor complex. IL-4 signals through a type I receptor complex that incorporates the IL 4Ra and yc, and a type II receptor complex that incorporates the IL-4Ra and IL-13Ral. 15 Cell lines such as TF-1 are not suited to this purpose as they co-express yc and IL-13RCl such that IL-4 may signal through either of-the two receptor complexes. In contrast, in the engineered cell line of the present invention, only IL-4 signaling through the type II complex should lead to luciferase expression, irrespective of 293T cell yc expression. 20 Using IL-13Ral and gp130 cDNAs as template, a human IL-13Ral-gp130 chimeric receptor cDNA is generated by splice-overlap-extension PCR and cloned into pEFBOS for expression as an N-terminal FLAG-tagged protein. For generation of the IL-4Ra-gp130 chimeric receptor, an IL-4Rc cDNA (extracellular domain only) is cloned by RT-PCR using mRNA extracted from TF-1 cells. The chimeric IL-4Ra-gpl30 receptor cDNA is 25 generated by splice-overlap-extension PCR and also cloned into pEFBOS for expression as an N-terminal FLAG-tagged protein. Details of both chimeric receptors are provided in schematic form in Figure 2. Transient expression in COS cells, followed by Western blot analysis with anti-FLAG or anti-IL- WO 03/080675 PCT/AU03/00352 -37 13Rcl antibodies confirmed that both constructs encode a protein of the expected molecular weight (Figure 3). To isolate stable lines, 293A12 cells are co-transfected with the chimeric receptor 5 constructs and a vector encoding the gene for hygromycin resistance. Following hygromycin selection, 100 isolated resistant colonies are picked and expanded through 48 and 24 well plates. Subsequently 56 of the picked colonies are assayed for luciferase in the presence of LIF (+ve control), IL-13 and IL-4. Thirteen of the 56 colonies assayed appear to express luciferase in response to both IL-13 and IL-4 in addition to LIF (Table 2) and of 10 these 11 were expanded for freezing and further analysis. The two cell lines with the best signal to noise ratio (3.1.2 and 3.2.4) were subsequently cloned by limited dilution and for both, a full dose response analysis with respect to IL-4, IL-13 and LIF was conducted (Figure 4). For both cell lines, the response to IL-13 appears 15 similar to that observed for LIF with 50% of maximal activity observed at 100-200 pg/ml. For IL-4, 50% of maximal activity observed at 2-4 ng/ml for both lines. Consistent with earlier data, the signal to noise ratio for both lines is in excess of 10. The data indicate that these cell lines represent the best cell-based assays for either IL-13 or IL-4. 20 Molecular assav A molecular assay based on the interaction of IL-13Ral with IL-13 represents the best primary screen for both monoclonal antibodies and, potentially, small molecule antagonists. As stated above, however, the interaction of IL-13 with the IL-13Rcl is weak 25 (>200 nM) and not amenable to a simple ELISA-based approach. While FRET and fluorescence polarization-based assays have been contemplated, the development of such assays is labour and material intensive. A chimeric receptor protein that incorporates the extracellular domain of the IL-13RCal 30 (human or mouse) and the Fc portion of human IgG has been developed (R & D Systems). These chimeric proteins are expressed as preformed dimers, based on inter-Fc region WO 03/080675 PCT/AU03/00352 - 38 disulphide bonds and are expected to associate more tightly with IL-13 than the monomeric form of the receptor. For initial Biosensor studies, human IL-13 was immobilized to the Biosensor chip and a 5 dose-response analysis of human and mouse IL-13Rcl-Fc binding was completed. Both chimeric receptors associated with human IL-13, with the signal obtained for the mouse receptor substantially higher than that obtained with the human receptor. Similar results are obtained with immobilized mouse IL-13. These findings confirm the cross-species activity of IL-13. To confirm the specificity of this interaction, a competitive binding-based 10 approach is employed. A fixed concentration of chimeric mouse receptor protein was incubated with titrating soluble mouse IL-13 and binding of the receptor to immobilized mouse IL-13 was assessed. The soluble IL-13 was able to compete for binding to the chip in a dose-dependant manner. Similar data was obtained using the chimeric human receptor. 15 A qualitative comparison of sensorgrams obtained in this study to data obtained previously with monomeric receptor protein, indicated a substantial improvement in binding kinetics. This improvement is attributed to a much slower off-rate for the dimeric form, compared with the monomeric form, of the receptor. To further quantify this interaction a complete dose-response analysis using both human and mouse chimeric receptor proteins and 20 immobilized human and mouse IL-13 was undertaken. Primary data obtained for the binding of the chimeric human and mouse receptors to mouse IL-13 are presented in Table 3. The chimeric mouse receptor appears to have an approximately 10-fold greater affinity for both human and mouse IL-13 compared with the chimeric human receptor. Nevertheless, the chimeric human receptor demonstrates a 100-fold increase in affinity for 25 IL-13 compared with the monomeric form of the receptor. Biosensor data indicate a substantial increase in binding affinity for the dimeric form of the receptor compared with the monomeric form and suggested that an ELISA-based approach to a molecular assay may be feasible. Preliminary experiments indicated that the 30 interaction of soluble chimeric receptors with plate bound mouse IL-13 is readily detectable using an anti-huIg-HRPO conjugate. As expected, a higher concentration of the WO 03/080675 PCT/AU03/00352 - 39 human receptor is required to obtain a signal equivalent to that obtained with the mouse receptor. Subsequently, both chimeric mouse and human receptors were titrated over various concentrations of plate bound IL-13 to establish optimal assay conditions. Results indicated that the chimeric human receptor titrates over a dose-range of 0.312-10 tg/ml 5 with plate bound IL-13 at concentrations greater than 2.5 pg/ml. In comparison, the chimeric mouse receptor titrates over a dose-range of 0.02-0.625 Ig/ml with plate bound IL-13 at greater than 1.25 pg/ml. As expected, control chimeric receptor, Flt-Fc, failed to bind in this assay. 10 EXAMPLE 5 Analysis ofIL-13Ral-specific mouse mAbs Analysis using biochemical assays - Biosensor and ELISA 15 Initially mouse mAb 1D9 is tested for its ability to inhibit the interaction of the chimeric human and mouse IL-13Rcl-Fc with IL-13 using both an ELISA- and Biosensor-based approach. In Biosensor studies, 1D9 clearly inhibits the interaction of the chimeric human receptor with both human and mouse IL-13 but has no effect on the binding of the chimeric mouse receptor (Figure 5). Identical results are obtained with the ELISA-based 20 assay. 1D9 is a potent inhibitor of the chimeric human receptor, compared with a control mAb, but has no effect on the binding of'the chimeric mouse receptor to mouse IL-13 (Figure 6). The Biosensor study incorporated a 1D9 dose-response analysis and a further dose-response analysis was undertaken using the ELISA. These results demonstrated that 1D9 is a potent antagonist with an IC 50 similar to the concentration of target receptor used 25 in the assays (-20 nM for the ELISA). The selectivity of 1D9 for human but not mouse IL 13Rcl is also demonstrated using Western blot analysis. In further studies, additional mouse mAbs are tested by ELISA for their ability to inhibit the interaction of the chimeric human receptor with IL- 13. mAb 6A9, which interacts with 30 the same epitope as 1D9 shows potent antagonist activity (Figure 7). mAb 3F10 binds to a different epitope and appeared to have a partial inhibitory activity. In contrast, mAb 2A2 WO 03/080675 PCT/AU03/00352 - 40 which binds to a further unrelated epitope and which is most useful in Western blot analysis, fails to inhibit the chimeric receptor-ligand interaction. As expected unrelated control mAbs 2H10 and 6C12 had no effect on binding. 5 Analysis using the cell-based assay The uncloned IL-13/IL-4 - responsive transfected 293A12 derivative, 3.2.4, is expanded and used to assess the antagonist activity of the IL-13Ral - specific mouse mAbs 1D9, 6A9 and 2A2. 3.2.4 cells are pre-incubated for 45 mins in titrating mAb prior to the 10 addition of either IL-13 or IL-4 to a final concentration of 10 or 1 ng/ml. Luciferase production is assessed at 24 hrs. Results presented in Figure 8 demonstrate that, in agreement with biochemical assay data, mAbs 1D9 and 6A9 (but not mAb 2A2) are able to inhibit IL-13 mediated luciferase 15 expression. For both 6A9 and 1 D9, the inhibitory activity was most pronounced with IL- 13 at 1 ng/ml. 1D9 appeared to be more potent than 6A9 with almost complete inhibition of the response to 1 ng/ml of IL-13 over the dose-range of mAb tested. The negative control unrelated mAb 2H 10 had no effect on IL- 13-induced luciferase expression as expected. 20 Unlike biochemical-based assays and existing cell-based assays, the 3.2.4 line allows the effects of IL-13Ral specific mAbs on IL-4 signaling through the type II IL-4 receptor complex to be assessed. Results presented in Figure 9 demonstrate that both mAbs that are able to inhibit IL-13-mediated activity are also able to inhibit IL-4 mediated luciferase expression. Again, the effect was substantially more pronounced with cytokine at 1 ng/ml 25 compared with 10 ng/ml and again 1D9 appeared to be the most potent of the two antibodies. As with IL-13, neither mAb 2A2 nor the negative control mAb 2H10, had any effect on IL-4-induced luciferase expression.
WO 03/080675 PCT/AU03/00352 -41 EXAMPLE 6 Cloning and sequencing of the murine antibody variable regions Messenger RNA was prepared from hybridoma cells producing the 1D9 mAb and reverse 5 transcribed using an oligo-dT primer to produce cDNA. Partially degenerate PCR primers based on the amino-terminal amino acid sequence and the antibody isotype were used to amplify the mature mouse heavy and light variable domains and incorporate restriction enzyme sites for cloning. The subsequent clones and PCR products were sequenced to reveal the amino acid sequence for each of the variable regions of 1D9 (Figure 1). 10 EXAMPLE 7 Construction of a human Fab template A synthetic human fragment antibody binding (Fab) was generated from synthetic 15 oligonucleotides as a template for intermediate and humanized variants of the 1D9 mouse antibody. The synthetic human Fab consisted of variable domain sequences derived from the consensus sequences for the most abundant human subclasses (VLK subgroup I and VH subgroup III) and human constant regions (REI human Ki light chain CL and IgG1 CHi). The synthetic human Fab sequences were subsequently inserted into a single E. coli 20 expression vector to generate a dicistronic construct for expression of either soluble or phage displayed functional Fab. EXAMPLE 8 Generation of CDR-grafted Fabs and mouse -human chimeric Fabs 25 As a starting point for humanization, a CDR-grafted Fab was generated by grafting the six complementarity-determining regions (CDRs) of the parent 1D9 antibody onto the synthetic human Fab. Optimization of key framework residues within a CDR-graft Fab is often required for correct presentation of the murine CDRs by the human framework and 30 hence retention of potent binding affinity. Chimeric Fab fragments are equivalent in their antigen binding properties to the fully murine Fab fragment so can be used to determine if WO 03/080675 PCT/AU03/00352 - 42 the CDR-grafted Fab requires framework optimization. A mouse-human chimeric Fab fragment consisting of the murine 1D9 heavy and light chain variable regions fused to the corresponding synthetic human constant domains was therefore generated as a reference for antigen binding affinity. 5 EXAMPLE 9 Comparison of the binding affinities of the chimeric and CDR-grafted Fabs The binding affinity of the CDR-grafted and chimeric Fabs for IL-13Ral were compared 10 in competition based assays, both as phage displayed Fabs in an ELISA format (Figure 1 1A.) and as purified soluble protein by Biacore (Figure 11 B). The CDR-grafted Fab has similar affinity for IL-13Ral as the reference murine-human chimeric Fab. This indicates that the CDR-graft Fab does not require optimization of the framework residues and can be considered humanized. 15 Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in 20 this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
WO 03/080675 PCT/AU03/00352 - 43 TABLE 2 Response of transfected (FLAG-tagged IL-13R al-gpl30 and IL-4Rca-gp130 and picked 293A12 colonies to LIF, IL-13 and IL-4 Line# Med LIF* IL-13 IL-4 3.1.1 6791 61220 7381 12469 3.1.2 3539 42150 34094(9.6) 53998 (15.2) 2.3.1 4626 43264 4383 4458 2.3.2 5850 52813 5377 5252 1.2.2 4921 45047 15093 (3.1) 29866 (6.1) 1.2.3 7222 159076 7183 7298 3.2.4* 7783 61163 42046(5.4) 117971 (15.1) 3.2.5 6823 62906 73145 (10.7) 129369 (18.9) 3.2.6 7849 67302 8307 16826 3.2.7 21589 163102 88581 (4.1) 136760 (6.3) 3.2.8 10698 89447 10352 12778 3.2.9 4093 45747 4141 4530 5 * LIF, IL-13 and IL-4 all used at a final concentration of 100 ng/ml, 24 hr assay. * Representative data, 12 of 56 colonies assessed. TABLE 3 10 Affinity (KD) of chimeric mouse and human IL-13Ral-Fcproteinsfor immobilized mouse and human IL-13 Chimeric receptor* mIL-13Ral-Fc hIL-13Ral-Fc Mouse IL-13 0.536 nM 15.11 nM Human IL-13 0.784 nM 5.93 nM WO 03/080675 PCT/AU03/00352 - 44 BIBLIOGRAPHY Ahdieh et al., Am J. Physiol. Cell Physiol. 281(6): C2029-2038, 2000 Akaiwa et al., Cytokine 13: 75-84, 2001 Antibodies: A Laboratory Manual, Harlow and Land (eds.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988 Bailer et al., Eur. J. Immunol. 30(5): 1340-1349, 2000 Bailer et al., J. Immunol. 162(12): 7534-7542, 1999 Bird, Science 242: 423, 1988 Callard et al., Immunology Today 17(3): 108, 1996 Danahay et al., Am. J. Physiol. Lung Cell Mol. Physiol. 282(2): L226-236, 2002 David et al., Oncogene 20(46): 6660-6668, 2001 Gauchat et al., Eur. J. Immunol. 28: 4286-4298, 1998 Gauchat et al., Eur. J Immunol. 30: 3157-3164, 2000 Howard et al., Am JHum Genet 70(1): 230-236, 2002 Howard et al., Am. J Hum. Genet. 70(1): 230-236, 2002 Huston et al., Proc. Natl. Acad. Sci. USA 85: 5879, 1988 Kabat et al. in Sequences of Proteins of Immunological Interest, 5th Ed., US Dept. of Health and Human Services, PHS, NIH, NIH Publication No. 91-3242, 1991 Kortt et al., Protein Engineering 10: 423, 1997 Larrick et al., BiolTechnology 7: 934, 1989 Liu et al., Proc. Natl. Acad. Sci. USA 84: 3439, 1987 Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Kennet et al. (eds.), Plenum Press, New York, 1980 Morris et al., J. Biol. Chem. 274: 418-423, 1999 Morse et al., Am. J. Physiol. Lung Cell Mol. Physiol. 282(1): L44-49, 2002 Noguchi et al., Hum Immunol 62(11): 1251-1257, 2001 Perez et al., J. Immunol. 168(3): 1428-1434, 2002 Riechmann etal., Nature 332: 323, 1988 . Ward et al., Nature 334: 544, 1989 Winter and Harris, TIPS 14: 139, 1993
Claims (21)
1. An isolated monoclonal antibody which binds to a mammalian IL-13Ral chain or an antibody-binding portion thereof and which competes with monoclonal antibody 1D9 produced by the hybridoma deposited at the European Collection of Cell Cultures (ECACC), Centre for Applied Microbiology and Research, Porton Down, Salisbury, United Kingdom, under Accession No. 0302101 for binding to a human IL-13Ral, wherein the binding of the antibody to IL-1 3Ral antagonizes IL- 13 receptor- mediated signaling by IL- 13 and/or IL-4.
2. The isolated antibody of Claim I wherein the IL-13 receptor-mediated signaling is by IL- 13.
3. The isolated antibody of Claim I wherein the antibody is a human antibody.
4. The isolated antibody of Claim 1 wherein the antibody is a deimmunized antibody.
5. The isolated antibody of Claim 1 wherein the antibody is a humanized antibody.
6. The isolated antibody of Claim 5 wherein the antibody is a humanized form of murine monoclonal antibody ID9 produced by the hybridoma deposited at the European Collection of Cell Cultures (ECACC), Centre for Applied Microbiology and Research, Porton Down, Salisbury, United Kingdom, under Accession No. 03032101.
7. The isolated antibody of any one of Claims 1 to 6 wherein the antibody is a fragment of a whole antibody.
8. The isolated antibody of Claim 7 wherein the antibody fragment is an Fv, Fab, Fab' or F(ab')2 fragment. CnNRPertbWlDCC\AAR\2602606_.DOC- 1/12/2009 -46
9. An isolated antibody comprising within the variable region of its light chain SEQ ID NOs:19-21 as CDRI, CDR2 and CDR3 respectively which binds to a mammalian IL-13Ral chain or an antibody-binding portion thereof and wherein the binding of the antibody to IL 13 Ral antagonizes IL- 13 receptor- mediated signaling by IL- 13 and/or IL-4.
10. The isolated antibody of Claim 9 wherein the variable region is defined by SEQ ID NO:25.
11. An isolated antibody comprising within the variable region of its heavy chain SEQ ID NOs:22-24 as CDR1, CDR2 and CDR3 respectively which binds to a mammalian IL-13Ral chain or an antibody-binding portion thereof and wherein the binding of the antibody to IL 13Ral antagonizes IL-13 receptor- mediated signaling by IL-13 and/or IL-4.
12. The isolated antibody of Claim 11 wherein the variable region is defined by SEQ ID NO:26.
13. An isolated antibody comprising within the variable region of its light chain SEQ ID NOs:19-21 as CDR1, CDR2 and CDR3 respectively and within the variable region of its heavy chain SEQ ID NOs:22-24 as CDRI, CDR2 and CDR3 respectively which binds to a mammalian IL-13Ral chain or an antibody-binding portion thereof and wherein the binding of the antibody to IL-13Ral antagonizes IL-13 receptor- mediated signaling by IL-13 and/or IL-4.
14. The isolated antibody of Claim 13 wherein the variable region of its light chain is defined by SEQ ID NO:25 and wherein the variable region of its heavy chain is defined by SEQ ID NO:26.
15. The isolated antibody of Claim 14 wherein the variable region of its light chain is defined by SEQ ID NO:27 and wherein the variable region of its heavy chain is defined by SEQ ID NO:28. CNRtnbl\DCC\AAR\60266L DOC-1/12/209 - 47
16. A composition comprising an antibody of any one of Claims 3 to 15.
17. A method of treating a disease condition in a mammal comprising administering to said mammal an effective amount of an antibody of any one of Claims 3 to 15 or a composition of Claim 16.
18. The method of Claim 17 wherein the mammal is a human.
19. The method of Claim 18 wherein the disease condition is fibrosis, Hodgkin's disease, ulcerative colitis, scleroderma, allergic rhinitis, oncological conditions, a lung disorder or an inflammatory disorder.
20. The method of Claim 19 wherein the lung disorder is asthma or chronic obstructive pulmonary disease.
21. An antibody according to any one of Claims I to 15 or a composition of Claim 16 or a method according to any one of Claims 17 to 20 substantially as herein described with reference to the Figures and/or Examples.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2003212102A AU2003212102B2 (en) | 2002-03-22 | 2003-03-21 | Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ralpha1) |
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AUPS1301 | 2002-03-22 | ||
AUPS1301A AUPS130102A0 (en) | 2002-03-22 | 2002-03-22 | Novel peptides |
AU2003900437A AU2003900437A0 (en) | 2003-02-03 | 2003-02-03 | Immunointeractive molecules |
AU2003900437 | 2003-02-03 | ||
AU2003212102A AU2003212102B2 (en) | 2002-03-22 | 2003-03-21 | Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ralpha1) |
PCT/AU2003/000352 WO2003080675A2 (en) | 2002-03-22 | 2003-03-21 | MONOCLONAL ANTIBODY AGAINST INTERLEUKIN-13 RECEPTOR ALPHA 1 (IL-13Rα1) |
Publications (2)
Publication Number | Publication Date |
---|---|
AU2003212102A1 AU2003212102A1 (en) | 2003-10-08 |
AU2003212102B2 true AU2003212102B2 (en) | 2010-01-14 |
Family
ID=34108211
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2003212102A Expired AU2003212102B2 (en) | 2002-03-22 | 2003-03-21 | Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ralpha1) |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU2003212102B2 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997015663A1 (en) * | 1995-10-23 | 1997-05-01 | Amrad Operations Pty. Ltd. | A novel haemopoietin receptor and genetic sequences encoding same |
WO1998010638A1 (en) * | 1996-09-10 | 1998-03-19 | Amrad Operations Pty. Ltd. | Therapeutic molecules |
-
2003
- 2003-03-21 AU AU2003212102A patent/AU2003212102B2/en not_active Expired
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997015663A1 (en) * | 1995-10-23 | 1997-05-01 | Amrad Operations Pty. Ltd. | A novel haemopoietin receptor and genetic sequences encoding same |
WO1998010638A1 (en) * | 1996-09-10 | 1998-03-19 | Amrad Operations Pty. Ltd. | Therapeutic molecules |
Non-Patent Citations (4)
Title |
---|
CLEMENT C. ET AL.: 'Monoclonal antibodies against the interleukin-13 receptor alpha1 and alpha2' CYTOKINE vol. 9, no. 11, 1997, page 959, ABSTRACT 280, XP009038099 * |
DATABASE GENPEPT [Online] SHAN H. ET AL.: 'The Mechanism of Autoantibody Production in an Autoimmune MRL/1pr Mouse', XP003008272 Database accession no. (AAB32552) & J. IMMUNOLOGY vol. 153, no. 11, 1994, pages 5104 - 5120 * |
DATABASE PIR [Online] XP003008271 Database accession no. (S20708) * |
VERMOT-DESROCHES C. ET AL.: 'Identification and characterization of Abs anti-IL-13 Ralpha1 or anti-IL-13 Ralpha2' TISSUE ANTIGENS vol. 55, no. SUPPLEMENT 1, 2000, pages 52 - 53, ABSTRACT H.25, XP009054384 * |
Also Published As
Publication number | Publication date |
---|---|
AU2003212102A1 (en) | 2003-10-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US8221755B2 (en) | Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ralpha1) | |
WO2022042690A1 (en) | Ccr8 antibody and application thereof | |
US9663580B2 (en) | Antibodies against human CSF-1R and uses thereof | |
CN112513090B (en) | Antibodies that bind human IL-4R, antigen-binding fragments thereof, and medical uses thereof | |
EP3656789A1 (en) | Antibody targeting interleukin 17a and preparation method and application thereof | |
AU2020350715A1 (en) | GIPR antibody and fusion protein between same and GLP-1, and pharmaceutical composition and application thereof | |
KR20200133365A (en) | GIPR antibody and fusion protein thereof with GLP-1, and pharmaceutical composition and application thereof | |
RU2758721C2 (en) | Anti-il-22r-antibodies | |
IL300660A (en) | Anti-par-2 antibodies and methods of use thereof | |
JP2011520989A (en) | Therapeutic method using interleukin-21 receptor binding protein | |
EP3683234A1 (en) | Il-6r antibody and antigen binding fragment thereof and medical use | |
CN114144431B (en) | Humanized anti-TNF alpha antibodies and uses thereof | |
TW202328183A (en) | Human interleukin-4 receptor alpha antibodies | |
CN114437212B (en) | Anti-human thymic stromal lymphopoietin antibody and preparation method and application thereof | |
CN114286827B (en) | Humanized anti-IL 17A antibodies and uses thereof | |
AU2003212102B2 (en) | Monoclonal antibody against interleukin-13 receptor alpha 1 (IL-13Ralpha1) | |
RU2779649C1 (en) | Antibody binding human il-4r, antigen-binding fragment thereof, and medical application thereof | |
WO2022247826A1 (en) | Specific binding protein targeting pd-l1 and cd73 | |
RU2800370C2 (en) | Gipr antibody and its glp-1 function protein as well as pharmaceutical composition based on it and its use | |
KR20230166120A (en) | Novel TNFR2-binding molecule | |
KR20240022546A (en) | Anti-IL-36R antibody and use thereof | |
TW202337898A (en) | Novel anti-tslp antibodies |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
NB | Applications allowed - extensions of time section 223(2) |
Free format text: THE TIME IN WHICH TO COMPLY WITH SECTION 6(C) HAS BEEN EXTENDED TO 01 JAN 2004. |
|
FGA | Letters patent sealed or granted (standard patent) | ||
MK14 | Patent ceased section 143(a) (annual fees not paid) or expired |